The integration of bioinformatics in drug discovery has revolutionized the field of pharmaceutical research. The use of computational tools and techniques has enabled researchers to analyze vast amounts of data, identify potential drug targets, and design new drugs with greater precision and efficiency. The integration of bioinformatics has also facilitated the development of personalized medicine, where drugs can be tailored to individual patients based on their genetic makeup. However, there are still challenges that need to be addressed, such as the need for more accurate predictive models and the ethical considerations surrounding the use of patient data. Overall, the integration of bioinformatics in drug discovery holds great promise for improving human health and advancing our understanding of disease mechanisms. In this mini-review, we discuss how Bioinformatics plays a crucial role in each step of drug discovery by providing tools and techniques to analyze large amounts of data generated from various sources, as well as the challenges and the opportunities offered by bioinformatics.

To study the fermentation process of biocatalyzing decanoic acid to synthesize trans-2-decenoic acid, this study was based on the engineering E.coli constructed in the laboratory in the early stage and studied the effect of seed liquid culture time, culture temperature, inoculum amount, induction temperature, dissolution effects of substrate solvent, metal ions, and substrate loading on the yield of trans-2-decenoic acid. Based on single-factor experimental optimization, the Box–Behnken design was used to conduct response surface testing using the substrate feeding concentration, inducer concentration, and MnCl2 concentration as response variables and trans-2-decenoic acid production as the response value. The optimal fermentation process was determined through experiments: seed culture time 20 h, culture temperature 37°C, inoculation amount 1%, induction temperature 30°C, substrate flow amount 0.15 g/L, inducer concentration 5.60 g/L, MnCl2 concentration was 0.10 mM. Under these conditions, the average production of trans-2-decenoic acid was 1.982 ± 0.110 g/L. Compared with the basic LB medium, the production of trans-2-decenoic acid increased by 1.042 g/L; compared with the previous period, the yield of trans-2-decenoic acid studied increased by 1.501 ± 0.110 g/L, which provides a reliable basis for further research on the fermentation process of biocatalytic decanoic acid synthesis of trans-2-decenoic acid.

The aim of this study was to evaluate the clinical and radiographic outcomes of the All-on-4 technique in fully edentulous maxilla using R2GATE software for flapless, computer-guided surgery and immediate loading. Ten adult patients with fully edentulous maxilla, aged between 35 and 60 years, were included in the study between April 2021 and April 2022. The surgical procedure was performed under local anesthesia and followed the All-on-4 approach with immediate loading of implants using a screw-retained provisional acrylic resin prosthesis on the same day. Final prosthesis was delivered four months after the surgery. Clinical and radiographic outcomes were evaluated at four- and twelve-months post-operation. The study reported a 95% implant survival rate using the All-on-4 technique. The mean marginal bone level was recorded at 0.35 mm and 0.66 mm during the 4 and 12-month follow-up periods, respectively. Fixed provisional prosthesis fracture, abutment, and prosthesis screw loosening were the most frequent mechanical complications reported. Within the limitations of this study, the use of computer-guided surgery in the All-on-4 technique seemed to be a promising treatment option with high implant survival rates that may help reduce post-surgical discomfort and mechanical complications in the rehabilitation of the edentulous maxilla.

Gold nanoparticles (AuNPs) have been used in a broad range of applications conferring to bio-molecules diverse proprieties such as deliver, stabilization and reduction of adverse effects of drugs or plant ex-tracts. Polyphenolic compounds from Bacopa procumbens (BP) are able to modulate proliferation, adhesion, migration and cell differentiation, reducing artificial scratch area in fibroblast cultures and promoting wound healing in in vivo model. Here, chemically synthetized AuNPs conjugated with BP (AuNP-BP) were characterized by Uv-Vis, ATR-FTIR, DLS and zeta-potential. Results showed over-lapping FTIR spectra of polyphenolic compounds from B. procumbens capping the AuNPs, stable size by the DLS and zeta potential, AuNP-BP was 44.58 nm, the zeta-potential of AuNPs was -36.3±12.3 mV after conjugation with the BP; - (AuNP-BP), the zeta-potential was reduced to -18-2±7.02 mV. Enhancement of wound healing effect were evaluated by morphometric, histochemical and FTIR changes in rat wound excision model. Results showed that the nanoconjugation process reduced 100 folds BP concentrations to have the same wound healing effect of BP alone. Besides histological and FTIR spec-troscopy analyses, demonstrated that AuNP-BP treatment displayed better macroscopical performance; the reduction on inflammatory cells, and the increased synthesis and better organization of collagen fibers.

Xaa-Pro dipeptidase (XPD, EC 3.4.13.9; also known as prolidase) catalyzes the hydrolysis of iminopeptide bond in the trans Xaa-Pro dipeptides (Xaa represents any amino acid except proline), which makes it find wide applications in food, medical and environmental protection fields. In the present study, a novel Xaa-Pro dipeptidase from Aspergillus phoenicis ATCC 14332 (ApXPD) was molecularly and biochemically characterized. Reclassification based on phylogenetic analysis and version 12.5 MEROPS database showed that this enzyme was the only fungal XPD in the unassigned subfamily which shared the highest sequence similarity with Xanthomonas campestris prolidase but not with that from the more related fungal species A. niudulans. As compared with other prolidases, ApXPD also contained an N-terminal tail (residues 81-89) and an additional region (PAPARLREKL), and used a different arginine residue for dipeptide selectivity. After heterologous expression and partial purification, recombinant ApXPD was highly active and stable over the alkaline range from 8.5 to 10.0, with a maximum activity at pH 9.0 and more than 80% activity retained after 1-h incubation at pHs of 8.5-10.0 (55oC). It also had an apparent optimum temperature of 55oC and remained stable at 20-30oC. Moreover, this enzyme was a cobalt dependent prolidase that only cleaved dipeptides Lys-Pro, Gly-Pro and Ala-Pro rather than other dipeptides, tripeptides and tetrapeptides. All these distinct features make A. phoenicis ATCC 14332 XPD unique among currently known prolidases, thus defining a novel Xaa-Pro dipeptidase subfamily.

Pollen, a remarkably versatile natural compound collected by bees for its abundant source of proteins and nutrients, represents a rich reservoir of diverse bioactive compounds with noteworthy chemical and therapeutic potential. Its large range of biological effects has been known and exploited since ancient times. Today, there is an increased interest in finding natural compounds agaisnt oxidative stress, a factor that contributes to various diseases. Recent research has unraveled a multitude of biological activities associated with bee pollen, ranging from antioxidant, anti-inflammatory, antimicrobial, and antifungal properties to potential antiviral and anticancer applications. Comprehending the extensive repertoire of biological properties across various pollen sources remains a challenge. By investigating a spectrum of pollen types and their chemical composition, this review produces an updated analysis of the bioactive constituents and the therapeutic prospects they offer. The findings of this review emphasize the necessity for further exploration and standardization of diverse pollen sources and bioactive compounds that could contribute to the development of innovative therapies.

The COVID-19 pandemic has unveiled the critical role that supercomputers play in addressing global health crises. This perspective article explores the transformative impact of supercomputing in pandemic response, highlighting how these powerful machines have transitioned from crisis management tools to essential components of preparedness strategies. In this article, we examine the key contributions of supercomputers in combating the pandemic, including their ability to accelerate scientific research, facilitate data analysis, model complex scenarios, and optimize resource allocation. Furthermore, we delve into the role of supercomputing in strengthening public health infrastructure and preparedness. We analyze the lessons learned from the pandemic and emphasize the need for proactive investment in supercomputing capabilities, data infrastructure, and computational expertise as a crucial element of pandemic preparedness efforts. By harnessing the potential of supercomputers, countries can establish robust computational frameworks that enable real-time monitoring, early detection, and effective response to future outbreaks. Moreover, we address the challenges faced by supercomputing initiatives, including the need for enhanced international collaboration, equitable access to computing resources, and the ethical considerations associated with data privacy and security. We discuss potential strategies to overcome these challenges and foster a global network of interconnected supercomputing centers dedicated to pandemic preparedness and response. Finally, we highlight ongoing research and development efforts aimed at advancing supercomputing technologies, such as exascale computing and quantum computing, and their potential to revolutionize pandemic response. We emphasize the importance of sustained investment in research and development to ensure that supercomputing remains at the forefront of future pandemic preparedness strategies.

Corynebacterium glutamicum is prominent for the industrial production of secreted amino acids. Notably, it naturally accumulates the carotenoid pigment decaprenoxanthin in its membranes. Metabolic engineering enabled production of astaxanthin. Here, a bioprocess for astaxanthin production in lab-scale stirred bioreactors was established by a DoE-guided approach to optimize the basic process parameters pH, rDOS, aeration rate as well as inoculation cell density. The DoE-guided approach from 2 L scale cultivation revealed that the pH showed the strongest effect on the product formation. Subsequently, an optimum at pH 8, an aeration rate of 0.25 vvm, 30 % rDOS and an initial optical density of 1 was established that allowed production of 7.6±0.6mg L-1 astaxanthin in batch mode. These process conditions were successfully transferred to a fed-batch process resulting in a high cell density cultivation with up to 60 g CDW L-1 biomass and 64 mg L-1 astaxanthin and thus demonstrating an about 9-fold improvement compared to optimal batch conditions. Moreover, pH shifts experiments indicate that the cells can quickly adapt to a change from pH 6 to 8 and start producing astaxanthin showing the possibility of a biphasic bioprocesses for astaxanthin production.

: With the increase in demand for non-dairy starter cultures and probiotic bacteria as carriers, the use of legumes (also called pulses) as an alternative has gained momentum. In this study, we investigated the diversity of bacterial communities in samples of pigeon pea (Cajanus cajan L. Millsp.) soaked in water for 12 h and 24 h. We soaked 500 g of pigeon pea in sterile distilled water at room temperature (± 25 °C) for 12 h and 24 h; 10 mL of the soaking water was then collected to measure the bacterial diversity using a metataxonomic analysis. The V1–V9 regions on the 16S ribosomal RNA gene were amplified using 27F and 1492R primers under specific polymerase chain reaction conditions for the bacterial identification. Genomic DNA (130 ng) was sequenced on a R9.4 flow cell by Oxford Nanopore Technologies using a GridION sequencer. Library preparations were initiated using a Native Barcoding Kit 24 V14 (SQK-NBD114.24). Primary data were acquired using MinKNOW version 22.05.7. A total of 13 bacterial families and 89 genera were identified in the pigeon pea sample soaked for 12 h; 26 families and 90 genera were identified in the pigeon pea sample soaked for 24 h. Among the bacterial families identified, the five predominant families in both samples were Enterobacteriaceae, Erwiniaceae, Yersiniaceae, Pectobacteriaceae, and Lactobacillaceae. According to the relative abundance of the identified bacterial genera, the following nine genera were predominant in both samples: Enterobacter, Klebsiella, Citrobacter, Pantoea, Kosakonia, Pseudoenterobacter, Pluralibacter, Leclercia, and Kluyvera. At a genus level, a slight increase in the abundance of Klebsiella, Kosakonia, and Pluralibacter and a slight decrease in the abundance of Citrobacter were observed after prolonged incubation from 12 h to 24 h. The values of five diversity indices revealed that the sample soaked in water for 24 h had a richer bacterial abundance and diversity than the 12 h sample. Shannon and Simpson values revealed a higher bacterial diversity in the sample collected at 24 h than the sample collected at 12 h. Species observations and abundance-based coverage estimator (ACE) values demonstrated that the sample collected at 24 h harbored a higher bacterial richness than the sample collected at 12 h. These findings indicated that the bacterial diversity in the pigeon pea samples increased with the soaking time. The bacterial communities during the soaking of the pigeon pea samples were dominated by the Enterobacteriaceae family and Enterobacter genus. The presence of bacterial genera such as Lacticaseibacillus, Lentilactobacillus, and Secundilactobacillus was notable because of their importance as starter cultures for fermented plant-based milk products, including pigeon pea beverages for lactose-intolerant individuals or individuals with malnutrition.

In recent years, genetic research has been developing rapidly and taking on a larger role in research and medicine. The synthesis of any particle that can be used in this research can pave the way for new developments in this field. This research aims to develop a chemical method to produce nitrogen-doped carbon quantum dots - economical and bio-sourced substances that bind to genomic DNA. Carbon quantum dots are produced by the green synthesis hydrothermal method from radish, which is abundant in nature, and economically affordable. Nitrogen is added to increase the fluorescence properties of the produced carbon quantum dots and to improve their binding to DNA. The synthesized nitrogen-doped carbon quantum dots (N-CQDs) were tested through chromosome imaging subsequently. It was shown that N-CQDs can bind to the chromosomes, and N-CQDs reflected green light better than DAPI under the FITC filter, a potential advantage of using N-CQDs over DAPI in chromosome imaging.

Castanea sativa Mill., an indigenous species of the mountainous Gabala region of Azerbaijan, where its local variety is now facing the danger of extinction. The preservation of this variety of European chestnut requires the development of effective strategies for reliable in vitro regeneration systems as an alternative to traditional methods, which has become the main objective of this study. In solving this problem, the generally accepted technique of micro-multiplication of axillary shoots was mainly used. First, a phased sterilization of was carried out using liquid soap, Previkur fungicide and mercury (II) chloride. DKW (Driver and Kuniyuki Walnut) nutrient medium was used for germination of explants, into which growth stimulants BAP (Benzilamunapurine), IBA (Indole - 3 butyric acid), IAA (Indole Acetic acid), NAA (Naphthalene Acetic Acid) and GA3 (Gibberelic acid) were introduced in various combinations and quantities. The test of the above-mentioned sterilization model revealed significant shortcomings in terms of the acceptability of the results obtained (16-77%). It was also found that the germination of explants takes 14 days and it is better to conduct it in a DKW environment containing hormones BAP (0.6 mg), IBA (0.1 mg) and GA3 (0.1 mg) / 1 L DKW. A mixture of BAP (0.1mg) + IBA (0.35 mg) is more suitable for the reproduction of grown explants + GA3 (0.2 mg) / 1 l DKW (the result is 3 new micro-plants for each explant), and for good root formation (it takes 30 days) – a mixture of IBA 1.0 mg + NAA 0.5 mg + IAA 0.5 mg / l L DKW. After the shoots have acquired a certain length (at least 1.5 cm), it is required to transfer them for 22 days to a DKW medium containing IBA (1 mg), IAA (0.5 mg) and NAA(0.5 mg) / l L DKW so that the root splitting process begins and ends.

