High average power narrow-linewidth tunable solid-state lasers in the wavelength region between 2 to 3 μm are attractive light sources for many applications. This paper reports a narrow-linewidth widely-tunable laser system based on the polycrystalline Cr2+:ZnSe elements pumped by the repetitively-pulsed 2.1 µm Ho3+:YAG laser operating at the tens of kilohertz pulse rate. An advanced procedure of ZnSe-element doping and surface improvement was applied to increase the laser-induced damage threshold, which resulted in an increase of the output power of the Cr2+:ZnSe laser system. The high-average-power laser system comprised double master-oscillators and power amplifiers: Ho3+:YAG and Cr2+:ZnSe laser oscillators, and Ho3+:YAG and Cr2+:ZnSe power amplifiers. The output wavelength was widely tuned within 2.3-2.7 µm by an acousto-optical tunable filter inside the Cr2+:ZnSe master oscillator cavity. The narrow-linewidth operation at the pulse repetition rate of 20-40 kHz in a high-quality beam with the average output power up to 9.7 W was demonstrated.

Species of the genus Drosophila have served as favorite models in speciation studies; however, genetic factors of interspecific reproductive incompatibility are underinvestigated. Here we performed the analysis of hybrid female sterility by crossing Drosophila melanogaster females and Drosophila simulans males. Using transcriptomic data analysis, molecular, cellular, and genetic approaches, we analyzed differential gene expression, transposable element (TE) activity, piRNA biogenesis, and functional defects of oogenesis in hybrids. Premature germline stem cell loss was the most prominent defect of oogenesis in hybrid ovaries. Due to the differential expression of genes encoding piRNA pathway components, rhino and deadlock, the functional RDCmel complex in hybrid ovaries was not assembled. However, the activity of the RDCsim complex was maintained in hybrids, independent of the genomic origin of piRNA clusters. Despite the identification of a cohort of overexpressed TEs in hybrid ovaries, we found no evidence that their activity can be considered the main cause of hybrid sterility. We revealed a complicated pattern of Vasa protein expression in the hybrid germline, including partial AT-chX piRNA targeting of the vasasim allele and a significant zygotic delay in vasamel expression. We arrived at the conclusion that the hybrid sterility phenotype was caused by intricate multi-locus differences between the species.

Thorough and precise gene structure annotations are essential for maximizing the benefits of genomic data and unveiling valuable genetic insights. The cucumber genome was first released in 2009 and updated in 2019. To increase the accuracy of predicted gene models, 64 published RNA-seq data and 9 new strand-specific RNA-seq data from multiple tissues were used for manual comparison with the gene models. The updated annotation file (version 2.0) contains increased 24,145 predicted genes from previous version (24317 genes) with a higher BUSCO value of 96.9%. 6231 and 1490 transcripts were adjusted and newly added, respectively, accounting for 31.99% of the overall gene tally. These newly added and adjust genes were renamed (CsaV3.1_XGXXXXX), while genes remaining unaltered preserve their original des ignations. A random selection of 21 modified/added genes were validated using RT-PCR analyses. Additionally, tissue-specific patterns of gene expression were examined using newly obtained transcriptome data with the revised gene prediction model. This improved annotation of cucumber genome will provide essential and accurate resources for studies in cucumber.

The grain filling rate (GFR) plays a crucial role in determining grain yield. However, the regulatory and molecular mechanism of grain filling rate (GFR) in foxtail millet remains unclear. In this study, we found the GFR of 'Changnong No.47' (CN47) was significantly higher at 14 days after flowering (DAF) and 21 DAF in comparison to 'Changsheng 13' (CS13). Furthermore, CN47 also exhibited higher thousand grain weight and yield than CS13. Therefore, we conducted transcriptomics and metabolomics to analyze the biological processes and functional genes associated with GFR during two stages of grain filling in both cultivars. A total of 765 differentially expressed genes (DEGs) and 246 differentially accumulated metabolites (DAMs) were identified at the 14 DAF stage, while at the 21 DAF stage, a total of 908 DEGs and 268 DAMs were identified. The integrated analysis of co-mapped DAMs and DEGs revealed enriched pathways, including flavonoid biosynthesis, plant hormone signal transduction, tyrosine metabolism, ATP-binding cassette (ABC) transporters, beta-alanine metabolism, as well as stilbenoid, diarylheptanoid and gingerol biosynthesis. In order to elucidate their potential functions in the context of GFR, we developed a gene-metabolite regulatory network for these metabolic pathways. Notably we found some genes associated with ABC transporters and plant hormone signal transduction pathway were implicated in auxin transport and signal transduction, highlighting the crucial role of auxin during grain filling. The results provide initial insights into the regulatory and molecular mechanisms underlying GFR in foxtail millet, as well as offer valuable genetic resources for further elucidation of GFR in future studies. The findings have established a theoretical basis for improving the efficiency of yield breeding in foxtail millet.

Salt stress is a major limiting factor for alfalfa yield due to its relatively low salt tolerance. High soil salinity adversely impacts alfalfa growth and development, leading to reduced yield. Melatonin (MT) is known to play a significant role in enhancing plant resistance to abiotic stresses. However, the mechanisms underlying melatonin-mediated abiotic stress responses, particularly salt stress, are not well understood. To address this gap, we conducted a study focusing on germinating alfalfa seeds under salt stress. Physiological indexes and transcriptomics analyses were carried out on the germinated seeds to investigate the effects of melatonin on alfalfa seedlings under salt stress conditions. Our results revealed that the application of melatonin led to an increase in shoot length and fresh weight of alfalfa seedlings under salt stress. Moreover, key physiological indexes such as peroxidase (POD) activity and glutathione (GSH) content were enhanced, while levels of malondialdehyde and superoxide anions decreased. Transcriptomic analysis identified a total of 2,131 differentially expressed genes in the salt-treated group, with 726 up-regulated and 1,405 down-regulated genes, while the MT-treated group showed 2896 differentially expressed genes, of which 1,097 were up-regulated and 1,799 were down-regulated. Further, KEGG enrichment analysis highlighted the enrichment of differentially expressed genes in pathways including flavonoid biosynthesis, ABC transporter, glutathione metabolism, and the MAPK signaling pathway, with these pathways more significantly enriched in the MT-treated group. These findings collectively suggest that melatonin plays a crucial role in alfalfa's response to salt stress and offer new insights into the genomic mechanisms underlying melatonin-mediated salt tolerance in alfalfa.

The endometrium, the inner mucosal lining of the uterus, undergoes complex molecular and cellular changes across the menstrual cycle in preparation for embryo implantation. Transcrip-tome-wide analyses have mainly been utilized to study the endometrial receptivity, the prerequisite for successful implantation, with most of the studies, so far, comparing the endometrial transcriptomes between (i) secretory versus proliferative endometrium or (ii) mid-secretory versus early-secretory endometrium. In the current study, we provide the complete transcriptome description of the endometrium across the entire menstrual cycle and, for the first time, comprehensively characterize the proliferative phase of the endometrium. Our temporal transcriptome analysis includes five time points: mid-proliferative, late-proliferative (peri-ovulatory phase), early-secretory, mid-secretory, and late-secretory phases. Thus, we exhaustively unveil the transitions between the consecutive proliferative and secretory phases, highlighting their unique gene expression profiles and possible distinct biological functions. Transcriptome analysis reveals many differentially expressed genes (DEGs) across the menstrual cycle, most of which are phase-specific. As an example of the coordinated gene activity, the expression profile of his-tone-encoding genes within the HIST cluster on chromosome 6 showed an increase in cluster activity during the late-proliferative and a decline during the mid-secretory phase. Moreover, numerous DEGs are shared among all phases. In conclusion, in the current study, we delineate the endometrial proliferative phase-centered view of transcriptome dynamics across the menstrual cycle. Data analysis highlights significant transcriptomic and functional changes occurring during the late-proliferative phase – an essential transition point from the proliferative to the secretory phase. Future studies should explore how the biology of the late-proliferative phase endometrium impacts the achievement of mid-secretory endometrial receptivity or contributes to molecular aberrations leading to embryo implantation failure.

