Cancer risk is known to increase tremendously when the immune system is suppressed, e.g., as observed in young organ-transplant recipients and AIDS patients. Based on such data, it may be hypothesized that the main reason for the development of clinical cancer is the weakening or suppression of the immune system, and that uncontrolled multiplication of cancer cells occurs when some aspects of the immune system fall below certain critical levels. Therefore, cancer may be prevented and treated by boosting these critical aspects of the immune system so that they are maintained above the critical levels. If multiple immune system boosting interventions are utilized, more aspects of the immune system would be boosted, increasing the likelihood of enhancing the critical aspects of the immune system and generating a cancer preventive and/or therapeutic effect. Clinical trials are needed to validate this approach for cancer prevention and treatment. If validated, the proposed approach could result in a major reduction of the death and suffering caused by cancer in the world.

Gut microbiota composition can affect tumor microenvironment and its interaction with the immune system, thereby having implications on treatment predictions. This article reviews the studies available to better understand how gut microbiomes help the immune system to fight cancer. To describe this fact, different mechanisms, and approaches of utilizing probiotics to improve advancements in cancer treatment will be discussed. Moreover, not only the calorie intake but also the variety and quality of diet can influence cancer patient’s immunotherapy treatment because dietary patterns could impair the immunological activities either by stimulating or suppressing the innate and adaptive immunity. Therefore, it is interesting and critical to understand the gut microbiome composition as a biomarker to decide cancer immunotherapy outcomes and responses. Here, more emphasis would be given to the recent development in immunotherapies utilizing microbiota to improve cancer therapies which is beneficial for cancer patients.

The innate immune system is the first line of defense against pathogens. It’s composition includes barriers, mucus and other substances as well as phagocytic and other cells. The purpose of the paper is to analyze in general grounds the immune system and the body immunity to cancer. Simple ideas and the qualitative theory of differential equations are used along with general principles such as the minimization of the pathogen load and economy of resources. In the simplest linear model, the annihilation rate of pathogens in any tissue should be greater than the pathogen’s average rate of growth. When nonlinearities are added, a reference value for the number of pathogens is set, and a stability condition emerges, which relates strength of regular threats, barrier height and annihilation rate. On the other hand, in cancer immunity, the linear model leads to an expression for the lifetime risk, which accounts for both the effects of carcinogens (endogenous or external) and the immune response. The stability condition allows a comparison of immunity in different tissues. The way the tissue responds to an infection shows a correlation with the way it responds to cancer. These statements are formulated at the qualitative level, but may and deserve to be quantitatively checked.

Autophagy is a highly conserved catabolic mechanism that mediates the degradation of damaged cellular components by inducing their fusion with lysosomes. This process provides cells with an alternative source of energy for the synthesis of new proteins and the maintenance of metabolic homeostasis in stressful environments. Numerous studies have demonstrated beneficial roles for the induction as well as the suppression of autophagy in cancer cells. Autophagy may induce either survival or death depending on the cell/tissue type. Radiation therapy is widely used therapeutic option to treat cancer, and it induces autophagy in human cancer cell line. Also, melatonin seems to affect cancer cell death via regulation of programmed cell death. In this review, we summarize the current understanding of autophagy and its regulation in cancer.

Prostate cancer is the second leading cause of death in males in America, with advanced prostate cancers exhibiting a 5-year survival rate of only 32%. Castration-resistance is often developed during the course of treatment, though its influences require further understanding. This study explores the human microbiome for its implications in castration-resistance and metastasis in prostate cancer. RNA sequencing data was downloaded for bone and soft tissue biopsies of patients with metastatic castration-resistant prostate cancer. These sequences were mapped to bacterial sequences to yield species-level abundance approximations. Numerous species were found to correlate to the expression of known markers of castration-resistance, including AR, PI3K, and AKT. Castration-resistance-associated signaling pathways were also enriched with these species, including PI3K-AKT signaling and endocrine resistance. For their implications in cancer aggression and metastasis, cancer stem cell markers were further explored for relation to these species. EGFR and SLC3A2 were widely downregulated with greater abundance of most species. Our results suggest that the microbiome is heavily associated with castration-resistance and stemness in prostate cancer. By considering the microbiome’s importance in these factors, we may better understand the highly aggressive and highly invasive nature of prostate cancer, allowing for needed improvement in the treatment of this disease.

Background: In the last years, many new treatment options have widened the therapeutic scenario of genitourinary malignancies. Immunotherapy has shown efficacy, especially in the urothelial and renal cell carcinomas, with no particular relevance in prostate cancer. However, despite the use of immune checkpoint inhibitors, there is still high morbidity and mortality among these neo-plasms. Cancer vaccines represent another way to activate the immune system. We sought to summarize the most recent advances in vaccine therapy for genitourinary malignancies with this review. Methods: We searched Pubmed, Embase and Cochrane Database for clinical trials conducted in the last ten years, focusing on cancer vaccines in the prostate, urothelial and renal cancer. Results: Various therapeutic vaccines, including DNA-based, RNA-based, peptide-based, dendritic cells, viral vectors, and modified tumor cells, have been demonstrated to induce specific immune responses in a variable percentage of patients. However, these responses rarely corresponded to significant survival improvements. Conclusions: Further pre-clinical and clinical studies will improve the knowledge about cancer vaccines in genitourinary malignancies to optimize dosage, select targets with a driver role for tumor development and growth, and finally overcome resistance mechanisms. Combination strategies represent possibly more effective and long-lasting treatments.

Pancreatic cancer represents one of the difficult problems of contemporary medicine. The development illness evolves very slowly, takes place in special sake (stroma) and manifests clinically close to a final stage. Another feature of this pathology is a coexistence (symbiotic) effect between cancer cells and normal cells inside stroma. All these aspects make it difficult to understand the pathogenesis of pancreatic cancer and develop a proper therapy. The emergence of pancreatic pre-cancer and cancer cells represents a branching stochastic process engaging populations of 64 cells differing in the number of acquired mutations. In this study we formulate and calibrate the mathematical model of pancreatic cancer using the quasispecies framework. The mathematical model incorporates the mutation matrix, fineness landscape matrix and the death rates. Each element of the mutation matrix presents the probability of appearing a specific mutation in the branching sequence of cells representing the accumulation of mutations. The model incorporates the cancer cell elimination by effect CD8 T cells (CTL). The down-regulation of the effector function of CTLs and exhaustion are parameterized. The symbiotic effect of coexistence of normal and cancer cells is considered. The computational predictions obtained with the model are consistent with empirical data. The modelling approach can be used to investigate other types of cancers and examine various treatment procedures.

Prostate cancer (PCa) is the most commonly diagnosed cancer and the second most common cause of death due to cancer. About 30% of patients with PCa who have been castrated develop a castration-resistant form of the disease (CRPC), which is incurable. In the last decade, new treatments that control the disease have emerged, slowing progression and spread, and prolonging survival while maintaining the quality of life. These include immunotherapies; however, we do not yet know the optimal combination and sequence of these therapies with the standard ones. All therapies are not always suitable for every patient due to co-morbidities or adverse effects of therapies or both, so there is an urgent need for further work on new therapeutic options. Advances in cancer immunotherapy with an immune checkpoint inhibition mechanism (e.g., ipilimumab, an anti-CTLA-4 inhibitor) have not shown a survival benefit in patients with CRPC. Other immunological approaches have also not given clear results, which has indirectly prevented breakthrough for this type of therapeutic strategy into clinical use. Currently, the only approved form of immunotherapy for patients with CRPC is a cell-based medicine, but it is only available to patients in some parts of the world. Based on the experience gained from recently completed clinical research on immunotherapy with dendritic cell-based immunohybridomas, the aHyC dendritic cell vaccine, for patients with CRPC, we highlight the current status, and possible alternatives that should be considered in the future.

Due to slow progression and susceptibility to radical forms of treatment low-grade PC is associ-ated with high overall survival (OS). With the clinical progression of PC the therapy is getting more complex. The immunosuppressive tumor microenvironment (TME) makes PC a difficult target for most immunotherapeutics. Its general immune resistance is established by i.e. immune evasion through Treg cells, synthesis of immunosuppressive mediators, and defective expression of surface neoantigens. The success of sipuleucel-T in clinical trials initiated several other clinical studies that specifically target the immune escape of the tumor and eliminate the immunosuppres-sive properties of TME. In the settings of PC treatment, this can be commonly achieved with radi-ation therapy (RT). Also, focal therapies usually applied for localized PC, such as high-intensity focused ultrasound (HIFU) therapy, cryotherapy, photodynamic therapy (PDT), or irreversible electroporation (IRE) were shown to boost anti-cancer response. Nevertheless, the present guide-lines restrict their application to localized and low-grade PC. This review explains how RT and focal therapies enhance the immune response. We also provide data supporting the combination of RT and focal treatments with immune therapies.

Like living organisms, cancer cells require energy to survive and interact with their environment. Mitochondria are the main organelles for energy production and cellular metabolism. Recently, investigators demonstrated that cancer cells can hijack mitochondria from immune cells. This behavior sheds light on a pivotal piece in the cancer puzzle, the ‘dependence’ on the normal cells. This article illustrates the benefits of new, functional mitochondria for cancer cells that urge them to hijack mitochondria. It describes how functional mitochondria help cancer cells’ survival in the harsh tumor microenvironment, immune evasion, progression, and treatment resistance. Recent evidence has put forward the pivotal role of mitochondria in cancer stem cells’ metabolism. This theory highlights the mitochondria in cancer biology and explains how targeted anti-mitochondrial treatments can improve oncological outcomes.

The Herpes Virus Entry Mediator (HVEM) delivers a negative signal to T cells mainly through the B and T Lymphocyte Attenuator (BTLA) molecule and thus, could represent a novel immune checkpoint during an anti-tumor immune response. A formal demonstration that HVEM can be targeted for cancer immunotherapy is however still lacking. Here, we first show that HVEM and BTLA were associated to a worse prognosis in patients with prostate adenocarcinomas, indicating a detrimental role for this pair of molecule during prostate cancer progression. We then show that a monoclonal antibody to human HVEM significantly impacted the growth of a prostate cancer cell line in immuno-compromised NOD.SCID.gc-null mice reconstituted with human T cells. Using CRISPR/Cas9, we showed that HVEM expression by the tumor was mandatory to observe the therapeutic effect. Mechanistically, tumor control was dependent on CD8+ T cells and was associated to an increase in the proliferation and number of tumor-infiltrating leukocytes. Accordingly, the expression of genes belonging to various T cell activation pathways were enriched in tumor infiltrating leukocytes, whereas genes associated with immuno-suppressive pathways were decreased, possibly resulting in modifications of leukocyte adhesion and motility. Finally, we developed a simple in vivo assay in humanized mice to directly demonstrate that HVEM was an immune checkpoint for T-cell mediated tumor control. Our results show that targeting HVEM is a promising strategy for prostate cancer immunotherapy.

(1) Background: This study aimed to investigate the effect of increased HER-2 expression on tumor-infiltrating lymphocytes (TILs) and determine its impact on the prognosis of colorectal cancer (CRC) patients; (2) Methods: HER-2, CD4, CD8, CD19, LY6G, CD56, CD68, CD11b, and EpCam expression in CRC tissues and adjacent paracancerous tissues were assessed using multiplex fluorescence immunohistochemical staining. The correlation between HER-2 expression and the number of TILs in CRC tissues was analyzed. Kaplan-Meier and Cox proportional hazards models were used to analyze survival outcomes; (3) Results: The expression of HER-2 in tumor tissues was higher than that in paracancerous tissues (1.31 ± 0.45 vs. 0.86 ± 0.20, P < 0.05). Additionally, there was an increase in the numbers of CD4+, CD8+, CD19+, and CD68+ cells in CRC tissues (14.11 ± 1.10 vs. 3.40 ± 0.18, P < 0.005; 0.16 ± 0.12 vs. 0.04 ± 0.04, P < 0.005; 0.71 ± 0.46 vs. 0.25 ± 0.13, P < 0.0005; 0.27 ± 0.24 vs. 0.03 ± 0.11, P < 0.05). The increase in HER-2 expression was positively correlated with an increase in CD4, CD8, and CD19 (p < 0.0001). In HER-2-positive CRC tissues, CD68 expression was increased (0.80 ± 0.55 vs. 0.25 ± 0.22, P < 0.05). In HER-2-upregulated CRC tissues, CD4, CD8, CD19, CD68, CD11b, Ly6G, and CD56 expressions were elevated (0.70 ± 0.37 vs. 0.32 ± 0.17, P = 0.03; 0.22 ± 0.13 vs. 0.09 ± 0.06, P = 0.03; 0.31 ± 0.19 vs. 0.12 ± 0.08, P = 0.02; 1.05 ± 0.62 vs. 0.43 ± 0.21, P < 0.01; 1.34 ± 0.81 vs. 0.53 ± 0.23, P < 0.01; 0.50 ± 0.31 vs. 0.19 ± 0.10, P < 0.01; 1.26 ± 0.74 vs. 0.52 ± 0.24, P < 0.01). Furthermore, increased HER-2 expression is an independent risk factor for recurrence-free survival (RFS) in patients (P < 0.01, HR = 3.421); (4) Conclusions: The increased expression of HER-2 and its relationship with immune cells will provide new insights for immunotherapy in CRC patients.

Pancreatic ductal adenocarcinoma (PDA), the most frequent type of pancreatic cancer, is one of the main unfinished businesses in the biomedical and clinical fields, with still discouraging 5 year survival rates and poor therapy efficiency. PDA abundant desmoplasia has for long played the lead in the mechanisms involved in poor drug performance, being the main source of cytokines and chemokines orchestrating rapid and silent tumor progression and guilty of isolating tumor cells into a extense fibrotic reaction resulting in inefficient drug delivery. However, since immunotherapy was proclaimed the breakthrough of the year back to 2013, the focus in the stroma of pancreatic cancer has interestingly moved from activated fibroblasts to the immune compartment, trying to understand the immunosuppressive factors that play part in the strong immune evasion that characterizes PDA. PDA microenvironment is highly immune-suppressive, being basically composed of T regulatory cells (Tregs), tumor-associated macrophages (TAMs) and myeloid-derived suppressive cells (MDSCs), which boycott CD8⁺ T-cell duties in tumor recognition and clearance. Interestingly, preclinical data have highlighted the importance of this immune evasion as the source of resistance to single checkpoint immunotherapies and cancer vaccines and point at pathways inhibiting the immune attack as the key to solve the therapy puzzle. Here, we will discuss the molecular mechanisms involved in PDA immune escape as well as the state of the art of the PDA immunotherapy.