Several effective online and offline inference tools offer an interactive platform for inference, visualization, and analysis of gene regulatory networks. However, a tool currently needs to offer a scalable, lightweight, integrated online platform for carrying out inference, visualization, benchmarking, and extensive network analysis in an integrated manner. We introduce NetRA (Network Reconstruction and Analysis for Gene Regulatory Network), a comprehensive web tool for network analysis, visualization, and inference of large expression networks. Additionally, a platform for benchmarking and evaluation is provided. In order to deliver a highly scalable, lightweight, and rich user interface, the tool is created using the most recent technologies. We incorporate the original code of eleven (11) inference algorithms (not limited to) from Bioconductor in the current version. We also report a qualitative comparison of 11 candidate methods regarding prediction accuracy and network characteristics which will shed light on their performance against 4000 sizes synthetic DREAM network. We believe the tool will significantly aid biologists' downstream system biology research. NetRA tool can be extensible to different kinds of complex network analyses. Availability: On request (sroy01@cus.ac.in).

For a comprehensive exploration of the Bimolecular Fluorescence Complementation (BiFC) approach, we critically assess whether protein pairs establish direct or indirect interactions within this context. Emphasizing the multifaceted nature of protein interactions, this review underscores the imperative of delineating macromolecular complex characteristics across five distinct levels: composition, stoichiometry, copy number, topology, and dynamics. A pivotal discussion revolves around the challenges introduced by the overexpression of target proteins and the potential artificial ramifications of fusion proteins. The significance of stoichiometry in protein interactions is illuminated, with the HOXA9/PBX1 interaction serving as a pertinent case study. The research identifies and elaborates on the inherent limitations of prevailing large-scale BiFC screenings, advocating for the incorporation of rigorous negative controls. A novel proposition is introduced in the form of a high-throughput multicolor BiFC strategy, exemplified using the HOXA9 and PBX1 proteins. The paper culminates with an insightful discourse on the implications of tags within the BiFC system, presenting the TriFC (Tripartite Fluorescence Complementation) assay as a promising alternative.

Bacillus species produce different classes of antimicrobial and antioxidant substances: peptides or proteins with different structural composition and molecular mass and a broad range of volatile organic compounds (VOCs), some of which may serve as biomarkers for microorganism identification. The aim of this study is the identification of biologically active compounds synthesized by five Bacillus species using gas chromatography coupled to mass spectrometry (GC–MS). The current study profoundly enhances the knowledge of antibacterial and antioxidant metabolites ensuring the unambiguous identification of VOCs produced by some Bacillus species, which were isolated from vegetable samples of potato, carrot, and tomato. Phylogenetic and biochemical studies were used to identify the bacterial isolates after culturing. Phylogenetic analysis proved that five bacterial isolates BSS12, BSS13, BSS16, BSS21, and BSS25 showed 99% nucleotide sequence similarities with Bacillus safensis AS-08, Bacillus cereus WAB2133, and Bacillus acidiproducens NiuFun, Bacillus toyonesis FORT 102 and Bacillus thuringiensis F3, respectively. The crude extract was prepared from bacterial isolates to assess the antibiotic resistance potency and the antimicrobial potential against various targeted multidrug-resistant strains, including Candida albicans, Candida krusei, Enterococcus hirae, Escherichia coli, Klebsiella aerogenes, Klebsiella pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus group B, Streptococcus mutans, Shigella sonnei, Salmonella enteritidis, Serratia marcescens, Pseudomonas aeruginosa, and Proteus vulgaris. GC–MS analysis of bacterial strains found that VOCs from Bacillus species come in a variety of chemical forms, such as ketones, alcohols, terpenoids, alkenes, etc. Overall, 69 volatile organic compounds were identified from five Bacillus species, and all five were found to share different chemical classes of volatile organic components, which have a variety of pharmacological applications. However, 8 antibacterial compounds with different concentrations were commonly found in all five species: acetoin, acetic acid, butanoic acid, 2-methyl-, oxime-, methoxy-phenyl, phenol, 1,2-benzenedicarboxylic acid, bis(2-methylpropyl) ester, nonanoic acid, and hexadecanoic acid, methyl. The biology and physiology of Bacillus can be better understood using these results, which can also be used to create novel biotechnological procedures and applications. Moreover, because of its exceptional ability to synthesize and produce a variety of different antibacterial compounds, Bacillus species can serve as natural and universal carriers for antibiotic compounds in the form of probiotic cultures and strains to fight different pathogens, including mycobacteria.

Intergenerational Justice entitles the maximum retention of Earth’s Biodiversity. The United Nations COP 15 committed to the protection of 30% of Earth’s terrestrial environments to provide Biospheric Sustainability. However, proactive amphibian sustainability needs support from amphibian Reproduction Technologies, Biobanking, and Conservation Breeding Programs [RBCs]. These technologies include the reliable practice of stimulation of reproduction and the collection of sperm and oocytes, refrigerated and cryopreserved sperm storage, in vitro fertilization. Emerging technologies promise the perpetuation of species solely from biobanked biomaterials. However, although exemplary national programs for amphibian RBCs are now established in the USA and Australia, these potentials are not fully realised resulting in unacceptable biodiversity loss. To fully realise these potentials an independent and democratic global organisation is proposed to, 1) focus on the bioregions with the highest amphibian biodiversity, 2) maximise regional inclusion in international initiatives, and 3) provide for maximum community engagement and financial resources. We present the first overall multidisciplinary review of amphibian RBCs, including their geopolitical, cultural, and scientific background, along with their development and application to economically, efficiently, and reliably, perpetuate amphibian biodiversity. We provide genetic models, the potential for diploid cell cryopreservation to perpetuate species, along with significant new information on methodologies and techniques, and standardise nomenclature for specificity in publications and media consistency.

Several genetic tools have been developed for Clostridium acetobutylicum utilizing 5-fluorouracil (5FU) or 5-fluorocytosine (5FC) resistance as a selection method. A method based on the integration, by single crossing-over, of a suicide plasmid (pCat-upp) followed by selection for the second crossing-over using a counter-selectable marker (the upp gene and 5FU resistance) was recently developed for genome editing in C. acetobutylicum. This method allows the modification of the genome without any marker or scar left in a strain of C. acetobutylicum that is ∆upp. Unfortunately, 5FU has strong mutagenic properties inducing mutations in the strain’s genome. After numerous applications of the pCat-upp/5FU system for genome modification in C. acetobutylicum, the bacteria became completely resistant to 5FU in the presence of the upp gene, resulting in failure in the selection for the second crossing-over. It was found that the potential repressor of the pyrimidine operon, PyrR, was mutated at position A115, leading to the 5FU resistance of the strain. We developed two plasmids, one overexpressing the native pyrR gene and a suicide plasmid carrying a non-mutated and optimized pyrR gene (pyrR*) and upp, which allowed us to restore the 5FU sensitivity of the strain. We also improved the pCat-upp/5FU system by reducing the concentration of 5FU from 1mM to 5 µM using a define synthetic medium.

Transcriptional regulation constitutes a key step in gene expression regulation. Myocyte enhancer factor 2C (MEF2C) is a transcription factor of MADS box family involved in the early development of several cell types including muscle cells. Over the last decade a novel layer of complexity modulating gene regulation is emerging as non-coding RNAs have been identified, impacting in both transcriptional and post-transcriptional regulation. microRNAs represent the most studied and abundantly expressed subtype of small non-coding RNAs and their functional role have been widely documented. On the other hand, our knowledge on the transcriptional and post-transcriptional regulatory mechanisms that drive microRNA expression is still incipient. We recently demonstrated that MEF2C is able to transactive the long, but not short, regulatory element upstream of miR-23a-miR-27a-miR-24-2 transcriptional start site. However, MEF2C over-expression and silencing, respectively, displayed distinct effects on each of the miR-23a-miR-27a-miR-24-2 mature cluster members, without affecting pri-miRNA expression levels, supporting thus additional MEF2C-driven regulatory mechanisms. Within this study we demonstrated a complex post-transcriptional regulatory mechanisms directed by MEF2C in the regulation of miR-23a-miR-27a-miR-24-2 cluster members, distinctly involving different domains of the MEF2C transcription factor and the physical interaction with pre-miRNAs and RNA interacting proteins such as Ksrp, HnRNPa3 and Ddx17.

Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a significant challenge to global wheat production. Common wheat landraces AUS27507 and AUS27894 displayed stripe rust resistance against several commercially prevailing Pst pathotypes. These genotypes were crossed with a stripe rust susceptible landrace AUS27229 to understand inheritance of resistance and to determine genomic location(s) of underlying gene(s). F3 generations of crosses AUS27507/AUS27229 and AUS27894/AUS27229 showed monogenic segregation for stripe rust resistance under greenhouse conditions. The absence of segregation for stripe rust response among the AUS27507/AUS27894-derived F3 population suggested that both genotypes carry the same gene. The stripe rust resistance gene carried by AUS27507 and AUS27894 was tentatively named YrAW4. Bulked segregant analysis placed YrAW4 in the long arm of chromosome 2B. The AUS27507/AUS27229 F3 population was enhanced to develop an F6 recombinant inbred line (RIL) population for detailed mapping of chromosome 2BL. DArT-based SSR, STS and KASP markers were employed to enrich the 2BL map. DArT-based STS markers sun481 and SNP marker IWB12294 flanked YrAW4 proximally (1.8 cM) and distally (1.2 cM), respectively. Deletion mapping placed sun481 in the deletion bin 2BL-5. All stripe rust resistance genes, previously located on chromosome 2BL, neither express infection type like YrAW4, nor are mapped in the deletion bin 2BL-5. Hence YrAW4 represented a new locus and was formally named Yr72. The robustness of IWB12294 marker in marker-assisted selection was demonstrated by amplification of and alternative allele to that linked Yr72 in 21 common wheat background.

N6-methyladenosine (m6A) is an RNA modification wherein N6-position of adenosine is methylated. It is one of the most prevalent internal modifications on RNA and regulates various aspects of RNA metabolism. M6A is deposited by m6A methyltransferases, removed by m6A demethylases and recognized by reader proteins, which modulate splicing, export, translation and stability of the modified mRNA. Recently evidence suggests that various classes of non-coding RNAs (ncRNAs) including microRNAs (miRNAs), circular RNAs (circRNAs), and long con-coding RNAs (lncRNAs) are also targeted by this modification. Depending on the ncRNA species, m6A may affect processing, stability, or localization of these molecules. The m6A modified ncRNAs are implicated in a number of diseases including cancer. In this review, I summarize the role of m6A modification in the regulation and function of ncRNAs in tumor development. Moreover, the potential applications in cancer prognosis and therapeutics is discussed.

Abrstract: Bacillus spp. it is a genus that is used to biocontrol post-harvest diseases in various vegetables and fruits during transportation and storage. It suppresses the development of pathogens such as gray mold (Botrytis cinerea) in strawberry cultivation. In this work, the molecular characterization of Bacillus spp. species was carried out. in three cities in Peru: Huaura, Chanchamayo and Cañete. The samples were collected from rhizospheric soil from crop areas, subsequently processed for microbiological isolation, molecular analysis using the 16S rRNA gene and bioinformatic analysis. In total, 14 strains were obtained where they were identified with a minimum of 92.05% and a maximum of 100% similarity: 8 strains of Bacillus subtilis, 4 strains of Bacillus licheniformis, 1 strain of Bacillus paralicheniformis and 1 strain of Bacillus cereus, all the strains were related by constructing a phylogenetic tree.

High production cost is one of the major factors that limit the market growth of polyhydroxyalkanoates (PHAs) as a biopolymer. Improving PHA synthesis performance and utilizing low grade feedstock are two logical strategies for reducing the cost. As an oleaginous yeast, Y. lipolytica has a high carbon flux through acetyl-CoA (main PHB precursor) which makes it a desired cell factory for PHB biosynthesis. Two different metabolic pathways introduced into Y. lipolytica PO1f in this study for enhancing PHB biosynthesis, along with glucose and acetate as co-substrates. Results showed that NBC pathway led to more than 11% PHB accumulation, while there was non-detectable PHB accumulations using ABC pathway. Further modifications were done using peroxisomal compartmentalization and gene-dose overexpression. Final strain showed up to 41% PHB of CDW with a growth rate of 0.227 h-1. Low growth rate was observed using acetate or glucose as sole carbon and energy source. The co-substrate strategy showed compensatory effect on overcoming inhibitory and toxic effects of both substrates at high concentrations. Cultivating the engineered strain in optimal co-substrate condition predicted by RSM led to 83.4 g/L biomass concentration and 31.7 g/L PHB.

Pathogenic microorganisms can cause a range of infectious diseases and are often treated with antimicrobial agents. The rise of antimicrobial resistance caused by inappropriate use of these agents in various settings has become a global health threat. There is, therefore, a need to find new and effective agents to combat infections caused by resistant pathogens. Nanotechnology has seen significant growth and development in recent years and has a wide range of applications in various fields, including health, agriculture, and industry. This novel area offers the potential for the synthesis of nanoparticles (NPs) with antimicrobial activity, such as iron oxide nanoparticles (IONPs). The use of IONPs is a promising way to overcome antimicrobial resistance or pathogenicity because of their ability to interact with several biological molecules and to inhibit microbial growth. This review focuses on the most common green synthesis methods for producing IONPs using bacteria, fungi, plants, and organic waste, as well as the most common methods for the characterization of these IONPs. Finally, it summarizes their application as promising antibacterial, antifungal, antiparasitic, and antiviral agents.

Microbial pigments have many structures and functions with excellent characteristics, such as being biodegradable, non-toxic, and ecologically friendly, constituting an important source of pigments. Industrial production presents a bottleneck in production cost that restricts large-scale commercialization. However, microbial pigments are progressively gaining popularity because of their health advantages. The development of metabolic engineering and cost reduction of the bioprocess using industry by-products opened possibilities for cost and quality improvements in all production phases. We are thus addressing several points related to microbial pigments, including the major classes and structures found, the advantages of use, the biotechnological applications in different industrial sectors, their characteristics, and their impacts on the environment and society.