(i) Investigations of stellar systems known as wide binaries suggest that Newton’s law of gravitation breaks down at low accelerations. This can be explained by proposing a fifth force with $U(1)$ gauge symmetry, whose corresponding gauge boson is the sought for dark matter candidate. (ii) Relativistic causality (i.e. no faster than light signalling) permits nonlocal correlations stronger than those permitted by quantum mechanics. This can be explained if our universe possesses a second 4D spacetime with a signature opposite to ours. (iii) Such a fifth force, and a second spacetime, arise naturally in a recently proposed theory of unification based on an $E_8\times E_8$ symmetry. Our spacetime arises from breaking of an $SU(2)_R\times U(1)_{YDEM}$ symmetry, and the second spacetime arises from broken electroweak symmetry.

Organic solar cells are contributing extensively to the production of future large area and cost-effective sources of renewable energy with a compact environmental impact. Moreover, due to tunable optical properties of the active medium, the semi-transparent organic solar cell can be fabricated and become a promising nominee for building Integrated Photovoltaics (BIPV), vehicles, and mobile electronic devices. Therefore, three newly synthesized polymers used as were host materials for the active medium and blended with beetroot dye. Hence, based on BHJ structure two ternary systems have been constructed and utilized to fabricate semitransparent solar cells and characterized. The results show that the natural dye has a crucial impact on solar cell characteristic parameters. Consequently, large value of V_OC close to 1V were obtained for ternary systems and acceptor material named PINDOLE exhibits potentials for electron transport layer (ETL) and shows an improvement in both fill factor and device efficiency.

The increase in hypoxia events, a result of climate change in coastal and fjord ecosystems, impacts the health and survival of mussels. These organisms deploy physiological and molecular responses as an adaptive mechanism to maintain cellular homeostasis under environmental stress. However, the specific effects of hypoxia on mussels of socioeconomic interest, such as Mytilus chilensis, are unknown. Using RNA-seq, we investigated the transcriptomic profiles of the gills, digestive gland, and adductor muscle of M. chilensis under hypoxia (10 days at 2 mg L-1) and reoxygenation (10 days at 6 mg L-1). There were 15,056 differentially expressed transcripts identified in gills, 11,864 in the digestive gland, and 9,862 in the adductor muscle. The response varied among tissues, showing chromosomal changes in Chr1, Chr9, and Chr10 during hypoxia. Hypoxia regulated signaling genes in the Toll-Like, mTOR, citrate cycle, and apoptosis pathways in gills, indicating metabolic and immunological alterations. These changes suggest that hypoxia-induced a metabolic shift in mussels, reducing reliance on aerobic respiration and increasing reliance on anaerobic metabolism. Furthermore, hypoxia appeared to suppress the immune response, potentially increasing disease susceptibility, with negative implications for the mussel culture industry and natural bed populations. This study provides pivotal insights into metabolic and immunological adaptations to hypoxia in M. chilensis, offering candidate genes for adaptive traits.

In this study, Silicon Carbide (SiC) nano-particle based serigraphic printing inks were formulated to fabricate highly sensitive and wide temperature range SiC printed thermistors. Initially, commercial silver ink was screen printed to fabricate inter-digitated electrodes (IDE’s) onto flexible Kapton® substrate via screen printing. Thermistor inks with different weight ratios of SiC nano- particles dispersed in polyimide resin matrix were fabricated. The SiC-polyimide temperature sensing inks were screen printed atop the IDE structures to form fully printed thermistors and encapsulated with a adhesive backed polyimide film for humidity inhibition. The high temperature tolerance of the Kapton® allowed the the sensors to be tested over a wide temperature range form 25◦C to 170◦C. The printed SiC thermistors exhibit excellent repeatability and stability over 15 hours of continuous operation. Optimal device performance was achieved with 30 wt.% SiC-polyimide ink. We report highly sensitive devices with a temperature coefficient of Resistance (TCR) of -0.556 %/◦C, a thermal coefficient of 502 K (β-index) and an activation energy of 0.08 eV which are comparable with printed thermistors previous reported. Further, the thermistor demonstrates an accuracy of ±1.35◦C which is well within the range offered by commercially available high sensitivity thermistors. SiC thermistors exhibit a small 6.5% drift due to changes in relative humidity between 10-90 %RH and a 4.2 % drift in baseline resistance after 100 cycles of aggressive bend testing at a 40°angle. The use of commercially available low cost materials, simplicity of design and fabrication techniques coupled with the chemical inertness of the Kapton® substrate and SiC nanoparticles paves the way to use all-printed SiC thermistors towards a wide range of applications where temperature monitoring is vital for optimal system performance.

RNA transcripts play a crucial role as witnesses of gene expression health. Identifying disruptive short sequences in RNA transcription and regulation is essential for potentially treating diseases. Let’s delve into the mathematical intricacies of these sequences. We’ve previously devised a mathematical approach for defining a “healthy” sequence (10.14218/GE.2023.00079). This sequence is characterized by having at most four distinct nucleotides (denoted as nt≤4). It serves as the generator of a group denoted as fp. The desired properties of this sequence are as follows: fp should be close to a free group of rank nt−1, it must be aperiodic, fp should not have isolated singularities within its SL2(C) character variety (specifically within the corresponding Groebner basis). Now, let’s explore the concept of singularities. There are cubic surfaces associated with the character variety of a four-punctured sphere denoted as S24. When we encounter these singularities, we find ourselves dealing with some algebraic solutions of a dynamical second-order differential (and transcendental) equation known as the Painlevé VI equation (10.3390/dynamics4010001). In certain cases, S24 degenerates, in the sense that two punctures collapse, resulting in a “wild” dynamics governed by the Painlevé equations of an index lower than VI. In our paper, we provide examples of these fascinating mathematical structures within the context of miRNAs. Specifically, we find a clear relationship between decorated character varieties of Painlevé equations and the character variety calculated from the seed of oncomirs. These findings should find applications in cancer research.

The new unique technology for granulation of metals and nonmetallic melts is presented in the paper. It was created on the newly developed controlled film flow disintegration with rapid cooling of the droplets and solidified granules in amorphous state. Three new phenomena discovered by us created the base for 3 different methods for granulation of metals and nonmetallic melts in a wide range of granules’ sizes. Electromagnetic resonance method allows producing granules of metals in the range of 1 mm and over. The soliton-like vibrational regime is available for production of any granulation material in the range 0.1-1 mm. Moreover, the shockwave regime is applicable for producing particles from 10 micrometers by size. All methods produce particles of the stated size with a narrow distribution by size: deviation from the average size no more than 50%. The other known methods do not produce granules with such high cooling rate, which can realize the amorphous state and cannot regulate size of particles in such bright but narrow range from 10 micrometers to 1-2 mm.

Plant transcriptomes are an extremely dynamic entities shaped spatially and temporally by many intracellular and environmental cues. In this review, we first summarize the complexity and diversity of plant genomes and transcriptomes as a start point for the multitude of transcriptomic responses. Numerous alterations within various tissue and organ-specific transcriptomes as well as the most relevant transcriptomic responses associated with plant acclimation to selected abiotic and biotic stress conditions, from the current studies employing high-throughput transcriptomic analysis are widely discussed. Understanding changes within plant transcriptomes, revealed by in silico functional analysis, allows for the characterization of stress-affected genes and stress acclimatory mechanisms, as well as allows to perform plant metabolic engineering. The latter allow cultivars to produce more secondary metabolites in the future, which are often desirable substances in the biomedical industry. Accordingly, in this review special attention was also paid to characterize the potential of transcriptomic analyses of medicinal species, particularly to search for new cultivars. Extensive characterization of transcriptomic responses in stress would also result in the development of new cultivars that display physiological and molecular mechanisms that allow them to cope with adverse environmental conditions more adequately.