The central reason behind emergence of clinically-detectable tumors is evasion from immune surveillance due to lack of cancer cells surface membrane expression of tumor-specific peptides in association with MHC class I molecules, concealment of natural killer cells-activating molecules, and absence of inflammation resulting from inefficient stimulation of innate immunity receptors and co-stimulatory molecules. The tumor microenvironment (TME) also contributes to tumor initiation, progression and resistance to therapeutic interventions because of its dense, fibrogenic, barrier-like composition, aberrant vasculature, and production of cytokines and chemokines responsible for recruitment of immune suppressive cells, notably myeloid-derived suppressor cells, M2 macrophages, regulatory T cells, extracellular trap-forming neutrophils, and cancer-associated fibroblasts. We herein show that the relentless efforts and strategies to overcome the TME elusive tumor-promoting impact produced contrasting, opposed, controversial effects, characterized by limited efficacy and proven adversity, and most importantly deterred from attempts to discover and counteract the fundamental inherent mechanisms initiating, and not consequent to, carcinogenesis.

Omega-3 polyunsaturated fatty acids (n-3 PUFA) have been found to be modulators of immune function. Additionally, they may affect the growth of colorectal cancer (CRC). With the advent of novel treatment approaches in oncology targeting immune checkpoint inhibition and aiming to boost the immune response against tumors the exact role of n-3 and n-6 PUFA in inflammation as well as in CRC needs to be re-evaluated in order to understand potential interactions with these new treatment paradigms. Interestingly, for the cyclooxygenase (COX) inhibitor aspirin a possible synergistic effect together with a PD1-Ligand antibody has been shown. However, could n-3 PUFA be disadvantageous in the context of immune tumor therapy due to an immune suppressive effect that has been described for these fatty acids in the past, or could they also enhance the effect of immune checkpoint inhibition? In this paper, we discuss the current data regarding the immune modulatory as well as the anti-CRC effect of n-3 PUFA. Arguing towards an immune-activating effect of n-3 PUFA, we demonstrate the results of a pilot study. Here, we show that incubation of human peripheral blood mononuclear cells (PBMCs) with the n-3 PUFA docosahexaenoic acid (DHA) significantly decreases CRC-cell supernatant-triggered secretion of IL-10 and increases secretion of TNF-a, while the omega-6 polyunsaturated fatty acid (n-6 PUFA) arachidonic acid (AA) reduced TNF-a secretion. These changes in cytokine secretion upon incubation with DHA demonstrate a possible enhancing effect of n-3 PUFA on an anti-tumor immune response.

Bladder cancer is one of the most common malignant diseases in the urinary system and a highly aggressive neoplasm. The prognosis is not favourable usually and its evolution for particular patients is very difficult to find out. In this paper we propose a dynamic mathematical model that describes the bladder tumor growth and the immune response evolution. This model is customized for a single patient, determining appropriate model parameter values via model calibration. Due to the uncertainty of the tumor evolution, using the calibrated model parameters, we predict the tumor size and the immune response evolution over the next few months assuming three different scenarios: favourable, neutral and unfavourable. In the former, the cancer disappears; in the second a 5mm tumor is expected around the middle of August 2018; in the worst scenario, a 5mm tumor is expected around the end of May 2018. The patient has been cited around June 15th, 2018, to check the tumor size, if it exists.

Molecular iodine (I2) induces apoptotic, antiangiogenic, and antiproliferative effects in breast cancer cells. Little is known about its effects on the tumor immune microenvironment. We studied the effect of oral (5 mg/day) I2 supplementation alone (I2) or together with conventional chemotherapy (Cht+I2) on the im-mune component of breast cancer tumors from a previously published pilot study conducted in Mexico. RNA-seq, I2 and Cht+I2 samples showed significant increases in expression of Th1 and Th17 pathways. Tumor immune composition determined by deconvolution analysis revealed significant increases in M0 macrophages and B lymphocytes in both I2 groups. Real-time RT-PCR showed that I2 tumors overexpress T-BET (p = 0.019) and interferon-gamma (IFNγ; p = 0.020) and silence tumor growth factor-beta (TGFβ; p = 0.049); whereas in Cht+I2 tumors, GATA3 is silenced (p = 0.014). Preliminary methylation analysis shows that I2 activates IFNγ gene promoter (by increasing its unmethylated form) and silences TGFβ in Cht+I2. In conclusion, our data showed that I2 supplements induce the activation of the immune response and that when combined with Cht, the Th1 pathways are stimulated. The molecular mechanisms involved in these responses are being analyzed, but preliminary data suggest that methylation/demethylation mechanisms could also participate.

Background: The endocannabinoid system (ECS) is a very heterogeneous array consisting of many proteins like ligands, enzymes and receptors synthetized in various tissues and immunity cells. The main endogenous ligands are unsaturated fatty acid derivatives like anandamide(AEA), 2-arachidonoylglycerol(2-AG), but many others are under study. Endocannabinoids are involved in both physiological and pathological conditions. ECS plays an important role in the regulation of main processes which lead to cancer and also in sex steroid hormone-related cancers. Methods: With focus on gynaecological cancers, main papers and review articles, up to April 2018, on the role of the ECS, were acquired by PubMed searches using the search terms: ‘cancer’, ‘cannabinoid’, ‘endocannabinoid’, ‘gynaecology’ and ‘malignancy’. Results: The review of recent literature data showed the involvement of the endocannabinoid system in numerous physiological and pathological conditions of the female genital tract up to the development of gynaecological malignancy as cervical, endometrial and ovarian cancer. Conclusions: The endocannabinoid system has an important role in antitumor actions involving different signalling receptor and receptor-independent pathways. It represents an exciting challenge to researchers for its potential use in diagnosis and treatment of all gynaecological malignancies

With the rise of novel immunotherapies able to stimulate the antitumor immune response, increasing literature data concerning the immunogenicity of breast cancer have been published in recent years. Numerous clinical studies have been conducted in order to identify novel biomarkers that could reflect the immunogenicity of BC and predict response to immunotherapy. In this regard, TILs have emerged as an important immunological biomarker related to the antitumor immune re-sponse in BC. TILs are more frequently observed in triple-negative breast cancer and HER2+ sub-types where increased TIL levels have been linked to better response to neoadjuvant chemotherapy and with improved survival. PD-L1 is a type 1 transmembrane protein ligand expressed on T lymphocytes, B lymphocytes and antigen-presenting cells and is considered a key inhibitory checkpoint involved in cancer immune regulation. PD-L1 immunohistochemical expression in breast cancer is observed in about 10–30% of cases and is extremely variable based on tumor stage and molecular subtypes . In detail, TNBC shows the highest percentages of PD-L1 positivity, followed by HER2+ tumors. On the other hand, PD-L1 is rarely expressed (0-10% of cases) in hormone-receptor positive BC. The prognostic role of PD-L1 expression in BC is still controversial since different immunohistochemistry (IHC) clones, cut-off points and scoring systems have been utilized across published studies. In the present paper an extensive review on the current knowledge of immune landscape of BC is provided. In detail TILS and PD-L1 expression across different BC subtypes is discussed also providing a guide for their pathological assessment and reporting.

The noncoding RNAs (ncRNAs) are small transcript sequences that do not encode proteins but participate in the regulation of gene expression at the post-transcriptional level playing important biological roles such as proliferation and differentiation. In the tumor microenvironment, the dysregulated immunological response can participate in the progression and negative phenotype of cancer, the variability of switch cell differentiation and activation of the different immune cell lineages showed differential regulation by the type of cancer. Recent evidence showed that the upregulation of lncRNA can be used as a biomarker and predictive indicator for cancer progression. The use of lncRNA to turn off the tumor immune response and activate the anti-tumoral immune response is day by day a promising reality for the control of cancer. However, is imperatively elucidated the role of each ncRNA identified as well as its respective molecular pathways regulated, including the immune checkpoints, before its application at the clinical level. The correct delivery of lncRNA or mimics to inhibit its expression using the most efficient carriers to the cell or cellular organelle is a science that should continue to be developed.

We have previously discussed the pathological characteristics, clinical characteristics, detection methods, pathogenesis, and treatment of Epstein–Barr virus (EBV)-positive gastric cancer, but we have not discussed the unique immune microenvironment in EBV-positive gastric cancer. Here, we reviewed studies on the immune microenvironment in EBV-positive gastric cancer and found that CD8+ T lymphocytes and a small number of CD204+ macrophages infiltrate the immune microenvironment in EBV-positive gastric cancer. Moreover, immune checkpoints, such as IDO1 and PD-L1, are expressed at high levels in EBV-positive gastric cancer. Lastly, we also analyzed the mechanisms underlying the formation of the immune microenvironment in EBV-positive gastric cancer. Our findings and conclusions have significance in clinical guidance and provide research direction for basic experiments.

Background: LncRNA and pyroptosis play important roles in cancer development and tumor immune microenviroment. However, pyroptosis-related lncRNAs (PRLs) in ovarian cancer have not been identified and its impact on prognosis and immune response are not fully understood. Methods: Using pearson correlation analysis, PRLs were screened. Subsequently, we constructed a prognosis signature by using LASSO cox regression. In addition, the association between risk score and cancer immune environment was analyzed. Results: In TCGA-RNA-seq cohort (n=377), 32 prognostic PRLs were selected and a 7-gene signature were developed and had high accuracy in predicting the OS of ovarian cancer patients. Stratification analysis suggested that it might serve as an independent prognostic indicator. Except to clinical outcome, the signature was significantly associated with tumor immune microenvironment. Patients with high risk score exhibited lower infiltration abundance of MHC class Ⅰ cells, Type Ⅰ IFN response and immunotherapy response. In ovarian cancer, TYMSOS was highly expressed and its high expression was associated with worse OS. TYMSOS deletion in ovarian cancer cell lines inhibited the cell proliferation, invasion and migration, indicating that it might serve as a novel biomarker in ovarian cancer. Conclusions: The prognostic PRLs signature constructed in this work is available for prognostic prediction and immune microenvironment infiltration in ovarian cancer.

Background：Increasingly, epidemiological surveys and experimental research findings indicate the involvement of immune cells in the onset and progression of prostate cancer. However, it remains unclear whether the relationship between specific immune cell types and prostate cancer is causal or influenced by bias. Through a two-sample Mendelian randomization design, our study aims to uncover the association between different immune cells and the risk of prostate cancer.Methods：A comprehensive study was conducted to investigate the association between immunophenotypes and prostate cancer risk. The study included a total of 731 immunophenotypes as potential exposure factors and analyzed data from 182,625 individuals of European ancestry from the UK Biobank. A screening of 12,097,504 single nucleotide polymorphisms (SNPs) was performed. The main analysis utilized the two-sample Mendelian randomization method with inverse variance weighting (IVW). Additionally, multiple analysis methods were combined, and various tests were conducted to assess heterogeneity and pleiotropy.Results：The resulting study showed a causal relationship between a total of 34 immune phenotypes and prostate cancer. Among them, the four immune phenotypes of CD62L- DC AC, CD19 on sw mem, FSC-A on plasmacytoid DC and HLA DR on monocyte simultaneously meet three or more statistical methods, suggesting a significant causal relationship with prostate cancer. Additionally, among the 34 immunophenotypes, CD28-CD8dim AC was shown to be positive in reverse Mendelian randomization. Most of these cell phenotypes have been reported to be potentially associated with prostate cancer.Conclusions：Our study demonstrates a causal link between immune cells and prostate cancer risk. Filled in the possible roles of all current immune cell pathways in the development and progression of prostate cancer. The next step is to verify the content and influencing mechanism of these immune phenotypes in cancer cells and adjacent cells through experiments, so as to provide new ideas and methods for the prevention and treatment of prostate cancer.

Accumulating evidences demonstrate that the host genome's epigenetic modificationsare essential for living organisms to adapt extreme conditions.DNA methylation, covalent modifications of histone, andinter-association of non-coding RNAs facilitate the cellular manifestation ofepigenetic changes in the genome. Out of various factors involved in the epigenetic programming of the host, miRNA (microRNA) and LncRNA (Long non-coding RNA) are new generationnon-coding molecules that influence a variety of cellular processes like immunity, cellular differentiation, and tumor development. During tumor development, temporal changes in miRNA/LncRNA rheostat influence sterile inflammatory responses accompanied by the changes in the carcinogenic signalling in the host. At the cellular level, this is manifested by the up-regulation of Inflammasome and inflammatory pathways, which promotes cancer-related inflammation. In view of this, we discuss the potential of lncRNA and miRNA directed interventions in regulating inflammation and tumor development in the host.

A therapy’s outcome is determined by a tumor’s response to treatment which, in turn, depends on multiple factors such as the severity of the disease and the strength of patient’s immune response. Gold standard cancer therapies are in most cases fragile when sought to break the ties to either tumor kill ratio or patient toxicity. Lately, research has shown that cancer therapy can be at most robust when handling adaptive drug resistance and immune escape patterns developed by evolving tumors. This is due to the stochastic and volatile nature of the interactions, at the tumor environment level, tissue vasculature, and immune landscape, induced by drugs. Herein, we explore the path towards antifragile therapy control, that generates treatment schemes that are not fragile but go beyond robustness. More precisely, we describe a first instantiation of a control-theoretic method to make therapy schemes cope with the systemic variability in the tumor–immune–drug interactions and gain more tumor kill with less patient toxicity. Considering the anti-symmetric interactions within a model of the tumor–immune–drug network, we introduce the antifragile control framework that demonstrates promising results in simulation. We evaluate our control strategy against state-of-the-art therapy schemes on various experiments and discuss the insights we gained on the potential that antifragile control could have in treatment design in clinical settings.

A single Cancer immunotherapy has ushered in a transformative era in oncology, bringing forth unprecedented promise and opportunities. However, even with its significant breakthroughs, the domain faces the continual issue of treatment resistance. Such resistance not only restricts the broad effectiveness of these pioneering treatments but also highlights the imperative need for further research. Delving into the complex world of cancer immunotherapy resistance, we identify a range of mechanisms, from primary and secondary resistance to the notable effects of genetic and epigenetic variables, and the pivotal importance of the tumor microenvironment (TME). Additionally, we emphasize the need for innovative strategies to mitigate this resistance, including combination treatments, customized immune checkpoints, and instantaneous monitoring. By advocating for these cutting-edge methods, we foresee a direction that incorporates personalized healthcare, enhanced treatment options, and a steadfast dedication to the welfare of patients. Through a comprehensive and diverse approach, we aim to address the hurdles posed by resistance, elevating cancer immunotherapy as a symbol of hope for patients worldwide.

