Submitted:
12 August 2023
Posted:
14 August 2023
Read the latest preprint version here
Abstract
Keywords:
1. Introduction
2. Results
2.1. Characterization of NPs and NPs-A6
2.2. Standard Concentration and Encapsulation Efficiency
2.3. Drug Release Profile
2.4. MTT Assay
2.5. Gene Expression Analysis
2.6. Invasion Assay
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Polymer Synthesis and Peptide Conjugation
4.3. Polymer Characterization
4.4. Nanoparticle Preparation
4.5. Nanoparticle Characterization
4.6. Preparation of Cur-Loaded NPs
4.7. Evaluation of Encapsulation Efficiency
4.8. In Vitro Release Study
4.9. Cell Culture
4.10. Cell Viability Assay Methodology
4.11. Gene Expression Analysis
4.12. Invasion Assay
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abdouss, H.; Pourmadadi, M.; Zahedi, P.; Abdouss, M.; Yazdian, F.; Rahdar, A.; Diez-Pascual, A.M. Green synthesis of chitosan/polyacrylic acid/graphitic carbon nitride nanocarrier as a potential pH-sensitive system for curcumin delivery to MCF-7 breast cancer cells. Int J Biol Macromol 2023, 242, 125134. [CrossRef]
- Bardania, H.; Jafari, F.; Baneshi, M.; Mahmoudi, R.; Ardakani, M.T.; Safari, F.; Barmak, M.J. Folic Acid-Functionalized Albumin/Graphene Oxide Nanocomposite to Simultaneously Deliver Curcumin and 5-Fluorouracil into Human Colorectal Cancer Cells: An In Vitro Study. Biomed Res Int 2023, 2023, 8334102. [CrossRef]
- Rostami, N.; Gomari, M.M.; Abdouss, M.; Moeinzadeh, A.; Choupani, E.; Davarnejad, R.; Heidari, R.; Bencherif, S.A. Synthesis and Characterization of Folic Acid-Functionalized DPLA-co-PEG Nanomicelles for the Targeted Delivery of Letrozole. ACS Applied Bio Materials 2023, 6, 1806-1815. [CrossRef]
- Edis, Z.; Wang, J.; Waqas, M.K.; Ijaz, M.; Ijaz, M. Nanocarriers-Mediated Drug Delivery Systems for Anticancer Agents: An Overview and Perspectives. International journal of nanomedicine 2021, 16, 1313-1330. [CrossRef]
- Ciuca, M.D.; Racovita, R.C. Curcumin: Overview of Extraction Methods, Health Benefits, and Encapsulation and Delivery Using Microemulsions and Nanoemulsions. Int J Mol Sci 2023, 24. [CrossRef]
- Behl, A.; Solanki, S.; Paswan, S.K.; Datta, T.K.; Saini, A.K.; Saini, R.V.; Parmar, V.S.; Thakur, V.K.; Malhotra, S.; Chhillar, A.K. Biodegradable PEG-PCL Nanoparticles for Co-delivery of MUC1 Inhibitor and Doxorubicin for the Confinement of Triple-Negative Breast Cancer. J Polym Environ 2023, 31, 999-1018. [CrossRef]
- Luo, D.; Wang, X.; Zhong, X.; Chang, J.; He, M.; Wang, H.; Li, Y.; Zhao, C.; Luo, Y.; Ran, L. MPEG-PCL Nanomicelles Platform for Synergistic Metformin and Chrysin Delivery to Breast Cancer in Mice. Anticancer Agents Med Chem 2022, 22, 280-293. [CrossRef]
- Su, W.T.; Huang, C.C.; Liu, H.W. Evaluation and Preparation of a Designed Kartogenin Drug Delivery System (DDS) of Hydrazone-Linkage-Based pH Responsive mPEG-Hz-b-PCL Nanomicelles for Treatment of Osteoarthritis. Front Bioeng Biotechnol 2022, 10, 816664. [CrossRef]
- Nezir, A.E.; Bolat, Z.B.; Ozturk, N.; Kocak, P.; Zemheri, E.; Gulyuz, S.; Ozkose, U.U.; Yilmaz, O.; Vural, I.; Bozkir, A., et al. Targeting prostate cancer with docetaxel-loaded peptide 563-conjugated PEtOx-co-PEI(30%)-b-PCL polymeric micelle nanocarriers. Amino Acids 2023, 10.1007/s00726-023-03292-3. [CrossRef]
- Khodaverdi, E.; Tayarani-Najaran, Z.; Minbashi, E.; Alibolandi, M.; Hosseini, J.; Sepahi, S.; Kamali, H.; Hadizadeh, F. Docetaxel-Loaded Mixed Micelles and Polymersomes Composed of Poly (caprolactone)-Poly (ethylene glycol) (PEG-PCL) and Poly (lactic acid)-Poly (ethylene glycol) (PEG-PLA): Preparation and In-vitro Characterization. Iran J Pharm Res 2019, 18, 142-155.