With the rising cost of animal feed protein, finding affordable and effective substitutes is crucial. Walnut kernel cake, a polyphenols, fiber, protein and fat-rich byproduct of walnut oil extraction, has been underexplored as a potential protein replacement in pig feed. In this study, we found that feeding large Diqing Tibetan pigs walnut kernel cake promoted adipose deposition and improved pork quality during pig growth. Transcriptome analysis revealed the upregulation of genes ANGPTL8, CCNP, ETV4, and TRIB3, associated with adipose deposition. Pathway analysis highlighted enrichment in adipose-deposition-related pathways, including PPAR, Insulin, PI3K-Akt, Wnt, and MAPK signaling. Further analysis identified DEGs (differentially expressed genes) positively correlated with adipose-related traits, such as PER2 and PTGES. Single-cell transcriptome data pointed to the specific expression of CD248 and PTGES in adipocyte progenitor/stem cells (APSCs), pivotal for adipocyte differentiation and adipose deposition regulation. This study demonstrates walnut kernel cake's potential to substitute soybean cake in pig feed, providing high-quality protein and promoting adipose deposition. It offers insights into feed protein replacement, human functional food, fat metabolism, and related diseases, with marker genes and pathways supporting pig breeding and pork quality improvement.

This paper shows that the empirical distribution of cross-sectional analyst coverage in China's stock markets follows an exponential law in a given month from 2011 to 2020. The findings hold in both the emerging (Shanghai) and the developed market (Hong Kong). Moreover, the unique distribution parameter (i.e., mean) is directly related to the amount of market-wide information. Average analyst coverage exhibits a significant negative predictive power for stock-market uncertainty, highlighting the role of security analysts in diminishing the total uncertainty. The exponential law can be derived from the maximum entropy principle (MEP). When analysts, who are constrained by average ability in generating information (i.e., the first-order moment), strive to maximize the amount of market-wide information, this objective yields the exponential distribution. Contrary to the conventional wisdom that security analysts specialize in the generation of firm-specific information, empirical findings suggest that analysts primarily produce market-wide information for 25 countries. Nevertheless, it remains unclear why cross-sectional analyst coverage reflects market-wide information, this paper provides an entropy-based explanation.

Wide bandgap semiconductors-based photocatalysts are usually limited by their low solar energy conversion efficiency due to their limited absorption solar wavelength, surface’s fast recombination of photoelectron–hole pairs and low charge-carrier mobility. Here we report a new stepwise solution synthesis for making a new photocatalytic core/shell of titanate nanowire/reduced graphene oxide shell (or titanate/rGO) 1D-nanocomposite. The new core/shell nanocomposite maximized the specific surface area, largely reduced the charge transfer resistance and reaction energy barrier, and significantly improved the absorption of the visible light. The core/shell nanocomposites’ large on/off current ratio and rapid photo-responses boosted the photocurrent by 30.0%, the photocatalysis rate by 50.0%, and the specific surface area by 16.4%, when comparing with the pure titanate nanowire core. Our numerical simulations support the effective charge separation on the new core-shell nanostructure, which can help further advance the new photocatalysis.

Coccomyxa subellipsoidea KJ (C-KJ) is a green alga with unique immunoregulatory characteristics. Here, we investigated the mechanism underlying the modification of T cell function by C-KJ components. The water-soluble extract of C-KJ was fractionated into protein (P) and sugar (S) fractions [acidic (AS), basic (BS), and neutral (NS)]. These fractions were used for the treatment of peripheral blood mononuclear cells stimulated with toxic shock syndrome toxin-1. Transcriptome analysis revealed that both P and AS enhanced the expression of the genes encoding metallothionein (MT) family proteins, inflammatory factors, and T helper (Th) 17 cytokine and suppressed that of those encoding Th2 cytokines in stimulated T cells. The kinetics of MT1 and MT2A gene expression showed a transient increase in MT1 and maintenance of MT2A mRNA after T cell stimulation in the presence of AS. The kinetics of Th17-related cytokine secretion in the early period were comparable to those of MT2A mRNA. Furthermore, our findings revealed that static, a STAT-3 inhibitor, significantly suppressed MT2A gene expression. These findings suggest that the expression of MTs is involved in the immune regulatory function of C-KJ components, which is partially regulated by Th17 responses, and may help develop innovative immunoregulatory drugs or functional foods.

During the last few years, advancement in the area of biochemistry, science of the material world, engineering and computer-aided testing has directed towards advancement of high-throughput tools for the sake of profiling information encoded in a gene. Single-cell RNA-sequencing (scRNA-seq) tools capable to examine the sequence data from each individual cells and it shows within population variety and permit exploring of cell conditions and transformation by extreme resolution, possibly give out cell sub-types or gene expression fluctuations that are shaded in mass sequencing processes, which shows population-averaged evaluations. Yet, the major disadvantage for this tool is the lack of success to pick out location related details of the RNA transcriptome, as this needs tissue detachment and cell isolation. Location based transcript determination is among the advancements in the area of medical biotechnology as this can find out the molecules like RNA dataset in their intact physical placement in tissue segment with spatial context at the scale of a single-cell, which is very advantageous as compare to single-cell sequencing techniques. These approaches give key observation in the areas of biomedical field sub-disciplines like neurology, embryology, carcinoma study, immune cell investigation and histological activities. Generally, this review mainly focused towards single-cell sequencing methods, technology development, its challenges observed, different expression data analysis mechanisms and their applications in different areas, such as in cancer research, microbes, central nervous system, sex organs and immune-biology, intensifying the essentiality of sequencing tools at single-cell level for the characterization of extremely dynamic individual cells.

Coffee Coffea arabica L. depends on abundantly distributed rainfall and drought impacts their development, fruit production, bean quality, and ultimately, beverage quality. Plant Biotechnology by means of genetic manipulation and plant regeneration by the somatic embryogenic process is an alternative technology to overcome these prob-lems. In the present work we used the molecular approach of the trehalose/trehalase role in plant surviving in extreme drought/salt environments. We used a cassette containing the antisense C. arabica L. trehalase gene under the RD29 promoter from A. thaliana and the NOS terminator to genetically modified an em-bryogenic coffee C. arabica L. cv typica line under osmotic stress supplemented with mannitol (0.3M) and sorbitol (0.3M) containing medium. Drought resistant SE lines were recovered and regenerate plants. Resistant SE lines showed a higher rate of competence to induce secondary SE capacity. A transcrip-tome analysis was performed from high competent SE lines to understand the acquired molecular mechanisms to developed SE. From the up-regulated genes, a PPI network made by STRING v12.0 with high confidence (0.700) revealed the presence of the 10 modules. The cell cycle, chromatin remodeling, somatic embryogenesis, oxidative stress, generic transcription pathway, carbon metabolism, phenylpropanoid biosynthesis, trehalose biosynthesis, proline bio-synthesis and glycerolipid metabolism.

Recent studies have elucidated the diversity of genes encoding venom in sea anemones. However, most of those genes are yet to be explored in an evolutionary context. Insulin is a common peptide across metazoans and has been coopted into a predatory venom in many venomous lineages. In this study, we focus on the diversity of insulin-derived venoms in sea anemones and on elucidating their evolutionary history. We sourced data for 34 species of sea anemones and found sequences belonging to two venom families that have Insulin PFAM annotations (Cono-Insulin, VP302). Our findings show that both families have undergone duplication events. Members of each of the independently evolving clades have consistent predicted protein structures and distinct dN/dS values. Our work also shows that VP302 is part of a multidomain venom contig and has experienced a secondary gain into the venom system of cuticulate sea anemones.

