The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

Tightly regulated and robust mitochondrial activities are critical for normal hearing. Previously, we demonstrated that Fus1 KO mice with mitochondrial dysfunction exhibit premature hearing loss. Molecular analysis of the cochlea revealed hyperactivation of the mTOR pathway, oxidative stress, altered mitochondrial morphology and quantity, suggesting compromised energy sensing and production. Here, we investigated whether pharmacological modulation of metabolic pathways using rapamycin (RAPA) or 2-deoxy-D-glucose (2-DG) supplementation can protect against hearing loss in female Fus1 KO mice. Additionally, we aimed to identify mitochondria- and Fus1-dependent molecular pathways and processes critical for hearing. We found that inhibiting mTOR or activating alternative mitochondrial energetic pathways to glycolysis protected hearing in the mice. Comparative gene expression analysis revealed dysregulation of critical biological processes in the KO cochlea, including mitochondrial metabolism, neural and immune responses, and cochlear hypothalamic–pituitary–adrenal axis signaling system. RAPA and 2-DG mostly normalized these processes, although some genes showed a drug-specific response or no response at all. Interestingly, both drugs resulted in a pronounced upregulation of critical hearing-related genes not altered in the non-treated KO cochlea, including cytoskeletal and motor proteins, and Ca2+-linked transporters and voltage-gated channels. These findings suggest that pharmacological modulation of mitochondrial metabolism and bioenergetics may restore and activate processes critical for hearing, thereby protecting against hearing loss

The multidrug-resistant fungal pathogens belonging to the Candida haemulonii complex and the phylogenetically related species Candida auris are well-known for causing infections that are difficult to treat due to their multidrug-resistance profile. C. auris is even more worrisome due to its ability to cause outbreaks in healthcare settings. These emerging yeasts produce a wide range of virulence factors that facilitate the development of the infectious process. In recent years, the aggregative phenotype has been receiving attention, as it is mainly associated with defects in cellular division and its possible involvement in helping the fungus to escape from host immune responses. In this study, we initially investigated the aggregation ability of 18 clinical isolates belonging to the C. haemulonii species complex and C. auris. Subsequently, we evaluated the effects of physicochemical factors on the fungal aggregation competence. The results demonstrated that cell aggregation was a typically time-dependent event, in which almost all studied fungal isolates exhibited high aggregation after 2 h of incubation at 37°C. The aggregation was not impacted by pH, temperature, -mercaptoethanol (a protein-denaturing agent) and EDTA (a chelator agent). Conversely, proteinase K, trypsin and sodium dodecyl sulfate significantly diminished the aggregation. Collectively, our results demonstrated that the aggregation ability in these opportunistic yeast pathogens is time-dependent, and surface proteins and hydrophobic interactions seem to mediate cell aggregation, since the presence of proteases and anionic detergent affected the aggregation ability. However, further studies are necessary to better elucidate this phenomenon.

Oxidative stress (OS) is involved in the pathogenesis of retinal neurodegenerative diseases like age-related macular degeneration (AMD) and diabetic retinopathy (DR) and an important target of therapeutic treatments. New therapeutics are tested in vivo despite limits in transferability and ethical concerns. Retina cultures using human tissue can deliver critical information and significantly reduce the number of animal experiments along with increased transferability. We cultured up to 32 retina samples derived from one eye, analyzed models’ quality, induced OS, and tested efficiency of antioxidative therapeutics. Bovine, porcine, rat, and human retinae were cultured in different experimental settings for 3-14 d. OS was induced by high-glucose or hydrogen peroxide (H2O2) and treated by Scutellarin, pigment epithelium-derived factor (PEDF), and/or granulocyte macrophage-colony stimulating factor (GM-CSF). Tissue morphology, cell viability, inflammation, and glutathione level were determined. Retina samples showed only moderate necrosis (23.83±5.05 increased to 27.00±1.66 AU PI-staining over 14 d) after 14 days in culture. OS was successfully induced (reduced ATP content of 288.3±59.9 vs. 435.7±166.8 nM ATP in controls); antioxidants reduced OS-induced apoptosis (from 124.20±51.09 to 60.80±319.66 cells/image after scutellarin-treatment). Enhanced mammalian animal and human retina cultures allow reliable, highly transferable research on OS-triggered age-related diseases and pre-clinical testing during drug development.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

After three years of the onset of the pandemic, there is scarce evidence about how COVID-19 disease affect the female reproductive system, and consequently, the menstrual cycle. Since the common causes of secondary amenorrhea are considered as exclusion criteria in the studies about menstrual changes following SARS-CoV-2 infection, the prevalence of this event and the influencing factors in formerly menstruating women remains unknown. A retrospective observational cross-sectional study was conducted on Spanish adult women (N= 17,512), using an online survey; a subpopulation of SARS-CoV-2-infected-formerly menstruating women was included in the present analysis (n= 72). Collected data included general characteristics, medical history, and specific information about COVID-19 disease. 38.9% of the respondents experienced menstrual-related disturbances after suffering from the COVID-19 disease, unexpected vaginal bleeding being the most common (20.8%). Other alterations related with the length – “shorter” by 12.5% − and the flow − “heavier than usual” 30.3% − of the menstrual bleeding were reported. The binary logistic regression showed that being a perimenopausal woman (AOR 4.608, CI 95%, 1.018 – 20.856, p = 0.047) and having heavy menstrual bleeding (AOR 4.857, CI 95%, 1.239 – 19.031, p=0.023) are influential factors. This evidence could help health professionals to provide scientifically up-to-date information to their patients, empowering them to actively manage their reproductive health, especially in those societies where menstrual health is still a taboo.

The genus Clostridium is an important group of pathogenic and nonpathogenic Gram-positive anaerobic bacteria with sporulation capacity and wide distribution in different environments, including the gastrointestinal tract of healthy and diseased animals and humans. Among the pathogenic species of the genus, Clostridium chauvoei stands out as a histotoxic agent. It causes important myonecroses such as blackleg, a disease with high lethality and mortality, especially in young cattle, and is responsible for significant losses to livestock worldwide. The pathogenic-ity of the disease is complex and has not yet been fully elucidated. The hypotheses cover pro-cesses from the initial absorption to the transport and deposition of the agent in the affected tis-sues. The virulence factors of C. chauvoei were divided into somatic and flagellar antigens and soluble antigens/toxins, which are the main antigens involved in vaccines against blackleg in Brazil and worldwide. This review provides important information on the first and current ap-proaches to the agent C. chauvoei and its virulence factors, as well as provides a compilation of data on Brazilian studies related to blackleg.

Age-related macular degeneration (AMD) is an eye disease and the most common cause of vision loss in the Western World. In its advanced stage, AMD occurs in two clinically distinguished forms: dry and wet, but only wet AMD is treatable. However, the treatment based on repeated injections with vascular endothelial growth factor A (VEGFA) antagonists may at best stop the disease progression and prevent or delay vision loss but without an improvement of visual dysfunction. Moreover, it is a serious mental and financial burden for patients and may be linked with some complications. The recent first success of intravitreal gene therapy with ADVM-022, which transformed retinal cells to continuous production of aflibercept, a VEGF antagonist, after a single injection, has opened a revolutionary perspective in wet AMD treatment. Promising results obtained so far in other ongoing clinical trials support this perspective. In this narrative/hypothesis review, we present basic information on wet AMD pathogenesis and treatment, the idea of gene therapy in retinal diseases, update evidence on completed and ongoing clinical trials with gene therapy for wet AMD, and perspectives on the road to the clinic of “one and done” therapy for wet AMD to replace a lifetime of injections. Gene editing targeting the VEGFA gene is also presented as another gene therapy strategy to improve wet AMD management.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

A new treatment option for cluster headache (CH) prevention is needed. Monoclonal antibodies (mABs) against calcitonin gene-related peptide (CGRP) ligands are used as a preventative treatment for migraine. Considering the CGRP’s role in the CH attack’s ignition and upkeep, fremanezumab and galcanezumab have been evaluated for CH preventative treatment. However, only high-dose (300 mg) galcanezumab was proven for episodic CH prevention. We herein report 3 cases of migraine and comorbid CH with previous failures of preventive treatments. The 2 cases were treated with fremanezumab and the one with non-high-dose galcanezumab. All 3 cases showed good results not only on migraine but also on CH attacks. Our report suggested the efficacy of CGRP-mABs for CH prevention. Our cases differed from the cases in the phase 3 trials of CGRP-mABs for CH prevention in the following 2 points. First, the patients had both migraine and comorbid CH. Second, the combined use of CGRP-mABs with preventative drugs for CH, such as verapamil and/or prednisolone, was performed. Future accumulation of real-world data may prove the efficacy of CGRP-mABs for CH prevention.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Mycobacterium tuberculosis (Mtb) the causative agent of human tuberculosis (TB) is one of the most successfully adapted-human pathogens. Human-to-human transmission occurs at high rates through aerosols containing bacteria, but the pathogen evolved prior to the establishment of crowded populations. Mtb has developed a particular strategy to ensure persistence in the host until an opportunity for transmission arise. It has refined its lifestyle to obviate the need for virulence factors such as capsules, flagella, pilli, or toxins to circumvent mucosal barriers. Instead, the pathogen uses host macrophages, where it establishes intracellular niches, for its migration into the lung parenchyma and other tissues and for the induction of long-lived latency in granulomas. Finally, at the end of the infection cycle Mtb induces necrotic cell death of macrophages to escape to extracellular milieu and instructs a strong inflammatory response required for progression from latency to disease and transmission. Common to all these events is ESAT-6, one of the major virulence factors secreted by the pathogen. This review highlights the recent advances in understanding the role of ESAT-6 in hijacking macrophage function to establish a successful infection and transmission and its use as a target for the development of diagnostic tools, and vaccines.