: Early and accurate detection of infectious diseases is a key step for surveillance, epidemiology, and control, notably timely disease diagnosis, patient management and follow-up. In this study, we aimed to develop hand-held ultra-fast duplex PCR assays coupled to amplicon detection by lateral flow (LF) immunoassay to deliver a rapid, and simple molecular diagnostic test for con-comitant detection and identification of the main Leishmania parasites encountered in Tunisia and the Old World. We selected two DNA targets to amplify L. major/L. tropica and L. infantum/L. tropica group of species DNAs, respectively. We optimized the experimental conditions of a du-plex ultra-fast PCR. The amplification is performed by a portable Palm convection PCR machine within 18 min and the products are detected by a LF cassette within 10 minutes. The test allows the identification of the infecting species according to the position and number of test lines re-vealed. Tested on a selection of DNAs of representative Leishmania strains of the three studied species (N=37), the ultra-fast duplex PCR-LF showed consistent, stable, and reproducible results. The analytical limit of detection of the test was 0.4pg for L. major, 4pg for L. infantum and 40pg for L. tropica.

Four strains of green microalgae (Scenedesmus acutus, Scenedesmus vacuolatus, Chlorella sorokiniana and Chlamydomonas reinhardtii) were compared for growth and pigment composition under photoautotrophic or heterotrophic conditions. Batch growth experiments were performed in multicultivators with online monitoring of optical density. For photoautotrophic growth, light-limited (CO2-sufficient) growth was analysed under different light intensities during exponential and deceleration growth phases. The specific growth rate, mesured during exponential phase, and the maximal biomass productivity, measured during deceleration phase, were not related to each other when different light intensities and different species were considered. This indicates species-dependent photoacclimation effects during cultivation time, which was confirmed by light-dependent changes in pigment contents and compositions when exponential and deceleration phases were compared. Except for C. reinhardtii, that does not grow on glucose, heterotrophic growth was promoted to similar extents by acetate or by glucose, however these two substrates led to different pigment compositions. Weak light increased pigment contents during heterotrophy in the four species, but was efficient in promoting growth only in S. acutus. C. sorokiniana and S. vacuolatus exhibited the best potential for heterotrophic biomass productivities both on glucose and acetate, with carotenoid (lutein) content being the highest in the former.

L-asparaginase from bacterial sources have been used in antineoplastic treatments and the food industry. A novel type II L-a sparaginase encoded by the N-truncated gene ansZP21 of halotolerant Bacillus subtilis CH11 isolated from Chilca salterns in Peru was expressed using a heterologous system in Escherichia coli BL21 (DE3)pLysS. The recombinant protein was purified using one-step nickel affinity chromatography and exhibited activity of 234.38 U mg-1 and a maximum catalytic activity at pH 9.0 and 60 °C. The enzyme shows a homotetrameric form with an estimated molecular weight of 155 kDa by gel filtration chromatography. The enzyme half-life at 60 °C was 3 h 48 min, and L-asparaginase retained 50% of initial activity for 24 h at 37 °C. The activity was considerably enhanced by KCl, CaCl2, MgCl2, mercaptoethanol, and DL-dithiothreitol (p-value < 0.01). Moreover, the Vmax and Km were 145.2 µmol mL-1 min-1 and 4.752 mM, respectively. These findings evidence a promising novel type II L-asparaginase for future industrial applications.

Background: Obesity and its attendant conditions have become major health problems worldwide and is currently ranked as the fifth most common leading cause of death globally. Complex environmental and genetic factors are the cause of the current obesity epidemic. Diet, lifestyle, chemical exposures, and other confounding factors are difficult to manage in humans. The mice model is helpful in researching genetics BW gain because genetic and environmental risk factors can be controlled in mice. Studies in mouse strains with various genetic backgrounds and established genetic structures provide unparalleled opportunities to find and analyze trait-related genomic loci. In this study, we used the Collaborative Cross (CC), a large panel of recombinant inbred mouse strains, to present a predictive study using CC mice SMAD4 knockout profiles to understand and effectively identify predisposition to body weight gain. Materials and Methods: Male C57Bl / 6J Smad4+/- mice were mated with female mice from 10 different CC lines to create F1 mice (Smad4+/- x CC). Body weight (BW) was measured weekly until week 16, then monthly until the end (week 48). The heritability H2 of the assessed traits was estimated and presented. Comparative analysis of various machine learning algorithms for predicting the BW changes and genotype of mice was conducted. Results and conclusions: Our data showed that the body weight records of F1 mice with different CC lines differed between wildtype and mutant Smad4 mice during the experiment. Genetic background affects weight gain and some lines gained more weight in the presence of Smad4 knockout, while others gained less, but in general, the mutation caused overweight mice, except for a few lines. In both control and mutant groups, female %BW had a higher heritability H2 value than males. Additionally, both sexes with wildtype genotypes showed higher heritability values than the mutant group. Logistic Regression provides the most accurate mouse genotype predictions using machine learning. We plan to validate the proposed method on more CC lines and mice per line to expand machine learning for BW prediction.

Cotton leaf curl Kokhran virus (CLCuKoV) (genus, Begomovirus; family, Geminiviridae) is highly infectious, widespread and the most dangerous pathogen of cotton (Gossypium hirsutum L.) that is responsible to a serious disorder, cotton leaf curl disease (CLCuD). Begomoviruses are spread very efficiently by the whitefly Bemisia tabaci cryptic species, causing economic losses to cotton crop, all over the world. The ‘Lucknow’ strain of CLCuKoV has emerged as a divergent isolate that could cause CLCuD. The monopartite ssDNA genome of CLCuKoV-Lu (2.7 Kb) contains six open reading frames (ORFs) that was shown to encode four major proteins. RNA interference (RNAi)-based antiviral innate immunity is a sequence-specific biological phenomenon and a powerful tool to control plant viruses. The present study aims to determine cotton locus-derived microRNAs (ghr-miRNAs) that are identified for targeting the CLCuKoV-Lu ss-DNA-encoded mRNAs using a predictive approach that involves four computational algorithms, miRanda, RNA22, psRNATarget and RNAhybrid. Mature ghr-miRNA sequences (n=80) from allotetraploid upland cotton (2n = 4x = 52) were selected from the miRBase and were tested for alignment with the CLCuKoV-Lu genome. Among the 80 cotton locus-derived ghr-miRNAs evaluated, only one consensus cotton locus-derived ghr-miRNA (ghr-miR2950) was concluded to have effective ghr-miRNA target site at common nucleotide position 82 in the CLCuKoV-Lu genome respectively, using a stringent criterion, identified by all the algorithms used. The miRNA targeting is reliant on base pairing of miRNA-mRNA target pairings. Conservation of the hybridization binding site of the predicted ghr-miR2950 was validated using multiple sequence alignment within all the strains of CLCuKoV. We constructed a regulatory interaction network of miRNA–mRNA to identify novel targets. The efficacy of the predicted miRNAs against CLCuKoV-Lu was evaluated by RNAi-mediated targeted mRNA cleavage. The current investigated miRNA targets provide evidence for the development of CLCuD-resistant cotton plants.

The copolyester of 3-hydroxybutyrate (3HB) and 3-hydoxyhexanoate (3HHx), PHBHHx, is a bi-odegradable plastic that has a high flexibility, softness, wide process window and marine bio-degradability. PHBHHx is usually produced from structurally related carbon sources such as vegetable oils or fatty acids but not from inexpensive carbon sources like sugars. In the previous studies, we demonstrated that engineered strains of hydrogen-oxidizing bacterium, Cupriavidus necator synthesized PHBHHx with high cellular content from not only sugars but also from CO2 as the sole carbon source in the flask culture. In this study, highly efficient production of PHBHHx from CO2 was investigated by pH-stat jar cultivation of the recombinant C. necator strains with feeding the substrate gas mixture (H2/O2/CO2=8:1:1) to complete mineral medium in recycled-gas closed-circuit culture system. As the result with the strain MF01/pBPP-ccrMeJAc-emd, the dry cell mass and PHBHHx concentration reached up to 59.62 ± 3.18 g･L-1 and 49.31 ± 3.14 g･L-1, respectively after 212 h of jar cultivation with limited addition of ammonia and phosphate solutions. The 3HHx composition was close to 10 mol% which is suitable for practical applica-tions. It is expected that autotrophic cultivation of the recombinant C. necator can be a feasible process for mass production of PHBHHx from CO2.

Coronary artery disease is the most prevalent cardiovascular disease, claiming millions of lives annually around the world. The current treatment includes surgically inserting a tubular construct called as a stent inside arteries to restore blood flow. However, due to lack of patient-specific design, the commercial products cannot be used with different vessel anatomies. In this review, we have summarized the drawbacks in existing commercial metal stents which face problems of restenosis and inflammatory responses, owing to the development of neointimal hyperplasia. Further, we have highlighted the fabrication of stents using biodegradable polymers, which can circumvent most of the existing limitations. In this regard, we elaborated on utilization of new fabrication methodologies based on additive manufacturing such as three-dimensional printing to design patient-specific stents. Finally, we have discussed on the functionalization of these stent surfaces with suitable bioactive molecules which can prove to enhance their properties in preventing thrombosis and better healing of injured blood vessel lining.

Candidatus Accumulibacter belongs to phosphate-accumulating organisms (PAO) which exhibit cyclic metabolism and are capable of intracellular polyphosphate accumulation and their hydrolysis under feast-famine anaerobic-aerobic cycling. In consortia of activated sludge microorganisms, these bacteria are responsible for enhanced biological phosphorus removal (EBPR). The spectrum of the substrates used by Ca. Accumulibacter remains insufficiently studied. It was investigated by measuring the oxygen uptake rates (OUR) of Ca. Accumulibacter-enriched culture supplemented with 17 different organic substrates. The highest oxygen uptake rates values were observed in the presence of tryptone, volatile fatty acids (acetate, propionate, and butyrate), succinate, pyruvate, and amino acids (aspartate and glutamate). Phosphate dynamics in the medium under shifts from anaerobic to aerobic cultivation in batch experiments was studied for these compounds (except for tryptone). All tested substrates were shown to cause phosphate cycling (release in the anaerobic phase and uptake in the aerobic one), with OURs for the substrates correlating with the amount of phosphates consumed during the aerobic phase. It was concluded that OUR may be used as an indicator of the monosubstrates used by Ca. Accumulibacter in the anaerobic/aerobic cycle. The possible pathways for substrate transport and metabolism by Ca. Accumulibacter are discussed using the stoichiometric data and the results of metagenomic analysis.

Histone modifications, especially H3K27 and H3K36 methylations, are crucial for epigenetic regulation and are often dysregulated in cancer. In a comprehensive analysis of 11,194 patient samples across 32 cancer types, we identified significant genomic alterations in H3K27 and H3K36 modifiers, with the most common being in KDM6B, BRPF1, KDM6A, SETD2, and NSD1. Patients with these alterations also frequently exhibited mutations in genes like TP53 and PIK3CA. Moreover, the presence of these histone modifier alterations correlated with poorer overall survival, emphasizing their potential as both oncogenic drivers and prognostic markers in various cancers.

Assessment of the genetic distinctiveness of a cultivar through morphological descriptors is an important tool for both the registration and the protection. New mango genotypes have been improved using valuable diverse germplasm resources to ensure food security. DNA fingerprinting based simple sequence repeats (SSR)-markers have been the most broadly used, effective and accurate in evaluation of genetic characterization of a cultivar. Molecular breeding is an effective source of genetic gain after improvement of fruit trees using marker assisted genomic selection. Mango (Mangifera indica L.) is an allotetraploid (2n = 4X= 40) drupe fruit and has high nutritional value belongs to genus Mangifera and family Anacardiaceae. Mango cultivars are used with worldwide acceptance to pharmacological, ethnomedical, and phytochemical industries. This study investigated the molecular evaluation of a new mango cultivar ‘Azeem Chaunsa’ using a set of the most effective 50 hyper-variable polymorphic SSR markers. Highly specific DNA fingerprints were identified in the genome of this mango cultivar, ‘Azeem Chaunsa’ compared with three standard cultivars such as Sindhri, Samar Bahisht (S.B) Chaunsa and Sufaid Chaunsa. Our results showed that SSR markers could efficiently assess genetic diversity in mango. An agglomerative hierarchical clustering method was used to construct dendrogram based on the ‘Unweighted Pair- Group Method with Arithmetic Mean’ (UPGMA). The genetic similarity coefficients were recorded between the mangos cultivars ranged from 0.49 to 0.67. Cultivar identification (CID) evaluates association among standard cultivars and Azeem Chaunsa and further concludes significant variations. CID results concluded that cultivar ‘Azeem Chaunsa’ varied significantly from the check cultivar, Sindhri (46.2%), S.B Chaunsa (45%) and Sufaid Chaunsa (46.7%). The results obtained in this study will orient cultivar identification strategies for a successful future mango breeding programmes in the context of climate change.

Abstract: Given the increasing resistance of some bacterial strains to many common antibiotics used in the local market, the current study aimed to produce nanoscale particles capable of combating pathogenic bacteria that have developed resistance to current antibiotics. In this research, an ex-perimental study was conducted to produce nanoscale particles using the single-celled blue-green algae Synechococcus sp., which was isolated from a local environment in the Arab Republic of Egypt, specifically from a soil sample in Beni-Suef City. The aim of the study was to generate silver NPs employing different biological approaches, encompassing the direct strain powder technique, ethanol extract pellet technique, and ethanol extract technique. These synthesized nanoparticles displayed different shapes, including cubic, spherical, pellet-like, and rod-shaped particles. They were characterized by bio-functional groups containing Ag+ ions, which were detected using FT-IR, Zeta sizer, and Zeta potential measurements. High-resolution SEM imaging unveiled the mor-phological features of Silver NPs with biologically formed protective layers, spanning sizes from 20 to 430 nm for individual particles. The study evaluated the antibacterial efficiency against both G+ve and G-ve bacteria. The ethanolic extract technique exhibited the largest inhibition zone (24 mm) against G+ve bacteria, particularly Staphy. aureus. Furthermore, it was observed that the larger particles produced using the powder and pellet techniques were less effective antibacterial agents. In conclusion, this investigation emphasizes the potential of cyanobacteria-based synthesis of silver nanoparticles as a promising approach for producing innovative antimicrobial agents.

The term new genomic techniques (NGTs), is an umbrella term to describe a variety of techniques that can alter the genetic material of an organism and that have emerged or have been developed since 2001, when the existing genetically modified organism (GMO) legislation was adopted. The analytical framework to detect GMOs in Europe is a established single harmonized procedure which is mandatory for authorization of GM food and feed, thus generating reliable, transparent and effective labelling scheme for GMO products. However, NGT products challenge the implementation and enforcement of the current regulatory system in the EU, relating in particular to the detection of NGT products that contain no foreign genetic material. Consequently, current detection methods will fail to meet minimum performance requirements. Although existing detection methods may be able to detect and quantify even small alterations in the genome, this does not necessarily confirm the distinction between products resulting from NGTs subject to the GMO legislation and other products. Therefore, this study provides a stepwise approach for the in silico prediction of PCR systems specificity by testing a bioinformatics pipeline for amplicon and primer set searches in current genomic databases. We have tested our methodology in two mutant genotypes produced by CRISPR/Cas9 in Arabidopsis thaliana. Overall, our results demonstrated that the single PCR system developed for the identification of a nucleotide insertion in the grf1-3 genotype has sufficient hits in the databases that would not allow discrimination of this mutanted event. Differently, the second mutated genotype grf8-61 which contains a -3bp deletion, found no matches in the sequence variant database. Our approach is the first step in decision making on PCR system and modification of them for empirical testings.