Gallium oxide (Ga2O3) is an emerging wide bandgap semiconductor promising a wide range of important applications. However, mass production of high-quality crystalline Ga2O3 still suffers from limitations associated with poor reproducibility and low efficiency. Low-temperature grown amorphous Ga2O3 demonstrates comparable performance with its crystalline counterparts. Lanthanide Er3+-doped Ga2O3 (Ga2O3: Er) possesses great potential for developing light-emitting devices, photodetectors and optical waveguides. The host circumstance can exert a crystal field around the lanthanide dopants and strongly influence their photoluminescence properties. Here we present a systematical study of the impact of amorphous-to-crystalline transition on the upconversion photoluminescence in Ga2O3: Er thin films. Through controlling the growth temperature of Ga2O3: Er films, the upconversion luminescence of as-grown thin films are strongly enhanced over 100 times. Moreover, the variation of photoluminescence reflects the amorphous-to-crystalline transformation of the Ga2O3: Er thin films. These results will aid further design of favorable optoelectronic devices integrated with lanthanide-doped Ga2O3 thin films.

Pachychoroid neovasculopathy (PNV) is a pachychoroid-spectrum disease. As blood circulation throughout the choroid may be involved in PNV pathogenesis, analysis using ultra-wide-field (UWF) fundus imaging is crucial. We evaluated choroidal thickness after half-fluence photodynamic therapy (PDT) combined with intravitreal aflibercept injection for PNV using UWF swept-source optical coherence tomography. Seventeen eyes with PNV that underwent half-fluence PDT with adjuvant single intravitreal aflibercept injection were analyzed. To compare choroidal thicknesses in the central and peripheral choroids, we set subfields <3, <9, and 9–18 mm from the fovea. The <9- and 9–18-mm subfields were divided into four quadrants. Choroidal thickness in each subfield decreased significantly after half-fluence PDT (P<0.001); this reduction was more pronounced in the central area. We also investigated the relationship between the dominant side of the deep choroidal veins that harbor choroidal vein efflux from the macula. When choroidal thickness in the supratemporal and infratemporal 9x9-mm subfields were evaluated, the ratio of choroidal thickness reduction was not significantly different between the dominant and non-dominant sides. The dominant side was not associated with the extent of choroidal thickness reduction in PNV. In conclusion, half-fluence PDT caused thinning of the entire choroid, especially in the central area, in PNV.

Actually wide excision is recommended after the primary excision of any cutaneous melanomas. The definition of the margins of wide excision indicated by the guidelines has remained unchanged over the years, although the reported indications derived from fairly dated studies, in which melanomas tend to be thicker or in advanced stages at diagnosis. These indications may no longer be current; especially in those patients affected by in situ or thin melanoma, exposing patients to a possible overtreatment. A retrospective observational study was conducted in patients who had undergone surgery for melanoma in a single institution. In a univariate model a melanoma-positive wide excision resulted related with a worst progression free survival (PFS); but this association was not confirmed in the multivariable model. Moreover, logistic model were applied to estimate the probability to find a metastasis after wide local excision (WLE) in relation to demographic data of patients and histologic information of the melanoma. Results testified that the Breslow thickness was the only factor associated with the increase of the risk to found metastases in the WLE area. The ROC curve testified that the optimum cut-off value to differentiate patients with respect those without a tumor-positive wide excision, was a Breslow thickness of 2.31mm in women, and 2.4mm in men.

Single-cell green microalga Nannochloropsis oceanica is potentially considered to be the bioresource for biofuel and pharmaceutical production. Urea is a kind of nutrient component for photosyn-thetic N. oceanica. Meanwhile, urea could induce to accumulate some substances such as lipid and affect its growth and physiology. However, how marine microalga N. oceanica respond and adapt to urea addition remains elusive. Here, acclimation of the metabolic reprogramming to changes in the nutrient environment was studied by high-throughput mRNA sequencing in N. oceanica under Ct vs U, there were 2104 genes displayed differential expression (including 1354 upregulation and 750 downregulation, respectively) and some pathways including carbon/nitrogen metabolism, photosynthesis, and lipid metabolism would be reprogrammed in N. oceanica. The results showed that genes related to photosynthesis in N. oceanica were significantly down-regulated, especially those related to light harvesting proteins. Interestingly, urea absorption and transport may de-pend not only on specialized transport mechanisms such as urease, but also on alternative transport channels such as the ABC transporter family, CLC protein family. In addition, urea causes specific changes in carbon and lipid metabolism. Genes associated with the Calvin cycle and carbon concentration mechanisms were significantly upregulated. In lipid metabolism, genes associated with lipases, or polyunsaturated fatty acid enzymes, are highly activated. In addition, expression is enhanced in the tricarboxylic acid cycle and folate metabolism, making important contributions to energy supply and synthesis and modification of genes or macromolecules. These phenomena indicate that N. oceanica actively and dynamically regulates the redistribution of carbon and nitrogen after urea addition., which will provide references for further research on the effects of urea on N. oceanica.

The flowering of Amorphophallus bulbifer plays an important role in its reproduction. The flowers and leaves of A. bulbifer cannot grow at the same time. However, the physiological and molecular mechanisms involved in flower bud and leaf bud formation are still unclear. In this study, the flower buds and leaf buds of A. bulbifer in the early stage of growth were used as research materials, transcriptome and metabolome analyses were carried out, and the soluble sugar and starch contents of A. bulbifer corms were determined. Transcriptome analysis revealed 5 542 differentially expressed genes (DEG) between flower buds and leaf buds, 3 107 of which were upregulated and 2 435 of which were downregulated. Enrichment analysis of the KEGG pathway showed that these differential genes were enriched mainly in the plant hormone signal transduction, DNA replication and fatty acid elongation pathways. Plant hormone signal transduction, DNA replication and fatty acid elongation pathways. A total of 5 296 significant differentially abundant metabolites were screened out by nontargeted metabolomics analysis. The differentially abundant metabolites were functionally classified in the HMDB, and 118 were successfully matched, including 17 that were highly expressed in flower buds. The differentially abundant metabolites in the flower buds were mainly enriched in pathways such as amino acid metabolism, isoquinoline alkaloid biosynthesis and pyrimidine metabolism. Targeted metabolomics analysis revealed that the contents of ABA, ZT and iPA in flower buds were significantly greater than those in leaf buds, while the opposite trend was observed for IAA. The analysis of soluble sugar and starch contents showed that the starch and soluble sugar contents in flower buds were significantly greater than those in leaf buds. The results of this study showed that flower bud development in A. bulbifer was regulated by amino acids, starch, ABA, ZT, iPA, IAA and other hormones. These findings could lead to valuable genetic resources for further study of A. bulbifer flowering and provide a deeper understanding of the molecular basis of A. bulbifer flowering.

Mercury (Hg) pollution not only poses a threat to the environment but also adversely affects the growth and development of plants, with potential repercussions for animals and humans through bioaccumulation in the food chain. Maize, a crucial source of food, industrial materials, and livestock feed, requires special attention in understanding the genetic factors influencing mercury accumulation. Developing maize varieties with low mercury accumulation is vital for both maize production and human health. In this study, a comprehensive genome-wide association study (GWAS) was conducted using an enlarged SNP panel comprising 1.25 million single nucleotide polymorphisms (SNPs) in 230 maize inbred lines across three environments. The analysis identified 111 significant SNPs within 78 quantitative trait loci (QTL), involving 169 candidate genes under the Q model. Compared to the previous study, the increased marker density and optimized statistical model led to the discovery of 74 additional QTL, demonstrating improved statistical power. Gene Ontology (GO) enrichment analysis revealed that most genes participate in arsenate reduction and stress responses. Notably, GRMZM2G440968, associated with the significant SNP chr6.S_155668107 of axis tissue, encodes a cysteine proteinase inhibitor, suggesting its potential role in alleviating Hg toxicity by inhibiting cysteine. Haplotype analyses provided further insights, indicating that lines carrying hap3 exhibited the lowest mercury content compared to other haplotypes. In summary, our study significantly enhances the statistical power of GWAS, identifying additional genes related to mercury accumulation and metabolism. These findings offer valuable insights into unraveling the genetic basis of mercury content in maize and contribute to the development of maize varieties with low mercury accumulation.