Methicillin-resistant Staphylococcus aureus (MRSA) exerts a considerable concern in healthcare and the community. Globally MRSA strains cause numerous infections with high morbidity and mortality rates. The success of MRSA is a result of the extensive production of virulence factors. With the limited treatment options for the MRSA infection and growing resistance problem, an urgent call is needed to search for an alternative to antibiotics. One of the promising strategies is targeting the quorum sensing (QS) system, of the MRSA, by using a dendrimer loaded with kinase inhibitor peptide. This study formulates a poly-amidoamine dendrimers (PAMAM) G4 dendrimers loaded with Quorum Quencher (QQ), QQ3 peptide which is a Histidine Kinase inhibitor. The physicochemical properties of the formula were characterized using different in-vitro analysis method such as Zetasizer and transmission electron microscope (TEM). The antibacterial activity and anti-virulence effect of the formula was tested against MRSA and different mutant stains using growth assay, haemolysis assay and biofilm assay. Overall, QQ3-G4 complex showed antibacterial and anti-virulence activity and it can be a potential alternative treatment to overcome antimicrobial resistance and treat MRSA infection.

: Healthcare workers are affected by mental health issues, burnout and turnover, and this burden is even greater during epidemics and pandemics, such as COVID-19. The purpose of this research is to provide an overview of the measures introduced or supported in the institutions of Quebec’s health and social services network during the COVID-19 pandemic with the aim of protecting healthcare workers’ mental health. An online questionnaire survey was administered in 2021 among human resources department personnel in health and social services network institutions involved in workplace mental health in Quebec. A total of 223 key informants representing 31 of the 34 public health and social services institutions in the province of Quebec in Canada responded to the questionnaire. Measures that focus on the needs of staff, involve all levels of authority and the ones that provide flexibility, support and recognition at work were more successful, according to the advisors surveyed. Future research into whether the same measures are considered effective or ineffective outside of a pandemic context is needed.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P<.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

Legionella is an opportunistic pathogen with a biphasic life cycle and humans are occasional hosts of Legionella. The aim of the study was to assess the distribution of virulence genes and genetic diversity among L. pneumophila isolated from water-supply systems of residential buildings in Latvia. In total, 492 water samples from 200 residential buildings were collected. Identification of Legionella spp. was performed according to ISO 11731 and 58 isolates were subjected to whole genome sequencing. At least one Legionella positive sample was found in 112 out of 200 apartment buildings (56.0%). The study revealed extensive sequence type diversity where 58 L. pneumophila isolates fell into 36 different sequence types. A total of 420 virulence genes were identified of which 260 genes were found in all sequenced L. pneumophila isolates. Virulence genes enhC, htpB, omp28, and mip were detected in all isolates, suggesting that adhesion, at-tachment, and entry into host cells are enabled for all isolates. The relative frequency of viru-lence genes among L. pneumophila isolates was high. High prevalence, extensive genetic diver-sity, and the wide range of virulence genes indicated that the virulence potential of environ-mental Legionella is high and proper risk management is of key importance to public health.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Objectives: We aimed to clarify the endoscopic and clinicopathological features of raspberry-shaped gastric lesions (RSGLs) and to establish an endoscopic diagnostic algorithm for RSGLs. Methods: We collected RSGLs from an endoscopic database at our hospital between May 2009 and August 2021. All RSGLs were histopathologically classified and compared based on their endoscopic and clinicopathological characteristics. Results: Sixty-five RSGLs in 54 patients were classified into five histopathological types: gastric adenocarcinoma of foveolar type (GA-FV, n = 43), gastric adenocarcinoma of fundic-gland type (GA-FG, n = 2), gastric adenocarcinoma of fundic-gland mucosa type (GA-FGM, n = 4), hyperplastic polyp (HP, n = 12), and proton pump inhibitor-related lesion (PPI-L, n = 4). All RSGLs exhibited polygonal or curved marginal crypt epithelium (MCE). GA-FV lesions had homogenously reddish (95%) and irregular microvascular (MV) pattern (91%). GA-FG lesions were heterogeneously reddish with a submucosal tumor shape (100%) and had a regular MV pattern (50%). GA-FGM lesions were homogenously reddish (75%) and occasionally had a submucosal tumor shape (50%) with an irregular MV pattern (75%). HP and PPI-L were homogeneously reddish (93%), with linear or dotted MCE (81%) and a regular MV pattern (100%). Conclusion: Our diagnostic algorithm for RSGLs constructed using endoscopic features might be useful for the endoscopic differential diagnosis of RSGLs.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

Of late, the focus has been shifted towards quorum sensing inhibitors which reduce bacterial virulence and lower the probability of resistance and refining infections. In this work, meta-bromo-thiolactone (mBTL), a potent quorum and virulence inhibitor against Staphylococcus aureus and MRSA phenotypes, was formulated in chitosan nanoparticles (ChNPs) using ionic gelation method. mBTL-loaded-ChNPs were characterized for particle size, polydispersity index, zeta potential. Morphology was visualized by Transmission Electron Microscopy (TEM), drug release profile and antibiofilm analysis using Confocal Laser Scanning Microscope (CLSM) and Scanning Electron Microscopy (SEM) were performed. Synthesized mBTL-loaded-CNPs showed homogenized nano-size particles ranging from 158+1.3 to 284+5.6 nm with spherical particles that exhibited sustainable release profile over 48 hr at 37 °C. These findings revealed successful preparation of mBTL-loaded-ChNPs, that further showed effective antibiofilm activity at MIC50 (0.5 mg/mL) where all strains displayed reduced biofilm formation compared to untreated strains. CLSM results showed a significant reduction in the number of viable cells, indicating the effectiveness of m-BTL as an antibacterial agent. SEM analysis permitted visualization of biofilm structure in relation to the spatial localization of important biofilm matrix components, the formed biofilms were clearly distinguished in the SEM images. Bacterial cells in the control group were enclosed in thick biofilms. In contrast, there was a considerable reduction in biofilm production when mBTL was present, where bacterial cells seemed less ordered and more scattered with no detectable biofilms. In conclusion, mBTL-loaded-ChNPs is a potential alternative treatment to overcome antimicrobial resistance and condensed MRSA infections.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

The main aim of the present study was to explore health professionals’ reported experiences and approaches to managing children who receive a designation of cystic fibrosis transmembrane conductance regulator-related metabolic syndrome/cystic fibrosis screen positive inconclusive diagnosis following a positive NBS result for cystic fibrosis. An online questionnaire was distributed via Qualtrics Survey Software and circulated to a purposive, international sample of health professionals involved in managing children with this designation. In total, 101 clinicians completed the online survey; 39 from the US, six from Canada and 56 from Europe (including the UK). Results indicated that while respondents reported minor deviations in practice, they were cognizant of recommendations in the updated guidance and for the most part, attempted to implement these into practice consistently internationally. Where variation was reported, the purpose of this appeared to be to enable clinicians to respond to either clinical assessments or parental anxiety in order to improve outcomes for the child and family. Further research is needed to determine if these findings are reflective of both a wider audience of clinicians and actual (rather than reported) practice.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Marek’s disease (MD) is an important neoplastic disease caused by serotype 1 Marek's disease virus (MDV-1), which results in severe economic losses worldwide. Despite vaccination practices that have controlled the MD epidemic, current increasing MD-suspected cases indicate the persistent viral infections circulating among vaccinated chicken farms in many countries. However, the lack of available information about phylogeny and molecular characterization of circulating MDV-1 field strains in Taiwan reveals a potential risk in MD outbreaks. This study investigated the genetic characteristics of 18 MDV-1 isolates obtained from 17 vaccinated chicken flocks in Taiwan between 2018 and 2020. Based on the sequences of the meq oncogene, phylogenetic analysis demonstrated that the circulating Taiwanese MDV-1 field strains were predominantly in a single cluster that showed high similarity with strains/isolates from countries of East Asian region. Because the isolated strains were obtained from CVI988/Rispens vaccinated chicken flocks and the molecular characteristics of the Meq oncoprotein showed the features like vvMDV and vv+MDV strains, the circulating Taiwanese MDV-1 field strains may have higher virulence compared with vvMDV pathotype. In conclusion, the presented data demonstrate the circulation of hypervirulent MDV-1 strains in Taiwan and highlight the importance of routine surveillance and precaution strategies in response to the emergence of enhanced virulent MDV-1.