Upper mesophilic temperature acclimation of halophilic, hydrogen-producing bacteria from salt fields was investigated in this study, along with the changes in microbial abundance during an-aerobic digestion (AD) process. Genomic approaches such as PCR-denaturing gradient gel elec-trophoresis (DGGE) and next-generation sequencing (NGS) were performed to profile the mi-crobial communities. During AD, there was a significant abundance of Halanaerobacter lacunarum at 48°C followed by the increase in hydrogen yield, signifying potential contribution from the halophile in the hydrogen production. A decrease in the dominance of H. lacunarum and Halan-aerobium fermentans at 42°C, likely due to an increase in other bacterial species, was noted but their dominance significantly increased at temperatures of 45°C and 48°C. This investigation provides valuable insights in highlighting the potential of Halanaerobium sp. and the other halo-philic bacteria to adapt under upper mesophilic temperature conditions and synthesizing hy-drogen. The findings in the present study also underscore the importance of optimizing temper-ature and pH conditions to maximize hydrogen yield during high-salt anaerobic digestion.

This hypothesis demonstrates that the efficiency of Loop-Mediated Isothermal Amplification (LAMP) for nucleic acid detection can be positively influenced by preconcentration of microbial cells onto hydrophobic paper surfaces. The mechanism of this model is based on the high attraction of microbes towards hydrophobic surfaces. Extensive studies have demonstrated that hydrophobic surfaces exhibit enhanced bacterial and fungal adhesion. The preconcentration approach by exploiting this inherent affinity of hydrophobic paper substrates enables the adherence of a greater number of target cells, resulting in a higher concentration of target templates for amplification directly from urine samples. In contrast to conventional methods, which often involve complex procedures, this approach offers a simpler, cost-effective, and user-friendly alternative. Moreover, the integration of cell adhesion, LAMP amplification, and signal readout within paper origami-based devices can provide a portable, robust, and highly efficient platform for rapid nucleic acid detection. This innovative hypothesis holds significant potential for point-of-care (POC) diagnostics and field surveillance applications. Further research and development in this field will advance the implementation of this technology, contributing to improved healthcare systems and public health outcomes.

Sulfite and kraft pulping are two principal methods of industrial delignification of wood. In recent decades, those have been considered as possibilities to pretreat recalcitrant wood lignocellulosics for enzymatic hydrolysis of polysaccharides and subsequent fermentation of obtained sugars to valuable bioproducts. Current work compares chemistry and technological features of two different cooking processes in the preparation of polysaccharide substrates for deep sacchari-fication with P. verruculosum glycosyl hydrolases. Bleached kraft and sulfite pulps were subjected to hydrolysis with enzyme mixture of high xylanase, cellobiohydrolase and β-glucosidase activities at a dosage of 10 FPU/g of dry pulp and fiber concentration of 2.5, 5 and 10%. HPLC was used to analyze soluble sugars after hydrolysis and additional acid inversion of oligomers to monosaccharides. Kraft pulp demonstrated higher pulp conversion after 48 h (74-99%), mostly resulted from deep xylan hydrolysis. Sulfite-pulp hydrolysates, obtained in similar conditions, due to higher hexose concentration (more than 50 g/L), had higher fermentability for industrial strains producing alcohols, microbial protein or organic acids. Along with saccharification, enzymatic modification of non-hydrolysed residues occurred, which led to decreased degree of polymerization and composition changes in two industrial pulps. As a result, crystallinity of kraft pulp increased by 1.3%, which opens possibilities for obtaining new types of cellulosic products in pulp and paper industry. The high adaptability and controllability of enzymatic and fermentation processes creates prospects for the modernization of existing factories.

Polo-like kinase 1 (PLK1) plays a pivotal role in cell division regulation and emerges as a promising therapeutic target for cancer treatment. Consequently, the development of small-molecule inhibitors targeting PLK1 has become a focal point in contemporary research. The adenosine triphosphate (ATP)-binding site and the polo-box domain in PLK1 present crucial interaction sites for these inhibitors, aiming to disrupt the protein's function. However, designing potent and selective small-molecule inhibitors can be challenging, requiring a deep understanding of protein-ligand interaction mechanisms at these binding sites. In this context, our study leverages the fragment molecular orbital (FMO) method to explore these site-specific interactions in-depth. Through the FMO approach, we used the FMO method to elucidate the molecular mechanisms of small-molecule drug binding to these sites to design PLK1 inhibitors that are both potent and selective. Our investigation further entailed a comparative analysis of various PLK1 inhibitors, each characterized by distinct structural attributes. This comparison enhanced our understanding of the structure-activity relationships of these inhibitors, underscoring the efficacy of the FMO method in identifying critical binding features and predicting binding modes for small-molecule ligands. Furthermore, Our research spotlighted "hot spot" residues instrumental for selective and robust PLK1 binding. Our findings offer profound insights, priming the rational design of innovative potential PLK1 inhibitors with significant implications for developing anticancer therapeutics.

The production of oil by thraustochytrids is still costly because of its necessary and expensive culture medium. We evaluated the growth, lipid production, and fatty acid composition in an inexpensive, molasses-based (M) medium. Newly isolated thraustochytrid strains were identified as members of genus Aurantiochytrium based on 18S rRNA gene sequences. Isolated strains were repeatedly cultured in M medium for acclimatization to the medium. Acclimatized and non-acclimatized strains were cultured in basal GY medium and M medium. The lipid in the cultured cells were extracted by the Folch method, and the fatty acid composition was analyzed by gas chromatograph. The growth and lipid production in the non-acclimatized strains were significantly inhibited by culturing in M medium, whereas the growth and lipid production were improved by acclimatization treatment in the same medium. The fatty acid composition in the cultured cells were affected by the M medium compared to the basal GY medium. The production of some enzymes such as leucine and valine aryl-amidase was suppressed in the M medium, and the activities recovered by acclimatization treatment. The growth of some strains in the molasses medium was thus recovered by the acclimatization process, and the profiles of extracellular enzymes were also affected.

Cotton is an important plant since it provides raw materials for various in-dustry bracnhes. Even though cotton is generally tolerant of drought, it is af-fected negatively by long-term drought stress. This experiment was conduct-ed according to a completed randomized plots trial design with 3 replications to determine the upland cotton genotype’s reactions against drought under controlled conditions in the 2022 year. All genotypes were watered with 80 mL-1 of water (100% irrigation, Field capacity) until three true leaves ap-peared. After this period water stress was applied at limited irrigation of 75% (60 mL-1), 50% (40 mL-1), and 25% (20 mL-1) of field capacity. After the trial terminated at 52. Days, the cv. G56, elit line G44, G5, and commercial variety G86 genotype, respectively resulted in the highest Root Length (RL), and the G76 genotype resulted in the lowest RL followed by G41 and G35 elite lines. G1 cultivar showed the highest Root Fresh Weight (RFW), followed by G56, G44, G86, G51, and G88, respectively. The lowest RFW was also obtained in elite lines G76 and G41. The third drought morphological marker, the Num-ber of Lateral Roots (NLRs), was the highest in G44, followed by G86, Cv. G56, elite lines G13 and G5 genotype. The lowest NLRs value was obtained in genotype G47 and G76. The highest RDW means was obtained in elite line G5, followed by Cv. G56, elite line G44, G75 and cv. G90, while the lowes RDW mean obtained in elite line G76, G35, and local varieties G20 and G61. In the SL marker, the highest averages were recorded for genotypes G35, G15, G26, G67, and G56, respectively. In the SFW marker, the highest averages were observed in genotypes G15, G52, G60, G31, and G68, respectively. The lowest SL values were observed in genotypes G91, G72, G32, and G22. Simi-larly, the lowest SFW values were found in genotypes G83, G2, G75, and G91. In another shoot drought marker, Shoot Dry Weight (SDW), the highest val-ues were obtained in genotypes G35, G52, G57, G41, and G60, respectively. Conversely, the lowest SDW values were observed in genotypes G65, G91, G4, G20, and G22. In conclusion, the commercial varieties with high averages in roots, namely G86, G56, G88, and G90, and the genotypes G67, G20, G60, and G57 showing tolerance in shoots, are suggested to be potential parent plants for developing cotton varieties resistant to drought. Using the culti-vars found tolerant in the current study as parents in a drought-tolerant vari-ety development Marker-assisted selection (MAS) plant breeding program will increase the chance of success in reaching the target after genetic diversi-ty analyses are performed. It is highly recommended to continue the plant breeding program with the G44, G30, G19, G1, G5, G75, G35, G15, G52, G29, and G76 genotypes which show high tolerance in both root and shoot sys-tems.

Antibody-based passive immunotherapy has been used effectively in the therapy and prophylaxis of infectious diseases. Outbreaks of the emerging viral infections from arthropod-borne viruses (arboviruses) represent a global public health problem due to the rapid spread and urge actions and treatment of the infected individuals to combat them. Preparedness in advance developing antivirals and studies related to the epidemiology could protect us from damages and losses. Immunotherapy based on monoclonal antibodies (mAbs) has shown to be very specific to combat infectious diseases and several illnesses. Recent advances in the mAb discovery techniques allowed the development and approval of a wide number of therapeutic mAbs. This review focuses on the technological approaches available to select neutralizing mAbs for emerging arbovirus infections and outstanding strategies to obtain highly effective and potent mAbs. The characteristics of mAbs developed as prophylactic and therapeutic antiviral agents for the dengue, Zika, chikungunya and West Nile virus are presented, as well as the protective effect verified in animal model studies.

Exosomes are membrane-bound, biologically active nanovesicles of size 30-200 nm produced by many cell types, such as both mammalian and plant cells. They are wrapped in a phospholipid bilayer and play a significant role in intercellular communications. The ease in their isolation and the ability of plant-derived exosome-like nanovesicles (PDEVs) to efficiently deliver bioactive constituents into mammalian cells have made them popular in contemporary research. PDEVs share many characteristics with mammalian EVs (MEVs), including shape, size, surface charge, and consist of bioactive molecules like lipids, proteins, nucleic acids, and tiny metabolites. However, the chemical composition profile of PDEVs and their biogenesis mechanism differ significantly from those of MEVs. They have been widely explored as potential therapeutic agents and are considered as good alternatives to act as a carrier for drug delivery. The present work elucidates the isolation of exosome-like-nanovesicles (henceforth exosomes) from the culture supernatants of an in vitro cultured callus tissue derived from a bone healing plant known for its osteogenic activity, i.e., Cissus quadrangularis. The physical and biological properties of exosomes were successfully studied using different characterization techniques. To assess their therapeutic potential, we studied the internalisation of calcein-AM labeled exosomes by human derived mesenchymal stromal cells (hMSCs). Additionally, we evaluated the potential of exosomes in the migration of cells in a cell scratch assay with hMSCs and their effect on amelioration of oxidative stress was investigated on preosteoblast MC3T3-E1 cells that were pre-treated with these exosomes. Furthermore, we investigated their proliferation and differentiation to osteoblasts like cells with the help of resazurin assay and alkaline phosphatase assay (ALP). The obtained results provide a primary justification for the use of Cissus quadrangularis-derived exosomes as a nanocarrier for drug molecules for various therapeutic bone applications.

Cyanobacteria are promising organisms for the sustainable production of various biotechnologi-cal interesting products. Due to their energy production via photosynthesis, the cultivation of cyanobacteria expands the CO2 cycle. Most cyanobacteria form biofilms on surfaces in their natu-ral environment by surrounding the cells with a self-produced matrix of extracellular polymeric substances (EPS) that hold the cells together. These special growth properties need special reac-tors for cultivation. By immobilizing cyanobacteria on carriers, systems currently established in industry could also be used for biofilm formers. Various artificial carriers for immobilized growth of cyanobacteria and microalgae have already been described in the literature. However, the use of waste materials or natural biodegradable carriers would be more sustainable and is, therefore, the focus of this study. Dried Luffa cylindrica, zeolite, and corn stalks were investigated for their use as carriers for cyanobacteria. L. cylindrica was shown to be an excellent natural carrier for (i) Anabaena cylindrica (ii) Nostoc muscorum 1453-12a, and (III) Nostoc muscorum 1453-12b. Higher or at least similar growth rates were achieved when cyanobacteria were cultivated with L. cylindrica compared to submerged cultivation. Additionally, the production of EPS and C-phycocyanin was increased at least 1.4-fold in all strains by culturing on L. cylindrica. The improved growth could be explained on the one hand by the high surface area of L. cylindrica and its properties, and on the other hand by the release of growth-promoting nutrients from L. cylindrica to the medium.

In the tissue regeneration field, stem cell transplantation and the control of their differentiation represent a promising therapeutic strategy. The second aspect can be achieved using electrical stimulation. This study aims to characterize the effect of a microsecond electrical stimulation on MSCs and iNSCs, in the context of the RISEUP FET-OPEN project (n. 964562) that seeks to control these cells differentiation for the spinal cord injury treatments. Here, the effect of a specific microsecond electric pulses stimulation, characterized by bipolar pulses of 100 µs + 100 µs, delivered for 30 minutes at an intensity of 250 V/cm, on i) cell proliferation, ii) cell cycle, iii) gene expression and iv) apoptosis was evaluated. Results show that the stimulation does not affect cell proliferation, cell cycle, and apoptosis, but induced some variations in gene expression, in particular in EGR1, FOS, and POU5F1. These ob-servations led us to deeply investigate the cell proliferation until 72h from the stimulation observing an increase in the iNSCs. The main outcome of this study is that the chosen stimulation protocol is safe and not toxic for MSCs and iNSCs. The observed variations in the gene expression need to be deeply investigated to assess the molecular mechanisms involved.