Apple red flesh coloration is a result of the performance of biochemical pathway involved in the biosynthesis of anthocyanins and anthocyanidins. Based on apple genome analysis, high number of regulatory genes, mainly transcription factors such as MYB, which are components of regulatory complex MYB-bHLH-WD40, and several structural genes (PAL, 4CL, CHS, CHI, F3H, DFR, ANS, UFGT) involved in anthocyanin biosynthesis have been identified so far. In this study, we investigated previously unrecognized genes involved in the constitution of red-flesh apple phenotype. These genes could be concerned as molecular markers for early selection of new apple cultivars. Based on comparative transcriptome analysis of apples with different fruit flesh coloration, we successfully identified and characterized ten genes from plant hormone transduction pathway of: auxin (GH3); cytokinins (B-ARR); gibberellins (DELLA); abscisic acid (SnRK2 and ABF); brassinosteroids (BRI1, BZR1 and TCH4); jasmonic acid (MYC2); and salicylic acid (NPR1). In presented studies an analysis of their expression profiles was performed in immature and ripe fruits of red-fleshed cultivars. Generally, we have uncovered, the set of the novel genes, mediating regulation of the abscisic acid, salicylic acid, cytokinins and jasmonic acid signaling and preliminarily described their role in anthocyanin biosynthesis, accumulation and degradation. Their expression was not characterized in apple fruits so far. Presented study, allowed to underline the relationship of genes from hormone signal transduction pathway with UFGT gene, directly responsible for anthocyanin color transformation as well as confirmed their crucial role of plant hormone regulation and anthocyanin accumulation during apple fruit ripening.

DNA-binding transcription factors are broadly characterized as proteins that bind to specific sequences within genomic DNA and modulate the expression of downstream genes. This study focused on KojR—a transcription factor involved in the metabolism of kojic acid, which is an organic acid synthesized in Aspergillus oryzae and is known for its tyrosinase-inhibitory properties. However, the regulatory mechanism underlying KojR-mediated kojic acid synthesis in remains unclear. Hence, we aimed to obtain a comprehensive identification of KojR-associated genes using genomic Systematic Evolution of Ligands by Exponential enrichment (gSELEX-Seq) and RNA-Seq. During the genome-wide exploration of KojR-binding sites via gSELEX-Seq and identification of KojR-dependent differentially expressed genes (DEGs) using RNA-Seq, we confirmed that KojR directly regulates kojT, as was previously reported. We also observed that kojA expression, which may be controlled by KojR, was significantly reduced in a ΔkojR strain. Notably, no binding of KojR to the kojA promoter region was detected. Furthermore, certain KojR-dependent DEGs identified in the present study were associated with enzymes implicated in the carbon metabolic pathway of A. oryzae. This strongly indicates that KojR plays a central role in carbon metabolism in A. oryzae.

In the autonomous navigation of mobile robots, precise positioning is crucial. In forest environments with weak satellite signals or in sites disturbed by complex environments, satellite positioning accuracy has difficulty in meeting the requirements of autonomous navigation positioning accuracy for robots. This article proposes a binocular vision SLAM/UWB tightly coupled localization method. The core of this algorithm is based on an Extended Kalman Filter (EKF), which utilizes the displacement increment output by binocular vision ORB-SLAM and the positioning coordinates calculated via UWB positioning as measurement information to achieve data fusion. The research utilized the constructed experimental platform to collect images and UWB ranging data in outdoor environments and experimentally validated the combined positioning method. The experimental results show that this algorithm outperforms the use of the individual UWB or visual SLAM localization methods in terms of positioning accuracy. Compared with traditional single positioning algorithms, this algorithm exhibits better practicality and stability, and can effectively suppress the impact of UWB non line of sight errors. The average error under normal line of sight conditions is 0.058 m, the root mean square error (RMSE) is 0.080, and the average error under non-line-of-sight conditions is 0.081 m, with an RMSE of 0.084. There is no significant jump or drift. Through the tightly coupled processing of binocular vision SLAM and UWB positioning, more reliable and accurate mobile robot positioning can be achieved, providing a useful reference for the autonomous navigation of mobile robots in complex environments.

Wide-field (WF) retinal imaging is becoming a standard diagnostic tool for diseases involving the retinal periphery. Technological progress elicited the advent of wide-field optical coherence tomography (WF-OCT) and WF-OCT angiography (WF-OCTA) examinations. This review presents the results of studies that analyzed the implementation of these procedures in clinical practice and refers to them as traditional and ultra-wide-field fluorescein angiography (UWF-FA). The PUBMED search was performed using the terms WF-OCT OR WF-OCTA OR UWF-FA AND the specific clinical entity, including diabetic retinopathy (DR), retinal vein occlusion (RVO), Coats disease, peripheral retinal telangiectasia, peripheral retinal degeneration, lattice degeneration, and posterior vitreous detachment. The analysis only included the studies in which the analyzed field of view for the OCT or OCTA exam was larger than 55 degrees. The evaluation of the extracted studies indicates that WF imaging with OCT and OCTA provides substantial information on retinal disorders involving the retinal periphery. Vascular diseases, such as DR or RVO, can be reliably evaluated using WF-OCTA with results superior to standard-field fluorescein angiography. Nevertheless, UWF-FA provides a larger field of view and still has advantages over WF-OCTA concerning the evaluation of areas of non-perfusion and peripheral neovascularization. Detailed information on the vascular morphology of peripheral changes should be obtained via WF-OCTA, not angiographic examinations. WF-OCT can serve as a valuable tool for the detection and evaluation of vitreoretinal traction, posterior vitreous detachment, and peripheral retinal degeneration, and guide therapeutic decisions on a patient’s eligibility for surgical procedures.

Basil, renowned for its aromatic properties, exhibits commendable drought tolerance and holds significant value both as an edible and medicinal plant. Recognizing the scarcity of studies addressing basil’s response to drought stress, we undertook a comprehensive analysis of the volatile metabolome and transcriptome of sweet basil across four distinct levels of drought stress. Our metabolic analysis meticulously identified 830 metabolites, with 215 differentially accumulated metabolites discerned. Notably, the primary constituents of sweet basil volatiles exhibited minimal alterations, while the differentially accumulated metabolites were predominantly lipids and terpenes. The transcriptome analysis unveiled 27,181 differentially expressed DEGs, with a predominant focus on metabolic pathways and biosynthesis of secondary metabolites. Integrating insights from both transcriptome and volatile metabolomic analyses highlighted the pivotal roles of Alpha-linolenic acid, flavonoid, and lignin metabolism in fortifying the resistance of sweet basil against drought stress. This holistic approach not only enriches our understanding of the molecular intricacies underpinning basil’s drought resistance but also furnishes valuable insights for the molecular breeding of basil varieties endowed with enhanced drought tolerance.

The diversity of leaf characteristics, including leaf color, is a prominent subject of study in plant science. Leaf color is predominantly determined by the synthesis and functionality of chlorophyll, a key component of photosynthesis. The regulation of chlorophyll synthesis and degradation involves complex gene interactions, and disruptions in these processes can lead to abnormal chlorophyll synthesis and impact leaf color. This study focuses on Bambusa multiplex f. silverstripe, a natural variant with various leaf colors, including green, white, and green-white leaves. The variations in leaf color are attributed to genetic factors and their influence on gene expression. By employing RNA-seq, we investigate the molecular mechanisms behind chlorophyll anomalies and genetic factors in Silverstripe. Our findings shed light on the complexity of gene interactions and regulatory networks that underlie leaf color diversity and provide valuable insights for future research and plant breeding.