As the world's population ages and the resulting health problems become more serious, medical and health policies in developed countries are focused on how to prevent and treat the diseases of the aging population and how to maintain their quality of life. Typical age-related diseases include deafness, cataracts, osteoarthritis, chronic obstructive pulmonary disease, diabetes mellitus, and dementia. Although the mechanisms by which these diseases develop differ, they are all caused by the accumulation of molecular and cellular damage over time. In addition, age-related diseases can cause a decline in physical and mental functions and the ability to perform activities of daily living, as well as the loss of roles in society and a sense of fulfillment in life. Therefore, there is a need for treatment and measures to accurately grasp and maintain their quality of life.

This paper is referred to a top frontline research in life science, showing that in spite of the large variation of the physiological architecture and behavioral forms of the living systems, the fundamental structure of their informational system is basically the same, allowing the body growth/development by micro to macro-structuration processes, maintaining the same informational configuration and functions like the basic unit of life – the eukaryotic cell. Starting and based on the determination of the special/specific info-operability in living structures and the role of information in structuration and their functionality, there are discussed the informational functions of the eukaryotic/prokaryotic cells, the simplest units of life and is elaborated and presented the Informational Model of the Living Structures, showing that these structures operate on the basis of two main informational systems: one of them defined as the Programmed Informational System, composed by three components, assuring respectively the info-generation, maintenance and the proliferation/reproduction, and another one defined as the Operative Informational System, necessary for the continuous communication with the environment for adaptation, consisting in four main components referred to memory, decision, sentience and info-connection/info-selection. The revealed properties are compared with the Informational System of the Human Body, as a prototype of a living system on the top of the evolutionary scale, showing/demonstrating the compatibility of structuration and functions on the entire scale, from prokaryotic/eukaryotic unit cells to multicellular organisms – plants, animals and human, by means of a continuous adaptation process, which always follows the same line of micro to macro-structuration process based on the same Info-organization and functionality. These models are new and revolutionary in the information and life sciences

Age-related Macular Degeneration (AMD) is the major cause of elders’ vision loss, early screening and treatment are the most efficient way to reduce the rate of blindness. AI-based methods based on ophthalmic images play great potential for AMD diagnosis. However, low levels of accuracy, robustness, and explainability are challenges for AI approaches applied in clinics. Thus, this study proposed a multi-type of data source fusion method and a multi-model fusion approach for AMD detection. Typical unsupervised (Hierarchical Clustering and K-Means), typical supervised (SVM, VGG-16, and ResNet) methods, and proposed methods (multi-source data fusion-based method and multi-model fusion-based approach) are compared based on Optical Coherence Tomography (OCT), Fundus Autofluorescence (FAF), regular color fundus photography (CFP) and Ultra-Wide field Fundus (UWF) images. Data preprocessing and enhancements of each type of data are discussed. A feature extraction based on unsupervised ML models, feature combination and normalization, and multi-layer perception (MLP) algorithm are involved in the proposed multi-source data fusion-based method. Supervised ML and DL models and a voting mechanism are involved in the multi-model fusion-based approach. Findings show that the proposed methods present a high performance of accuracy and robustness. A real-world UWF database is involved from Shenzhen Aier Hospital. Practical and theoretical contributions are delivered. A reference value for medical diagnosis based on multiple digital images is contributed.

Background: The link between nocturia and aging male symptoms (AMS) has not been scientifically established. This study aimed to measure the degree of severity of AMS that impact on the health-related quality-of-life (HRQoL) in adult males living with nocturia, and to determine the predictive values of nocturnal factors on AMS. Methods: It is an extended analysis of new data collected by using the Hong Kong Traditional AMS (HK-AMS) scale and Cantonese version of the Pittsburgh Sleep Quality Index (PSQI) in a recently published cross-sectional population-based survey. Results: Of the 781 respondents that have completed the set of questionnaires, 68% and 61% of men living with nocturia reported clinically significant (at moderate-to-severe levels) somato-vegetative and sexual AMS, whereas the prevalence and severity were increased with advancing nighttime voiding frequency. The nocturia-specific QoL (NQoL) score and nocturnal frequency were found to be significant predictive factors for composite, somato-vegetative and sexual AMS, in addition to age, global OSQI score, and certain metabolic diseases. Conclusions: Current findings suggested the inclusion of nocturia when measuring the male-specific HRQoL related to aging.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

This review explores the application of the conservative management model for pain to sports-related concussions (SRCs), framing concussions as a distinct form of pain syndrome with a pathophysiological foundation in central sensitization. Drawing parallels with proven pain management models, we underscore the significance of a proactive approach to concussion management. Recognizing concussions as a pain syndrome allows for the tailoring of interventions in alignment with conservative principles. This review first covers the epidemiology and controversies surrounding prolonged concussion recovery and persistent post-concussion symptoms (PPCS). Next, the pathophysiology of concussions is presented within the central sensitization framework, emphasizing the need for early intervention to mitigate the neuroplastic changes that lead to heightened pain sensitivity. Five components of the central sensitization process specific to concussion injuries are highlighted as targets for conservative interventions in the acute period: peripheral sensitization, cerebral metabolic dysfunction, neuroinflammation, glymphatic system dysfunction, and pain catastrophizing. These proactive interventions are emphasized as pivotal in accelerating concussion recovery and reducing the risk of prolonged symptoms and PPCS, in line with the philosophy of conservative management.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

Biofilm formation and lipopolysaccharide (LPS) are implicated in the pathogenesis of gastrointestinal (GI) diseases caused by Gram-negative such as Escherichia coli and Salmonella enterica serovar Typhimurium. Grape seeds, wine industry by-products, have antioxidant, antimicrobial, and anti-inflammatory activities. In the present study, the protective effect of procyanidin-rich grape seed extract (prGSE), from unfermented pomace of Vitis vinifera cv Bellone, on bacterial LPS-induced oxidative stress and epithelial barrier integrity damages has been studied in a model of Caco-2 cells. The in vitro activity of prGSE against formation of biofilm of S. Typhimurium and E. coli, has been investigated. In vivo, prGSE activity using infected Galleria mellonella larvae has been evaluated. The results showed that the prGSE, if administered with LPS, can significantly reduce the LPS-induced permeability alteration. Moreover, the ability of the extract to prevent Reactive Oxygen Species (ROS) production induced by LPS treatment of Caco-2 cells has been demonstrated. prGSE inhibited the biofilm formation of E. coli and S. Typhimurium. In in vivo activity, increased survival of infected G. mellonella larvae after treatment with prGSE has been demonstrated. In conclusion, grape seed extracts could be used in the reduction of GI damage caused by bacterial endotoxin and biofilm of Gram-negative bacteria.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

Introduction: The primary objective of researchers in the biology of ageing is to gain a comprehensive understanding of the ageing process while developing practical solutions that can enhance the quality of life for older individuals. This involves a continuous effort to bridge the gap between fundamental biological research and its real-world applications. Purpose: In this narrative review, we attempt to link research findings concerning the hormetic relationship between neurons and germ cells, and translate these findings into clinically relevant concepts. Methods: We conducted a literature search using PubMed, Embase, PLOS, Digital Commons Network, Google Scholar and Cochrane Library from 2000 to 2023, analyzing studies dealing with the relationship between hormetic, cognitive, and reproductive aspects of human ageing. Results: The process of hormesis serves as a bridge between the biology of neuron-germ cell interactions on one hand, and the clinical relevance of these interactions on the other. Details concerning these processes are discussed here, emphasizing new research which strengthens the overall concept. Conclusions: This review presents a scientifically and clinically relevant argument, claiming that maintaining a cognitively active lifestyle may decrease age-related degeneration, and improve overall health in ageing.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Prediabetes, a pivotal phase in glucose metabolism between normalcy and diabetes, exerts a profound influence on the aging process and the risk of age-related diseases. This comprehensive review delves into the intricate web of blood-based biomarkers that collectively expedite senescence, marking the transition from a state of health to age-related complications. Key findings underscore the significance of diverse biomarkers, such as telomere length, p16INK4a, senescence-associated secretory phenotype (SASP) factors, DNA methylation clocks, advanced glycation end products (AGEs), inflammatory and oxidative stress markers, circulating hormones, and additional factors like folate, B12, osteocalcin, and more. Not only do these biomarkers serve as indicators of senescence, but they actively fuel chronic inflammation, oxidative stress, and metabolic dysregulation, all of which contribute to accelerated aging. The implications of this understanding are profound, as prediabetes emerges as a critical period in an individual's life, influencing various physiological systems, including the vascular and neural systems, metabolic functions, hormonal regulation, and bone health. Recognizing the profound influence of prediabetes on senescence provides a foundation for personalized intervention strategies to mitigate age-related complications and promote healthy aging. Future research directions call for a more diverse array of biomarkers, in-depth exploration of their roles, and the development of tailored precision medicine strategies to ensure a holistic understanding and effective management of prediabetes-induced senescence and its implications for aging. This knowledge has far-reaching implications for public health and clinical practice, emphasizing the need for early detection and intervention in prediabetic individuals to enhance the quality of life in an aging population with diverse needs.