The emergence of immune checkpoint inhibitors (ICIs) has dramatically changed the treatment landscape for patients with metastatic non-small cell lung cancer (NSCLC). These achievements inspired investigators and pharmaceutical companies to conduct clinical trials in patients with early-stage NSCLC because both adjuvant and neoadju-vant platinum-based doublet chemotherapies (PT-DCs) showed only a 5% improve-ment in the 5-year overall survival. IMpower010, a phase 3 trial (P3), showed that ad-juvant PT-DC followed by maintenance atezolitumab significantly prolonged dis-ease-free survival than adjuvant PT-DC alone (hazard ratio, 0.79; stage II to IIIA). Since conventional therapies, including chemotherapy and radiotherapy, can promote im-munogenic cell death, which releases tumour antigens from dead tumour cells, ICI combination therapies with conventional therapies are widely proposed. Checkmate 816 trial (P3) indicated a significantly higher pathological complete response rate of neoadjuvant nivolumab/PT-DC combination therapy than neoadjuvant PT-DC alone (odds ratio, 13.9, for stage IB to IIIA). Detection of circulating tumour DNA is highly anticipated for the evaluation of minimal residual disease. Multimodal approaches and new ICI agents are being attempted to improve the efficacy of ICI treatment in phase 2 trials. This review presents the development of perioperative treatment using ICIs in patients with NSCLC while discussing problems and perspectives.

Background: Bladder cancer (BC) development is highly related to immune cell infiltration and inflammation. This study aimed to construct a new classification of bladder cancer (BC) molecular subtypes based on immune cells-associated CpG sites. Methods: The genes of 28 types of immune cells were obtained from previous studies. Then methylation sites corresponding to immune cells-associated genes were acquired. Differentially methylation sites (DMSs) were identified between normal samples and bladder cancer samples. Unsupervised clustering analysis of differentially methylation sites was performed to divide into several subtypes. Then the potential mechanism of different subtypes was exploded. Result: Bladder cancer patients were divided into three groups. Cluster 3 (methylation-L) subtype had the best prognosis. Cluster 1 (methylation-M) had the worst prognosis. The distribution of immune cells, level expression of checkpoints, stromal score, immune score, ESTIMATEScore, tumor purity, APC_co_inhibition, APC_co_stimulation, HLA, MHC_class_I, Type_I_IFN_Reponse, and Type_II_IFN_Reponse were significant difference among three subgroups. The distribution of genomic alterations was different among them. Conclusion: The classification was accurate and stable. BC patients could be divided into three subtypes based on the immune cells-associated CpG sites. Specific biological signaling pathways, immune mechanisms, and genomic alterations were various among three subgroups. High level immune infiltration was a correlation with high level methylation. The lower RNAss score was associated with higher immune infiltration and higher level expression of CD274.

In breast cancer, epithelial-mesenchymal transition (EMT) is positively associated with programmed death ligand 1 (PD-L1) expression and immune escape, and TWIST1 induces EMT and cancer metastasis. However, how TWIST1 regulates PD-L1 and immune evasion is unknown. This study analyzed TWIST1 and PD-L1 expression in breast cancers, investigated the mechanism for TWIST1 to regulate PD-L1 transcription, and assessed the effects of TWIST1 and PD-L1 in cancer cells on the cytotoxicity of CD8+ effector T cells. Interestingly, TWIST1 expression is associated with high-level PD-L1 in triple negative breast cancers (TNBCs). Overexpression and knockdown of TWIST1 robustly upregulates and downregulate PD-L1 expression, respectively. TWIST1 binds to the PD-L1 promoter and recruits the TIP60 acetyltransferase complex in a BRD8-dependent manner to promote PD-L1 expression, which drives immune escape of breast cancer cells by accelerating the exhaustion of CD8+ T cells. Accordingly, knockdown of TWIST1 or BRD8 or blockade of PD-L1 with a PD-L1 antibody significantly enhances CD8+ T cells to inhibit breast cancer cell growth. These results demonstrate that TWIST1 directly induces PD-L1 expression in breast cancer cells to drive immune evasion. Targeting TWIST1, BRD8 or PD-L1 in TNBC should facilitate CD8+ T cell-mediated immune therapy. TWIST1 may also serve as a biomarker for anti-PD-L1 immunotherapy.

Ulcerative colitis (UC) is a chronic autoimmune disorder affecting the colonic mucosa. UC is a subtype of inflammatory bowel disease along with Crohn’s disease and presents with varying extraintestinal manifestations. No single etiology for UC has been found, but a combination of genetic and environmental factors is suspected. Research has focused on the role of intestinal dysbiosis in the pathogenesis of UC, including the effects of dysbiosis on the integrity of the colonic mucosal barrier, priming and regulation of the host immune system, chronic inflammation, and progression to tumorigenesis. Characterization of key microbial taxa and their implications in the pathogenesis of UC and colitis-associated cancer (CAC) may present opportunities for modulating intestinal inflammation through microbial-targeted therapies. In this review, we will discuss the microbiota-immune crosstalk in UC and CAC, as well as the evolution of microbiota-based therapies.

There exists a variety of studies about tumor-infiltrating lymphocytes (TILs) in cervical cancer, but their prognostic value in correlation to the histopathological subtype was never investigated. Therefore, the aim of this study was to quantify TILs in a panel of 250 sporadic cervical cancers and investigate the correlation with cervical cancer subtype and patient survival. TIL levels were significantly increased in the subgroup of squamous cell carcinomas in comparison to adenocarcinomas. In squamous cell carcinomas, TIL infiltration shows a negative correlation to age, FIGO stage and to the histone protein modification H3K4me3. Moreover, in adenocarcinomas, it was positively correlated to p16 and to the glucocorticoid receptor and inversely correlated to the MDM2 protein and to H3K4me3. Interestingly, immune infiltration was an independent positive prognosticator for disease free survival (DFS) in patients with squamous cell carcinomas, those bearing tumors with the strongest TIL infiltration showing the better DFS. Altogether, the present study provides a differentiated overview of the relations between TIL levels and prognosis in patients with cervix squamous cell carcinomas vs patients with cervix adenocarcinomas.

Autoantibodies against specific lung cancer-associated antigens have been suggested for lung cancer diagnosis. This study aimed to evaluate the diagnostic performance of anti-gen-autoantibody immune complex (AIC) against its free antigens for CYFRA21-1, ProGRP, NGAL, and NSE in non-small cell lung cancer (NSCLC). In total, 85 patients with NSCLC and 120 healthy controls (HCs) were examined using a 9G DNA chip method. The ratios of AICs to their antigens and combinations of ratios consisting of two to four markers were calculated. The levels of AICs for CYFRA21-1, ProGRP, NGAL, and NSE were higher than their free antigens in all participants. The levels of each free antigen distinguished patients with NSCLC from HCs. The ratios of AIC to its antigen and seven combinations consisting of two to four ratios were significantly higher in patients with NSCLC than those in HCs. Excellent diagnostic performance was observed for all combination ratios (C4-1), with 85.9% sensitivity and 86.7% specificity at cutoff 3.51. Higher sensitivity was observed in the very early stages (0–I) and adenocarcinoma than in stages II–IV and other pathological types. The combination of all ratios of AICs and their antigens for all four markers is useful in the diagnosis of NSCLC.

Nowadays the positive immune involvement in the eradication of tumor cells is assigned to the adaptive immune response. By awakening of in vivo responding T cells that are suppressed by the tumor and prevents immunological cure of the cancer. The adaptive immune response is a complex of different cells and protein molecules. Normally activated T cells are well-ordered by several late occurring inhibitors to contain the response to the unknown invaders and spare the normal cells. The tumor strengthens this inhibitory response to escape from immune elimination. Immunotherapy is to unleash the full capacity of the adaptive immune system by blocking this inhibitor response by monoclonal antibodies but with the potential drawback of autoimmune phenomena. Seen the success of the immunotherapy another feature of the immune system is overlooked. Cytokines and chemokines became in oblivion after their suspected necrosis of the tumor (TNF) did not fulfil their initial hope. When patients seek help for their complaints the ovarian cancer is in most cases already metastasized to the peritoneum and omentum. Here, we show that on the one hand chemokines produced by Th2, CD8 and NK cells inhibit cancer spreading and thus leads to a better operability and thus better survival. On the other hand, chemokine receptors are expressed by the tumor that are a decoy by binding chemokines that normally should attract antigen cross-presenting dendritic cells, which start an adaptive T cell response.

The dominant paradigm holds that spontaneous and therapeutically induced anti-tumor responses are mediated mainly by CD8 T cells and directed against tumor-specific antigens (TSAs). The presence of specific TSAs on cancer cells can only be proven by mass spectrometry analyses. Bioinformatic predictions and reverse immunology studies cannot provide this type of conclusive evidence. Most TSAs are coded by unmutated non-canonical transcripts that arise from cancer-specific epigenetic and splicing aberrations. When searching for TSAs, mass spectrometry analyses must therefore interrogate not only the canonical reading frame of annotated exome but all reading frames of the entire translatome. The majority of aberrantly expressed TSAs (aeTSAs) derive from unstable short-lived proteins that are good substrates for direct MHC I presentation but poor substrates for cross-presentation. This is an important caveat because cancer cells are poor antigen-presenting cells and the immune system therefore depends on cross-presentation by dendritic cells (DCs) to detect the presence of TSAs. We therefore postulate that, in the untreated host, most aeTSAs are undetected by the immune system. We present evidence suggesting that vaccines inducing direct aeTSA presentation by DCs represent an attractive strategy for cancer treatment.

Most pivotal clinical trials in advanced non-small cell lung cancer (NSCLC) have excluded patients with poor performance status (PS), and data on the efficacy and safety of pharmacotherapy have not been fully accumulated. For NSCLC patients with PS 2 and without druggable genetic alterations, monotherapy with cytotoxic agents or carboplatin-based combination therapy is usually administered based on the results of several randomized trials. However, the evidence of cytotoxic chemotherapy for patients with PS 2 is insufficient, with limited efficacy and toxicity concerns. Immune checkpoint inhibitors (ICIs) are a promising treatment for patients with PS 2 because of lower incidence of severe toxicity compared to cytotoxic chemotherapy. Meanwhile, several reports suggest that anti-PD-1 antibodies monotherapy is less effective for patients with PS 2, especially for those with PS 2 caused by disease burden. Although the combination therapy of nivolumab and ipilimumab is a promising treatment option, there is a divergence in efficacy data between clinical trials. The standard of care for advanced NSCLC with PS 2 has not been established, and future therapeutic strategies should take into account the heterogeneity of the PS 2 population.

Background: Metastasis is a complex process that involves the spread of the tumor to distant parts of the body from its original site. Metastatic dissemination represents the main physiopathology of cancer. Soluble factors such as cytokines have been closely related to breast cancer (BC) metastasis. Bisphenol A (BPA) is an endocrine disrupting chemical compound with estrogenic properties, which exposure in the early stages of neonatal life leads to an increase in the size and weight of breast tumors and cellular changes in the tumoral immune microenvironment. Methods: Thus, we used female BALB/c mice that were exposed neonatally to a single dose of BPA. Once sexual maturity was reached, a mammary tumor was induced injecting 4T1 cells in situ. After 25 days of injection, we evaluated endocrine alterations, cytokine expression, tissue alterations denoted by macro and micro metastases in the lung, and metastasis-induced cell infiltration. Results: BPA neonatal treatment did not show significant endocrine alterations. Nevertheless, BPA induced a great rate of metastasis to the lung associated with higher intratumoral expression of IL-1b, IL-6, IFN-g, TNF-a and VEGF. Conclusions Our data suggest that cytokines are key players in BC metastasis induction, and that BPA is a risk factor to be considered. This knowledge must be considered with the aim of recognizing environmental pollution in the clinical history of patients to possibly counter BC metastases.

Background:Malignant pleural effusion (MPE),a frequent complication of advanced malignancies. This pilot study characterized and compared the immune landscapes of breast carcinoma (BC) and lung adenocarcinoma (LADC) primary tumors(PTs) and their corresponding MPEs and tested the incorporation of multiplexed image technology for the study of malignant fluids. Methods: We studied the immune contexture of 6 BC and 5 LADC PT samples and their MPEs using 3 multiplex immunofluorescence panels. We explored associations between sample characteristics and pleural effusion–free survival. Results: Although we found 3 out of 11 PTs PD-L1 positive more than 1% by malignant cells, no MPE samples reached positive expression by malignant cells. In addition, CD3+ T cells and CD3+CD8+ cytotoxic T cells predominated (median percentages for MPEs vs. PTs: 45.5% vs. 40.7% and 4.7% vs. 6.6%, respectively). In the BC samples, CD68+ macrophages predominated (median percentages for MPEs vs. PTs:61% vs. 57.1%). Generally, CD3+CD8+FOXP3+ T cells in PTs and the distances from the malignant cells to CD3+CD8+Ki67+ and CD3+PD-1+ T cells were correlated in the first event of MPE after diagnosis. Conclusions: The immune cell phenotypes in the MPEs and PTs were similar within each cancer type but were different for LADC vs. BC.MPE analysis could be used as a substitute for PT analysis, but an expanded study on this topic is essential.

Background: We investigated the tumor immune response in gastric cancer patients receiving third line nivolumab monotherapy to identify immune-related biomarkers for better patient se-lection. Methods: Nineteen patients (10 males, median age 67 years) who received nivolumab as a third or later line therapy were enrolled. We analyzed the tumor immune response in durable clinical benefit (DCB) and non-DCB patients. Pre-treatment and early-on-treatment tumor transcriptomes were examined, and gene expression profiles, immunograms, and T cell receptor (TCR) repertoire were analyzed. Results: DCB was observed in 15.8% of patients, with comparable secondary endpoints (ORR, OS, PFS) to previous trials. Individual immunograms showed no significant changes before and ear-ly-on-treatment, nor consistent alterations among DCB cases. The intratumoral immune response was suppressed by previous treatments in most third or later line nivolumab recipients. TCR repertoire analysis revealed newly emerged clonotypes in on-treatment tumors, but clonal re-placement did not impact efficacy. High T cells/Tregs ratios and a low UV radiation response gene signature were linked to DCB and treatment response. Conclusions: This study emphasizes the tumor immune response's importance in nivolumab ef-ficacy for gastric cancer. High T cells/Tregs ratios and specific gene expression signatures show promise as potential biomarkers for treatment response. Larger cohort validation is crucial to optimize immune checkpoint inhibitors in gastric cancer treatment.