The reflection and transmission spectra of a metamaterial formed by omega-shaped elements with pre-calculated optimal parameters on a silicon substrate have been recorded in the terahertz range at oblique incidence for the s- and p- polarizations of the incident wave. The spectra were interpreted within the dipole radiation theory of electromagnetic waves. Both measurement results and analysis provide evidence sup-porting the presence of a pronounced polarization anisotropy impact in the reflection and transmission of the metamaterial. The potential of these materials to be utilized in the development of devices that control the polarization properties of THz radiation across a wide spectral range is examined.

The development of modern genomic tools has sped up the breeding program of food crops. More recently, genomic resources are being developed for tropical forages and will be key resources for developing climate resilient high yielding forage varieties. In this study, we present a genome-wide association study for biomass yield and feed quality traits in buffel grass (Cenchrus ciliaris L. aka Pennisetum ciliare L.,). Genome-wide markers generated using the DArTSeq platform and mapped onto the reference genome of Setaria italica were used for the genome-wide association study. The results revealed several markers associated with biomass yield and feed quality traits. A total of 78 marker trait associations were identified with R2 values ranging from 0.138 to 0.236. The marker trait associations were distributed across different chromosomes. Of these associations, the most marker trait associations (23) were observed on Chr9, followed by Chr5 with 12. The fewest number of marker trait associations were observed on Chr4 with 2. In terms of traits, 17 markers were associated with biomass yield, 24 with crude protein, 26 with TDN, 14 with ADF, 10 with NDF and six with DMI. Twenty of the identified markers were associated with at least two traits. The identified marker trait associations provide a useful genomic resource for future improvement and breeding of buffel grass.

The lengthy maturation period is the key cause of the reduced hot pepper market value. An experiment was performed to assess the effects of R/B/W light qualities on reducing the maturation period. The maturation period was shortened by 16 days under 4R:1B:5W compared to the control. The appearance of the first flower is a limiting factor affecting the maturation period. It exhibited a dark purple color and an abnormal petal under 4R:1B:5W compared to the control, which was associated with increased contents of flavonoids, total organic acids, and phenolics and decreased total amino acid and carbohydrate contents. Plant hormone, flavonoid, ABC transporters, key metabolites (such as amino acid, carbohydrate, organic acid) was associated with first flower development. Ethylene response factors (ERFs) mediated by light, especially ERF021, were identified as potential hub regulators during the development of the first flower due to their involvement in all the associated metabolic pathways.

Universal Stress Protein (USP) plays an important regulatory role in the response to abiotic stress. Most of the research related to USP so far has been conducted on plant models such as Arabidopsis, rice, and cotton. The potato is one of the four major food crops in the world. Therefore, it is of great significance to study the expression pattern of the potato StUSP gene family under abiotic stress conditions. In this study, a total of 108 USP genes were identified from the genome of the Atlantic potato, divided into four subgroups. And based on the genetic structure, the physical and chemical properties of proteins and other aspects of their biological characteristics are comprehensively analyzed. Collinear analysis showed that the homologous genes of StUSPs and four other representative species (Arabidopsis, rice, coyote tobacco, and tomato) were highly conserved. The cis-regulatory elements of the StUSPs promoter are involved in plant hormones, environmental stress, mechanical damage, and light response. RNA-seq analysis showed that under different abiotic stresses, there are differences in the expression patterns of members of each subgroup. WGCNA co-expression analysis of the central gene showed that the differential co-expression gene is mainly involved in the plant-pathogen response process, plant hormone signal transduction, and the biosynthesis process of secondary metabolites. Through qRT-PCR analysis, it was confirmed that StUSP13, StUSP14, StUSP15, and StUSP41 may be important candidate genes involved in the response to adversity stress in potatoes. The results of this study provide the basis for further research on the functional analysis of StUSPs in the potato response to adversity stress.

The main aim of this work is to present a step-by-step procedure to model and analyze the power loss distribution of three-level Gallium Nitride (GaN) inverters. It has been applied to three distinct three-phase three-levels voltage source inverters utilized in electric traction drives: Active Neutral Point Clamped, Neutral Point Clamped and T-Type Neutral Point Clamped. The proposed analytical power loss modelling, combined to an equivalent representation of the electrical machine demonstrated to be a viable solution to achieve a time-saving and low computational burden simulation platform, leading to satisfying accuracy results. This has been confirmed by comparing the results carried out from the simulations of a 110kW permanent magnet synchronous motor drive and those determined by considering a simplified circuital representation based on the proposed analytical power loss modelling.

in this article, an ultra-wideband traveling wave antenna with antipodal topology is proposed. The proposed design is realized on an economical substrate with minimum thickness. The proposed design offers an ultra-wide bandwidth of 26 to 40 GHz, translating to 42%. The dimensions of the antenna are 20mm x10mm x 0.5mm indicating an electrically compact structure. The proposed antenna offers high front to back ratio of at least 10dB across the bandwidth of operation. The forward gain of the antenna varies from 4 to 7dBi in the afore-mentioned band. The pattern integrity is maintained throughout the band. The antenna is fabricated using the commercial photolithography process. A mutli-step topology of the antennas is also proposed for wide angular coverage. The coverage is greater than 150º with mutual coupling less than 25dB. These performance metrics is achieved with a very small footprint. Simulated and experimental results are presented in this paper.

Genome-wide association studies (GWAS) have successfully revealed many disease-associated genetic variants. For a case-control study, the adequate power of an association test can be achieved with a large sample size, although genotyping large samples is expensive. A cost‐effective strategy to boost power is to integrate external control samples with publicly available genotyped data. However, the naïve integration of external controls may inflate the type I error rates if ignoring the systematic differences (batch effect) between studies, such as the differences in sequencing platforms, genotype calling procedures, population stratification, and so forth. To account for the batch effect, we propose an approach by integrating External Controls into the Association Test by Regression Calibration (iECAT-RC) in case-control association studies. Extensive simulation studies show that iECAT-RC not only can control type I error rates but also can boost statistical power in all models. We also apply iECAT-RC to the UK Biobank data for M72 Fibroblastic disorders by considering genotype calling as the batch effect. Four SNPs associated with Fibroblastic disorders have been detected by iECAT-RC and the other two comparison methods. However, our method has a higher probability of identifying these significant SNPs in the scenario of an unbalanced case-control association study.

Control of Tropical Theileriosis, a tick-borne disease with a strong impact on cattle breeding, can be facilitated by using marker-assisted selection in breeding programs. Genome-wide association studies (GWAS) using high-density arrays are extremely important for the ongoing process of identifying genomic variants associated with resistance to Theileria annulata infection. In this work, Single Nucleotide Polymorphisms (SNPs) were analyzed in the Portuguese autochthonous cattle breeds Alentejana and Mertolenga. In total, 14 SNPs suggestive of significance (p ≤ 10-4) were identified for Alentejana cattle and 20 SNPs for Mertolenga cattle. The genomic regions around these SNPs were further investigated for annotated genes and Quantitative trait loci (QTLs) previously described by other authors. Regarding the Alentejana breed, the MAP3K1, CMTM7, SSFA2, and ATG13 genes are located near suggestive SNPs and appear as candidate genes for resistance to Tropical Theileriosis, considering its action the immune response and resistance to other diseases. On the other hand, in the Mertolenga breed, the UOX gene is also a candidate gene due to its apparent link to the pathogenesis of the disease. These results may represent a first step towards the possibility of including genetic markers for resistance to Tropical Theileriosis in current breed selection programs.