This study investigated the impact of seven-strain probiotic supplementation on the frequency of T helper 17 (Th17) cells, regulatory T (T-reg) cells, Treg/Th17 ratio, and their gene expression in individuals with severe traumatic brain injury (STBI). Probiotics can influence the gut microbiota, modulate the immune response, and prevent or alleviate certain immune diseases. However, it is necessary to clarify whether probiotics can effectively impact Th cells in STBI patient. Despite the great attention to improving the immune system in most diseases, there is currently no accurate mechanism for the use of probiotics in diseases with damage to the head injury, which can be a basis for the use of probiotics. The primary objective of this study is to address this research gap. The present study was a randomized, double-blind, placebo-controlled trial that enrolled 48 STBI patients. They were treated with probiotics or placebo: 4 capsule/day for 14 days. The pre- and post-study evaluation included examining the frequency of Treg, Th17 cells, as well as the expression of associated immunological parameters (Foxp3 and RORγt) and Treg/Th17 ratio in both groups. No significant differences were found between the two groups in terms of subject characteristics (P>0.05). GCS scores at 14 days were significantly higher in the probiotic compared to the placebo group. The probiotic group showed a significant decrease in Th17 cell and RORγt gene expression (P = 0.022 and P< 0.001, respectively), a notable increase in T-reg and FoxP3 gene expression (P= 0.025 and P< 0.001, respectively), and a higher Treg/Th17 ratio compared to the placebo group. Our study provides promising evidence of the beneficial effects of seven-strain probiotic supplementation on Th cells in individuals with STBI.

The COVID-19-medical emergency has ended worldwide, yet there is still a need to evaluate the psychological impact of these years of unprecedented changes on students’ life. Methods: This study aims to assess and compare COVID-19-related stressors (Relationships-and-Academic-Life; Isolation; Fear-of-Contagion) and psychophysical symptoms reported by university students in April-2020, April 2021, and April 2022. The predictive role of COVID-19-related stressors on psychophysical symptoms within each time was also tested. Data were collected among 637 university students in April-2020 (n = 197), April-2021 (n = 200), April-2022 (n = 240). Results: In April-2022, perceived Isolation and Fear-of-Contagion decreased from the peak registered in April-2021, but stress related to Relationships-and-Academic-Life remained noteworthy high. A sharp and ongoing increase in psychophysical symptoms was found, with more than 50% of students reporting clinical levels of Sleep-Disorders, Depression, Psychoticism, and Interpersonal-Sensitivity. In April-2022, students still perceiving stress related to Relationships-and-Academic-Life and Isolation were at risk for Anxiety, Somatization, and Sleep-Disorders, while those still perceiving stress related to Fear-of-Contagion were also at risk for Depression, Obsessive-Compulsive, and Psychoticism. Conclusion: Findings emphasized the long-lasting detrimental effects of the COVID-19-related stress. Interventions must pinpoint the complex post-pandemic adjustment process and their effects on university students' psychophysical health.

Healthcare workers' stress, burnout, and job dissatisfaction were exacerbated by the Covid-19 pandemic, whose mid-term negative effects are still present. The aim of this study was to investigate in healthcare workers the effect of the dimensions of burnout (Psychophysical exhaustion, Relational deterioration, and Professional inefficacy) on Career satisfaction. These relationships were evaluated by considering the direct and mediated effects of Disillusion. For these purposes, the Link Burnout Questionnaire (LBQ) and the Career Satisfaction Scale (Occupational Stress Indicator - OSI) were administered to 295 healthcare professionals working at three Italian public hospitals in Cagliari, Italy. The analyses were conducted using the Partial Least Square Structural Equation Model (PLS-SEM) method. Findings highlight that healthcare workers were in a condition of work distress, high risk of burnout, and career dissatisfaction. Also recognized was the direct negative effect of burnout dimensions on career satisfaction. Finally, the mediated negative effect of Disillusion in the relationship between burnout and career satisfaction was identified. This study emphasizes the relevance of the dimension of Disillusion, and its “bright side” Fulfilment, in healthcare workers, specifically referring to the disregarded relationship between burnout and career satisfaction.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

Lower limb exoskeletons have the potential to reduce the prevalence of work-related musculoskeletal disorders; however, they often lack user-oriented control strategies. Human-in-the-loop (HITL) controls can adapt an exoskeleton’s assistance in real-time, to optimize the user-exoskeleton interaction. This study presents a HITL control for a knee exoskeleton to minimize the users’ physical effort, a parameter innovatively evaluated by their interaction torque with the exoskeleton (a muscular effort indicator) and metabolic cost. This work innovates by estimating the user’s metabolic cost within the HITL control through a machine-learning model. The regression model was able to estimate the metabolic cost, in real-time, with a root-mean-squared error of 0.66 W/kg and a mean absolute percentage error of 26%, making faster (10s) and less noisy estimations than a respirometer (K5, Cosmed) device. The HITL reduced the user’s metabolic cost and interaction torque by 7.3% and 32.3%, respectively, when compared to a zero-torque control. The developed HITL control surpassed both a non-exoskeleton and a zero-torque condition regarding the user’s physical effort, even for a simple task such as slow walking. Furthermore, the user-specific control enabled a lower metabolic cost than the non-user-specific assistance. This proof-of-concept demonstrated the potential for HITL controls in assisted working.

Previous research on video game player aggression has focused on violent content, while recent studies have examined competitive factors. Few research has examined the solely impacts of competitive factors in video games without violent content on aggression, and it is still unknown what neurological processes of these effects. The present study is the first to examine the the electrophysiological characteristics of short-term competitive video game exposure and aggression. Thirty-five participants played a video game in either competitive or solo mode for 15 minutes, followed by an ERP experiment based on the Oddball paradigm and the hot sauce paradigm to measure aggressive behavior. Results showed that playing competitive game mode was associated with faster judgment to aggressive words, larger P300 amplitudes, and selection of more chili powder. The P300 amplitude partially mediated the relationship between competitive game exposure and aggressive behavior. These findings support the general aggression model.

Age-related diseases place an intense and growing stress on healthcare systems. Numerous theories of ageing exist. Yet prediction, prevention and treatment limitations of age-related disease persist because we lack a complete aetiological understanding of their origins. Here we propose a new theory that aims to provide a blueprint-type understanding of ageing and disease aetiology, working across multiple scientific disciplines. Supported by specific examples, we demonstrate that the primary driver of much of age-related diseases is the futile triggering of specific molecular pathways in a pathological manner, which we term patho-pathways. Patho-pathways induce pathological cell, tissue and system changes in the form of hyperactivity (undesirable increased and new biological activities that are typical of age related disease). As part of patho-pathways, all wild-type (normal) genes have the potential to contribute to age-related diseases (though specific risk varies and can be formularised). In a domino-style effect, one patho-pathway typically triggers others, resulting in complex, but traceable, cascades. Utility, in terms of changing clinical and scientific practice, is derived from mapping these cascades to create Blueprint Maps that allow identification of biomarkers and therapeutic targets far upstream in the causal chain of events. Finally, our theory provides testable hypotheses concerning predictions of links between otherwise seemingly disparate diseases as well as new interventions into ageing.