- Doan, N.Q.H.; Nguyen, N.T.K.; Nguyen, N.B.; Tran, T.T.; Tran, Q.N.; Truong, T.N. Design, synthesis, in vitro and in silico evaluation of anti-colorectal cancer activity of curcumin analogues containing 1,3-diphenyl-1H-pyrazole targeting EGFR tyrosine kinase. Biochim Biophys Acta Gen Subj 2023, 1867, 130414. [CrossRef]
- Hsu, K.Y.; Ho, C.T.; Pan, M.H. The therapeutic potential of curcumin and its related substances in turmeric: From raw material selection to application strategies. J Food Drug Anal 2023, 31, 194-211. [CrossRef]
- Hussain, A.; Kumar, A.; Uttam, V.; Sharma, U.; Sak, K.; Saini, R.V.; Saini, A.K.; Haque, S.; Tuli, H.S.; Jain, A., et al. Application of curcumin nanoformulations to target folic acid receptor in cancer: Recent trends and advances. Environ Res 2023, 10.1016/j.envres.2023.116476, 116476. [CrossRef]
- Jang, S.Y.; Kim, J.; Hong, E.; Lee, K.; Na, Y.; Yeom, C.H.; Park, S. Curcumin inhibits human cancer cell growth and migration through downregulation of SVCT2. Cell Biochem Funct 2023, 10.1002/cbf.3824. [CrossRef]
- Mohebian, Z.; Babazadeh, M.; Zarghami, N. In Vitro Efficacy of Curcumin-Loaded Amine-Functionalized Mesoporous Silica Nanoparticles against MCF-7 Breast Cancer Cells. Adv Pharm Bull 2023, 13, 317-327. [CrossRef]
- Santhamoorthy, M.; Thirupathi, K.; Kumar, S.S.D.; Pandiaraj, S.; Rahaman, M.; Phan, T.T.V.; Kim, S.C. k-Carrageenan based magnetic@polyelectrolyte complex composite hydrogel for pH and temperature-responsive curcumin delivery. Int J Biol Macromol 2023, 244, 125467. [CrossRef]
- Wang, X.; Tian, Y.; Lin, H.; Cao, X.; Zhang, Z. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1alpha signaling. Open Life Sci 2023, 18, 20220618. [CrossRef]
- Zhang, J.; Liu, Y.; Wang, X.; Wang, Z.; Xing, E.; Li, J.; Wang, D. Curcumin inhibits proliferation of hepatocellular carcinoma cells by blocking PTPN1 and PTPN11 expression. Oncol Lett 2023, 26, 307. [CrossRef]
- Berkenblit, A.; Matulonis, U.A.; Kroener, J.F.; Dezube, B.J.; Lam, G.N.; Cuasay, L.C.; Brunner, N.; Jones, T.R.; Silverman, M.H.; Gold, M.A. A6, a urokinase plasminogen activator (uPA)-derived peptide in patients with advanced gynecologic cancer: a phase I trial. Gynecol Oncol 2005, 99, 50-57. [CrossRef]
- Gold, M.A.; Brady, W.E.; Lankes, H.A.; Rose, P.G.; Kelley, J.L.; De Geest, K.; Crispens, M.A.; Resnick, K.E.; Howell, S.B. A phase II study of a urokinase-derived peptide (A6) in the treatment of persistent or recurrent epithelial ovarian, fallopian tube, or primary peritoneal carcinoma: a Gynecologic Oncology Group study. Gynecol Oncol 2012, 125, 635-639. [CrossRef]
- Gu, W.; Liu, T.; Fan, D.; Zhang, J.; Xia, Y.; Meng, F.; Xu, Y.; Cornelissen, J.; Liu, Z.; Zhong, Z. A6 peptide-tagged, ultra-small and reduction-sensitive polymersomal vincristine sulfate as a smart and specific treatment for CD44+ acute myeloid leukemia. J Control Release 2021, 329, 706-716. [CrossRef]