Flax seed is one of the richest plant sources of linolenic acid (LIN) and also contains unsaturated linoleic acid (LIO) and oleic acid (OLE). Stearoyl-ACP desaturases (SAD) and fatty acid desaturases (FAD) play a key role in the synthesis of flax fatty acids (FA). We sequenced flax seed transcriptomes at the 3, 7, 14, 21, and 28 day after flowering (DAF) for ten flax varieties with different oil FA compositions grown under three temperature/watering conditions. Expression levels of 25 genes of SAD, FAD2, and FAD3 families were evaluated. FAD3b, FAD3a, FAD2b-2, SAD3-1, SAD2-1, SAD2-2, SAD3-2, FAD2a-1, and FAD2a-2 had the highest expression levels, which changed significantly during seed development. These genes probably play a key role in the FA synthesis in flax seeds. High temperature and insufficient watering shifted the maximum expression levels of the FAD and SAD genes to earlier development stages, while the opposite trend was observed for low temperature and excessive watering. Differences in FAD and SAD expression profiles under different growth conditions could contribute to the FA composition of linseed oil. Stop codons in the FAD3a gene, resulting in reduced LIN content, decreased the level of the FAD3a transcript. Some difference in reaching the maximum expression level during seed development was observed between 1) SAD3-1, SAD3-2, and FAD2b-2 and 2) SAD2-1, SAD2-2, FAD2a-1, FAD2a-2, FAD3a, and FAD3b. These groups possibly contribute somewhat differently to the synthesis of FA at different development stages.

Smart farm is a technology that greatly helps improve the productivity and quality of crops and is being actively introduced into indoor environments such as green houses. However, it has not yet been distributed to field-grown crops. The main reason is that, unlike indoor environments, it is very difficult to collect sensor data for monitoring the growth environment of crops in open fields where weather conditions change significantly and power supply is difficult. Additionally, because various sensors are used, the data formats of the devices are different, making it difficult to process. This paper presents a field crop growth environment monitoring and big data analysis system. The proposed system first solves power supply and data communication problems using solar power generation and LPWA technology. Additionally, based on the oneM2M architecture, data from various sensors is transmitted to the server using standardized technology. The transmitted data is stored and managed on the server as big data, and can be used to predict the production and quality of field-grown crops and take appropriate measures. The proposed system is expected to create an environment optimized for the growth of field crops and help prevent and manage diseases.

Background: Genome-wide association studies (GWAS) have shed light on various complex diseases and traits, by detecting more than 400,000 associated genetic loci. This number is expected to drastically increase because of the use of novel artificial intelligence methods offering new ways to study the effects of variants. Deep learning using artificial neural networks (ANN) is a sub-field of artificial intelligence, which simulates how the human brain learns. We aimed at assessing the potential of deep learning in human genetic studies of Alzheimer’s Disease (AD) and how these compare to the traditional statistical methods used in GWAS, by simultaneously testing the two approaches on the same dataset, while discovering new genetic loci associated to AD. Methods: To address this aim, phenotypic and genome-wide SNP data from the UK Biobank was analysed on a binary outcome, AD diagnosis, in two different data balance options, of one-to-one and one-to-two case-control datasets, using 2,764 cases vs 2,764 controls and 5,528 controls respectively matched on gender, age, ethnicity, PC1-20 and genotyping array. Genetic data handling and GWAS were performed using PLINK, whereas neural networks were trained using GenNet, a new ANN tool, with the same datasets, separated into training (60%), validation (20%) and test (20%) sets. Neural network layers were determined using biological knowledge, by annotating SNPs to genes and genes to AD related pathways, using ANNOVAR annotations followed by GeneSCF and KEGG. Results: Significant associations were detected between four SNPs linked to two different genes and AD for the 1 to 1 case-control study design and six SNPs linked to four different genes for the 1 to 2 case-control study design by using PLINK. All identified regions have been previously associated to AD. GenNet identified twelve SNPs on seven genes to be associated with AD, all with biological plausibility, achieving an AUC of 0.80 when using three biologically determined layers and 0.73 when using two layers at the neural networks. No common top SNPs were identified between the machine learning and GWAS models. Conclusion: This is one of the first studies attempting to compare the traditional GWAS to more sophisticated state-of-art methods for understanding the genetic architecture of complex phenotypes using the same dataset. More systematic comparisons with such approaches on real data are needed to enable best practises for machine learning in the analysis of genome-wide genetic data.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

REV-ERBα and its paralog, REV-ERBβ encoded by NR1D1 and NR1D2 genes, are key nuclear receptors that link the circadian timing system and metabolic homeostasis. Since heme is an endogenous ligand, REV-ERBs have been considered key components of the circadian molecular clock that can be pharmacologically targeted to treat various circadian rhythm-related diseases, such as cardiometabolic, inflammatory, and neuropsychiatric diseases, as well as cancer. REV-ERBs are believed to be functionally redundant and compensatory, although they often affect the expression of gene subsets in an isoform-specific manner. Therefore, this study aimed to identify the redundant and distinct roles of each isoform in controlling its target genes by comparing the transcriptome profiles of a panel of mutant U2OS human osteosarcoma cells in which either NR1D1 or NR1D2 was ablated. Indeed, our transcriptomic analyses revealed that most REV-ERB-regulated genes were controlled by redundant or even additive actions. However, the RNA expression profiles of each single mutant cell line also provided strong evidence for isoform-dependent actions. For example, REV-ERBα were more responsible for regulating the NF-κΒ signaling pathway, whereas a group of extracellular matrix components required REV-ERBβ to maintain their expression. We found that REV-ERBs have isoform-selective functions in the regulation of certain circadian output pathways, despite their overlapping roles in the circadian molecular clock. Thus, the development of isoform-selective REV-ERB modulators may help treat metabolic disturbances and certain types of cancer.

In recent years, magnetic fields have emerged as a non-thermophysical treatment with a signifi-cant impact on microbial fermentation processes. Brassica trispora is a microorganism known for its indus-trial-scale production of lycopene and high yield of single cells. This study aimed to in-vestigate the impact of low frequency magnetic fields on lycopene synthesis by Brassica trispora and elucidate the underlying mechanism for enhancing lycopene yield. The results indicated that both the intensity and duration of the magnetic field treatment influenced the cell. Exposing the cell to a 0.5 mT magnetic field for 48 hours on the second day of fermentation resulted in a lyco-pene yield of 1473.16 mg/L, representing a re-markable increase of 216.1% compared to the con-trol group. Transcriptome analysis revealed that al-ternating magnetic field significantly up-regulated genes related to ROS and cell membrane structure, leading to a substantial increase in lycopene production. Scanning electron microscopy revealed that the magnetic field treatment resulted in rough, loose, wrinkled surface morphology of the mycelium, along with a few mi-cropores, thereby altering the cell membrane permeability to some extent. Moreover, there was a significant increase in intracellular ROS content, cell membrane permeability, key enzyme activi-ty involved in lycopene metabolism, and ROS-related enzyme activity. In conclusion, the alter-nating fre-quency magnetic field can activate a self-protective mechanism that enhances lyco-pene synthesis by modulating intracellular ROS content and cell membrane structure. These find-ings not only deepen our understanding of the impact of magnetic fields on microbial growth and metabolism but also provide valuable insights for developing innovative approaches to en-hance carotenoid fermentation.