The role of calcium ions (Ca2+) is extensively documented and comprehensively understood in eukaryotic organisms. Nevertheless, emerging insights, primarily derived from studies on human pathogenic bacteria, suggest that this ion also holds a pivotal role in prokaryotes. In this review, our primary focus will be on unraveling the intricate Ca2+ toolkit within prokaryotic organisms, with particular emphasis on its implications in plant growth promoting rhizobacteria (PGPR). To pinpoint and identify homologues of Ca2+ channels, pumps, exchangers, and Calcium-Binding Proteins (CaBPs) we undertook an in silico exploration in the genomes of four distinct PGPR strains using as query prokaryotic sequences that were experimentally confirmed to play a role in regulating intracellular calcium concentration ([Ca2+]i) or sensing and transducing this essential cation. These investigations were conducted in Pseudomonas chlororaphis subsp. aurantiaca SMMP3, P. donghuensis SVBP6, Pseudomonas sp. BP01, and Methylobacterium sp. 2A. which have been isolated and characterized within our research laboratories. We also present experimental data to evaluate the influence of exogenous Ca2+ concentrations ([Ca2+]ex) on the growth dynamics of these isolated strains

Parasitic diseases are among the most serious public health problems in developing countries, causing high mortality and economic burdens. The Trypanosomatidae family includes Leishmania spp. and Trypanosoma cruzi, which cause leishmaniasis and Chagas disease, respectively. Both these parasites are among the major agents of neglected tropical diseases (NTDs). Leishmaniasis is currently the second most widespread vector-borne parasitic disease after malaria. The World Health Organization (WHO) records approximately 0.7-1 million newly diagnosed leishmaniasis cases each year, resulting in approximately 20,000-30,000 deaths. Also, 25 million people worldwide are at risk of Chagas disease and an estimated 6 million people are infected with Trypanosoma cruzi. Despite the similarity of the parasites, the evolution of the disease and the clinical indexes are explicitly different in African, Asian, and American forms of infection. Clinical therapies are associated with drug resistance and side effects. As a result, the discovery of novel therapeutic agents has emerged as a top priority and a promising alternative. Peptide-based drugs are an attractive class of therapeutic agents. They are recognized for being highly selective and effective, as well as safe and well tolerated. Moreover, they are now being explored in the development of novel therapeutics for a variety of health disorders, including oncology, endocrinology, metabolic, cardiovascular, and bone diseases. In addition, they are being explored in tropical diseases such as leishmaniasis and Chagas disease. We will discuss current knowledge regarding the parasite life cycle, signs and symptoms, diagnosis, and treatment options for leishmaniasis and Chagas disease.

Homologous recombination deficiency (HRD) has become an important prognostic and predictive biomarker for patients with high-grade serous ovarian cancer who may benefit from poly-ADP ribose polymerase inhibitors (PARPi) and platinum-based therapies. HRD testing provides relevant information to personalize patients’ treatment options, and it has been progressively incorporated in diagnostic laboratories. In this study, we evaluated the feasibility of in-house HRD testing deployable in a diagnostic clinical setting, comparing results from two commercially available next-generation sequencing (NGS)-based tumor tests (SOPHiA DDMTM HRD Solution and AmoyDx HRD Focus Panel) with the reference assay from Myriad MyChoice CDx. A total of 85 ovarian cancer samples were subjected to HRD testing. An overall strong correlation was observed across the three assays evaluated, regardless of the different underlying methods employed to assess genomic instability, with the highest pairwise correlation between Myriad and SOPHiA (R=0.87, p-value=3.39x10-19). The comparison of the assigned HRD status to the reference Myriad’s test revealed a positive predictive value (PPV) and negative predictive value (NPV) of 90.9% and 96.3% for SOPHiA’s test, while AmoyDx’s test achieved 75% PPV and 100% NPV. This is the largest HRD testing evaluation using different methodologies and provides a clear picture of the robustness of NGS-based tests currently offered in the market. Our data show that the implementation of in-house HRD testing in diagnostic laboratories is technically feasible and it can be reliably performed with commercial assays. Also, the turnaround time is compatible with clinical needs, being an ideal alternative to offer to a broader number of patients, while still maintaining high-quality standards at more accessible price tiers.

Bloodstream infection is a major health problem worldwide, with extremely high mortality. Detecting infection in the early stage is challenging due to the extremely low concentration of bacteria in the blood. Digital PCR provides unparalleled sensitivity and can achieve absolute quantification, but it is time-consuming. Moreover, the presence of unavoidable background signals in negative controls poses a significant challenge for single-molecule detection. Here, we propose a novel strategy called “Ultrafast flexible thin tube-based droplet digital PCR (utPCR)” that can shorten the digital PCR process from 2 hours to only 5 minutes, with primer annealing/extension time reduced from minutes to only 5 seconds. Importantly, the ultrafast PCR eliminates the nonspecific amplification and thus enables single-molecular detection. The utPCR enabled sensitive detection and digital quantification of E. coli O157 in the high background of 106-fold excess of E. coli K12 cells. Moreover, this method also displayed the potential to detect rare pathogens in blood samples, and the limit of detection (LOD) could be as low as 10 CFU per mL of blood without false positive results. Considering ultrafast (<5 min) and highly sensitive (single-molecule detection), the utPCR holds excellent prospects in the next generation of molecular diagnosis.

: The cytotoxic effect of four extracts obtained from the wild plant and two from a culture of Ag-eratina pichinchensis calluses on cell lines: prostate carcinoma, cervical cancer, hepatocellular car-cinoma, human hepatoma, lung cancer and cellular keratinocytes was evaluated; the extracts were obtained with ethyl acetate and methanol, leaves and stems were used from the wild plant. The results of the cytotoxic evaluation showed that only the ethyl acetate extract obtained from the callus culture showed an effect on the cervical cancer cell line (HeLa) with an IC50 of 94.79 ± 2.0 µg/mL. The purification of this extract allowed obtaining a benzofuran type compound as the main product, which was identified as 2,3-dihydrobenzofuran. The cytotoxic evaluation of this compound showed an important effect against the HeLa cell line with an IC50 of 23.86 ± 2. .5µg/mL. These results contribute to the development of alternatives for the production of com-pounds for the treatment of cancer.

Training researchers and stakeholders is crucial to mitigate the risks associated with toxins and venom. By sharing knowledge on the responsible use of toxins, venoms, chemicals, and data from biosecurity and cyberbiosecurity perspectives, we empower laboratorians to make informed choices. We need to remember that cultivating a culture of sustainable biosafety and biosecurity is vital for one health. This technical note highlights the essence of safeguarding biosecurity and cyberbiosecurity in toxin and venom research laboratories workshop designed and implemented to boost biosecurity.

(1) Background: ganoderic acids (GAs) are specific triterpenes of Ganoderma lucidum. The HPLC fingerprint profile of GAs of the fruiting body has been well-known, but the mycelial fingerprinting remains unclear. (2) Methods: the ethanol extract of the mycelium of G. lucidum (YK-01) was further purified by preparative HPLC. The HPLC spectra for four strains of G. lucidum and one strain of G. formosanum (purple lingzhi) were investigated. (3) Results: nineteen lanostane triterpenes, including five new triterpenes, GA-TP (1), ganodermic acid Jc (GmA-Jc) (2), GmA-Jd (3), GA-TQ1 (4), and ganoderal B1 (5), and fourteen known triterpenes 6-19 were isolated from the ethanol extract. A green chemical HPLC analytical method was developed by using ethanol and acetic acid as mobile phase. These triterpenes comprise of a unique HPLC triterpenoid spectral pattern of G. lucidum mycelium. All four G. lucidum strains showed the same HPLC spectral pattern, whereas G. formosanum displayed a different pattern. Quantitation methods for ganoderic acid T (10) and S (12) were also validated. (4) Conclusions: the triterpenoid HPLC analytical method can be used to identify G. lucidum species, and to determine the contents of GA-T and GA-S.

Fipronil is an insecticide widely used in the agricultural and veterinary sectors for its efficacy in pest control. The presence of fipronil in the environment is mainly due to agricultural and domestic practices and is frequently found in different types of environmental matrices in concentrations ranging from µg/L to mg/L and can be hazardous to non-target organisms due to its high toxicity. This study was carried out to obtain and characterize microorganisms from soil which are capable of biodegrading fipronil that could be of great biotechnological interest. For this purpose, a bioprospecting was carried out using fipronil (0.6 g/L) as the main source of carbon and nitrogen for growth. Once obtained, the strain was identified by sequencing the 16S ribosomal RNA (rRNA) gene and the capacity to degrade fipronil was monitored by GC-MS. Our study showed the presence in soil samples of the strain identified as Enterobacter chengduensis, which was able to metabolize fipronil and its metabolites during the mineralization process. Enterobacter chengduensis was able to biodegrade fipronil (96%) and its metabolites fipronil-sulfone (92%) and fipronil-sulfide (79%) in 14 days. Overall, the results of this study provided a bacterium with great potential that could contribute to the degradation of fipronil in the environment.

Some of the most recent advances in enzymatic glycosylation processes focused on the production of important bioactive compounds have been analyzed. The applicability of different enzymes such as glycosidases, glycosyltransferases, glycophosphorylases and glycosynthases have been de-scribed around the review article considering their advantages and disadvantages of these biocat-alysts in the stereoselective and regioselective synthesis of different types of glycosylated mole-cules, phenolic and aliphatic alcohols, oligosaccharides, polysaccharides, glycoderivatives, glyco-peptides and glycoproteins with a clear focus on food and pharmaceutical chemistry. Therefore, these approaches combining the use of different catalytic systems, the improvement of tools such as immobilization technology, or chemical or genetic modification to improve the synthesization in the glycosylation process could be a very useful tool in a continuous biotechnological advance.

With worsening environmental degradation and increasing international demand for human health, plant cell based technology will be more important. The aim of this review is to give an overview regarding key points of current progress and development trend of nature medical and edible plants from the framework of whole plant cell engineering including cell cultures, cell fusion and cell splitting derived biotechnology. Here we sum up three main application trends of medical plants cell cultures covering industrial output, technology upgrading and potential resource development. We also provide classification and typification insights to summarize the development of somatic hybridization in cereal, vegetables crops and other medicinal and edible plants as well as application of artificial polyploidy induction in major medicinal herbs. Development medicinal and edible homologous plants based on modern plant cell engineering will bring us a promising future.

This study aimed to evaluate the proliferation and migration of fibroblast cells derived from chronic wounds and investigate the impact of low-level laser therapy (LLLT) on their growth and migration. A total of 60 dermal samples were obtained from three sites of chronic pressure ulcers and diabetic ulcers in 20 patients. Following collection in the operating room, the dermal samples were isolated using the procedure described by Freshney RI. Fibroblasts from the wound base (Site 1) exhibited a slow proliferation rate and a decrease in proliferative capacity. Fibroblasts from wound margins (Site 2) and adjacent healing skin (Site 3) could be successfully isolated and maintained for multiple generations without any morphological changes. Fibroblasts from chronic wounds at Sites 2 and 3 showed slower proliferation rates and reduced migration capabilities compared to normal dermal fibroblasts (control samples). The fibroblast cells were exposed to LLLT at different energy levels (2.5, 3, and 3.5 J/cm2). The laser-treated groups demonstrated a significantly higher increase in cell count compared to the control sample, with the highest increase observed at an energy level of 3 J/cm2. These findings suggest that LLLT at an energy level of 3 J/cm2 could effectively enhance fibroblast migration, indicating its potential as a therapeutic intervention for chronic wounds.

Water deficit greatly affects global crop growth and productivity, particularly in water-limited environments like upland rice cultivation, leading to reduced grain yield. Plants activate various defense mechanisms during water deficit, involving numerous genes and complex metabolic pathways. Exploring orthologous genes, linked to enhanced drought tolerance, can aid functional validation in target species using genomic data from model organisms. Here, we studied the OsCPK5 gene in upland rice, an AtCPK6 ortholog from A. thaliana, by overexpressing it in the BRSMG Curinga cultivar. Transformants were assessed under two conditions: water deficit applied 79 days after seeding, lasting 14 days, followed by 7 days of irrigation at 80% field capacity. Physiological data and samples were collected at R3, R6, and R8 stages. GM plants consistently exhibited higher OsCPK5 gene expression across stages, peaking during grain filling. During this phase, GM plants displayed reduced stomatal conductance, photosynthetic rate, and increased water use efficiency compared to non-GM plants under drought. GM plants also exhibited higher filled grain percentage in both irrigation conditions. Their drought susceptibility index was 0.9 times lower than NGM plants, and they maintained a higher chlorophyll a/b index, indicating sustained photosynthesis. NGM plants under water deficit exhibited more leaf senescence, while OsCPK5-overexpressing plants retained green leaves. Overall, OsCPK5 overexpression induced diverse drought tolerance mechanisms, hinting at potential for future development of more drought-tolerant rice cultivars.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Abstract: The ability to detect several types of cancer using a non-invasive, blood-based test holds the potential to revolutionize oncology screening. We mined tumor methylation array data from the Cancer Genome Atlas (TCGA) covering 14 cancer types and identified two novel, broadly oc-curring methylation markers at TLX1 and GALR1. To evaluate their performance as a general-ized blood-based screening approach, along with our previously reported methylation bi-omarker, ZNF154, we rigorously assessed each marker individually or combined. Utilizing the TCGA methylation data and applying logistic regression models within each individual cancer type, we found that the three-marker combination significantly increased the average area under the ROC curve (AUC) across the 14 tumor types compared to single markers (p= 1.158e-10; Friedman test). Furthermore, we simulated dilutions of tumor DNA into healthy blood cell DNA and demonstrated increased AUC of combined markers across all dilution levels. Finally, we evaluated assay performance in bisulfite sequenced DNA from patient tumors and plasma, in-cluding early-stage samples. When combining all three markers the assay achieved 100% sensi-tivity and specificity, as demonstrated in lung cancer plasma samples. In patient plasma from hepatocellular carcinoma, ZNF154 alone yielded the highest combined sensitivity and specificity values averaging 68% and 72%, whereas multiple markers could achieve higher sensitivity or specificity, but not both. Altogether this study presents a comprehensive pipeline for the identifi-cation, testing and validation of multi-cancer methylation biomarkers with a considerable poten-tial for detecting a broad range of cancer types in patient blood samples.