- Gu, W.; An, J.; Meng, H.; Yu, N.; Zhong, Y.; Meng, F.; Xu, Y.; Cornelissen, J.; Zhong, Z. CD44-Specific A6 Short Peptide Boosts Targetability and Anticancer Efficacy of Polymersomal Epirubicin to Orthotopic Human Multiple Myeloma. Adv Mater 2019, 31, e1904742. [CrossRef]
- Koh, H.J.; Cheng, L.; Bessho, K.; Jones, T.R.; Davidson, M.C.; Freeman, W.R. Intraocular properties of urokinase-derived antiangiogenic A6 peptide in rabbits. Journal of ocular pharmacology and therapeutics : the official journal of the Association for Ocular Pharmacology and Therapeutics 2004, 20, 439-449. [CrossRef]
- Piotrowicz, R.S.; Damaj, B.B.; Hachicha, M.; Incardona, F.; Howell, S.B.; Finlayson, M. A6 peptide activates CD44 adhesive activity, induces FAK and MEK phosphorylation, and inhibits the migration and metastasis of CD44-expressing cells. Mol Cancer Ther 2011, 10, 2072-2082. [CrossRef]
- Zhang, C.; Wang, X.; Cheng, R.; Zhong, Z. A6 Peptide-Tagged Core-Disulfide-Cross-Linked Micelles for Targeted Delivery of Proteasome Inhibitor Carfilzomib to Multiple Myeloma In Vivo. Biomacromolecules 2020, 21, 2049-2059. [CrossRef]
- Akiyama, Y.; Komiyama, M.; Nakamura, Y.; Iizuka, A.; Oshita, C.; Kume, A.; Nogami, M.; Miyata, H.; Ashizawa, T.; Yoshikawa, S., et al. Identification of novel MAGE-A6- and MAGE-A12-derived HLA-A24-restricted cytotoxic T lymphocyte epitopes using an in silico peptide-docking assay. Cancer Immunol Immunother 2012, 61, 2311-2319. [CrossRef]
- Araveti, P.B.; Srivastava, A. Curcumin induced oxidative stress causes autophagy and apoptosis in bovine leucocytes transformed by Theileria annulata. Cell Death Discovery 2019, 5, 100. [CrossRef]
- Wang, J.B.; Qi, L.L.; Zheng, S.D.; Wu, T.X. Curcumin induces apoptosis through the mitochondria-mediated apoptotic pathway in HT-29 cells. Journal of Zhejiang University. Science. B 2009, 10, 93-102. [CrossRef]
- Grossen, P.; Witzigmann, D.; Sieber, S.; Huwyler, J. PEG-PCL-based nanomedicines: A biodegradable drug delivery system and its application. Journal of Controlled Release 2017, 260, 46-60. [CrossRef]
- Moyano, D.F.; Goldsmith, M.; Solfiell, D.J.; Landesman-Milo, D.; Miranda, O.R.; Peer, D.; Rotello, V.M. Nanoparticle Hydrophobicity Dictates Immune Response. Journal of the American Chemical Society 2012, 134, 3965-3967. [CrossRef]
- Yao, Y.; Zhou, Y.; Liu, L.; Xu, Y.; Chen, Q.; Wang, Y.; Wu, S.; Deng, Y.; Zhang, J.; Shao, A. Nanoparticle-Based Drug Delivery in Cancer Therapy and Its Role in Overcoming Drug Resistance. Front Mol Biosci 2020, 7, 193. [CrossRef]
- Shuai, Q.; Cai, Y.; Zhao, G.; Sun, X. Cell-Penetrating Peptide Modified PEG-PLA Micelles for Efficient PTX Delivery. Int J Mol Sci 2020, 21. [CrossRef]
- Freire, J.M.; Domingues, M.M.; Matos, J.; Melo, M.N.; Veiga, A.S.; Santos, N.C.; Castanho, M.A. Using zeta-potential measurements to quantify peptide partition to lipid membranes. Eur Biophys J 2011, 40, 481-487. [CrossRef]
- Chen, J.; Dai, W.T.; He, Z.M.; Gao, L.; Huang, X.; Gong, J.M.; Xing, H.Y.; Chen, W.D. Fabrication and Evaluation of Curcumin-loaded Nanoparticles Based on Solid Lipid as a New Type of Colloidal Drug Delivery System. Indian J Pharm Sci 2013, 75, 178-184.