Obesity, type 2 diabetes, and different forms of cancers are among the leading human diseases and highly complex in terms of diagnostic and therapeutic approaches. Diabetes and cancer are among the most frequent and complex diseases and based on epidemiological evidence and study it can be concluded that the patients suffering from diabetes are considered to be significantly at higher risk for a number of cancer types. Both these diseases are among the highly complex and heterogeneous in nature. There are a number of evidences which support the hypothesis that these diseases interlinked and obesity may aggravate the risk(s) of both these diseases type 2 diabetes and different types of cancers. Multi-level unwanted alterations such as (epi-)genetic alterations, changes at the transcriptional level, and altered signaling pathways (receptor, cytoplasmic, and nuclear level) are the major source which promotes a number of complex diseases and such heterogeneous level of complexities are considered as the major barrier in the development of therapeutic. With so many known challenges, it is critical to understand the relationships and the common shared causes between type 2 diabetes and cancer which is difficult to unravel and understand. Furthermore, the real complexity arises during diagnosis from contended corroborations that specific drug(s) (individually or in combination) during diagnosis process of type 2 diabetes may increase or decrease the cancer risk or affect cancer prognosis. In this review article, we have presented the recent and most updated evidences from the studies where the origin, biological background, correlation between them have been presented or proved. Furthermore, we have summarized the methodological challenges and tasks that are frequently encountered. we have also outlined the physiological links between type 2 diabetes and cancers. Finally, we have presented and summarized the outline of the hallmarks for both these diseases diabetes and cancer.

Lung cancer remains the leading cancer killer worldwide. Early diagnosis can effectively increase the patient cure rate but existing diagnostic methods limit early lung cancer diagnosis. Therefore, development of a simple but efficient lung cancer screening method is important to improvement of both the diagnosis rate and the survival rate of lung cancer patients. In this study, ten photosensitive materials with high sensitivity and high specificity were screened accurately to construct a microarray sensor that can rapidly identify six types of lung cancer biomarkers in exhaled breath. Results from hierarchical cluster analysis (HCA), principal component analysis (PCA) and difference maps showed that the classification of the analytes agreed with structure similarity laws. The detection results from parallel experiments and structurally similar analytes, in turn, cluster into a group; the fingerprints of the different analytes have specific response regions. The well-screened sensor chip fabrication workload and cost were both reduced by approximately two thirds, while the microfluidic device sensitivity and stability increased by approximately 1.3 times their corresponding values before optimization. The dual-channel device also offers real-time contrast detection and synchronous parallel detection functions and has potential application prospects for use in extensive screening of high-risk populations for lung cancer.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Background: Ovarian cancer (OC) represents the eighth most common cancer and the fifth leading cause of cancer-related deaths among the female population. In the advanced setting, chemotherapy represents the first-choice treatment, despite a high recurrence rate. In the last ten years, immunotherapy based on immune checkpoint inhibitors (ICIs) has profoundly modified the therapeutic scenario of many solid tumors. We sought to summarize the main findings regarding the clinical use of ICIs in the OC. Methods: We searched the PubMed, Embase, and Cochrane Databases, and conference abstracts from international congresses (such as ASCO, ESMO, SGO) for clinical trials, focusing on ICIs both as monotherapy and as combinations in the advanced OC. Results: 20 studies were selected, of which 16 were phase I or II and 4 phase III trials. ICIs targeting PD1 (nivolumab, pembrolizumab), PD-L1 (avelumab, atezolizumab, durvalumab), and CTLA4 (ipilimumab, tremelimumab) were employed. No significant survival improvement was achieved; conversely, early terminations due to futility or toxicity were recorded. Combinations with chemotherapy, anti-VEGF, and, overall, PARP-inhibitors seem feasible and enhance the response rate and survival, notwithstanding a worse safety profile. Conclusions: The identification of biomarkers with a predictive role for ICIs’ efficacy is mandatory. Moreover, genomic and immune profiling of the OC might lead to an improved treatments selection and design of tailored trials.

Immune checkpoint receptors play a crucial role in steering tumor progression, prompting a focused investigation into the role of TIM3 in breast cancer. Analysis of TCGA BRCA data unveiled diverse correlations between TIM-3 expression and immune cell infiltration across subtypes. In our in-house cohort studied through IHC, significant changes in TIM3 expression with tumor grades were observed. Higher TIM3 expression correlated with increased disease-free survival in pan breast cancer, marking the first revelation of TIM3's positive role in pan BC prognosis. The study indicates that alluring TIM3 response, rather than suppression, may enhance breast cancer prognosis.

Agaricus blazei Murrill or Himematsutake is an edible and medicinal mushroom. Agaricus blazei Murrill's fruiting body extracts have anticancer properties, although the mechanism is unknown. Basic or organic solvents, which are hazardous for human health, are generally used to prepare Agaricus blazei Murrill's extracts. Inhibition of immune checkpoint molecules and Axl receptor is an effective therapy in cancer. This study assessed whether subcritical water extracts of the Agaricus blazei Murrill's fruiting body or mycelium affect the expression of Axl and immune checkpoint molecules in lung cancer cells. We used A549 cells and mouse bone marrow-derived dendritic cells in the experiments. We prepared subcritical water extracts from the Agaricus blazei Murrill's fruiting body or mycelium. The subcritical water extracts from the Agaricus blazei Murrill's fruiting body or mycelium significantly inhibited the expression of immune checkpoint molecules and Axl compared to saline-treated cells. Also, the hot water extract, subcritical water extract, and the hot water extraction residue subcritical water extract from the Agaricus blazei Murrill's mycelium significantly enhanced the expression of maturation markers in dendritic cells. These observations suggest that the subcritical water extract from Agaricus blazei Murrill's mycelium is a promising therapeutic tool for stimulating the immune response in cancer.

White adipose tissue (WAT) represents an endocrinologically and immunologically active tissue that’s primary role is energy storage and homeostasis. Breast WAT is involved in the secretion of hormones and proinflammatory molecules that are associated with breast cancer development and progression. The role of adiposity and systemic inflammation in immune responses and resistance to anti-cancer treatment in breast cancer (BC) patients is still not clear. This review aims to evaluate the emerging evidence on the crosstalk between adiposity and the immune-tumour microenvironment in BC, its progression and treatment resistance. Adiposity, and by extension subclinical inflammation, are associated with metabolic dysfunction and changes in the immune-tumour microenvironment in BC. In oestrogen receptor positive (ER+) breast tumours, it is proposed that these changes are mediated via a paracrine interaction between macrophages and preadipocytes leading to elevated aromatase expression and secretion of pro-inflammatory cytokines and adipokines in the breast tissue in patients who are obese or overweight. In HER2+ breast tumours, WAT inflammation has been shown to be associated with resistance to trastuzumab mediated via MAPK or PI3K pathways. Furthermore, adipose tissue in patients with obesity is associated with upregulation of immune checkpoints on T-cells that is partially mediated via immunomodulatory effects of leptin and has been paradoxically associated with improved responses to immunotherapy in several cancers. In conclusion, evidence suggests that body composition and metabolic status are associated with patient outcomes. To optimise patient stratification and personalisation of treatment, prospective studies are required to evaluate the role of body composition and metabolic parameters in metabolic immune reprogramming with and without immunotherapy in patients with BC.

Cancer immunotherapy reaches a remarkable achievement in various cancer types and brings new possibilities to improve cancer patients’ long-term survival. However, outcomes vary from case to case, and the present protocol benefits a small fraction of patients. One notable factor is the tumor microenvironment, especially the immune cell components, that may reflect the immune response's status quo on site. Thus, understanding the content of infiltrating immune cells in tumors is not only for research interesting but also a crucial subject toward precision medicine. We implement an algorithm for resolving relative proportions of twenty-one immune cell subclasses from a human tissue profiled transcriptome by microarray technology to reach the goal above. By selecting gene features and then adopting ?-Support Vector Regression, we can construct a deconvolution model and resolve the immune cell context. The excellent consistency between the estimated values and the correct immune-cell composition further demonstrates this approach provides a more natural alternative to revealing samples' immune cell content and reliable results like recent single-cell technologies. Based on this algorithm, the web-based deconvolution tool implemented named mySORT provides a user-friendly interface for estimating the immune cell content by uploading gene expression profiling. We also present comprehensive visualization 2D/3D plots in mySORT so that users can easily make a comparison between different samples. Finally, we synthesized pseudo-bulk expression data from single-cell transcriptomic datasets of 17 melanoma and 16 head and neck cancer patients. The deconvolution results of microarray-based data in the previous study and synthetic pseudo-bulk data all proved the excellent performance of mySORT. We believe that mySORT can help researchers in all fields easily understand complex immune microenvironment. The website of mySORT is freely accessible on https://symbiosis.iis.sinica.edu.tw/mySORT/.

: Image guided superficial radiation therapy (IGSRT) combines superficial radiation therapy (SRT) with full dermal visualization (FDV) via high resolution dermal ultrasound (HRDUS) for the treatment of non-melanoma skin cancer (NMSC). The gold standard for IGSRT delivery includes a comprehensive cancer care model with support for the dermatologists by a multidisciplinary team. When delivered in this model, IGSRT can achieve cure rates of 99% for treatment of NMSC. This paper focuses on the benefits of IGSRT during therapy. Medical records from 7 dermatology clinics of 883 patients with 1,507 cases of NMSC treated with IGSRT be-tween 2017 and 2018 were retrospectively reviewed. 92% of the NMSC lesions showed daily depth fluctuations, 60.32% of lesions did not require changes during therapy, and nearly 40% of lesions required at least one compensatory change during therapy. 83% of NMSC lesions were labeled high-risk based on the 2024 NCCN guidelines. Increasing and decreasing tumor depth measurements during IGSRT inform dermatologists when adaptive changes in energy (kV), TDF and dose will result in more efficacy and less toxicity, respectively.

Background: Prostate cancer (PCa) is characterized by significant heterogeneity in its molecular, genomic, and immunologic characteristics. Methods: Whole transcriptome RNAseq data from The Cancer Genome Atlas of prostate adenocarcinomas (n=496) was utilized. The immune microenvironment was characterized using the CIBERSORTX tool to identify immune cell type composition. Unsupervised hierarchical clustering was performed based on immune cell type content. Analyses of progression-free survival (PFS), distant metastases, and overall survival (OS) were performed using Kaplan-Meier estimates and Cox-regression multivariable analyses. Results: Four immune clusters were identified, largely defined by plasma cell, CD4+ Memory Resting T Cells (CD4 MR), M0 and M2 macrophage content (CD4 MRHighPlasma CellHighM0LowM2Low, CD4 MRLowPlasma CellHighM0LowM2Low, CD4 MRHighPlasma CellLowM0HighM2Low, and CD4 MRHighPlasma CellLowM0LowM2High). The two macrophage-enriched/plasma cell non-enriched clusters (3&4) demonstrated worse PFS (HR 2.24, 95% CI 1.46–3.45, p=0.0002) than the clusters 1&2. No metastatic events occurred in the non-macrophage-enriched clusters. Comparing clusters 3 vs 4, in patients treated by surgery alone, cluster 3 had zero progression events (p<0.0001). However, cluster 3 patients had worse outcomes after post-operative radiotherapy (p=0.018). Conclusion: Distinct tumor immune clusters with a macrophage-enriched phenotype and reduced plasma cell enrichment independently characterize an aggressive phenotype in localized prostate cancer that may differentially respond to treatment.

Significant recent advances in cancer immunotherapeutics include the vaccination of cancer patients with tumor antigen-associated peptide-pulsed dendritic cells (DCs). DC vaccines with homogeneous, mature, and functional activities are required to achieve effective acquired immunity; however, the yield of autologous monocyte-derived DCs varies in each patient. Priming with a low dose of recombinant human granulocyte colony-stimulating factor (rhG-CSF) 16–18 h prior to apheresis resulted in 50% more harvested monocytes, with a significant increase in the ratio of CD11c+CD80+ DCs/apheresed monocytes. The detection of antigen-specific cytotoxic T lymphocytes after Wilms’ tumor 1-pulsed DC vaccination was higher in patients treated with rhG-CSF than those who were not, based on immune monitoring using tetramer analysis. Our study is the first to report that DC vaccines for cancer immunotherapy primed with low-dose rhG-CSF are expected to achieve higher acquired immunogenicity.

CRCMSS/pMMR contain a significantly increased fraction of TREM2+ macrophages (TAMs) and CD66+ neutrophils (TANs) together with decrease of CD4-CD8-CD3+ double negative T lymphocytes (DNTs); no differences were revealed by the analysis of myeloid and plasmacytoid dendritic cell populations. A fraction of tumor-infiltrating T-cells display an exhausted phenotype, co-expressing PD-1 and TIM-3. Remarkably, expression of PD-L1 on fresh tumor cells and TAMs was undetectable even after in vitro stimulation with interferon-γ. These findings confirm the immune suppressive microenvironment of CRCMSS/pMMR characterized by dense infiltration of TAMs, occurrence of TANs, lack of DNTs, T-cell exhaustion and interferon-γ unresponsiveness by host and tumor cells. Appropriate bypass strategies should consider these combinations of immune escape mechanisms in CRCMSS/pMMR.

Analyzed the literature devoted to the changes in the expression of the RAS proteins of cancer cells. A brief review of protein expression dynamics PAC in malignant tumors and the possible role of epigenetic mechanisms in these processes. Through research epigenetic mechanisms state for cancer have been developed principally new techniques for their correction, based on the use of selective regulators systems covalent modification-histone proteins (for example, deacetylase inhibitor) and microRNA synthesis technologies. Literature data show promising pharmacological correction epigenetic modification of chromatin in the treatment of cancer.