Sulfated polysaccharides from seaweed are highly active natural substances having valuable applications. In the present paper, attempts have been made to discuss the physicochemical and structural features of polysaccharides isolated from red marine alga Alsidium corallinum (ACPs) and its protective effect in hepatic impairments induced by tebuconazole (TBZ) in rats. Structural features were determined using High performance liquid chromatography, Fourier transformed infrared, and solid state ¹H and ¹³C-Nuclear magnetic resonance analysis. ACPs are found to be hetero-sulfated-anionic polysaccharides that contained carbohydrates, sulfate groups and uronic acids. In vitro biological activities suggested the effective antioxidant and antimicrobial capacities of ACPs. For antioxidant testing in vivo, the biochemical analysis and plasma profiles displayed that oral administration of ACPs could mitigate blood lipid indicators, including total cholesterol, triglyceride, low and high density lipoprotein cholesterol, bilirubin, liver function indexes involving alanine aminotransferase and aspartate aminotransferase, showed that ACPs possessed obvious antioxidant activities. Besides, the intervention of ACPs potentially inhibited lipid peroxidation, protein oxidation, key enzymes of lipid metabolism (<0.001) and increased levels and antioxidant status (<0.05). Histomorphological observation confirmed that ACPs intervention could partially repair liver injuries caused by TBZ. The computational results showed that A. corallinum monosaccharides bound 1JIJ, 1HD2 and 1WL4 receptors with acceptable affinities, which together with deep embedding and molecular interactions support the antioxidant, antimicrobial and hypolipidemic outlined effects in the in vitro and in vivo findings. In view of their prominent antioxidant effects, ACPs stand for promising candidates in liver diseases and need be considered in pharmaceutical applications.

Progress in macrophage research is crucial for numerous applications in medicine, including cancer and infectious diseases. However, the existing methods to manipulate living macrophages are labor intense and inconvenient. Here we show that macrophage membranes can be reconstituted after storage for months at 4C, with their CD206 receptor selectivity and specificity being similar to that in the living cells. Then, we have developed a mannose ligand, specific to CD206, linked with PEG as IR spectroscopy marker to detect binding with the macrophage receptor. PEG was selected due to its unique adsorption band of C-O-C group at IR spectra, which does not overlap with other biomolecule’s spectroscopic feature. Next, competitive binding assay versus the PEG-bound ligand, has enabled selection of other higher-affinity ligands specific to CD206. Further, those higher-affinity ligands were used to differentiate activated macrophages in patient’s bronchoalveolar (BAL) or nasopharyngeal (NPL) lavage. CD206- control cells (HEK293T) showed only non-specific binding. Therefore, biochips based on reconstituted macrophage membranes as well as PEG-trimannoside as an IR spectroscopic marker, can be used to develop new methods facilitating macrophage research and macrophage-focused drug discovery.

Neuronal PAS domain protein 2 (NPAS2) is a hemeprotein comprising a basic helix-loop-helix domain (bHLH) and two heme-binding sites, the PAS-A and PAS-B domains. This protein acts as a pyridine nucleotide-dependent and gas-responsive CO-dependent transcription factor and is encoded by a gene whose expression fluctuates with circadian rhythmicity. NPAS2 can heterodimerize with ARNTL in the activating limb of the transcriptional/translational feedback loop operating the circadian clock circuitry. NPAS2 can functionally substitute for the core transcription factor and histone/protein acetylase CLOCK in the molecular clockwork endowing central oscillators in the suprachiasmatic nuclei of hypothalamus as well as in peripheral oscillators in the cell of other body tissues, such as the liver and kidney.

Multiple myeloma (MM) has witnessed improved patient outcomes through advancements in therapeutic approaches. Notably, allogeneic stem cell transplantation, proteasome inhibitors, immunomodulatory drugs, and monoclonal antibodies have contributed to enhanced quality of life. Recently, a promising avenue has emerged with chimeric antigen receptor (CAR) T cells targeting B-cell maturation antigen (BCMA), expressed widely on MM cells. To mitigate risks associated with allogenic T cells, we investigated the potential of BCMA CAR expression in natural killer cells (NKs), known for potent cytotoxicity and minimal side effects. Using the NK-92 cell line, we co-expressed BCMA CAR and soluble tumor necrosis factor-related apoptosis-inducing ligand (sTRAIL) employing the PiggyBac transposon system. Engineered NK cells (CAR-NK-92-TRAIL) demonstrated robust cytotoxicity against a panel of MM cell lines and primary patient samples, outperforming unmodified NK-92 cells with a mean difference in viability of 45,1% (± 26,1%, depending on the target cell line). Combination therapy was explored with the proteasome inhibitor bortezomib (BZ) and γ-secretase inhibitors (GSI), leading to a significant synergistic effect in combination with CAR-NK-92-TRAIL cells. This synergy was evident in cytotoxicity assays where a notable decrease in MM cell viability was observed in combinatorial therapy compared to single treatment. In summary, our study demonstrate the therapeutic potential of the CAR-NK-92-TRAIL cells for the treatment of MM. The synergistic impact of combining these engineered NK cells with BZ and GSI supports further development of allogeneic CAR-based products for effective MM therapy.

To map Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV 2) spreading and evaluate immune responses variations against this virus, it was essential to locally set up efficient serological tests. The SARS-CoV2 immunogenic proteins were very expensive and not affordable mainly for Low and Middle Income Countries (LMICs). For this purpose, the commonly used antigen, Re-ceptor-Binding Domain (RBD) of Spike S1 protein (S1RBD), was produced using the the Baculovirus Expression Vector System (BEVS) . During the current study, the expression of S1RBD was monitored using western blot under different culture conditions. Different parameters were studied: Multiplicity Of Infection (MOI), cell density at infection and harvest time. Hence, optimal conditions for efficient S1RBD production were identified: MOI 3; cell density at infection 2-3x 106 cells/mL and time post-infection (tpi or harvest time) of 72h and 72-96 h successively for expression in shake-flasks and 7L-bioreactor. A high production yield of S1RBD varying between 4mg and 70 mg per liter of crude cell culture supernatant was achieved, respectively, in shake-flasks and in 7L-bioreactor. Moreover, the produced S1RBD showed an excellent antigenicity potential against COVID-19 patient sera evaluated by western blot. Thus, additional serological assays, such as ELISA, were developed using the purified S1RDB (published by other research groups).

Large volume bone defect regeneration is complex and demands time to complete. Several regeneration phases with unique characteristics including immune responses follow, overlap, and interdepend on each other and, if successful, lead to the regeneration of the organ bone's form and function. However, during traumatic, infectious, or neoplastic clinical cases, the intrinsic bone regeneration capacity may exceed, and surgical intervention is indicated. Scaffold-guided bone regeneration (SGBR) has recently shown efficacy in preclinical and clinical studies. To investigate different SGBR strategies over periods of up to 3 years we have established a well characterized large segmental tibial bone defect ovine model, for which we have developed and optimized immunohistochemistry (IHC) protocols. We present an overview of the immunohistochemical characterization of different experimental groups in which all ovine segmental defects were treated with a bone grafting technique combined with a three-dimensionally printed medical-grade polycaprolactone-tricalcium phosphate (mPCL-TCP) scaffold. The qualitative data set is based on osteoimmunological findings gained from IHC analyses of over &gt;350 sheep surgeries over the past two decades. Our systematic and standardized IHC protocols enabled us to gain further insight into the complex and long-drawn-out bone regeneration processes, which ultimately proved to be a critical element for successful translational research.

Cellobiose phosphorylase (CBP) catalyzes the reversible phosphorolysis of cellobiose into α-glucose 1-phosphate and glucose. When it was used in transforming cellulose to amylose (PNAS, 110: 7182-7187, 2013) as well as in constructing a yeast with the ability to phosphorolytically use cellodextrin to produce ethanol, a CBP with a broadened substrate specificity would be more desirable. Based on the structure differences in the catalytic loops of CBP and cellodextrin phosphorylase from Clostridium thermocellum (named CtCBP and CtCDP, respectively), CtCBP was mutated. A single-site mutant S497G was identified to have a 5.7-fold higher catalytic efficiency with cellotriose as a substrate in phosphorolytic reaction direction compared to wild type, without any loss of catalytic efficiency on its natural substrate cellobiose. When S497G variant was used in the transformation of mixed cellodextrin (cellobiose + cellotriose) to amylose, a significant increase in amylose yield was achieved compared to that of wild type CtCBP. Structure change in the substrate binding pocket of S497G variant accounted for its capacity to accept longer cellodextrins than cellobiose. Taken together, S497G variant of CtCBP was confirmed to acquire a promising feature favorable to those application scenarios involving cellodextrin’s phosphorolysis.

Methanotrophic bacteria that possess a unique ability of using methane as a sole source of carbon and energy have attracted considerable attention as potential producers of a single-cell protein. So far, this biotechnology implied using freshwater methanotrophs, although many regions of the world have limited freshwater resources. This study aimed at searching for novel methanotrophs capable of fast growth in saltwater comparable in composition with seawater. A methane-oxidizing microbial consortium containing Methylomarinum- and Methylotuvimicrobium-like methanotrophs has been enriched from a sediment of the river Chernavka (water pH 7.5, total salt content 30 g L-1), a tributary river of the hypersaline Lake Elton, southern Russia. This microbial consortium, designated Ch1, demonstrated stable growth on natural gas in a bioreactor in media with a total salt content of 23 to 35.9 g L-1 at a dilution rate of 0.19-0.21 h-1. The highest biomass yield of 5.8 g CDW/L with a protein content of 63% was obtained during continuous cultivation of the consortium Ch1 in a medium with a total salt content of 29 g L-1. Isolation attempts resulted in obtaining a pure culture of methanotrophic bacteria, strain Ch1-1. The 16S rRNA gene sequence of strain Ch1-1 displayed 97.09-97.24% similarity to the corresponding gene fragments of characterized representatives of Methylomarinum vadi, methanotrophs isolated from marine habitats. The genome of strain Ch1-1 was 4.8 Mb in size and encoded 3 rRNA operons, and about 4400 proteins. The genome contained the gene cluster coding for ectoine biosynthesis, which explains the ability of strain Ch1-1 to tolerate high salt concentration.

The emergence of multidrug-resistant pathogens such as Listeria monocytogenes and Shiga toxin-producing Escherichia coli (STEC) poses public health challenges, and this has led to a continuous search for effective novel antimicrobial agents. This study aimed to isolate marine actinomycetes from South Africa, evaluate their in vitro antimicrobial activity against Listeria and STEC, and characterize their mechanisms of action. Marine actinoymcetes were isolated and identified by 16S rRNA sequencing. Gas chromatography-mass spectrometry (GC-MS) was used to identify the chemical constituents of bioactive actinomycetes secondary metabolites. Antibacterial activity of the secondary metabolites was assessed by the broth microdilution method and their mode of actions were predicted using computational docking. While five strains showed antibacterial activity during primary screening, only Nocardiopsis dassonvillei strain SOD(B)ST2SA2 exhibited activity during secondary screening for antibacterial activity. GC-MS identified five major bioactive compounds: 1-octadecene, diethyl phthalate, pentadecanoic acid, 6-octadecenoic acid, and tri-fluoroacetoxy hexadecane. SOD(B)ST2SA2`s extract demonstrated the minimum inhibitory con-centration and minimum bactericidal concentration ranging from 0.78–25 mg/ml and 3.13 to > 25 mg/ml, respectively. Diethyl phthalate displayed the lowest bacterial protein binding energies (kcal/mol): −7.2, dihydrofolate reductase; −6.0, DNA gyrase B, and −5.8, D-alanine:D-alanine lig-ase. Thus, marine N. dassonvillei SOD(B)ST2SA2 is a potentially good source of antibacterial compounds that can be used to control STEC and Listeria monocytogenes.

Keywords: Porcine reproductive and respiratory syndrome virus, baculovirus surface display vectors, neutralizing antibody, IFN-γ, IL-4.

Kluyveromyces marxianus is an attractive thermotolerant yeast species for ethanol production because of its ability to utilize various carbon sources as a fermentation substrate. The use of thermotolerant microbes enables performance of high-temperature ethanol fermentation, which has several advantages including reduction of cooling costs and minimization of contamination risk. To improve K. marxianus for ethanol fermentation under stress conditions, two strains, DMKU 3-1042 and DMKU 3-118, were adapted for heat resistance and toxic substances in pulp wastewater from a paper mill, respectively, resulting in the generation of KMR1042 and KMR118, respectively. Both adapted mutants exhibited clumpy clusters of cells as pseudohyphae and altered colony morphology, and their sedimentation speeds were much faster than those of the corresponding parent strains. The two mutants showed stronger tolerance to various stresses and higher performance for ethanol production than those of the corresponding parent strains at high temperatures or in the presence of toxic substances. Genome sequencing analysis revealed that both mutants had disruption of the same gene, SWI5, despite adaptation under different stress conditions, suggesting that the formation of pseudohyphae is a common strategy of K. marxianus for coping with stresses.

The concept of targeted drug delivery can be described in terms of the drug’s ability to mimic the other biological objects’ property to localize to target cells or tissues. For example, drug delivery systems based on red blood cells or mimicking some of their useful features, such as long circulation in stealth mode, have been known for decades. On the contrary, therapeutic strategies based on macrophages have gained very limited attention until recently. Here we review two biomimetic strategies associated with macrophages, that can be used to develop new therapeutic modalities: First, the mimicry of certain types of macrophages (i.e., the use of macrophages, including tumor-associated, or macrophage-like particles as a carrier for targeted delivery of therapeutic agents); and Second, the mimicry of ligands, naturally absorbed by macrophages (i.e., the use of therapeutic agents specifically targeted at macrophages). We discuss potential applications of biomimetic systems involving macrophages for the new advancements in treatment of infections, inflammatory diseases, and cancer.

COS production is carried out enzymatically using chitosanase, but this process is expensive. Production costs can be reduced by using crude enzyme chitosanase, and the resulting COS has depolymerization &lt; 20 and molecular weight &lt; 3900 Da. Sources of crude enzyme chitosanase come from the soil, sediment, and fishery waste. Chitosanase is produced from bacteria and molds isolated from the source or direct isolation process for extracellular enzymes, especially from fishery waste. Microorganisms in the soil produce chitosanase as a biocontrol and self-defense agent. Bacteria and molds have been isolated, including Bacillus cereus, Bacillus mycoides, Paenibacillus sp., and Penicillium janthinellum. Fishery waste, especially parts of the digestive tract, is a source of chitosanase because of its relation to its nature and food, such as small fish, frogs, and several types of crustaceans. In addition, fishery waste can be used as a carbon and nitrogen source (C/N) in microorganism culture media. The chitin content becomes a stimulant for the synthesis of chitosanase by microorganisms. Crude enzyme chitosanase has an active site that hydrolyzes chitosan by breaking glycosidic bonds and producing glucosamine units (GlcN) and N-acetyl glucosamine (GlcNAc). This mechanism can take place through two events, namely inverting and retaining. Crude enzyme chitosanase can break glycosidic bonds, especially with the same groups, for example, bonds between glucosamine or N-acetyl glucosamine. The COS produced is of the partially acetylated COS (paCOS) type, which still contains an acetyl group. The degree of deacetylation is a significant factor in the resulting COS product, COS with the fully deacetylated COS (fdCOS) type of chitosan with a high degree of deacetylation. Other factors to consider are the raw material of chitosan, the incubation time, the screening process, and the production of microorganism cultures.