- Siepmann, J.; Peppas, N.A. Higuchi equation: derivation, applications, use and misuse. Int J Pharm 2011, 418, 6-12. [CrossRef]
- Weng, J.; Tong, H.H.Y.; Chow, S.F. In Vitro Release Study of the Polymeric Drug Nanoparticles: Development and Validation of a Novel Method. Pharmaceutics 2020, 12. [CrossRef]
- Bruschi, M.L. Mathematical models of drug release. In Strategies to Modify the Drug Release from Pharmaceutical Systems, Woodhead Publishing: 2015; pp. 63-86. [CrossRef]
- Grossen, P.; Witzigmann, D.; Sieber, S.; Huwyler, J. PEG-PCL-based nanomedicines: A biodegradable drug delivery system and its application. J Control Release 2017, 260, 46-60. [CrossRef]
- Madhavi, D.; Kagan, D. Bioavailability of a Sustained Release Formulation of Curcumin. Integr Med (Encinitas) 2014, 13, 24-30.
- Liu, D.; Chen, Z. The effect of curcumin on breast cancer cells. J Breast Cancer 2013, 16, 133-137. [CrossRef]
- Bhawana; Basniwal, R.K.; Buttar, H.S.; Jain, V.K.; Jain, N. Curcumin Nanoparticles: Preparation, Characterization, and Antimicrobial Study. Journal of Agricultural and Food Chemistry 2011, 59, 2056-2061. [CrossRef]
- Shishodia, S. Molecular mechanisms of curcumin action: gene expression. Biofactors 2013, 39, 37-55. [CrossRef]
- Elmore, S. Apoptosis: a review of programmed cell death. Toxicologic pathology 2007, 35, 495-516. [CrossRef]
- Chen, C.; Zhao, S.; Karnad, A.; Freeman, J.W. The biology and role of CD44 in cancer progression: therapeutic implications. Journal of hematology & oncology 2018, 11, 64. [CrossRef]
- Wang, Z.; Ma, W.; Wei, J.; Lan, K.; Yan, S.; Chen, R.; Qin, G. High-performance olfactory receptor-derived peptide sensor for trimethylamine detection based on Steglich esterification reaction and native chemical ligation connection. Biosens Bioelectron 2022, 195, 113673. [CrossRef]
- Kheiri Manjili, H.; Ghasemi, P.; Malvandi, H.; Mousavi, M.S.; Attari, E.; Danafar, H. Pharmacokinetics and in vivo delivery of curcumin by copolymeric mPEG-PCL micelles. Eur J Pharm Biopharm 2017, 116, 17-30. [CrossRef]
- Cohen-Sela, E.; Chorny, M.; Koroukhov, N.; Danenberg, H.D.; Golomb, G. A new double emulsion solvent diffusion technique for encapsulating hydrophilic molecules in PLGA nanoparticles. J Control Release 2009, 133, 90-95. [CrossRef]
- Patra, J.K.; Das, G.; Fraceto, L.F.; Campos, E.V.R.; Rodriguez-Torres, M.d.P.; Acosta-Torres, L.S.; Diaz-Torres, L.A.; Grillo, R.; Swamy, M.K.; Sharma, S., et al. Nano based drug delivery systems: recent developments and future prospects. Journal of Nanobiotechnology 2018, 16, 71. [CrossRef]
- Li, X.; Wang, Y.; Xu, F.; Zhang, F.; Xu, Y.; Tang, L.; Webster, T.J. Artemisinin Loaded mPEG-PCL Nanoparticle Based Photosensitive Gelatin Methacrylate Hydrogels for the Treatment of Gentamicin Induced Hearing Loss. International journal of nanomedicine 2020, 15, 4591-4606. [CrossRef]
- Zatorska-Płachta, M.; Łazarski, G.; Maziarz, U.; Foryś, A.; Trzebicka, B.; Wnuk, D.; Chołuj, K.; Karewicz, A.; Michalik, M.; Jamróz, D., et al. Encapsulation of Curcumin in Polystyrene-Based Nanoparticles—Drug Loading Capacity and Cytotoxicity. ACS Omega 2021, 6, 12168-12178. [CrossRef]
- Liu, Y.; Yang, G.; Jin, S.; Xu, L.; Zhao, C.X. Development of High-Drug-Loading Nanoparticles. Chempluschem 2020, 85, 2143-2157. [CrossRef]
- Khosropanah, M.H.; Dinarvand, A.; Nezhadhosseini, A.; Haghighi, A.; Hashemi, S.; Nirouzad, F.; Khatamsaz, S.; Entezari, M.; Hashemi, M.; Dehghani, H. Analysis of the Antiproliferative Effects of Curcumin and Nanocurcumin in MDA-MB231 as a Breast Cancer Cell Line. Iran J Pharm Res 2016, 15, 231-239.