Purpose: Pancreatic cancer (PAAD) is one of the most lethal malignancies. Immunotherapy is largely ineffective in PAAD. T-cell exhaustion contributes to the resistance for immunotherapies. We investigated the prognostic potential of T cell exhaustion-related genes (TEXGs). Methods: Single-cell RNA (scRNA) sequencing dataset from TISCH, and bulk sequencing datasets from TCGA and GTEx were applied to screen differently expressed TEXGs. Kaplan-Meier survival, LASSO regression, and Univariate/Multivariate Cox regression analysis were performed to construct TEXGs risk model. This model was used to predict the prognosis, tumor immune microenvironment, and immunotherapy response. PAAD cohorts from ICGC and GSE71729 datasets were used to validate this risk model. Pan-cancer expression of SPOCK2 was performed in TISCH database. Results: A six-gene (SPOCK2, MT1X, LIPH, RARRES3, EMP1, and MEG3) risk model was constructed. Low-risk PAAD patients had longer survival time in both training dataset (TCGA-PAAD, n=178) and validation datasets (ICGC-PACA-CA, ICGC-PAAD-US, and GSE71729, n=412). Multivariate Cox regression analysis demonstrated that the risk score was an independent prognostic variable for PAAD. High-risk patients correlated with cancer-related KEGG pathway enrichment, higher mutation frequency of KRAS and TP53 genes, and immunosuppressive status. Immunohistochemistry staining confirmed the changes of TEXGs in clinical samples. Moreover, pan-cancer scRNA sequencing datasets from TISCH analysis indicated that SPOCK2 might be a novel marker of exhausted CD8+ T cells. Conclusion: In conclusion, we established and validated a T cell exhaustion-related prognostic signature for PAAD patients. Moreover, our study suggests that SPOCK2 may be a novel marker of exhausted CD8+ T cells.

We use a system biology approach to translate the interaction of Bacillus Calmette-Gurin (BCG) + interleukin 2 (IL-2) for the treatment of bladder cancer into a mathematical model. The model is presented as a system of differential equations with the following variables: number of tumor cells, bacterial cells, immune cells, and cytokines involved in the tumor-immune response. This work investigates the delay effect induced by the proliferation of tumor antigen-specific effector cells after the immune system destroys BCG-infected urothelium cells following BCG and IL-2 immunotherapy in the treatment of bladder cancer. For the proposed model, three equilibrium states are found analytically. The stability of all equilibria is analyzed using the method of Lyapunov functionals construction and the method of linear matrix inequalities (LMIs).

Background: Qazvin province has suffered a lot of natural disasters (earthquakes) for a long time. so, the establishment of the first industrial city in Iran, has always been a source of concern. One of these problems is the possibility of chlorine gas leaking from the chlorination system of drinking water and treatment plant the existing ones are on the health of the inhabitants of this region.Material and method: This analytical study was carried out in Novorossiysk district of Alborz in December 2012. Initially, chlorine gas leakage scenarios from these facilities were simulated by ALOHA and WISER software, and then using the Emergency Level System, according to the CCPS Consultative Center's Chemical Process Safety Advice, the Emergency Response Program was presented. Results: ALOHA software, in comparison with WISER software, has more precision to identify and address the consequences of chlorine gas leakage hazards and according to the simulation of this software in the event of a leak from the well and water resources unit at 8240 m from the area and at night 7520 meters will be affected. Due to the speed of delivering results through the WISER software, this software can be used at times when the operating speed is considered (incident time).Conclusion: According to the CCPS model, the emergency conditions were classified at levels 3 and 4, therefore, the relevant crisis management agencies (Qazvin Crisis Management Committee, Alborz City Health Center, Red Crescent and Firefighting Authority) should provide training maneuvers At Alborz city level, and informing people of cities and industrial companies, many efforts have been made to reduce human and environmental damage in case of possible leakage.

Patients with glioblastoma (GB), a highly aggressive brain tumor, have a median survival of 14.6 months following neurosurgical resection with adjuvant chemoradiotherapy. Quiescent GB cancer stem cells (CSCs) invariably cause local recurrence. These GB CSCs that can be identified by embryonic stem cell markers express components of the renin-angiotensin system and are associated with circulating CSCs. Despite the presence of circulating CSCs, GB rarely develops distant metastasis outside the central nervous system. This paper reviews the current literature on GB growth inhibition in relation to CSCs, circulating CSCs, the RAS and the novel therapeutic approach by repurposing drugs that target the renin-angiotensin system to improve overall symptom-free survival and maintain quality of life.

Patients with pT1 high-grade (HG) bladder cancer (BC) and a very high risk of progression might benefit from immediate radical cystectomy (RC), but this option remains controversial. Validation of a standardized method to evaluate the extent of lamina propria (LP) invasion (with recognized prognostic value) in transurethral resections (TURBT) specimens is still needed. The Rete Oncologica Lombarda (ROL) system showed a high predictive value for progression after TURBT in recent retrospective studies. Our aim was to validate ROL system on a large mono-institutional prospective series of primary urothelial carcinomas. From 2016 to 2020, we adopted ROL for all patients with pT1 HG BC on TURBT. We employed a 1.0-mm threshold to stratify tumors in ROL1 and ROL2. A total of 222 pT1HGBC were analyzed. Median age was 74 years, with male predominance (73.8%). ROL was feasible in all cases: 91 cases were ROL1 (41%) and 131 ROL2 (59%). At a median follow up of 26.9 months (IQR 13.8-40.6), we registered 80 recurrences and 40 progressions. ROL was a significant predictor of tumor progression at both univariable (HR 3.53; CI 95% 1.56 – 7.99; p&lt;0.01) and multivariable (HR 2.90; CI 95% 1.25 – 6.75; p=0.01) Cox regression analyses. At Kaplan-Meier estimates, ROL showed correlation with both PFS (p=0.0012) and RFS (p=0.0167). Our results confirmed the strong predictive value of ROL for progression on a large prospective series. We encourage the application of ROL for reporting the extent of LP invasion, substaging T1 HG BC, and improving risk tables for urological decision making.

Because it can make exact double-strand breaks in DNA, CRISPR-Cas9 can help almost every species and type of cell. It is a powerful way to change the DNA code. CRISPR-Cas9 can be used for a lot more than just changing genes. We are close to being able to do high-throughput gene screening, epigenome editing, in-vivo cell tagging, and RNA change. With the help of CRISPR-Cas9, the function of genes can be studied better, and more realistic disease models can be made. The revolutionary new discipline of gene editing has the potential to profoundly impact healthcare and the life sciences. By simplifying the process of creating double-strand breaks in the DNA of almost any species or kind of cell, CRISPR-Cas9 has revolutionized gene editing. Numerous applications have been found for the CRISPR-Cas9 system. High-throughput gene screening, RNA modification, live-cell chromosome marking, and epigenome editing are all examples. CRISPR-Cas9 facilitates gene research, leading to the development of CRISPR-based disease models. CRISPR-Cas9-based methods of altering the genome will aid researchers in learning more about sickness and discovering better ways to cure it, despite the fact that there are still many questions and large difficulties to answer.

Background This study aimed to determine the association between immune checkpoint inhibitors (ICIs) and the risk of herpes zoster (HZ) incidence in patients with lung cancer. Method We obtained national claims data of 51,021 patients from South Korea with lung cancer between August 2017 and December 2021. The study population was classified into ICIs and non-ICIs groups based on prescription of ICIs at least once during the study period. To estimate the effects of ICIs treatment compared with those without ICIs treatment on HZ incidence, we used the Cox proportional hazards model adjusted for sex, age, comorbidities, and concomitant use of immunosuppressive drugs. Stratified analyses based on sex, age, and comorbidities were conducted to identify corresponding risk factors. Results Of the 51,021 study participants, 897 (1.8%) were prescribed ICIs, and 2,262 (4.4%) were diagnosed with HZ. Approximately 75.6% of the patients were male, and the prevalence of diabetes, cardiovascular disease, and chronic lung disease in the ICIs group was significantly lower than that in the non-ICIs group. The Kaplan–Meier plot showed that the probability of incidence of HZ in the ICIs group was lower than that in the non-ICIs group. Additionally, treatment with ICIs was associated with a 31% lower risk of developing HZ when compared to that seen without ICIs treatment (95% confidence interval [CI], 0.48–1.00). This association was stronger in females (hazard ratio [HR], 0.42; 95% CI, 0.19–0.94) and those less than 68 years of age (HR, 0.58; 95% CI, 0.34–0.99). Conclusion In these real-world data from an Asian population with lung cancer, ICIs treatment might be associated with a reduced risk of HZ compared to that without ICIs treatment.

Polymeric based nanoparticles are garnering significant interest for their potential in drug delivery. Specially, nanopolymers that have been functionalized with molecules, such as proteins or peptides, are a versatile vehicle for drug delivery. Curcumin (Cur) is one of the most commonly studied anticancer compounds and is widely acknowledged as having positive effects on human health. However, its insolubility and low bio-distribution greatly hinder the exploitation of its beneficial traits. In this study, our team created a nano delivery system which utilized a nanopolymer called PCL-PEG (poly(ε-caprolactone)-poly (ethylene glycol)). This system was functionalized with A6 peptide to enable targeted delivery of Cur. The system was designed with advantageous nanoparticles (NPs), including a stable zeta potential (–32.7), small size (54.3), uniform surface morphology, and high hydrophilicity (13.72°). In addition, targeted delivery systems exhibited high encapsulation efficacy (93 ± 0.89 %), and drug loading (16.7 ± 0.9 %), and were characterized by a slow and gradual release profile with a release of approximately 83.13 ± 0.12%. The MTT assay results showed that the formulation known as Cur-NPs-A6 caused a significant increase in cell death in MDA-MB-231 cancer cells (IC50 = 23.31 ± 0.85 µM). The designed delivery system did not cause any harm to the noncancerous MCF-10A cells (normal group). Furthermore, the results of both the RT-qPCR and invasion assays demonstrated that the designed system was able to effectively activate the apoptosis pathway and inhibit cell invasion. Our findings suggest that the use of the designed smart delivery system, which is functionalized with A6 peptide that has a high affinity for CD44 receptor - known to be upregulated in numerous malignant conditions, could be a highly efficient approach to treating cancer.

One of the most used markers of cancer stem cells in several cancers, including colorectal cancer and breast cancer, is CD44. CD44 is a glycoprotein that traverses the cell membrane and binds to many ligands including hyaluronan resulting in activation of signaling cascades. Several reports have shown conflicting data on the expression of CD44 and that the expression depends on modes of investigations and subtypes of cancers. In addition, the correlation between CD44 expression and drug resistance, immune infiltration, EMT, metastasis and patients prognosis in several cancer types remains unclear. This study investigated CD44 expression in several cancers and explored its relationship with tumorigenesis using various publicly available databases, including The Cancer Genome Atlas, GEPIA, Oncomine, Genomics of Drug Sensitivity in Cancer and Tumor Immune Estimation Resource. Our analysis reveals that CD44 is differentially expressed in different cancers. CD44 expression is significantly associated with cancer patients’ survival in gastric, pancreatic and colorectal cancers. In addition, CD44 expression is closely linked with immune infiltration and immune suppressive features in pancreatic, colon adenocarcinoma and stomach cancer. High CD44 expression was significantly correlated with the expression of drug resistance-, EMT- and metastasis- linked genes. Tumors expressing high CD44 have higher mutation burden and afflict older patients than tumors expressing low CD44. Cell lines expressing high CD44 are more resistant to anti-cancer drugs compared to those expressing low CD44. Protein-protein interaction investigations and functional enrichment analysis showed that CD44 interacts with gene products related to cell-substrate adhesion, migration, platelet activation, and cellular response to stress. KEGG pathway analysis revealed that these genes play key roles in biological adhesion, cell component organization, locomotion, G-α-signaling and the response to stimulus. Overall, this investigation reveals that CD44 play significant roles in tumorigenesis, can be used as a prognostic biomarker in several cancers and can be therapeutically targeted in cancer therapy.

In recent years, numerous approaches have been developed to comprehend the molecular altera-tions underlying thyroid cancer (TC) oncogenesis and explore novel therapeutic strategies for TC. It is now well established that the neurokinin-1 receptor (NK-1R) is overexpressed in cancer cells and that NK-1R is essential for viability of cancer cells. The binding of substance P (SP) to NK-1R in neoplastic cells plays a pivotal role in cancer progression by promoting neoplastic cell growth, protecting tumour cells from apoptosis, triggering invasion and metastasis through enhanced migration of cancer cells, and stimulating endothelial cell proliferation for tumour angiogenesis. Remarkably, all types of human TC (papillary, follicular, medullary, anaplastic), as well as met-astatic lesions, exhibit overexpression of SP and NK-1R compared to the normal thyroid gland. TC cells synthesize and release SP, which exerts its multiple functions through autocrine, para-crine, intracrine, and neuroendocrine processes, including the regulation of tumour burden. Con-sequently, the secretion of SP from TC results in increased SP levels in plasma, which are signifi-cantly higher in TC patients compared to controls. Additionally, NK-1R antagonists have demonstrated a dose-dependent antitumour action. They impair cancer cell proliferation on one side and induce apoptosis of tumour cells on the other side. Furthermore, it has been demonstrat-ed that NK-1R antagonists inhibit neoplastic cell migration, thereby impairing both invasiveness and metastatic abilities, as well as angiogenesis. Given the consistent overexpression of NK-1R in all types of TC, targeting this receptor represents a promising therapeutic approach for TC. Therefore, NK-1R antagonists, such as the drug aprepitant, may represent novel drugs for TC treatment.

Alterations in the carnitine shuttle system may be an indication of the presence of cancer. As such, in-depth analyses of this pathway in different malignant tumors could be important for the detec-tion and treatment of this disease. The current study aims to assess the profiles of carnitine and acylcarnitines in gliomas with respect to their grade, the presence of isocitrate dehydrogenase (IDH) mutations, and 1p/19q co-deletion. Brain tumors obtained from 19 patients were sampled on-site using solid-phase microextraction (SPME) immediately following excision. Analytes were desorbed and then analyzed via liquid chromatography-high resolution mass spectrometry. The results showed that SPME enabled the extraction of carnitine and 22 acylcarnitines. An analysis of the correlation factor revealed presence of two separate clusters: short-chain and long chain car-nitine esters. Slightly higher carnitine and acylcarnitine concentrations were observed in the higher malignancy tumor samples (high vs low grade), and in those samples with worse projected clinical outcomes (without vs with IDH mutation; without vs with 1p/19q co-deletion). Thus, the proposed chemical biopsy approach offers a simple solution for on-site sampling that enables sample preservation, thus supporting comprehensive multi-method analyses.