Helicobacter pylori is a gastric oncopathogen that infects over half of the world’s human population. It is a Gram-negative, microaerophilic, helix-shaped bacterium that is equipped with flagella, which provide high motility. Colonization of the stomach is asymptomatic in up to 90% of people but is a recognized risk factor for developing various gastric disorders such as gastric ulcers, gastric cancer and gastritis. Invasion of the human stomach occurs via numerous virulence factors such as CagA and VacA. Similarly, outer membrane proteins (OMPs) play an important role in H. pylori pathogenicity as a means to adapt to the epithelial environment and thereby facilitate infection. While some OMPs are porins, others are adhesins. The epithelial cell receptors SabA, BabA, AlpA, OipA, HopQ and HopZ have been extensively researched to evaluate their epidemiology, structure, role and genes. Moreover, numerous studies have been performed to seek to understand the complex relationship between these factors and gastric diseases. Associations exist between different H. pylori virulence factors, the co-expression of which appears to boost pathogenicity of the bacterium. Improved knowledge of OMPs is a major step towards combatting this global disease. Here, we provide a current overview of different H. pylori OMPs and discuss their pathogenicity, epidemiology and correlation with various gastric diseases.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

The presence of Staphylococcus aureus in six dry-cured meat-processing facilities was investigated. S. aureus was detected in 3.8% of surfaces from five facilities. Prevalence was clearly higher during processing (4.8%) than after cleaning and disinfection (1.4%). Thirty eight isolates were typified by PFGE and MLST. Eleven sequence types (STs) were defined by MLST. ST30 (32%) and ST12 (24%), were the most abundant. Enterotoxin genes were detected in 53% of isolates. The enterotoxin A gene (sea) was present in all ST30 isolates, seb in one ST1 isolate and sec in two ST45 isolates. Sixteen isolates harbored the enterotoxin gene cluster (egc) with four variations in the sequence. The toxic shock syndrome toxin gene (tst) was detected in 82% of isolates. Regarding the antimicrobial resistance, twelve strains were susceptible to all the antibiotics tested (31.6%). However, 15.8% were resistant to three or more antimicrobials, and therefore multidrug-resistant. Our results showed that, in general, efficient cleaning and disinfection procedures were applied. Nonetheless, the presence of S. aureus with virulence determinants and resistance to antimicrobials, and particularly multidrug resistant MRSA ST398 strains might represent a potential health hazard for consumers, even though the pathogen was not isolated from final products.

Influenza A (IAV) is a major human respiratory pathogen, causing illness, hospitalizations, and mortality annually worldwide. IAV is also a zoonotic pathogen with a multitude of hosts, allowing for interspecies transmission, reassortment events, and the emergence of novel pandemics, as was seen in 2009 with the emergence of a swine origin H1N1 (pdmH1N1) virus into humans, causing the first influenza pandemic of the 21st century. While the 2009 pandemic was considered to have high morbidity and low mortality, studies have linked the pdmH1N1 virus and its gene segments to increased disease in humans and animal models. Genetic components of the pdmH1N1 virus currently circulate in the swine population, reassorting with endemic swine viruses that co-circulate and occasionally spillover into humans. This is evidenced by the regular detection of variant swine IAVs in humans associated with state fairs and other intersections of humans and swine. Defining genetic changes that support species adaptation, virulence, and cross-species transmission, as well as mutations that enhance or attenuate these features will improve our understanding of influenza biology, aid in surveillance and virus risk assessment, and guide the establishment of counter measures for emerging viruses. Here, we review current understanding of determinants of specific IAV phenotypes, focusing on the fitness, transmission, and virulence determinants that have been identified in swine IAVs and/or in relation to the 2009 pdmH1N1 virus.

Whole-genome sequencing (WGS) was used for genomic characterization of 110 strains of Listeria innocua isolated from 23 cattle farms, 8 beef abattoirs, and 48 retail outlets in Gauteng province, South Africa. In silico multilocus sequence typing (MLST) was used to identify the isolates' sequence types (STs). BLAST-based analyses were used to identify antimicrobial and virulence genes. The study also linked the detection of the genes to the origin (sources and types of samples) of the L. innocua isolates. The study detected 12 STs, 13 resistance genes, and 23 virulence genes. Of the 12 STs de-tected, ST637 (26.4%), ST448 (20%), 537 (13.6%), and 1085 (12.7%) were predominant, and the frequency varied significantly (P<0.05). All 110 isolates of L. innocua were car-riers of one or more antimicrobial resistance genes, with resistance genes lin (100%), fosX (100%), and tet(M) (30%) being the most frequently detected (P<0.05). Of the 23 virulence genes recognized, 13 (clpC, clpE, clpP, hbp1.svpA, hbp2, iap/cwhA, lap, lpeA, lplA1, lspA, oatA, pdgA, and prsA2) were found in all 110 isolates of L. innocua. Overall, diversity and significant differences were detected in the frequencies of STs, resistance, and virulence genes according to the origins (source and sample type) of the L. innocua isolates. This, being the first genomic characterization of L. innocua recovered from the three levels (farm, abattoir, and retail outlets) of the beef production system in South Africa, provides data on the organism's distribution and potential food safety implications..

Migraine is a debilitating neurovascular disorder characterized by recurrent headache attacks of moderate to severe intensity. Calcitonin gene-related peptide (GGRP), which is abundantly expressed in trigeminal ganglion (TG) neurons, plays a crucial role in migraine pathogenesis. Cortical spreading depolarization (CSD), the biological correlate of migraine aura, activates the trigeminovascular system. In the present study, we investigated CGRP mRNA expression in TG neurons in a CSD-based mouse migraine model. Our in situ hybridization analysis showed that CGRP mRNA expression was observed in smaller neuronal populations. CSD did not significantly change the density of CGRP mRNA-synthesizing neurons in the ipsilateral TG. However, the cell sizes of CGRP mRNA-synthesizing TG neurons were significantly larger in the 48 h and 72 h post-CSD groups than in the control group. The proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters less than 14 μm became significantly less at several time points after CSD. In contrast, we found significantly greater proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters of 14–18 μm at 24 h, 48, and 72 h post-CSD. We deduce that the CSD-induced upward cell size shift in CGRP mRNA-synthesizing TG neurons might be causative of greater disease activity and/or less responsiveness to CGRP-based therapy.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

Multiple myeloma (MM) accounts for about 10 to 15% of all diagnosed hematologic malignancies and about 1-2% of all cancer cases. Approximately 80-90% of MM patients develop bone disease and the changes rarely regress. It is only possible to stop or slow their progression. A major role in bone destruction in MM is attributed to the Wnt signaling pathway, and its action can be modified by various types of interventions including training and diet. Therefore, the aim of this project was to evaluate the effects of a Nordic Walking (NW) training cycle and intermittent fasting (IF) on the levels of selected bone turnover markers associated with the Wnt pathway in patients with MM. Results from 35 patients divided into training (NW and IF NW) and non-training (IF and control) groups were included in the analysis. A 6-week training cycle involving 60-minute workouts 3 times a week was conducted. Body mass and composition and the levels of: vitamin D, calcium and phosphorus, beta2-microglobulin and albumin were examined before and after completion of training cycle. Markers of bone turnover were also determined: sclerostin (SOST), Dickkopf-related protein 1 (DKK-1), osteoprotegrin (OPG), osteopontin (OPN) and Tartrate-resistant acid phos-phatase 5b (TRACP 5b). There was no negative effect of IF or combined training and fasting on the nutritional status of the patients (the level of albumines was unchanged). Both training groups showed an increase in serum concentrations of the active metabolite of vitamin D (IF NW and NW: p=0.001 and p=0.022, re-spectively). The change in the concentration of this vitamin negatively correlated with the con-centration of TRACP 5b (r=-0.413, p=0.014). Evaluating the concentrations of markers related to bone turnover, a reduction in the concentrations of SOST (time: p=0.026, time vs. group: p=0.033) and TRACP 5b (time: p

The large American liver fluke (Fascioloides magna) is considered an invasive trematode parasite in Europe. Its origin dates back before the Cretaceous-Paleogene Mass Extinction, after which it survived at least three population bottlenecks, and successful host switches before it arrived in Europe. The authors review the evolutionary history of F. magna, the distribution by its ancient proboscidean hosts and the probable drivers of switch to the white-tailed deer (Odocoileus virginianus). The review collects knowledge on the biology of intermediate hosts, which help understand the factors that influence the epidemiology of F. magna in aquatic ecosystems. The authors demonstrate the adaptation potential of the parasite by data from both the North American and the European endemics. Finally, the study calls attention to the epidemiological risk of human induced global change, with a special interest to the invasive snail species, Pseudosuccinea columella.