- Koroth, J.; Nirgude, S.; Tiwari, S.; Gopalakrishnan, V.; Mahadeva, R.; Kumar, S.; Karki, S.S.; Choudhary, B. Investigation of anti-cancer and migrastatic properties of novel curcumin derivatives on breast and ovarian cancer cell lines. BMC Complementary and Alternative Medicine 2019, 19, 273. [CrossRef]
- Katta, S.; Srivastava, A.; Thangapazham, R.L.; Rosner, I.L.; Cullen, J.; Li, H.; Sharad, S. Curcumin-Gene Expression Response in Hormone Dependent and Independent Metastatic Prostate Cancer Cells. Int J Mol Sci 2019, 20. [CrossRef]
- Khanna, P.; Johnson, K.L.; Maron, J.L. Optimal reference genes for RT-qPCR normalization in the newborn. Biotechnic & histochemistry : official publication of the Biological Stain Commission 2017, 92, 459-466. [CrossRef]
- Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative real-time RT-PCR--a perspective. Journal of molecular endocrinology 2005, 34, 597-601. [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001, 29, e45. [CrossRef]
- Pijuan, J.; Barceló, C.; Moreno, D.F.; Maiques, O.; Sisó, P.; Marti, R.M.; Macià, A.; Panosa, A. In vitro Cell Migration, Invasion, and Adhesion Assays: From Cell Imaging to Data Analysis. Frontiers in cell and developmental biology 2019, 7, 107. [CrossRef]
- Li, Y.; Sun, W.; Han, N.; Zou, Y.; Yin, D. Curcumin inhibits proliferation, migration, invasion and promotes apoptosis of retinoblastoma cell lines through modulation of miR-99a and JAK/STAT pathway. BMC Cancer 2018, 18, 1230. [CrossRef]
- Ghasemi, M.; Turnbull, T.; Sebastian, S.; Kempson, I. The MTT Assay: Utility, Limitations, Pitfalls, and Interpretation in Bulk and Single-Cell Analysis. Int J Mol Sci 2021, 22. [CrossRef]
- Ranstam, J. Hypothesis-generating and confirmatory studies, Bonferroni correction, and pre-specification of trial endpoints. Acta Orthop 2019, 90, 297-297. [CrossRef]











| Gene Name | Primer Sequence | Strand | Product Size |
|---|---|---|---|
|
BCL-2 |
TGGGATCGTTGCCTTATGCA | Plus |
101 |
| GTCTACTTCCTCTGTGATGTTGT | Minus | ||
|
hTERT |
GTCTACTTCCTCTGTGATGTTGT | Plus |
128 |
| CCGGCATCTGAACAAAAGCC | Minus | ||
|
BAX |
AAACTGGTGCTCAAGGCCC | Plus |
81 |
| AGAGGCAGGGATGATGTTCT | Minus | ||
|
MMP-2 |
TGGATACCCCTTTGACGGTAAG | Plus |
137 |
| CATACTTCACACGGACCACTTG | Minus | ||
|
MMP-9 |
GATGCCTGCAACGTGAACAT | Plus |
88 |
| AGAATCGCCAGTACTTCCCATC | Minus | ||
|
CD44 |
GCTTCAATGCTTCAGCTCCA | Plus |
71 |
| TCCATCAAAGGCATTGGGCA | Minus |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).