Background: Recently we demonstrated that Astragalus polysaccharide (PG2), the active ingredient in dried roots of astragalus membranaceus, ameliorates cancer symptom clusters and improve quality of life (QoL) in patients with metastatic disease by modulating inflammatory cascade, against the background that inflammatory cells including macrophages, dendritic cells (DCs), and cytotoxic T lymphocytes (CTLs) in tumor initiation, metastasis, and progression. Nevertheless, the role of PG2 in the modulation of anticancer immunogenicity and therapeutic response remains relatively underexplored and unclear. Purpose: The present study investigates how and to what extent PG2 modulates cellular and biochemical components of the inflammatory cascade, enhance anticancer immunity, and the therapeutic implication of same in patients with lung cancer. Methods and Results: Herein, we demonstrated that PG2 significantly increased the M1/M2 macrophage polarization ratio in non-small cell carcinoma (NSCLC) H441 and H1299 cells. This PG2-induced preferential pharmacologic up-regulation of tumoral M1 population in vitro, positively correlated with the downregulation of tumor-promoting IL-6 and IL-10 expression in NSCLC cell-conditioned medium, with concomitant marked inhibition of cell proliferation, clonogenicity and tumorsphere formation. Our ex vivo results, using clinical sample from our NSCLC cohort, demonstrated that PG2 also promoted the functional maturation of DCs with consequent enhancement of T cell-mediated anticancer immune responses. Consistent with the in vitro and ex vivo results, our in vivo studies showed that mice treated with PG2 exhibited significant time-dependent depletion of the tumor-associated M2 population, synergistically enhanced the anti-M2-based anticancer effect of cisplatin, and inhibition of xenograft tumor growth in the NSCLC mice models. Moreover, in the presence of PG2, cisplatin-associated dyscresia and weight-loss was markedly suppressed. Conclusion: These results do indicate a therapeutically-relevant role for PG2 in modulating the M1/M2 macrophage pool, facilitating DC maturation, and synergistically enhancing the anticancer effect of conventional chemotherapeutic agent, cisplatin; thus laying the foundation for further exploration of the curative relevance of PG2 as surrogate immunotherapy and/or clinical feasibility of its use for maintenance therapy in patients with lung cancer.

Triple-negative breast cancer (TNBC) is an aggressive and highly metastatic type of tumor. TNBC is often enriched in tumor-infiltrating neutrophils (TINs), which support cancer growth in part by counteracting tumor-infiltrating lymphocytes (TILs). Prior studies identified the enhancer of zeste homolog 2 (EZH2) as a pro-tumor methyltransferase in primary and metastatic TNBC. We hypothesized that EZH2 inhibition in TNBC cells per se would exert anti-tumor activity by altering the tumor immune microenvironment. To test this hypothesis, we used CRISPR to generate EZH2-knockout (KO) and overexpressing lines from parent (wild-type -WT) 4T1 cells, an established murine TNBC model. In vitro, EZH2 KO and OE cells showed little change in replicative capacity and invasiveness, but marked changes in surface marker profile and cytokine/chemokine secretion compared to WT cells. On in vivo injection, EZH2 KO cells showed significantly reduced primary tumor growth and a 10-fold decrease in lung metastasis compared to WT cells, while EZH2 OE cells were unchanged. Compared to WT tumors, TIN:TIL ratios were greatly reduced in EZH2 KO tumors but unchanged in EZH2 OE tumors. Our findings show a tumor-intrinsic role of EZH2 in the 4T1 TNBC model in regulating TIN/TIL poise, primary tumor progression and lung metastasis in vivo.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Currently, skin cancer is the most commonly diagnosed form of cancer in humans and is one of the leading causes of death in patients with cancer. Biopsy methods are an invasive research method and are not always available for primary diagnosis. Imaging methods have low accuracy and depend on the experience of the dermatologist. Artificial intelligence technologies can match and surpass visual analysis methods in accuracy, but they have the risk of a false negative response when a malignant pigmented lesion can be recognized as benign. One possible way to improve accuracy and reduce the risk of false negatives is to analyze heterogeneous data, combine different preprocessing methods, and use modified loss functions to eliminate the negative impact of unbalanced dermatological data. The paper proposes a multimodal neural network system with a modified cross-entropy loss function that is sensitive to unbalanced heterogeneous dermatological data. The accuracy of recognition in 10 diagnostically significant categories for the proposed system was 85.19%. The novelty of the proposed system lies in the use of cross-entropy loss when training the modified function with the help of weight coefficients. The introduction of weighting factors has reduced the number of false negative forecasts, as well as improved accuracy by 1.02-4.03 percentage points compared to the original multimodal systems. The introduction of the proposed multimodal system as an auxiliary diagnostic tool can reduce the consumption of financial and labor resources involved in the medical industry, as well as increase the chance of early detection of skin cancer.

Breast cancer is a leading cause of death among women. Conventional screening methods, such as mammography, and ultrasound diagnosis are expensive and have significant limitations. Digital Image Elasto Tomography (DIET) is a new noninvasive breast cancer screening system that has a potential to be a low cost and reliable breast cancer screening tool. It is based on modal analysis of the breast mass, and stereographic 3D image analysis to detect the stiffer abnormal tissues. However, camera sensor noise, especially Gaussian noise is a major source of Optical Flow (OF) error in this approach to tumor detection. This work studies the performance of different conventional filters, including the standard Gaussian filter tool to remove this noise and produce more robust screening results. A radical approach, Multiple Frame Noise Removal (MFNR) is proposed, for use in this type of medical image processing instead of a Gaussian filter or other typical image noise removal tools. Its a multiple frame noise removal method where Probability Density Function (PDF) of noise is extracted from the multiple images by characterizing the same pixel positions in multiple images. The noise becomes deterministic, and hence easily removed. The proposed algorithm was applied to a data set from 10 phantom breast tests with a prototype DIET system, and 10 in-vivo samples from healthy women. Comparisons were made to an optimal Gaussian filter form that is commonly used. Reductions in OF error using these digitally imaged data sets was used to compare performance. Refinement of the images for medical applications requires higher PSNR, which was successfully achieved by using MFNR algorithm. In this study, the algorithm was used to improve the imaging results of a DIET system. The conventional wisdom that states that noise removal and detail preservation are contrasting effects is

Aim. To study the processes of lipid peroxidation and the activity of antioxidant defense enzymes depending on the chemiluminescent activity of neutrophilic granulocytes in patients with gastric cancer associated with H. pylori infection, depending on the stage. Materials and methods. 39 patients with stage I-II gastric cancer and 30 patients with stage III-IV gastric cancer were examined. The study of the chemiluminescent activity of neutrophilic granulocytes was carried out, the parameters of the lipid peroxidation system and antioxidant protection in plasma were determined using the spectrophotometric method. Statistical data processing was performed using the Statistica 7.0 software package (StatSoft, USA). Results. In patients with gastric cancer associated with H. pylori infection, regardless of stage, the proportion of neutrophilic granulocytes with normal activity does not exceed 1/3 of the total number of patients, the remaining 2/3 of patients have an altered chemiluminescent activity of neutrophilic granulocytes: in patients with gastric cancer by I -II stage of the disease, the majority revealed a reduced function of neutrophilic granulocytes, and in patients with gastric cancer stage III-IV of the disease, the majority showed increased chemiluminescent activity of neutrophilic granulocytes. In all patients with gastric cancer associated with H. pylori infection, regardless of the stage of the disease, an increase in lipid peroxidation processes with activation of antioxidant defense enzymes was detected. Conclusion. In all patients with gastric cancer associated with H. pylori infection, regardless of the stage of the disease, an increase in lipid peroxidation processes with activation of antioxidant defense enzymes was detected. At the same time, there are no statistically significant differences between the indicators of the system lipid peroxidation - antioxidant protection depending on the stage of gastric cancer and the chemiluminescent activity of neutrophilic granulocytes, which probably indicates that all reactive oxygen species produced by neutrophilic granulocytes in the respiratory burst are consumed locally, minimally affecting the development of oxidative stress in the blood plasma.

Background: This study assessed the nephrotoxicity of oral BRAF inhibitors (BRAFi), regorafenib (REG) and encorafenib (ENC), in metastatic colorectal cancer (mCRC), through an analysis of re-ports from the US Food and Drug Administration's Adverse Event Reporting System (FAERS) da-tabase. Methods: A descriptive and disproportional analyses were performed for all reports with ENC and REG as the primary suspect. Results: A total of 379 reports had at least one renal ADR, mainly related to REG (93.1%). Potential safety signals for REG particularly included chromaturia (n = 44; ROR = 12.00, CI 95% = 8.92-16.16; IC = 2.36, IC025-IC075 = 2.06-2.66), hydronephrosis (10; 8.70, 4.67-16.19; 1.85, 1.23-2.47), nephrotic syn-drome (7; 5.73, 2.73-12.03; 1.47, 0.73-2.21), renal impairment (53; 4.16, 3.17-5.45; 1.39, 1.12-1.66), dys-uria (19; 3.06, 1.95-4.81; 1.06, 0.61-1.52), renal failure (38; 1.66, 1.20-2.28; 0.49, 0.17-0.81), and acute kidney injury (AKI) (43; 1.46, 1.08-1.97; 0.37, 0.07-0.67). For ENC, consistent disproportionalities were observed for AKI (n = 11; ROR = 3.79, CI 95% = 2.09-6.90; IC = 1.32, IC025-IC075 = 0.72-1.91) and dysuria (4; 6.50, 2.43-17.39; 1.86, 0.88-2.85). Conclusions: These findings highlighted some not extensively reported renal ADRs that required further investigations to better characterize the safety profile of BRAFi in patients with mCRC.

Over the past several years there has been much debate with regards to the prognostic and clinical significance of pancreatic ductal adenocarcinoma (PDAC) with lymph nodes metastasis. The PDAC gene-expression knowledge and the biologic alterations underlying the lymph node involvement convey a clinical implication in dealing with the theranostic window.To this end, we provide an original bioinformatic dissection of the gene-expression differences of PDAC according to the nodal involvement from a large public available dataset. Comprehensive transcriptomic analysis from 143 RNA-seq patient’s derived samples indicated that WNT increased activation and a peculiar immune-microenvironment identify subjects with nodal involvement.In frame of this thinking, we validated the WNT pathway role in increasing the likelihood of lymphatic dissemination in vitro. Moreover, we demonstrated for the first time in a PDAC model the potential therapeutic window that XAV-939, a specific WNT pathway inhibitor, has in re-educating a tumour permissive immune system. Finally, we outline the potential implication on bystander molecular drivers exerted by WNT molecular inhibition, providing a picture of the proteomic oncogenic landscape changes elicited by XAV-939 on PDAC cells and their clinical implication. Our findings hold the promise to identify novel immune-based therapeutic strategies targeting WNT to enhance PDAC cytotoxicity and restore anti-PDAC immunity in nodes-positive disease.

Tspo is a receptor involved in the regulation of cellular proliferation, apoptosis and mitochondrial functions. Previous studies showed the expression of TSPO protein correlated positively with tumour malignancy and negatively with patient survival. The aim of this study was to determine the transcription of Tspo mRNA in various types of normal and cancer tissues. In situ hybridization was performed to localise the Tspo mRNA in various human normal and cancer tissues. The relative level of Tspo mRNA was quantified using fluorescent intensity and visual estimation of colorimetric staining. RT-PCR was used to confirm these mRNA levels in normal lung, lung cancer, liver cancer and cervical cancer cell lines. There was a significant increase in the level of transcription in liver, prostate, kidney and brain cancers while a significant decrease was observed in cancers of the colon and lung. Quantitative RT-PCR confirmed that the mRNA levels of Tspo are higher in a normal lung cell line than in a lung cancer cell line. An increase in the expression levels of TSPO makes it a good diagnostic biomarker and TSPO could serve as a target for anticancer drug development.

Background: The Micro Hand S robot is the first domestically produced surgical robot that has entered clinical use in China, and this is the first report of its application in colon cancer. Objective: This study aimed to validate the safety and efficacy of the domestically produced Chinese minimally invasive Micro Hand S surgical robot system in complex surgery, such as robotic complete mesocolic excision (R-CME). Methods: From March 2018 to December 2018, 30 patients with right hemicolon cancer underwent R-CME with the Micro Hand S robot system. The operative findings, morbidities, oncological findings and unique characteristics were summarizedwere analyzed. Result: 12 patients with right hemicolon cancer and 18 patients with sigmoid colon cancer underwent RCME with the Micro Hand S robot system. During the study period, the median operative duration was 209 (range, 180-255) min, and the median estimated blood loss volume was 35 (range, 25-75) ml. The median number of lymph nodes harvested was 42 (21-77), and the median postoperative hospital stay was 5 (range, 4-7) days. According to the Clavien-Dindo classification, there were no severe complications except for 7 cases of grade I complications and 5 cases of grade II complications. The conversion rate for all operations was 0%. There were no cases of 30-day readmission or 30-day mortality. Conclusion: Clinical application of domestically produced Chinese minimally invasive surgical robot system “Micro Hand S ” in selected colon cancer patients is technically feasible and safe.

Background: The Micro Hand S robot is the first domestically produced surgical robot that has entered clinical use in China, and this is the first report of its application in colon cancer.Objective: This study aimed to validate the safety and efficacy of the domestically produced Chinese minimally invasive Micro Hand S surgical robot system in complex surgery, such as robotic complete mesocolic excision (R-CME).Methods: From March 2018 to December 2018, 30 patients with right hemicolon cancer underwent R-CME with the Micro Hand S robot system. The operative findings, morbidities, oncological findings and unique characteristics were summarizedwere analyzed.Result: 12 patients with right hemicolon cancer and 18 patients with sigmoid colon cancer underwent RCME with the Micro Hand S robot system. During the study period, the median operative duration was 209 (range, 180-255) min, and the median estimated blood loss volume was 35 (range, 25-75) ml. The median number of lymph nodes harvested was 42 (21-77), and the median postoperative hospital stay was 5 (range, 4-7) days. According to the Clavien-Dindo classification, there were no severe complications except for 7 cases of grade I complications and 5 cases of grade II complications. The conversion rate for all operations was 0%. There were no cases of 30-day readmission or 30-day mortality. Conclusion: Clinical application of domestically produced Chinese minimally invasive surgical robot system “Micro Hand S ” in selected colon cancer patients is technically feasible and safe.

The microbiome, once considered peripheral, is emerging as a relevant player in the intricate web of factors contributing to cancer development and progression. These often overlooked microorganisms, in the context of urological malignancies, have been investigated primarily focusing on the gut microbiome, while exploration of urogenital microorganisms remains limited. In light of this, our systematic review delves into the complex role of these understudied actors in various neoplastic conditions, including prostate, bladder, kidney, penile, and testicular cancers. Our analysis found a total of 37 studies, with prostate cancer-12, bladder cancer-20, kidney cancer-4, penile/testicular cancer-1, which reveals distinct associations specific to each condition, hinting at potential therapeutic avenues and future biomarker discoveries. It becomes evident that further research is imperative to unravel the complexities of this domain and provide a more comprehensive understanding.