Leishmania spp. is the aetiologic agent of leishmaniasis, a disease endemic in several developing countries. The parasite expresses and secretes several virulence factors that subvert macrophage function and immune response. Extracellular vesicles (EVs) can carry molecules of the parasites that show immunomodulatory effects on macrophage activation and disease progression. In the present work, we detected a significantly higher expression of lpg3 and gp63 genes in Leishmania amazonensis promastigotes recovered after successive experimental infections (IVD-P) compared to those cultured for a long period (LT-P). In addition, we observed a significantly higher percentage of infection and internalized parasites in groups of macrophages infected with IVD-P. Macrophages previously treated with EVs from LT-P showed higher percentages of infection and production of inflammatory cytokines after challenge with the parasite compared to untreated ones. However, macrophages infected with parasites and treated with EVs did not reduce the parasite load. In addition, no synergistic effects were observed in infected macrophages treated with EVs and reference drugs. In conclusion, parasites cultured for a long period in vitro and recovered from animals’ infection differently affect the macrophage response. Furthermore, EVs produced by these parasites affected macrophage response in the early infection of these cells.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

The frequency of selected polymorphisms, one in each gene coding for proteins with antioxidative properties (CAT, SOD2, GPX1, NQO1) was compared between patients suffering from pain-related temporomandibular disorders (TMDp;n=85) and control subjects (CTR;n=85). According to the Oral Behaviours Checklist score participants were divided into high-frequency parafunction (HFP;n=98) and low-frequency parafunction (LFP;n=72) groups. In addition, we have investigated the association of selected polymorphisms with participants' psychological (anxiety, depression) and psychosomatic (hypervigilance, somatosensory amplification) characteristics. Polymorphisms rs1001179, rs4880, rs1050450, rs689452 were genotyped using the genomic DNA extracted from buccal mucosa swabs and real-time TaqMan genotyping assays. No differences in genotype distribution between TMDp patients and control subjects were found. Still, TMDp patients who were homozygous for minor allele A, related to the GPX1 polymorphism rs1050450 reported significantly more waking-state oral behaviours compared to GA+GG genotype carriers (score: 30 vs. 23, p=0.019). Frequency of genotype AA for rs1050450 polymorphism was higher in HFP compared to LFP participants (14.3% vs. 4.2%, p =0.030). Most important predictors of waking-state oral behaviours were depression, anxiety, AA genotype (rs1050450) and female sex. Explored genetic factors were not found to be significant risk factors for either TMDp or sleep-related oral behaviours. The association of waking-state oral behaviours with selected gene polymorphisms additionally supports previous assumptions that the daytime bruxism is more closely linked to various stress manifestations, which might also be reflected through the variability related to cellular antioxidative activity.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Listerias of the phylogenetic lineage II (PLII) are common in the European environment, and are hypovirulent. Despite this, they caused more than a third of sporadic cases of listeriosis, and multi-country foodborne outbreaks. L. monocytogenes ST37 is one of them. During the COVID-19 pandemic ST37 appeared in the clinical cases and ranked second in occurrence among food isolates in the Moscow region. The aim of this study was to describe the genomic features of ST37 isolates from different sources. All clinical cases of ST37 were in the cohort of male patients (age, 48-81 years) with meningitis-septicemia manifestation, and COVID-19 or Influenza in the anamnesis. The core genomes of the fish isolates were closely related. The clinical and meat isolates revealed a large diversity. Prophages (2-4/genome) were the source of the unique genes. Two clinical isolates displayed the pseudolysogeny, and excided prophages were A006-like. Absence of the plasmids, the assortment of virulence factors and resistance determinants in chromosome corresponded to the hypovirulent characteristics. However, all clinical isolates caused severe disease with deaths in four cases. Thus, these studies allow us to speculate that a previous viral infection increases a human susceptibility to listeriosis.

Exogenous proteases are well established for hydrolysing proteins and improving the digestibility of amino acids, which, in animal production, enhances growth performance and diet formulation flexibility. Attention has now turned to the wider, or ‘extra-proteinaceous’, benefits of proteases. Both host and (gut) microbiome utilise amino acids for diverse functions beyond just cellular growth and proliferation. For example, the host produces a diverse array of proteinaceous secretions that seek to modulate the activity of the intestinal microbiome and opportunities to interact with host (e.g., epithelial) receptors. Reciprocally, the microbiome utilises various protein-based components to perform individual lifestyle traits, such as colonising gut niches, production of virulence traits, etc., which can be influenced by protease activity and amino acid availability. In addition, microbial fermentation of proteins and amino acids produces metabolites that may be considered undesirable (e.g., toxic) for the host’s cells or, for example, can act as signalling molecules, shaping the secretion of gut hormones and function. Parallels may also exist between various antibiotic growth promoters and proteases, in that both can target/impact microbial proteins (synthesis and degradation, respectively). There are many aspects to consider, such as determining optimal intestinal levels and spectra of proteolytic activity under various scenarios, but great potential exists.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Due to the progression of antimicrobial resistance, Photodynamic (aPDT) and Sonodynamic (SDT) Therapies arose as promising approaches for microbial control. Recently, the combination of both therapies, called Sonophotodynamic Therapy (SPDT), have shown greater effects than the single treatments. This study evaluated the effects of aPDT, SDT and SPDT mediated by curcumin on the metabolism, adhesion capacity, biofilm formation ability and structural alteration in the Staphylococcus aureus biofilm. Moreover, possible antimicrobial mechanisms involved, such as the production of reactive oxygen species (ROS) and the degradation spectrum of curcumin by light, ultrasound and light+ultrasound, were measured. SPDT was more effective to inactivate the biofilm than aPDT and SDT. All treatments reduced the adhesion ability of the bacteria and it is probably related to the metabolism cell reduction. Regarding to the biofilm formation ability, all treatments reduced the total biomass. One possible mechanism involved in the inactivation is the ROS production observed. Curcumin had a significantly decay in its absorbance with the application of light, and a slighter one caused by the ultrasound. Finally, all treatments impacted the biofilm components and structure, reducing the cells and matrix. In conclusion, SPDT was more effective in the inactivation, and all treatments had the same effect in the virulence factors evaluated.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

The concept of ecosystem services (ESs) provides a valuable approach to communicate societies' dependence on natural ecosystems, assisting in the evaluation of measures to protect vegetation in watersheds that promote water-related ESs. Vegetation cover and land use are important factors related to the capacity of ecosystems to provide soil loss regulation and sediment retention services, which are highly relevant for sediment management in watersheds draining into reservoirs with multiple water uses. This study aims to assess the relationship between potential changes in land use and land cover and the sediment retention service provided by riparian vegetation in a watershed draining into a hydroelectric reservoir in the Brazilian Cerrado. Sediment load was selected as a physical variable that affects different water uses in reservoirs, with these uses being dependent on the quality or quantity of stored water. Scenarios were analyzed to represent landscape reconfigurations from a baseline condition in order to account for the recovery of riparian vegetation by the agricultural sector, as foreseen in the Brazilian Forest Code. To map and quantify variations in annual sediment retention, the InVEST model was used, which allows estimating an integrated response of the drainage basin to large-scale land use changes over time and space. The results show that for the drainage basin of the Corumbá IV Hydroelectric Power Plant (HPP), the recovery of riparian areas occupied by annual crops has the potential to generate greater benefits to water use in the reservoir. In the studied catchment area, 14% of the total vegetation deficit in riparian areas is occupied by crops, while 86% is occupied by pastures. This highlights the buffering role of riparian vegetation as an effective practice for managing sediment flows originating from sheet erosion in agricultural landscapes. The methodology employed in this study allows for the quantification and mapping of the effects of soil and water conservation measures in river basins. This enables the prioritization of sectoral efforts for the restoration of native vegetation, considering the highest returns in benefits perceived by water users affected by sediment input in reservoirs. The study's results reinforce the importance of conserving vegetation in riparian areas and their surroundings for sediment retention, highlighting the role of these areas as assets in providing water-related ecosystem services.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p &lt; 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p &lt; 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Humans are often exposed to various environmental contaminants, among which phthalates are prevalent due to their extensive use as plasticizers in various consumer goods. Di(2-ethylhexyl) phthalate (DEHP), a widely used phthalate, is recognized as an endocrine disruptor chemical (EDC). DEHP is reported to affect various organs. Few studies have addressed the effects of phthalates on bone. However, the effects of DEHP on the bone forming cells (osteoblasts) are obscure. The present study was peformed to determine the cytotoxic effects of DEHP on human osteoblasts in vitro and to delineate the mechansims. In this study, we exposed the human osteo-blastic cell line MG-63 to various concentrations of DEHP (1, 25, 50 and 100 µM) for 24, 48 and 72 h. Cell viability was assessed by MTT assay. Total RNA and protein were collected after 48 h treatment with 1 and 100 µM DEHP and determined for the mRNA and/or protein expression of alkaline phosphatase (ALP), sex steroid receptors (androgen and estrogen receptors), receptor activator of nuclear factor kappa-Β ligand (RANKL), runt-related transcription factor 2 (RUNX2) and peroxisome proliferator-activated receptor alpha (PPARα). The mRNA expression was stud-ied by real-time RT-PCR analysis and the protein expression was determined by western blot analysis. Statistical analyses were done by one-way analysis of variance (ANOVA) followed by the Students–Newman–Keuls (SNK) test. The exposure of MG-63 cells to DEHP caused a signifi-cant decrease in osteoblast viability in all the treatment groups and at all the time points stud-ied. Interestingly, DEHP exposure decreased the mRNA expression of ALP, a bone formation marker. DEHP had differential effects on estrogen receptor alpha (ERα) mRNA and protein ex-pression. However, DEHP treatment downregulated the mRNA and protein expression of ERβ, and androgen receptor (AR). Surprisingly, DEHP downregulated the RANKL mRNA expression. DEHP decreased the protein expression of RUNX2, the key transcription factor and master regu-lator of bone formation. Furthermore, DEHP increased the PPARα protein expression in the os-teoblasts. Importantly, DEHP increased the reactive oxygen species (ROS) molecules and thus oxidative stress in osteoblasts, as observed by increased hydrogen peroxide, hydroxyl radical levels and lipid peroxidation. On the other hand, it decreased the enzymatic and non-enzymatic antioxidant levels namely catalase, superoxide dismutase, glutathione peroxidase activity and reduced glutathione. Our study demonstrated that in vitro exposure to DEHP reduces the osteo-blast viability possibly through alterations in the oxidant-antioxidant system and modulation of the key genes involved in bone formation, highlighting the cytotoxic effects of DEHP on bone forming cells.