The emergence of multi-drug resistant bacteria has severely increased the burden on the global health system, and such pathogen infections are considered a great threat to human well-being. Antimicrobial peptides, due to their potent antimicrobial activity and low possibility of inducing resistance, are increasingly becoming the focus of much interest. Herein, a novel dermaseptin peptide, named Dermaseptin-SS1 (SS1), was identified from a skin secretion-derived cDNA library of the South/Central American tarsier leaf frog, Phyllomedusa tarsius, using a ‘shotgun’ cloning strategy. Chemically-synthesised peptide SS1 was found to be broadly effective against Gram-negative bacteria with low haemolytic activity in vitro. A designed synthetic analogue of SS1, named peptide 14V5K, showed a lower salt sensitivity with more rapid bacteria-killing compared to SS1. Both peptides employed the membrane-targeting mechanism to kill Escherichia coli. The antiproliferative activity of SS1 and its analogues, against lung cancer cell lines, was found to be significant.

Frontal Temporal Dementia (FTD) is a neurological disorder known to have less therapeutic options. So far only a few biomarkers are available for FTD that can be used as potential comorbidity targets. To this end, in the present study we aim to identify potential biomarkers or susceptible genes for FTD that show comorbidities with diseases such as COVID-19 and Breast Cancer. Gene expression Omnibus datasets containing FTD expression profiles from African American and white ethnicity background were included in our study. In FTD samples of GSE193391 dataset, we identified 305 DEGs with 168 genes being up-regulated and 137 genes being down-regulated. We conducted comorbidity analysis for COVID-19 and Breast cancer followed by analysis of potential drug interactions, pathogenicity, analysis of genetic variants and functional enrichment analysis. Resulting genes AKT3, GFAP, ADCYAP1R1, VDAC1, and C4A showed significant transcriptomic alterations in FTD and significant comorbidity status with COVID-19 and Breast cancer. Functional pathway analysis revealed that these comorbid genes were significantly enriched in the pathways such as glioma, JAK/STAT signaling, systematic lupus erythematosus, neurodegeneration-multiple diseases and neuroactive ligand-receptor interaction. Overall, from these results, we concluded that these genes could be recommended as potential therapeutic targets for the treatment of comorbidities in FTD.

High-grade gliomas present a significant challenge in neuro-oncology because of their aggressive nature and resistance to current therapies. Boron neutron capture therapy (BNCT) is a potential treatment method; however, the boron carrier compounds used — such as 4-borono-L-phenylalanine (L-BPA) — have limitations. This study evaluated the use of boron-conjugated 4-iodophenylbutanamide (BC-IP), a novel boron compound in BNCT, for the treatment of glioma. Using in vitro drug exposure experiments and in vivo studies, we compared BC-IP and BPA, with a focus on boron uptake and retention characteristics. The results showed that although BC-IP had a lower boron uptake than BPA, it exhibited superior retention. Furthermore, despite lower boron accumulation in tumors, BC-IP showed significant survival improvement in glioma-bearing rats compared to controls. These results suggest that BC-IP, with its unique properties, may be an alternative boron carrier for BNCT. Further research is required to optimize this potential treatment modality, which could significantly contribute to advancing the treatment of high-grade gliomas.

Lipases have tremendous potential for industrial use, particularly, those mostly active against water-insoluble substrates, such as triglycerides composed of long-chain fatty acids. However, in most cases, mutants often need to be constructed to achieve optimal performance for such substrates. Protein engineering techniques have been reported as strategies for improving lipase characteristics by introducing specific mutations in the cap domain of esterases or in the lid domain of lipases, or through lid domain swapping. Here, we have improved the lipase character of a lipase, retrieved from the Marine Metagenomics MarRef Database and assigned to the Actinoalloteichus genus (WP_075743487.1), through site-directed mutagenesis and by substituting its lid domain (FRGTEITQIKDWLTDA) by the one of Rhizopus delemar (previously Rhizopus oryzae) lipase (FRGTNSFRSAITDIVF). Results demonstrated that the redesigned mutants gain activity against bulkier triglycerides such as glyceryl tridecanoate and tridodecanoate, olive oil, coconut oil, and palm oil. The absence of a residue in the new lid, present in the original lid, appears to be a key aspect to the increase in lipase character, although full activity recovery is only obtained with lid swapping.

Cheese whey, a significant byproduct of the dairy industry, poses a substantial environmental challenge due to its organic pollutant load and large size demands for effective and affordable valorization methods. The abundance of lactose and other organic compounds in whey contributes to its elevated Biological Oxygen Demand (BOD) and Chemical Oxygen Demand (COD), further straining natural ecosystems. This study aimed to investigate the nutritional potential of whey and its conversion into value-added products: bioethanol and probiotic drinks. To achieve this, Bacillus megaterium and Bacillus subtilis strains, isolated from soil samples in Nepal, were co-cultured with Lactobacillus and Saccharomyces cerevisiae in the whey broth for fermentation. Ethanol distillation was carried out using a Rota-evaporator to maintain the viability of the fermenting organisms within the broth. Moreover, the probiotic criteria of the fermenting strains were extensively examined. Experimental observations revealed a remarkable concentration of 9.2 g/L of ethanol, resulting in an ethanol yield of 0.23 g/L. Extrapolating this rate, it is theoretically possible to produce an annual global bioethanol output of 5 million tons using whey as a sustainable and abundant resource. Furthermore, the study explores novel advancements in the distillation process, demonstrating the successful extraction of ethanol at room temperature. Additionally, the fermentation organisms employed in this research exhibit robust viability, surviving various in-vitro stress-tolerant tests, including exposure to bile salt, pH fluctuations, and gastric juice. These resilient strains also demonstrated long-term stability in fermented whey broth, making them promising candidates for the development of probiotic beverages. This dual approach not only enables the sustainable management of organic waste but also presents an opportunity to create value-added products with positive implications for both the environment and human health.

Abstract: Fertility tracking of menstrual cycles during perimenopause with a quantitative hormone monitor is a novel undertaking. Women in regular menstrual cycles have been tracking their fertility using different biomarkers since the 1960’s [1]. Presently, there are newer electronic hormonal devices used to track fertility that provide more exact and objective data to help delineate the fertile time frame of a woman’s cycle. These devices measure quantitative levels of estrogen, luteinizing hormone, progesterone, and follicle stimulating hormone, all of which occur at varying levels during the menstrual cycle. As women advance toward menopause, their cycles vary in length and their hormones fluctuate [2]. In this retrospective analysis, forty-two women aged 40 to 50 tracked their cycles over time and eight of the forty-two women used the quantitative hormonal device. With the use of this device, the perimenopausal period has revealed distinct hormonal cycle characteristics unique to this group of women. It is the purpose of this paper to discuss those cycle characteristics during perimenopause that were found with the use of the quantitative hormonal device.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (&gt;2-fold, p&lt;0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (&gt;2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

Thrombosis is characterized by the pathological formation of fibrin clots within a blood vessel, leading to the obstruction of blood flow. Fibrinolytic enzymes from microorganisms have exhibited promising effects to dissolve clots in a more efficient and safe way. Then, the aim of this study was to evaluate the biomass and fibrinolytic enzyme production of Tetradesmus obliquus under autotrophic and mixotrophic conditions using different concentration of corn steep liquor (CSL). Different extraction and precipitating methods were tested, and the enzyme was purified by ion exchange chromatography. More advantageous culture condition was mixotrophic using 0.25% CSL, showing the highest values of biomass productivity (Px = 169.3 ± 44.36 mg∙L-1day-1) and specific growth rate (µmax = 0.17 ± 0.00 day-1), and significant fibrinolytic production (391.34 ± 40.03 U∙mg-1). Moreover, fibrinolytic activity was higher when extracted by homogenization and precipitated using acetone, which exhibited clear zone of fibrin degradation in the fibrinolytic plate assay. Additionally, the purified enzyme showed specific activity of 1176.90 ± 140.37 U∙mg-1 and molecular weight around 97 kDa. Finally, the enzyme has higher enzymatic activity than various fibrinolytic enzymes, and the obtained enzyme has potential to be developed as a therapeutic agent in thrombosis treatment. Additional studies are need to investigate the biochemical properties and biological profile of this enzyme.

Yarrowia lipolytica is a widely used microorganism in biotechnology since it is capable of producing a wide range of products. A less studied related strain is Y. divulgata, which is also capable of erythritol production in even higher concenctration then most Y. lipolytica wild strains. Thus the aim of this work was to investigate Y. divulgata’s complex utilisation based on erythritol fermentation to establish a Yarrowia based biorefinery in which both the fermentation broth and separated cells are utilised in high-value products. An important parameter of erythritol fermentation is the adequate oxygen level, so the effect of it was investigated in baffled flasks and fermentor as well. Furthermore, we measured the cosmetic applicability of cell lysates and the efficiency of biodetergent produced during erythritol fermentation. The results were showed that Yarrowia divulagata NCAIM 1485 strain could produce relative high amount of erythritol (44.14±1 g/l) under adequate oxygen supply while its cell lysate could exert good skin moisturizing effect. In all cases, the collected samples had emulsification index above 50% of which stability was also high, above 50% even after 24 hours.Therefore, it can be considered as an effective bioemulsifier. In conclusion, the erythritol fermentation of Y. divulgata is suitable for complex utilisation in a biorefinery, since the fermentation broth can be used for isolation of sweetener and bioemulsifier, meanwhile the cells can be processed for cosmetic application as skin moisturizer.

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

Helicobacter pylori, a gram-negative bacteria usually found in stomach and first part of small intestine, is known to cause infections and ulcers and may have association with cancer. Normally, the treatment options include combinations of antibiotics with proton pump inhibitors and antiinflammatory drugs. However, all of them have high systemic exposure, and hence, unfavourable side effects, whereas their exposure in stomach mucus, the predominant location of the bacteria, is very limited. We have attempted to develop a predominantly gut-restricted formulations of antibiotic + adjuvant combinations as a basis for potentially more safe and efficacious treatment of gastrointestinal tract infections. We have considered E. coli (as a model of H. pylori) and Lactobacilli to study the antibacterial activity of nanogel with combined drugs (classical antibiotics and individual components of essential oils). It has been shown that levofloxacin (LF) in combination with zephirol demonstrates synergy effect against E. coli (cell viability has decreased by about 50%) and weakens the effect against Lactobacilli. A number of other combinations of antibiotic + adjuvant is also shown to be effective. Using FTIR and UV spectroscopy, it has been proved that chitosan nanogels with the drug are well adsorbed on the mucosal model, thereby increasing the bioavailability of drugs. Using ABTS assay, the antioxidant properties of flavonoids and other drugs are shown, which is potentially necessary to minimize the harmful effects of toxins and radicals produced by pathogens. Thus, chitosan nanogels loaded with a combination of drugs can be considered as a new strategy for the treatment of infectious diseases of the gastrointestinal tract, and applicable to difficult-to-treat bacteria.

Prior to clinical trials, preclinical testing of oncology drug candidates is performed by evaluating drug candidates with in vitro and in vivo platforms. For in vivo testing, animal models are used to evaluate the toxicity and efficacy of drug candidates. However, animal models often display poor translational results as many drugs that pass preclinical testing fail when tested in humans, with oncology drugs exhibiting especially poor acceptance rates. The FDA Modernization Act 2.0 promotes alternative preclinical testing techniques, presenting the opportunity to use higher complexity in vitro models as an alternative to in vivo testing, including 3D cell culture models. 3D tissue cultures address many of the shortcomings of 2D cultures by more closely replicating the tumour microenvironment through a combination of realistic drug diffusion, paracrine signaling, cellular phenotype, and vascularization that can better mimic native human tissue. This review will discuss the common forms of 3D cell culture, including cell spheroids, organoids, organs-on-a-chip, and 3D bioprinted tissues. Their advantages and limitations will be presented, aiming to discuss the use of these 3D models to accurately represent human tissue and as an alternative to animal testing. The use of 3D culture platforms for preclinical drug development is expected to accelerate as these platforms continue to improve in complexity, reliability, and translational predictivity.

We recently reported the isolation and characterization of an anti-SARS-CoV-2 antibody, called IgG-A7, that protected transgenic mice expressing the human angiotensin-converting enzyme 2 (hACE-2) from the infection with SARS-CoV-2 Wuhan. We show here that IgG-A7 protected 100% of the transgenic mice infected with Delta (B.1.617.2) and Omicron (B.1.1.529) at doses of 0.5 and 5 mg/kg, respectively. In addition, we studied the pharmacokinetic (PK) profile and Toxicology (Tox) of IgG-A7 in CD-1 mice at single doses of 100 and 200 mg/kg. PK parameters at those high doses were proportional to the dose, with the half-life in serum of ~10.5 days. IgG-A7 was well tolerated with no signs of toxicity in urine and blood samples, nor in histopathology analyses. Tissue Cross-reactivity (TCR) with a panel of mouse and human tissues showed no evidence of IgG-A7 interaction with tissues of these species, supporting the PK/Tox results in vivo and suggesting that while IgG-A7 has a broad efficacy profile it is not toxic in humans. The information generated in CD-1 mouse as PK/Tox model, complemented with the mouse and human TCR, could be of relevance as alternatives to NHPs in rapidly emerging viral diseases and/or quickly evolving viruses such as SARS-CoV-2.

GDF5 gene is involved in the development of skeletal elements, synovial joint formation, tendons, ligaments, and cartilage. Several polymorphisms are present within the gene and two of them, rs143384 and 143383, have been reported as correlated with osteoarticular disease or muscle flexibility. The aim of this research is to verify if the worldwide distribution among human populations of rs143384 polymorphism has been shaped by selective pressure, or if it’s the result of random genetic drift events. Ninety-four individuals of both sexes, 18-28 years old, from Sardinia were analyzed. We observed the following genotype frequencies: 28.72% of homozygotes AA, 13.83% of homozygotes GG, and 57.45% of heterozygotes AG. Allele frequencies were 0.574 for allele A and 0.426 for alle G. Relationships between populations were verified by Multidimensional Scaling (MDS). Our data show: i) a clear heterogeneity within the African populations; ii) a strong differentiation between Africans and the other populations: iii) the Sardinian population is placed withing the European cluster. To reveal possible traces of selective pressure, Population Branch Statistic (PBS) was calculated; both SNPs rs143384 and 143383 have low PBS values, suggesting that there are no signals of selective pressure in those areas of the gene.