Nanosized drug delivery systems (DDS) have been studied as a novel strategy against cancer due to their potential to simultaneously decrease drug inactivation and systemic toxicity and increase passive and/or active drug accumulation within the tumor(s). Triterpenes are plant-derived compounds with interesting therapeutic properties. Betulinic acid (BeA) is a pentacyclic triterpene which has great cytotoxic activity against different cancer types. Herein, we developed a nanosized protein-based DDS of bovine serum albumin (BSA) as the drug carrier combining two compounds: doxorubicin (Dox) and the triterpene BeA using an oil-water-like micro-emulsion method. Spectrophotometric assays were performed to determine protein and drug concentrations in the DDS. The biophysical properties of these DDS were characterized using dynamic light scattering (DLS) and circular dichroism (CD) spectroscopy confirming nanoparticle (NP) formation and drug loading into the protein structure, respectively. The encapsulation efficiency was 77% for Dox and 18% for BeA. More than 50% of both drugs were released within 24 h, at pH 6.8, while less drug was released at pH 7.4 in this time period. Co-incubation viability assays of Dox and BeA alone for 24 h demonstrated synergistic cytotoxic activity in the low μM range against the non-small cell lung carcinoma (NSCLC) A549 cells. Viability assays of the BSA(Dox+BeA) DDS demonstrated a higher synergistic cytotoxic activity than the two drugs with no carrier. Moreover, confocal microscopy analysis confirmed cellular internalization of the DDS and nucleus accumulation of the Dox. We determined the mechanism of action of the BSA(Dox+BeA) DDS, confirming S-phase cell cycle arrest, DNA damage, caspase cascade activation, and downregulation of the epidermal growth factor receptor (EGFR) expression. This DDS has the potential to synergistically maximize the therapeutic effect of Dox and diminish chemoresistance induced by EGFR expression using a natural triterpene against NSCLC.

Inherited mutations in BRCA1 and BRCA2 genes increase risks for breast, ovarian, and other cancers. Both genes encode proteins for accurately repairing chromosome breaks. If mutations inactivate this function, broken chromosomes may not be restored correctly, allowing breaks to persist or rearrange chromosomes. These abnormalities are potentially catastrophic events that can originate from viral infections. I used bioinformatic analyses of publicly available breast cancer patient data to show that the distribution of chromosome breaks in hereditary breast cancers differs markedly from sporadic breast cancers. Then I tested hereditary breast cancer sequence data around chromosome breaks for DNA similarity to all known viruses. Human DNA flanking breakpoints usually had decisive matches to Epstein-Barr virus (EBV / HHV4) tumor variants HKHD40 and HKNPC60. Many breakpoints were near EBV genome anchor sites, human EBV tumor-like sequences, EBV-associated epigenetic marks, and some fragile sites. On chromosomes 2 and 12, sequences near EBV genome anchor sites accounted for 90% and 88% of breakpoints (p<0.0001), respectively. On chromosome 4, 51/52 inter-chromosomal breakpoints were close to EBV-like sequences in 19 hereditary breast cancers. In contrast, 19 sporadic breast cancers only had 12 interchromosomal breakpoint regions on chromosome 4 near EBV-like sequences. On various other chromosomes, five EBV genome anchor sites were near hereditary breast cancer breakpoints at precisely defined, disparate gene or LINE locations. Independent evidence further implicating EBV in hereditary breast cancer breakpoints is that 25 breast cancer break positions are within 1.25% of breakpoints in model EBV cancers. In addition to BRCA1 or BRCA2 mutations, all the hereditary breast cancers had mutated genes essential for immune responses. This compromise facilitates reactivation of herpes viruses which produce nucleases capable of breaking chromosomes. EBV also causes other deleterious effects: anchored EBV episomes can interfere with normal replication and obstruct DNA break repairs; even very early infection causes massive transcription changes. The results, therefore, imply proactive treatment and prevention of herpes viral infections may prevent some chromosome breaks and benefit BRCA mutation carriers.

Urological cancers include a spectrum of malignancies affecting organs of the reproductive and/or urinary systems, such as prostate, kidney, bladder, and testis. Despite improved primary prevention, detection and treatment, urological cancers are still characterized by an increasing incidence and mortality worldwide and although advances have been made toward understanding the molecular basis of these diseases, a complete insight of the pathogenic mechanisms is still a research challenge for defining safer pharmacological therapies and prognostic factors, especially for the metastatic stage of these neoplasms for which no effective therapies exist. Glyoxalases are enzymes that catalyzes the glutathione-dependent metabolism of cytotoxic methylglyoxal (MG), thus protecting against cellular damage and apoptosis. They are generally overexpressed in numerous cancers as a survival strategy by providing a safeguard through enhancement of MG detoxification. Increasing evidence suggest that glyoxalases, especially Glo1, would act as oncogenes in urological malignancies and be central to their initiation, growth and progression. In this review, we highlight the critical role of glyoxalases as regulators of tumorigenesis in the prostate through modulation of various critical signaling pathways, and provide an overview of the current knowledge on glyoxalases in bladder, kidney and testis cancers. We also discuss the promise and challenges for Glo1 inhibitors as future anti-PCa therapeutics and the potential of glyoxalases as biomarkers for PCa diagnosis.

Gastroesophageal (GE) junction adenocarcinoma is an aggressive malignancy of growing incidence and is associated with public health issues such as obesity and GERD. Management has evolved over the last 2 decades to incorporate a multidisciplinary approach including endoscopic intervention, and neoadjuvant chemotherapy/ chemoradiation and minimally invasive or more limited surgical approaches. Surgical approaches include esophagectomy, total gastrectomy, and more recently proximal gastrectomy. This review analyzes the evidence for and applicability of these varied approaches in management as well areas of continued controversy and investigation.

Epidemiological studies on micronutrient consumption have reported protective associations in the incidence and/or progression of various cancer types. Supplementation with some of these micronutrients has been analyzed, showing chemoprotection, low toxicity, antiproliferation, and the ability to modify epigenetic signatures in various cancer models. The following review inves-tigates the reported effects of micronutrient intake or supplementation in breast cancer progres-sion. A PubMed search was conducted with the keywords “micronutrients breast cancer progres-sion,” and the results were analyzed. The selected micronutrients were: Vitamins (A, C, D, and E), Folic Acid, metals (Cu, Fe, Se, and Zn), fatty acids, polyphenols, and iodine. The majority of in vitro models showed antiproliferative, cell cycle arrest, and antimetastatic effects for almost all the micronutrients analyzed, but these effects do not reflect animal or human studies. Only one clinical trial with Vitamin D and one pilot study with molecular iodine showed favorable overall survival and disease-free interval.

: Cancer metastasis is the lethal developmental step in cancer, responsible for the majority of cancer deaths. To metastasize, cancer cells must acquire the ability to disseminate systemically and to escape an activated immune response. Here, we endeavoured to investigate if metastatic dissemination reflects acquisition of genomic traits that are selected for. We acquired mutation and copy number data from 8,332 tumours representing 19 cancer types acquired from The Cancer Genome Atlas and the Hartwig Medical Foundation. A total of 827,344 non-synonymous mutations across 8,332 tumour samples representing 19 cancer types were timed as early or late relative to copy number alterations, and potential driver events were annotated. We found that metastatic cancers had significantly higher proportion of clonal mutations and a general enrichment of early mutations in p53 and RTK/KRAS pathways. However, while individual pathways demonstrated a clear time-separated preference for specific events, the relative timing did not vary between primary and metastatic cancers. These results indicate that the selective pressure that drives cancer development does not change dramatically between primary and metastatic cancer on a genomic level, and is mainly focused on alterations that increase proliferation.

Epidemiological data highlight prostate cancer as a significant global health issue, with high incidence and substantial impact on patients' quality of life. The prevalence of this disease is associated with various factors, including age, heredity, and race. Recent research in prostate cancer genetics has identified several genetic variants that may be associated with an increased risk of developing the disease. However, despite the significance of these findings, genetic markers for prostate cancer are not currently utilized in clinical practice as reliable indicators of the disease. In addition to genetics, epigenetic alterations also play a crucial role in prostate cancer development. Aberrant DNA methylation, changes in chromatin structure, and microRNA (miRNA) expression are major epigenetic events that influence oncogenesis. Existing markers for prostate cancer, such as prostate-specific antigen (PSA), have limitations in terms of sensitivity and specificity. The cost of testing, follow-up procedures, and treatment for false-positive results and overdiagnosis contributes to the overall healthcare expenditure. Improving the effectiveness of prostate cancer diagnosis and prognosis requires either narrowing the risk group by identifying new genetic factors or enhancing the sensitivity and specificity of existing markers. Immunological biomarkers (both circulating and intra-tumoral), including markers of immune response and immune dysfunction, represent a potentially useful area of research for enhancing the diagnosis and prognosis of prostate cancer. Our review emphasizes the need for developing novel immunological biomarkers to improve the diagnosis, prognosis, and management of prostate cancer. We highlight the most recent achievements in the identification of biomarkers provided by circulating monocytes and tumor-associated macrophages (TAMs). We highlight that monocytes-derived and TAMs-derived biomarkers can enable to establish the missing links between genetic predisposition, hormonal metabolism and immune responses in prostate cancer.

Mammography is often used as the most common laboratory method for the detection of breast cancer, yet associated with the high cost and many side effects. Machine learning prediction as an alternative method has shown promising results. This paper presents a method based on a multilayer fuzzy expert system for the detection of breast cancer using an extreme learning machine (ELM) classification model integrated with radial basis function (RBF) kernel called ELM-RBF, considering the Wisconsin dataset. The performance of the proposed model is further compared with a linear-SVM model. The proposed model outperforms the linear-SVM model with RMSE, R², MAPE equal to 0.1719, 0.9374 and 0.0539, respectively. Furthermore, both models are studied in terms of criteria of accuracy, precision, sensitivity, specificity, validation, true positive rate (TPR), and false-negative rate (FNR). The ELM-RBF model for these criteria presents better performance compared to the SVM model.

In the era of nanotechnology, researchers are implementing point to care service to cancer patients to detect malignancy beforehand and to reduce the mortality rate of cancers. Cancer is known to be the most fatal disease among all other diseases and the survivability from cancer is quite impossible if the stage of the cancer is an advanced level. Though the early detection of cancer can increase the chances of survival with a double fold. Biosensor is a part of nanotechnology which is capable to provide point to care service in the field of medicine. With the rising number of cancer occurrences being identified around the world and the increasing number of deaths because of the identification of advanced cancer, biosensors can play a significant part in the early detection of cancer. New molecular methods, including as genomic and proteomic approaches, are increasingly being used to study patient molecular profiles. When such diagnosis method is paired with bioinformatics tools, they generate new data that can be used to discover new disease biomarkers. Finding precise and sensitive indicators that are corelated to a specific disease, as with many other diseases, can be challenging. Furthermore, the concentration of biomarkers in biological fluids varies according to illness states and phases. Peptides, proteins, up or down regulated expression of gene markers, and gene alternation are all examples of molecular markers that are commonly used to diagnose cancer. In this article, we have highlighted six different deadliest cancers such as Ovarian, Breast, Prostrate, Lung, Colorectal and Liver cancer. The article contains distinct types of biomarkers which are normally found in these kinds of cancer and generally used as a potential diagnostic target in the medicine field. The article mainly summarized the application of different types of biosensors devices in the detection of the mostly found biomarkers in the above cancer types.

Gambogic acid, a common traditional Chinese medicine and widely distributed throughout South China, Vietnam, Cambodia, and Thailand. It is prenylated xanthone which is the significant bioactive compound of gamboge. Gambogic acid is known as a strong apoptotic inducer in cancer cells. It has been found as strong anticancer agent against various types of cancer cells lines such as breast cancer, pancreatic, and cervical cancer. It induces apoptosis, down regulates the anti-apoptotic proteins (survivin and BCL2,) and down regulates the activities of P-glycoprotein in drug sensitive human breast MCF-7 and drug-resistant MCF-7/ADR cells. Similarly, it also exerts alteration in P13K, AKT, p21, MMP-2 &-9, and phosphorylated-AKT expressions. The current review highlights the anticancer and chemo-preventive perspectives of gambogic acid and its mechanistic role against human and animal cancers.

Objective: To provide mechanistic evidence for the epidemiological link between long-term use of alcohol containing mouthwashes and oral cancer.Methods: Human epithelial keratinocytes were exposed for 30 seconds to concentrations of ethanol commonly present in mouthwashes. After a recovery period, cell viability was assessed with the MTT assay.Results: A marked cytotoxic effect was observed for ethanol concentrations of 20% and above. Conclusions: The cytotoxicity of ethanol can explain the epidemiological association between mouthwash use and oral cancer. Recent findings indicate that the risk of developing cancer in a tissue is strongly determined by the number of stem cell divisions accumulated by the tissue during a person's lifetime; cell division is a major source of mutations and other cancer-promoting errors. Since cell death activates the division of stem cells, the cytotoxicity of ethanol on the cells lining the oral mucosa will promote the division of the stem cells located in deeper layers to produce new cells to regenerate the damaged epithelium. If we regularly use mouthwashes containing cytotoxic concentrations of ethanol, we will force the stem cells of the oral cavity to divide more often than usual and our risk of developing oral cancer will probably increase.Clinical significance: Many mouthwashes contain percentages of ethanol above 20%. Because ethanol is not crucial to prevent and reduce gingivitis and plaque, members of the dental team should consider the potential risk of oral cancer associated with frequent use of alcohol containing mouthwashes when advising their patients.

Patients with metastatic triple negative breast cancer (TNBC) need new therapies to improve the low survival rates achieved with standard treatments. In this work, we show that the survival of mice with metastatic TNBC can be markedly increased by replacing their normal diet with artificial diets in which the levels of amino acids (AAs) and lipids are strongly manipulated. After observing selective anticancer activity in vitro, we prepared five artificial diets and evaluated their anticancer activity in a challenging model of metastatic TNBC. The model was established by injecting 4T1 murine TNBC cells into the tail vein of immunocompetent BALB/cAnNRj mice. First-line drugs doxorubicin and capecitabine were used as positive controls. AA manipulation led to modest improvements in mice survival when the levels or lipids were normal. Reducing lipid levels to 1% markedly improved the activity of several diets with different AA content. Mice fed the artificial diets as monotherapy lived longer than mice treated with doxorubicin and capecitabine. An artificial diet without 10 non-essential AAs, with reduced levels of essential AAs, and with 1% lipids improved the survival not only of mice with TNBC but also of mice with other types of metastatic cancers.