Currently, hepatitis B virus (HBV) core antibody (anti-HBc antibody) and HBV core-related antigen (HBcrAg) are widely used as serum markers for diagnosis based on the HBV core region. While anti-HBc is very significant for clinical diagnosis, the clinical significance of quantitative assay of anti-HBc antibody has been reevaluated with improvements in diagnostic performance, including its association with clinical stage and prediction of carcinogenesis and reactivation. In addition, concerning the new HBcrAg, a high-sensitivity assay method has recently been established, and its diagnostic significance, including the prediction of reactivation, is being reevaluated. On the other hand, the quantitative level of anti-HBc antibody expressed in different units among assay systems, complicating the interpretation of the results. However, it is difficult to standardize assay systems as they vary in advantages, and caution is needed in interpreting the assay results. In this review, the clinical usefulness and remaining problems of anti-HBc antibody and HBcrAg were summarized.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

Outbreaks of Anticarsia gemmatalis (Hübner, 1818) (Lepidoptera: Erebidae), a major pest of soybean, can be controlled below economic thresholds with methods that do not involve the application of synthetic insecticides. Formulations based on natural isolates of the Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV) (Baculoviridae: Alphabaculovirus), played a significant role in integrated pest management programs in the early 2000s, but a new generation of chemical insecticides and transgenic soybean, have displaced AgMNPV-based products over the past decade. However, the marked genotypic variability present among and within alphabaculovirus isolates suggests that highly insecticidal genotypic variants can be isolated and used to reduce virus production costs or overcome isolate-dependent host resistance. This study aimed to select novel variants of AgMNPV with suitable insecticidal traits that could comple-ment the existing AgMNPV active ingredients. Three distinct AgMNPV isolates were compared by restriction endonuclease profile and in terms of their occlusion body (OB) pathogenicity. One isolate was selected (AgABB51) from which eighteen genotypic variants were plaque purified and characterized in terms of their insecticidal properties. The five most pathogenic variants varied in OB pathogenicity although none of them was faster-killing or had higher OB production characteristics than the wild-type isolate. We conclude that the AgABB51 wild-type isolates ap-pear to be genotypically structured for fast speed-of-kill and high OB production, both of which would favor transmission. Interactions among the component variants are likely to influence this insecticidal phenotype.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

The relationship between pangolin-CoV and SARS-CoV-2 has been a subject of debate. Further evidence of a special relationship between the two viruses can be found by the fact that all known COVID-19 viruses have abnormally hard outer shell (low M disorder; i.e., low content of intrinsically disordered residues in the membrane (M) protein) that so far was found in CoVs associated with burrowing animals, such as rabbits and pangolins, in which transmission involves virus remaining in buried feces for a long time. While a hard outer shell is necessary for viral survival, a harder inner shell could also help. For this reason, the N disorder range of pangolin-CoVs, not bat-CoVs, more closely matches that of SARS-CoV-2 especially when Omicron is included. The low N disorder (i.e., low content of intrinsically disordered residues in the nucleocapsid (N) protein), first observed in pangolin-CoV-2017 amd later in Omicron, is associated with attenuation according to the Shell-Disorder-Model. Our experimental study revealed that pangolin-CoV-2017 and SARS-CoV-2 Omicron (XBB.1.16 subvariant) show similar attenuations with respect to viral growth and plaque formation. Subtle differences have been observed that are consistent with disorder-centric computational analysis.

Introduction: Oral candidiasis is an opportunistic fungal infection, often caused by Candida albicans. One of the virulence factors of C. albicans is sterol 14a-demethylase or CYP51. Compounds of anthocyanins (ternatin, cyanin) and flavonoids (rutin, isoquercetin, kaempferol, myricetin, limocitrin) from the extract of the Clitoria ternatea (butterfly pea) plant are believed to have potential to inhibit the CYP51 virulence factor of C. albicans to suppress oral candidiasis. The purpose of this research was to investigate the interaction between the ligands of anthocyanins and flavonoids from C. ternatea (butterfly pea) with CYP51. Methods: The in silico study applied molecular docking to examine the molecular interactions (binding affinity) between the anthocyanin and flavonoid ligands of interest from C. ternatea and the CYP51 receptor of C. albicans. Results: Predicted interactions exist between the ligands of anthocyanins (ternatin, cyanin) and flavonoids (rutin, isoquercetin, kaempferol, myricetin, limocitrin) from C. ternatea and the CYP51 receptor of C. albicans. Conclusion: C. ternatea has the potential to provide anti-fungal agents that can inhibit or slow down the occurrence of oral candidiasis, as indicated by in silico studies. However, it is important to conduct additional research regarding the properties of the plant to determine the unknown aspects of its effects to the human body.

In vineyards, Botryosphaeria dieback (BD) occurs in young and old plants. In the field, the prevalence and severity of the disease increase proportionally with the age of the vineyards. Among the pathogens that cause (BD), Diplodia seriata is the most prevalent species in Chile and other countries with a Mediterranean climate. To date, no information is available on the sus-ceptibility of adult wood to infection by this pathogen since most of the pathogenicity tests have been carried out on 1- or 2-year-old shoots or detached canes. Therefore, a pathogenicity test was carried out on plants under field conditions, with inoculations in plants, on one-year-old shoots, and 2- and 10-year-old wood in grapevine cv. Cabernet Sauvignon. A pathogenicity test was carried out with two isolates of D. seriata selected in an assay in detached canes that were 2-year-old. The results on plants showed that D. seriata was significantly more aggressive on 10-year-old than on one- or two-year-old tissue. These results were compared with the lesions ob-tained from two-year-old canes. The results of this work are consistent with the damage ob-served in the field, highlight the importance of identifying each pathogenic species that causes (BD) and contribute to the knowledge of the epidemiology of this disease in Mediterranean cli-mates.

