Version 1
: Received: 10 August 2023 / Approved: 11 August 2023 / Online: 11 August 2023 (12:06:04 CEST)
Version 2
: Received: 25 August 2023 / Approved: 25 August 2023 / Online: 29 August 2023 (08:48:24 CEST)
How to cite:
WU, J.; ZHU, J.; DYNKA, A.; CHANG, J.; Zhang, X.; JIANG, J.; LU, G. Construction and application of CRISPR-mediated TBCK-Knockout system in multiple human and mouse cell models. Preprints2023, 2023080943. https://doi.org/10.20944/preprints202308.0943.v2
WU, J.; ZHU, J.; DYNKA, A.; CHANG, J.; Zhang, X.; JIANG, J.; LU, G. Construction and application of CRISPR-mediated TBCK-Knockout system in multiple human and mouse cell models. Preprints 2023, 2023080943. https://doi.org/10.20944/preprints202308.0943.v2
WU, J.; ZHU, J.; DYNKA, A.; CHANG, J.; Zhang, X.; JIANG, J.; LU, G. Construction and application of CRISPR-mediated TBCK-Knockout system in multiple human and mouse cell models. Preprints2023, 2023080943. https://doi.org/10.20944/preprints202308.0943.v2
APA Style
WU, J., ZHU, J., DYNKA, A., CHANG, J., Zhang, X., JIANG, J., & LU, G. (2023). Construction and application of CRISPR-mediated TBCK-Knockout system in multiple human and mouse cell models. Preprints. https://doi.org/10.20944/preprints202308.0943.v2
Chicago/Turabian Style
WU, J., JUN JIANG and GUANTING LU. 2023 "Construction and application of CRISPR-mediated TBCK-Knockout system in multiple human and mouse cell models" Preprints. https://doi.org/10.20944/preprints202308.0943.v2
Abstract
Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood.
Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression.
Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression.
Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.
Keywords
TBCK, CRISPR-Cas9, MIA PaCa-2, HT1080, transcriptome analysis, cancer-related pathways
Subject
Biology and Life Sciences, Biology and Biotechnology
Copyright:
This is an open access article distributed under the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