The cancer stem cell hypothesis suggests that neoplastic cells with stem characteristics hierarchically regulate tumor generation and its high cellular heterogeneity. These cells have been detected in all cancer types, and specific signaling pathways give the regulation of self-renewal and differentiation. In prostate cancer, androgen receptor signaling has been extensively studied, and in non-stem cells, it promotes cell proliferation and tumor progression, but in the cancer stem cell population, it negatively regulates processes such as self-renewal. However, in other types of cancer, such as breast and glioblastoma, the androgen receptor seems to favor the maintenance of cancer stem cells, suggesting that androgen signaling has different effects depending on the tumor context. This review discusses the role of androgen receptor in maintaining cancer stem cells by regulating proliferation, self-renewal, and differentiation, as well as the possible signaling pathways involved in these processes.

The COVID-19 pandemic has led to numerous delays in cancer-related care and cancer-specific screening, but the extent is not fully understood. For those that experience a delay or disruption in care, health related self-management is required to re-engage in care pathways and the role of health literacy in this pathway has not been explored. The purpose of this analysis is to (1) report the frequency of self-reported delays in cancer treatment and preventative screening services at an academic, NCI-designated center during the COVID-19 pandemic and (2) investigate cancer-related care and screening delays among those with adequate and limited health literacy. A cross-sectional survey was administered from an NCI-designated Cancer Center with a rural catchment area during November 2020 through March 2021. Nearly 19 percent of participants were categorized as having limited health literacy. Twenty percent of those with a cancer diagnosis reported a delay in cancer-related care; and 23-30% of the sample reported a delay in cancer screening. In general, the proportions of delays among those with adequate and limited health literacy were similar with the exception of colorectal cacner screening. There was also a notable difference in the ability to re-engage in cervical cancer screening among those with adequate and limited health literacy. Thus, there is a role for those engaged in cancer-related education and outreach to offer additional navigation resources for those at risk to cancer-related care and screening disruptions. Future study is warranted to investigate the role of health literacy on cancer care engagement.

Despite the recognized benefits of fecal occult blood test (FOBT) and mammography screenings, participation in breast (BC) and colorectal cancer (CRC) screening programs is still suboptimal. This study investigates municipal characteristics associated with their BC/CRC screening uptake profiles among women aged 55–69 years. Using data from 308 municipalities of Flanders from 2014 to 2017, a profile for each municipality based on its BC/CRC screening uptake compared with the median screening uptake was created. Logistic regression with generalized estimating equations was used to assess the associations between municipal characteristics and BC/CRC screening uptake profiles. The overall median uptake of cancer screening was higher for CRC (57.4%) than for BC (54.6%). The following municipal characteristics were associated with worse performance in terms of only CRC, only BC, or both CRC and BC screening uptake, respectively: foreign nationality, self-employment rate, (early) retirement rate, diabetes, disabilities; (early) retirement rate; age group 65–69, foreign nationality, self-employment rate, (early) retirement rate, wage-earners, diabetes. The following municipal characteristics were associated with better performance in terms of only CRC, only BC, or both CRC and BC screening uptake respectively: residential stability, having a partner, having children, jobseeker rate, GP visits, preventive dental visits; having children, GP visits; age group 55–59, residential stability, having a partner, having children, jobseeker rate, higher education, GP visits, preventive dental visits. This study’s results regarding the interrelation between the BC and CRC screening could be used to tailor interventions to improve the participation of the target population in both programs.

Several infectious agents are ascertained causes of cancer, but the burden of cancer mortality attributable to carcinogenic infections in Italy was still unknown. To tackle this issue, we calculated the rate and regional distribution of cancer deaths due to infections sustained by seven pathogens ranked as group-1 carcinogenic agents in humans by IARC. Population attributable fractions related to these agents were applied to annual statistics of cancer deaths coded according to 10th International Classification of Diseases. The estimated burden of cancer mortality attributable to carcinogenic infections in Italy during the period 2011-2015 was on average 8.7% of all cancer deaths registered yearly. Approximately 60% of deaths occurred in men and almost the whole burden was due to four infectious agents (Helicobacter pylori, HCV, HPV, and HBV). The analysis of regional distribution showed a higher number of infection-related cancer deaths in the northern regions, where the estimates reached 30 (Liguria) and 28 (Friuli Venezia Giulia) deaths per 100,000 inhabitants in 2015. Since one-twelfth of cancer deaths were attributable to these modifiable risk factors, the implementation of appropriate prevention and treatment interventions may help to reduce the impact of these infections on cancer mortality.

Inherited mutations in BRCA1 and BRCA2 genes increase risks for breast, ovarian, and other cancers. Both genes encode proteins for accurately repairing chromosome breaks. If mutations inactivate this function, chromosome fragments may not be restored correctly. Resulting chromosome rearrangements can become critical breast cancer drivers. Because I had data from thousands of cancer structural alterations that matched viral infections, I wondered whether infections contribute to chromosome breaks and rearrangements in hereditary breast cancers. There are currently no interventions to prevent chromosome breaks because they are thought to be unavoidable. However, if chromosome breaks come from infections, they can be treated or prevented. I used bioinformatic analyses to test publicly available breast cancer sequence data around chromosome breaks for DNA similarity to all known viruses. Human DNA flanking breakpoints usually had the strongest matches to Epstein-Barr virus (EBV) tumor variants HKHD40 and HKNPC60. Many breakpoints were near sites that anchor EBV genomes, human EBV tumor-like sequences, EBV-associated epigenetic marks, and fragile sites. On chromosome 2, sequences near EBV genome anchor sites accounted for 90% of breakpoints (p<0.0001). On chromosome 4, 51/52 inter-chromosomal breakpoints were close to EBV-like sequences. Five EBV genome anchor sites were near breast cancer breakpoints at precisely defined, disparate gene or LINE locations. Breakpoint flanking regions resembled known EBV-cancers. Twenty-five breakpoints in breast cancers were within 1.25% of EBV cancer breakpoints. In addition to BRCA1 or BRCA2 mutations, all the breast cancers had mutated genes essential for immune responses. Because of this immune compromise, herpes viruses can activate and produce nucleases that break chromosomes. Alternatively, anchored viral episomes can obstruct break repairs, whatever the cause. The results, therefore, imply proactive treatment and prevention of herpes viral infections may prevent some chromosome breaks and benefit BRCA mutation carriers.

There is a rich history of cancer treatments which provides a number of important lessons for present and future cancer therapies. We outline this history by looking in the past, reviewing the current landscape of cancer treatments, and by glancing at the potential future cancer therapies.

Targeted therapies with antiangiogenic drugs (e.g., sunitinib) and immune checkpoint inhibitors (e.g., anti-PD-1 antibodies) are the standard of care for patients with metastatic renal cell carcinoma. Although these treatments improve patient survival, they are rarely curative. We previously hypothesized that advanced cancers might be treated without drugs by using artificial diets in which the levels of specific amino acids (AAs) are manipulated. In this work, after showing that AA manipulation induces selective anticancer activity in renal cell carcinoma cells in vitro, we evaluated the anticancer activity of 17 artificial diets in a challenging animal model of renal cell carcinoma. The model was stablished by injecting murine renal cell carcinoma (Renca) cells into the peritoneum of immunocompetent BALB/cAnNRj mice. Mice survival was markedly improved when their normal diet was replaced with our artificial diets. Mice fed a diet lacking six AAs (diet T2) lived longer than mice treated with sunitinib or anti-PD-1 immunotherapy; several animals lived very long or were cured. Controlling the levels of several AAs (e.g., cysteine, methionine and leucine) and lipids was important for the anticancer activity of the diets. Additional studies are needed to further evaluate the therapeutic potential of this simple and inexpensive anticancer strategy.

Survivin was initially identified as a member of the inhibitor apoptosis (IAP) protein family and has been shown to play a critical role in regulation of both apoptosis and mitosis. Survivin has emerged as an attractive target for cancer therapy because its overexpression has been found in most human cancers and is frequently associated with chemotherapy resistance, recurrence, and poor survival rate in cancer patients. In this review, we discuss our current understanding of how survivin mediates various aspects of malignant transformation and drug resistance, as well as efforts that have been made to develop therapeutics targeting survivin for the treatment of cancer.

Despite advances in our understanding of molecular aspects of oncogenesis, cancer remains a leading cause of death. The malignant behavior of a cancer cell is driven by the inappropriate activation of transcription factors. In particular, signal transducers and activators of transcription (STATs), which regulate many critical cellular processes such as proliferation, apoptosis, and differentiation, are frequently activated inappropriately in a wide spectrum of human cancers. Multiple signaling pathways converge on the STATs, highlighting their importance in the development and progression of oncogenic diseases. STAT3 and STAT5 are two members of the STAT protein family that are the most frequently activated in cancers and can drive cancer pathogenesis directly. The development of inhibitors targeting STAT3 and STAT5 has been the subject of intense investigations in the last decade, although effective treatment options remain limited. In this review, we investigate the specific roles of STAT3 and STAT5 in normal physiology and cancer biology, discuss the opportunities and challenges in pharmacologically targeting STAT proteins and their upstream activators, and offer insights into novel therapeutic strategies to identify STAT inhibitors as cancer therapeutics.

Tobacco use, most people would say. Smoking tobacco increases the risk of developing many types of cancer and is responsible for approximately one-third of all cancer deaths. The association between tobacco use and lung cancer is well known; lung cancer occurs about 20 times more often in heavy smokers than in nonsmokers [1]. However, many lung cancers are diagnosed in never smokers [2], and most smokers do not develop lung cancer [3,4].

Background: So far, vaccination has been considered the most crucial defense against viral infection, including SARS-CoV-2. Numerous reports have demonstrated the effectiveness of the above vaccines in oncology patients. It has also been proven that, apart from vaccinations and oncological therapy, the course of the cancer process itself influences the magnitude of the humoral response, especially in people after infection with SARS-CoV-2. Objective: This study aimed to answer the question about the impact of the cancer process on the humoral response in oncological patients vaccinated against SARS-CoV-2 infection and in patients after COVID-19. Material and methods: 1,668 people were observed. Over two years, 5,082 SARS-CoV-2 IgG and IgM antibody samples were determined. The concentration of antibodies was assessed in three groups of oncological patients: those undergoing anticancer therapy after contracting COVID-19 and those after vaccination against the SARS-CoV-2 infection. Results: The obtained results indicate a naturally more significant humoral response in oncological patients who have not been vaccinated and have not undergone anticancer therapy, such as radiotherapy, chemotherapy, or surgical intervention. The above observation applies to patients with breast, lung, and colon cancer, although the response varies significantly depending on the type of cancer. Summary: The size of the humoral response and the presence of specific antibodies directed against the SARS-CoV-2, IgM, and IgG, in response to the supply of the vaccine antigen or assessed after COVID-19, is an indicator of adequate immune protection against reinfection. This study highlights for the first time the phenomenon of increased humoral response in response to a viral infection in patients with certain types of cancer that are assumed to be sensitive to oncological therapy, the initiation of which, according to generally accepted principles, was blocked by infection with the SARS-CoV-2. The phenomenon we observe seems to confirm the presence of a "natural" defence potential in a cancer patient's body, in this case, directed against infection with a viral pathogen. A "stronger" antiviral response also seems to explain the asymptomatic course of SARS-CoV-2 infection in some of the above patients. It remains an open question to what extent the SARS-CoV-2 infection weakened the "natural" potential of the anticancer response in these patients.

The mechanisms involved in immune responses to cancer have been extensively studied for several decades and, considerable attention has been paid to harnessing the immune system's therapeutic potential. Cancer immunotherapy has established itself as a promising new treatment option for a variety of cancer types. Various strategies including cancer vaccines, monoclonal antibodies (mAbs), adoptive T-cell-cancer therapy and immune test therapy have gained prominence through immunotherapy. However, it remains to be accomplished the full potential of cancer immunotherapy. In spite of having startling aspects, the cancer immunotherapies have some difficulties including the inability to effectively targeting the cancer antigens and the abnormalities in patient response. With the advancement of technology, this system has changed the genome-based immunotherapy process in the human body including generation of engineered T cells. Due to its high specificity, CRISPR-Cas9 has become a simple and flexible genome-editing tool to target nearly any genomic locus. Recently, the CD19-mediated CAR-T cell (chimeric antigen receptor T cell) therapy has opened a new avenue for the treatment of human cancer, though low efficiency is a major drawback of this process. Thus, increasing the efficiency of the CAR-T cell (engineered T cells that induce the chimeric antigen receptor) by using CRISPR-Cas9 technology could be a better weapon to fight against the cancer. In this review, we have broadly focused on the use of CRISPR-Cas9 technology for the modification of the T-cell, which can specifically recognize cancer cells and be used as immune therapeutics against cancer. We have also demonstrated the other potential strategies for the treatment of cancer.

Nowadays molecular research is essential for the better understanding of tumor cells pathophysiology. The increasing number of neoplasms is taken under ‘the molecular magnifying glass’ therefore it is possible to discover complex relationships between cytophysiology and tumor cells. Signal transducer and activator of transcription 3 (STAT3) belongs to the family of latent cytoplasmic transcription factors called STATs which comprises seven members: STAT1, STAT2, STAT3, STAT5A, STAT5B, STAT6. Those proteins play important role in cytokine-activated gene expression by transducing signals from the cell membrane to the nucleus. Abnormal prolonged activation results in tumorigenesis, metastasis, cell proliferation, invasion, migration and angiogenesis. Inhibition of this transcription factor inhibits previously mentioned effects in cancer cells whereas normal cells are not affected. Hence STAT3 might be a viable target for cancer therapy.

This review of the meaningful data from 2021 on cervical, endometrial, and ovarian cancers aims to provide an update of the most clinically relevant studies presented at important oncologic congresses during the year [the American Society of Clinical Oncology (ASCO) Annual Meeting, the European Society for Medical Oncology (ESMO) Congress and the Society of Gynecologic Oncology (SGO) Annual Meeting]. Despite the underlying existence of the COVID-19 pandemic, the last year has been notable in terms of research, with significant and promising advances in gynecologic malignancies. Several major studies reporting the effects of innovative therapies for patients with cervical, endometrial, and ovarian cancers might change the medical practice in the future.