Number of studies claim that tobacco control (TC) regulations are associated with reductions in smoking-related hospitalisation rates, however very few have estimated the impact of TC laws (TCL) at both countrywide and regional levels, and none of them - in relation to compliance with TC regulations. This study evaluates the effects of Russian TCL on hospital admission (HA) rates for pneumonia countrywide and in 10 Russian regions and the extent of these effects in connection with the compliance to TCL. Methods: HA rates for pneumonia during 2005–2019 were analysed to compare the periods before and after the adoption of TCL in 2013. An interrupted time series design and a Poisson regression model were used to estimate the immediate and long-term effects of TCL on pneumonia annual hospitalisation rates after the TCL adoption, compared with the pre-law period. The 10 Russian regions were compared using the TCL Implementation Scale (TCIS) developed on the basis of the results of Russian TC policy evaluation survey; Spearman’s rank correlation and linear regression models were employed. Results showed a 14.3% reduction in HA rates for pneumonia (RR 0.88; p=0.01) after the adoption of TCL in Russia with significant long-term effect after 2013 (RR 0.86; p=0.006). Regions with better enforcement of TCL exhibited greater reductions in pneumonia HA rates (rsp=−0.55; p=0.04); (=−4.21; p=0.02). Conclusions: TCL resulted in a sustained reduction in pneumonia hospitalisation rates, but these effects, varying by region, may depend on the scale of the TCL enforcement.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Kodamaea ohmeri is an environmental yeast considered a rare emerging pathogen. In clinical settings, the correct identification of this yeast is relevant since some isolates are associated with resistance to antifungals. There is a lack of available data regarding the geographical distribution, virulence, and drug resistance profile of K. ohmeri. To contribute to the knowledge of this yeast, this study aimed to describe in depth three isolates of K. ohmeri associated with fungemia in Honduras. The identification of the isolates was carried out by sequencing the ribosomal ITS region. In addition, the sensitivity profile to antifungals was determined, and some properties associated with virulence were evaluated (exoenzyme production, biofilm formation, cell adhesion, and invasion). The isolates showed strong protease, phospholipase, and hemolysin activity, in addition to being biofilm producers. Adherence and invasion capacity were evident in the HeLa and Raw 264.7 cell lines respectively. This study expands the understanding of the underlying biological traits associated with virulence in K. ohmeri and is the first report of the detection and identification of K. ohmeri in Honduras as a cause of human infection.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Assessment of health-related quality of life (HRQoL) after pediatric traumatic brain injury (TBI) has been limited in children and adolescents due to a lack of disease-specific instruments. To fill this gap, the Quality of Life after Traumatic Brain Injury for Children and Adolescents (QOLIBRI-KID/ADO) was developed for the German-speaking population. Reference values from a comparable general population are essential for comprehending the impact of TBI on health and well-being. This study examines the validity of the German QOLIBRI-KID/ADO in a general pediatric population in Germany and provides reference values for use in clinical practice. Overall, 1997 children and adolescents aged 8-17 years from the general population and 300 from the TBI population participated in the study. The questionnaire was tested for reliability and validity. A measurement invariance (MI) approach was used to assess the comparability of the HRQoL construct between both samples. Reference values were determined by percentile-based stratification according to factors that significantly influenced HRQoL in regression analyses. The QOLIBRI-KID/ADO demonstrated strong psychometric properties. The HRQoL construct was measured largely equivalently in both samples, and reference values could be provided. The QOLIBRI-KID/ADO was considered reliable and valid for assessing HRQoL in a general German-speaking pediatric population, allowing for clinically meaningful comparisons between general and TBI populations.

Abstract: The study used whole-genome sequencing (WGS) and bioinformatics analysis for the genomic characterization of 60 isolates of Listeria monocytogenes isolated from cattle farms, cattle abattoirs, and retail outlets in Gauteng province, South Africa. The isolates' sequence types (STs), clonal complexes (CCs), and lineages were determined using in silico multilocus sequence typing (MLST). We used BLAST-based analyses to identify virulence and antimicrobial genes, plasmids, proviruses, and the CRISPR-Cas system. The study investigated any association of the detected genes to the origin in the beef production chain of the L. monocytogenes isolates. Overall, in 60 isolates of Listeria monocytogenes, there were 7 STs, 6 CCs, 44 putative virulence factors, 2 resistance genes, 1 plasmid with AMR genes and 3 with conjugative genes, 1 CRISPR gene, and all 60 isolates were positive for proviruses. Among the 7 STs detected, ST204 (46.7%) and ST2 (21.7%) were the most prominent, with ST frequency varying significantly (p&lt;0.001). The predominant CC detected were CC2 (21.7%) and CC204 (46.7%) in lineages I and II, respectively. Of the 44 virulence factors detected, 26 (across Listeria Pathogenicity Islands, LIPIs) were present in all the isolates. The difference in the detection frequency varied significantly (P&lt;0.001). The two AMR genes (fosX and vga(G)) detected were present in all 60 (100%) isolates of L. monocytogenes. The only plasmid, NF033156, was present in 3 (5%) isolates. A CRISPR-Cas system was detected in 6 (10%), and all the isolates carried proviruses. Significant differences were detected in the frequencies of STs and virulence factors regarding the source and sample type of the L. monocytogenes isolates. The presence of both fosX and vga(G) genes in all the isolates from the three industries (cattle farms, abattoirs, and retail outlets) can potentially cause therapeutic implications. Our study, which characterized L. monocytogenes recovered from the three levels in the beef production chain in the country, provides the first evidence of the distribution of the pathogen with potential food safety and therapeutic implications.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

Shiga toxin-producing Escherichia coli (STEC) are notorious foodborne pathogens capable of causing severe diarrhea and other life-threatening complications in humans. Cattle remain a major reservoir and asymptomatic carriers of STEC. In reservoir animals, the rectoanal junction (RAJ) serves as the primary colonization site of STEC playing a critical role in its transmission to humans through contaminated food sources. However, the molecular mechanisms behind the adaptation of STEC in the RAJ of the asymptomatic reservoir host and its subsequent infection of human colonic epithelial cells in an event of a foodborne transmission to cause diarrhea remain largely unexplored. This study aimed to unravel the intricate dynamics of STEC O157:H7 serotype in these two distinct host environments: bovine RAJ cells and human colonic epithelial cells, during initial colonization. In this context, comparative transcriptomics analysis was employed to investigate the differential gene expression profiles of STEC O157:H7 during its interaction with these cell types. The bacterial cells were cultured under controlled conditions to simulate the microenvironments of both bovine RAJ and human colonic epithelial cells. Using high-throughput RNA sequencing, we identified key bacterial genes and regulatory pathways that were significantly modulated in response to each specific host environment. Our findings reveal distinct expression patterns of bacterial genes involved in virulence, including adherence, metal iron homeostasis and stress response in STEC O157:H7 grown in bovine RAJ cells as op-posed to human colonic epithelial cells six hours post-infection. Additionally, the comparative analysis highlights the potential role of certain genes in host adaptation and tissue-specific pathogenicity. Furthermore, this study sheds light on the potential factors contributing to the survival and persistence of STEC O157:H7 in the bovine reservoir, and its ability to colonize in-testinal epithelium and cause disease in humans.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

Klebsiella pneumoniae is a leading cause of healthcare acquired infections. The severity of the infections is multifactorial including virulence and antimicrobial resistance properties. The objective of the study was to investigate the virulence determinants of K. pneumoniae strains colonizing patients hospitalized in the intensive care units (ICU) of a tertiary hospital in Uganda. A hospital based cross-sectional study involving 103 patients admitted in the ICU of Mulago National Referral hospital was conducted from January 2022 to April 2022. A total of 31 identified clinical strains of K. pneumoniae isolated from rectal swabs of the same number of patients were characterized. Susceptibility testing of colistin was performed by broth microdilution method, thereafter, 5 colistin resistant K. pneumoniae were purposefully selected for whole genome sequencing. Bioinformatics analysis was performed using established web-based tools to detect virulence genes, sequence type and other genomic features. Numerous virulence factor genes related to pathogenicity of K. pneumoniae were identified. They ranged from those related to colonization to those of persistence and dissemination including capsule genes (wzi), siderophore systems; yersiniabactin (ybt15), aerobactin (iutA), enterobactin (entC, entD, entF, entS, fepB, fepD, fepG, fes), and salmochelin (iroN), secretion systems; type II (T2SS) and type VI (T6SS-1). Furthermore, the isolates harbored outer membrane protein (ompA) gene, biofilm synthesis gene (fimH) and several adhesion genes. The results demonstrate the dual-risk of K. pneumoniae strains combining high level of virulence and colistin resistance which is a great concern as it leads to unmanageable infection outbreaks with high morbidity and mortality.

Pachychoroid neovasculopathy (PNV) is a pachychoroid-spectrum disease. As blood circulation throughout the choroid may be involved in PNV pathogenesis, analysis using ultra-wide-field (UWF) fundus imaging is crucial. We evaluated choroidal thickness after half-fluence photodynamic therapy (PDT) combined with intravitreal aflibercept injection for PNV using UWF swept-source optical coherence tomography. Seventeen eyes with PNV that underwent half-fluence PDT with adjuvant single intravitreal aflibercept injection were analyzed. To compare choroidal thicknesses in the central and peripheral choroids, we set subfields <3, <9, and 9–18 mm from the fovea. The <9- and 9–18-mm subfields were divided into four quadrants. Choroidal thickness in each subfield decreased significantly after half-fluence PDT (P<0.001); this reduction was more pronounced in the central area. We also investigated the relationship between the dominant side of the deep choroidal veins that harbor choroidal vein efflux from the macula. When choroidal thickness in the supratemporal and infratemporal 9x9-mm subfields were evaluated, the ratio of choroidal thickness reduction was not significantly different between the dominant and non-dominant sides. The dominant side was not associated with the extent of choroidal thickness reduction in PNV. In conclusion, half-fluence PDT caused thinning of the entire choroid, especially in the central area, in PNV.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.