Despite numerous studies on cancer treatment, cancer remains a challenging disease to cure, even after decades of research. In recent years, cancer vaccine has emerged as a promising approach for cancer treatment, offering few unexpected side effects compared to existing therapies. How-ever, cancer vaccine faces obstacles to commercialization due to its low efficacy. Particularly, the Toll-like receptor (TLR) adjuvant system, specifically the TLR 7/8 agonist, has shown potential for activating Th1 immunity, which stimulates both innate and adaptive immune responses through T cells. In this study, we developed ProLNG-S, a cholesterol-conjugated form of resiquimod (R848), to enhance immune efficacy by stimulating the immune system and reducing toxicity. ProLNG-S was formulated as ProLNG-001, a positively charged liposome, and co-administered with oval-bumin (OVA) protein in the B16-OVA model. ProLNG-001 effectively targeted secondary lym-phoid organs, resulting in a robust systemic anti-tumor immune response and tumor-specific T cell activation. Consequently, ProLNG-001 demonstrated potential for preventing tumor progression and improving survival compared to AS01 by enhancing anti-tumor immunity.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

The bean weevil (Acanthoscelides obtectus (Say.)) is one of the main pests of stored beans in the world. Heterogeneous Inbreed Families (HIF) Population of Near Isogenic Lines (NILs) could be an exceptional strategy to study the inheritance of the resistance against A. obtectus. We developed a HIF population of NILs of R-bufa-80-12 (Phaseolus vulgaris) to study the inheritance related to bean weevil resistance and to search NILs with high resistance to the pest within the HIF population. The objective of this research was to study the inheritance in a HIF population and to identify the best lines to provide weevil resistance in bean breeding for commercial genotypes that could reduce pesticide applications. To achieve this objective, we developed a set of 148 NILs which were near-homozygous in the genome, except in the region under study. The HIF were evaluated in two environments under natural infestation with A. obtectus in free choice bioassays in a warehouse highly infested. The population showed wide variability for the traits studied, from 17.2 to 29.2 g for 100 seed weight, 0.0-0.8 for consumption in grams, 2.0-30.0 for consumption in percent and 1.2-9.6 for preference (number of adults in the bottle to the end of the experiments. The heritabilities for resistance traits were from very low to low 0.0 to 0.19. The heritability for 100 seed weight was the highest, with a value of 0.90. All traits studied in this research have a normal distribution, so they are considered to be quantitatively inherited. However, a great variability was found for the traits studied, which allows selecting lines with a high level of resistance within the R-bufa-80-12 HIF population. All traits studied in present research are of quantitative inheritance. The best lines of the HIF population for resistance to A. obtectus were the Line-45, Line-129, Line-124, Line-108 and Line-47.

For a significant period, conventional breeding and genetic modification were the key techniques that were effective in managing biotic and abiotic stresses in crops and adding desirable traits. However, the recent appearance of novel diseases and unexpected climatic changes that have substantial implications for agriculture worldwide have urged scientists to look for alternative methods to quickly manage seasonal crises. The primary emphasis of this chapter is on the obstacles and diverse biotechnological methods employed to enhance crop resilience against a range of biotic and abiotic stressors in plants. Furthermore, we consider gene transformation, omics techniques, genome editing, and other sophisticated biotechnological tools that utilize transcriptomic, proteomic, metabolomic, phenomics, RNA interference, and epigenome modifications for enhancing plant resilience. Lastly, we examine the potential of merging these eco-friendly and innovative methods with conventional breeding to promote modern agriculture and aid in enhancing tolerance to different biotic, abiotic stresses and growth promotion.

Cascalote pods are an important source of phenolic compounds, mainly recovered using solvent extraction methods. As a sustainable alternative, this study aimed to evaluate solid-state fermentation (SSF) to enhance the extractability of total phenolic compounds (TPC) with antioxidant activity (AA) from cascalote pods. Aspergillus niger GH1 was selected based on the amount of TPC released and AA measured (ABTS, DPPH, FRAP) in a shorter time. Moreover, moisture, temperature, inoculum size, and mineral composition were evaluated. The largest amount of TPC released was 124.17 mg/gdm (g of dry material) after 12 h of culture, strongly and highly significantly correlated with the AA. Moisture and KH2PO4 concentration were the main influencing factors on TPC release. Treatment 6 [1x 107 spores/gdm, 30 °C, 60% moisture, mineral composition (g/L): KH2PO4, 1.52; NaNO3, 7.65; and MgSO4, 1.52] was selected due to the highest values of both TPC and AA. SSF-assisted extraction allowed increase 118 % and 93 % in TPC and AA values, respectively. Corilagin, lagerstannin, geraniin, and ellagic acid were the main phenolic compounds identified by RP-HPLC-ESI-MS in cascalote extracts. The results obtained demonstrate the feasibility of SSF-assisted extraction as a biotechnological alternative for the recovery of important bioactive molecules from this underutilized material.

ABSTRACT: Recurrent glioblastoma (rGBM) is a highly aggressive form of brain cancer that poses a significant challenge for treatment in neurooncology, and the survival status of patients after relapse usually means rapid deterioration, and also the leading cause of death among patients. In recent years, immunotherapy has emerged as a promising strategy for the treatment of recurrent glioblastoma by stimulate the body's immune system to recognize and attack cancer cells , which could be used as a in combination with other treatments such as surgery, radiation, and chemotherapy to improve outcomes for patients with recurrent glioblastoma, This therapy combines several key methods such as the use of monoclonal antibodies, chimeric antigen receptor T cell (CAR-T) therapy, checkpoint inhibitors, oncolytic viral therapy cancer vaccines, and combination strategies. In this review, we mainly document the latest immunotherapies for the treatment of glioblastoma and focus on the rGBM especially.

Eucalyptus, a therapeutic plant mentioned in the ancient Algerian pharmacopeia, specifically two species belonging to the Myrtaceae family - E. radiata and E. cinerea, were investigated in this study for their antibacterial, antioxidant, and anti-inflammatory properties. The study used aqueous extracts (AE) obtained from these plants, and the extraction yields were found to be dif-ferent. The in vitro antibacterial activity was evaluated using a disc diffusion assay against three typical bacterial strains. The results showed that E. radiata EAq was effective against all three strains, while E. cinerea EAq was only effective against E. coli. Both extracts displayed significant antioxidant activity compared to BHT. The anti-inflammatory impact was evaluated using a pro-tein (BSA) inhibition denaturation test. The E. radiata extract was found to inhibit inflammation by 75% at a concentration of 250 g/ml, significantly higher than the placebo. Ellagic acid, a pri-mary phytochemical found in the extracts, demonstrated noteworthy toxic and pharmacokinetic characteristics and a maximum binding energy of -7.53 kcal/mol for its anti-TyrRS activity in sili-co. The study suggests that the extracts and their primary phytochemicals could enhance the effi-cacy of antibiotics, antioxidants, and non-steroidal anti-inflammatory drugs (NSAIDs). As phar-maceutical engineering experts, we believe this research contributes to developing natural-based drugs with potential therapeutic benefits.

Mushrooms are unexploited treasures of secondary metabolites. Analysis of the chemical constituents of these mushrooms would be necessary for the assessment of their pharmacological and biological activities. This study aimed at profiling of mycochemical constituents of five wild mushroom extracts thereby understanding their biological and pharmacological properties. Mushrooms were collected from Arabuko-Sokoke and Kakamega National Reserved Forests, Kenya. Specimens were identified by both morphological and molecular methods. Bioactive compounds were extracted using chloroform, 70% ethanol, and hot water solvents. Chloroform, 70% ethanol, and hot water extracts of Auricularia auricula-judae, Microporus xanthopus, Termitomyces umkowaani, Trametes elegans, and Trametes versicolor were determined using gas chromatography and mass spectrometry (GC-MS). From all extracts, a total of fifty-one (51) compounds were identified and grouped into carboxylic acids, esters, phenols, fatty acids, alcohol, epoxides, aldehyde, fatty aldehyde, isoprenoid lipids, and steroid. Of the total compounds, Oleic acid (72.90%) from Trametes elegans was detected abundantly. Most of the compounds obtained from the chloroform extract of Trametes elegans and 70% ethanol extract of T. umkowaani are fatty acids. The identified compounds have revealed many biological and pharmacological activities such as antimicrobial, antioxidant, antimalarial, anti-inflammatory, insecticidal, anti-helminthic, larvicidal, vasodilator, antihypertensive, hepatoprotective, anticancer, antidiabetic, antifertility anti-diuretic, antiasthma, antifouling, anti-dermatophytic, antispasmodic, anti-hypocholesterolemic, nematicide, pesticide, immunostimulant, antiarthritic, and antihistaminic. These fatty acids are particularly playing important roles in the anti-inflammatory, hypocholesterolemic anticancer, and anti-biofilm formation activities. The presence of these bioactive components suggests that the extracts of five wild mushrooms could be good sources of secondary metabolites for drug discovery.

The use of phosphate-solubilizing fungi in coffee cultivation is an alternative with which to reduce the use of fertilizers. The objective of this study was to analyze the mechanisms involved in the phosphorus solubilization of the fungal strains and to evaluate the effect of a phosphate-solubilizing strain on the coffee plants. For this, phosphorus-solubilizing fungal strains were selected for evaluation of their solubilization potential and phosphatase activity. Coffee plants were inoculated in the field with a phosphate solubilizing strain, and soil and foliar soluble phosphorus, as well as coffee bean yield, were quantified. Of the 151 strains analyzed, Aspergillus niger, Penicillium waksmanii, and Penicillium brevicompactum showed the highest solubilization. Aspergillus niger and P. waksmanii presented the highest soluble phosphorus values; however, P. brevicompactum showed the highest phosphatase activity. The P. brevicompactum strain inoculated on the coffee plants did not favor foliar phosphorus content but increased the soil soluble phosphorus content in two of the coffee plantations. The plants inoculated with the phosphate solubilizing strain showed an increase in coffee bean weight on all plantations, although this increase was only significant in two of the three selected coffee plantations.

Pathological aseptic calcification is the most common form of structural valvular degeneration (SVD), leading to premature failure of heart valve bioprostheses (BHVs). The processing methods used to obtain GA-fixed pericardium-based biomaterials determine the hemodynamic characteristics and durability of BHVs. This article presents a comparative study of the effects of several processing methods on the degree of damage to the ECM of GA-fixed pericardium-based biomaterials as well as on their biostability, biocompatibility, and resistance to calcification. Based on the assumption that preservation of the native ECM structure will enable the creation of calcinosis-resistant materials, this study provides a soft biomimetic approach for the manufacture of GA-fixed biomaterials using gentle decellularization and washing methods. It has been shown that the use of soft methods for preimplantation processing of materials, ensuring maximum preservation of the intactness of the pericardial ECM, radically increases the resistance of biomaterials to calcification. The data obtained are of interest for the development of new calcinosis-resistant biomaterials for the manufacture of BHVs.

Pregnancy associated plasma protein-A (PAPP-A) plays an integral role in breast cancer (BC), especially triple negative breast cancer (TNBC). This subtype accounts for the most aggressive BC, possesses high tumor heterogeneity, is least responsive to standard treatments and has the poorest clinical outcomes. There is a critical need to address the lack of effective targeted therapeutic options available. PAPP-A is a protein that is highly elevated during pregnancy. Frequently, higher PAPP-A expression is detected in tumors than in healthy tissues. The increase in expression coincides with increased rates of aggressive cancers. In BC, PAPP-A has been demonstrated to play a role in tumor initiation, progression, metastasis including epithelial-mesenchymal transition (EMT), as well as acting as a biomarker for predicting patient outcomes. In this review, we present the role of PAPP-A, with specific focus on TNBC. The structure and function of PAPP-A, belonging to the pappalysin subfamily, and its proteolytic activity are assessed. We highlight the link of BC and PAPP-A with respect to the IGFBP/IGF axis, EMT, the window of susceptibility and the impact of pregnancy. Importantly, the relevance of PAPP-A as a TNBC clinical marker is reviewed and its influence on immune-related pathways are explored. The relationship and mechanisms involving PAPP-A reveal the potential for more treatment options that can lead to successful immunotherapeutic targets and the ability to assist with better predicting clinical outcomes in TNBC.

In light of the recent pandemic, several COVID-19 vaccines were developed, tested and approved in a very short time, a process that otherwise takes many years. Above all, these efforts have also unmistakably revealed the capacity limits and potential for improvement in vaccine production. This review aims to emphasize recent approaches for targeted rapid adaptation and production of vaccines from an interdisciplinary multifaceted perspective. Using literature research, stakeholder analysis and a value proposition canvas, we reviewed technological innovations on the pharmacological level, formulation, validation and resilient vaccine production to supply bottlenecks and logistic networks. We identified four main drivers to accelerate the vaccine product life cycle: computerized candidate screening, modular production, digitized quality management and a resilient business model with corresponding transparent supply chains. In summary, the results presented here can serve as a guide and implementation tool for flexible, scalable vaccine production to respond swiftly to pandemic situations in the future.

Apple snails of the genus Pomacea (Mollusca: Caenogastropoda: Ampullariidae) are native to the Neotropics and exhibit high species diversity. They hold cultural and ecological significance, serving as an important protein source in Peru. However, this genus has also received broad interest worldwide due to its invasive capacity, especially in Southeast Asia, where some species such as Pomacea canaliculata (Lamarck, 1822) and P. maculata Perry, 1810 are considered significant pests. Consequently, most genetic studies have focused almost exclusively on these invasive species. In contrast, few efforts have been made to understand the evolutionary relationships of the South American native species, especially at the genomic level. In this study, we assembled and annotated the mitochondrial genome of two Pomacea species native to the Peruvian Amazon: Pomacea reevei Ampuero &amp; Ramírez, 2023 and P. aulanieri (Deville &amp; Huppé, 1850). Through a comprehensive comparison with available mitogenomes on NCBI, we found that the length and organization of these mitogenomes fall within the range of what is currently known in Pomacea. Comparisons between these mitogenomes with those previously published revealed differences in the overlapping of adjacent genes, the size of certain protein-coding genes (PCGs) and the secondary structure of some tRNAs which are consistent with the phylogenetic relationships between these species. These findings provide valuable insights into the systematics and genomics of the genus Pomacea.