Pollination in angiosperms depends on a complex communication between pollen grains and stigmas, classified as wet or dry, depending on the presence or absence of secretions at the stigma surface, respectively. In species with wet stigma, the cuticle is disrupted and the presence of exudates is indicative of their receptivity. Most stigma studies are focused on few species and families, many of them with self-incompatibility systems. However, there is scarce knowledge about the stigma composition in Fabaceae, the third angiosperm family, whose stigmas have been classified as semidry. Here we report the first transcriptome profiling and DEGs of Vicia faba L. styles and stigmas from autofertile (flowers able to self-fertilize in absence of manipulation whose exudate is released spontaneously) and autosterile (flowers that need to be manipulated to break the cuticle and release the exudates to be receptive) inbred lines. From the 76,269 contigs obtained from the de novo assembly, only 45,1% of the sequences were annotated with at least one GO term. A total of 115,920, 75,489 and 70,801 annotations were assigned to Biological Process (BP), Cellular Component (CC) and Molecular Function (MF) categories, respectively and 5,918 differentially expressed genes (DEGs) were identified between the autofertile and the autosterile lines. Among the most enriched metabolic pathways in the DEGs subset were those related with aminoacid biosynthesis, terpenoid metabolism or signal transduction. Some DEGs have been related with previous QTLs identified for autofertility traits, and their putative functions are discussed. Results derived from this work provides an important transcriptomic reference for style-stigma processes to aid understanding of the molecular mechanisms involved in faba bean fertilization.

Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

Plant protein phosphatase 2Cs (PP2Cs) serve as negative regulators of protein kinase cascades activated in different processes and play important roles in plant development and abiotic-stress-mediated signaling pathways. In this study, a genome-wide study was conducted on the CqPP2C gene family. A total of putative 117 CqPP2C genes were identified. Comprehensive analyses of physical and chemical feature, chromosome localization and subcellular localization were conducted. According to phylogenetic analysis, CqPP2Cs were divided into 13 subfamilies. CqPP2Cs in the same subfamily had similar gene structure, conserved motif and all the CqPP2C proteins had the type 2C phosphatase domains. Gene duplication revealed that segmental duplication was the major driving force for CqPP2Cs expansion and all duplicated CqPP2Cs evolved from purifying selection. The expression of CqPP2Cs in various tissues under different abiotic stresses was analyzed using RNA-seq data. The results revealed that CqPP2C genes were involved in regulating development and stress responses of quinoa. Real-time quantitative reverse transcription PCR (qRT-PCR) analysis of six CqPP2C genes in subfamily A revealed that they were up-regulated or down-regulated under salt and drought treatments. Furthermore, the results of yeast two-hybrid assays revealed that subfamily A CqPP2Cs interacted not only with subclass III CqSnRK2s, but also with subclass II CqSnRK2s. Subfamily A CqPP2Cs could interact with CqSnRK2s in different combinations and intensities to respond to various biological processes and stresses. Overall, our results will be useful for understanding the functions of CqPP2C in regulating ABA signals and responding to abiotic stress.

Machine learning, including deep learning, reinforcement learning, and generative artificial intelligence are revolutionising every area of our lives when data is made available. With the help of these methods, we can decipher information from larger datasets while addressing the complex nature of biological systems in a more efficient way. Although machine learning methods have been introduced to human genetic epidemiological research as early as 2004, those were never used to their full capacity. In this review, we outline some of the main applications of machine learning to assigning human genetic loci to health outcomes. We summarise widely used methods and discuss their advantages and challenges. We also identify several tools, such as Combi, GenNet and GMSTool, specifically designed to integrate these methods for hypothesis-free analysis of genetic variation data. We elaborate on the additional value and limitations of these tools from a geneticist’s perspective. Finally, we discuss the fast-moving field of foundation models and large multi-modal omics biobank initiatives.

Parkinson's disease (PD) stands as the most prevalent degenerative movement disorder, characterized by the loss of dopaminergic neurons in the substantia nigra of the midbrain. In this study, we assessed the transcriptome by analyzing post-mortem mRNA extracted from the substantia nigra of individuals with PD and healthy controls. A total of 16,148 transcripts were identified, with 92 mRNAs displaying differential expression between PD and control groups. Specifically, 33 mRNAs were significantly upregulated, while 59 mRNAs were downregulated in PD compared to controls. The identification of statistically significant signaling pathways, with an adjusted p-value threshold of 0.05, unveiled noteworthy insights. Particularly, enriched categories included cardiac muscle contraction (involving genes such as ATPase Na+/K+ transporting subunit beta 2 (ATP1B2), solute carrier family 8 member A1 (SLC8A1), and cytochrome c oxidase subunit II (COX2)), GABAergic synapse (involving GABA type A receptor-associated protein like 1 (GABARAPL1), G protein subunit beta 5 (GNB5), and solute carrier family 38 member 2 (SLC38A2)), autophagy (involving GABARAPL1 and tumor protein p53-inducible nuclear protein 2 (TP53INP2)), and Fc gamma R-mediated phagocytosis (involving amphiphysin (AMPH)). These findings uncover new pathophysiological dimensions underlying PD, including the involvement of cardiac muscle contraction and specific mitochondrial activity. This knowledge not only contributes to better diagnostic precision but also paves the way for the development of new targeted therapies.Keywords: mRNAs; RNA sequencing; Parkinson’s disease; transcriptome analysis; substantia nigra

In order to investigate both the physiological and molecular mechanisms underlying the impacts of organic selenium and nano-selenium on drought stress of Pak Choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), we measured photosynthetic pigment, antioxidant, nutritional quality, and performed transcriptome sequencing of leaves using RNA-seq technology. Under drought conditions, the beneficial effects of organic selenium and nano-selenium on weight and quality of ‘Suzhouqing’ were primarily manifested in the following aspects. Firstly, there was an enhancement in photosynthetic capacity through upregulation of light-trapping pigment proteins: Lhca1, Lhca2, Lhca3, Lhca4, Lhcb1, Lhcb2, Lhcb3, Lhcb4 and Lhcb5. Secondly, effective regulation of reactive oxygen species homeostasis was achieved by activating the antioxidant system via up-regulation of glutathione S-transferase. Thirdly, water homeostasis was maintained through glutathione oxidase activity. Lastly, increased expression levels of ABC transporter, adenylate kinase and cysteine desulphurase contributed to elevated total selenium content. In addition, we screened hub core genes related to the above key metabolic pathways through Weighted Gene Co-expression Network Analysis. Since the results were consistent with the up-regulated genes identified in the Kyoto Encyclopedia of Genes and Genomes pathway of differentially expressed genes by transcriptome sequencing analysis, this confirms the accuracy and reliability of the transcriptome sequencing data.

Innovative strategies to control malaria are urgently needed. Exploring the interplay between the Plasmodium sp. parasites and host red blood cells (RBC) offers opportunities for novel antimalarial interventions. Pyruvate kinase deficiency (PKD), characterized by heightened 2,3-diphosphoglycerate (2,3-DPG) concentration, has been associated with protection against malaria. Elevated 2,3-DPG levels, a specific mammalian metabolite, may hinder glycolysis, prompting us to hypothesize its potential contribution to PKD-mediated protection. We investigated the impact of the extracellular supplementation of 2,3-DPG on the Plasmodium falciparum intraerythrocytic developmental cycle in vitro. Results showed an inhibition of parasite growth, resulting from significantly less progeny from 2,3-DPG-treated parasites. We analyzed differential gene expression and the transcriptomic profile of P. falciparum trophozoites, from in vitro cultures submitted or not submitted to the action of 2,3-DPG, using Nanopore Sequencing Technology. The presence of 2,3-DPG in the culture medium was associated to a significant differential expression of 71 genes, mostly associated to GO terms nucleic acid binding, transcription, or monoatomic anion channel. Further, several genes related to the cell cycle control were downregulated in treated parasites. These findings suggest that the presence of this RBC-specific glycolytic metabolite impact the expression of genes transcribed during the parasite trophozoite stage and the number of merozoites released from individual schizonts, which supports the potential role of 2,3-DPG in the mechanism of protection against malaria by PKD.

Multiple Gateways (GWs) provide network connectivity to Internet of Things (IoT) sensors in a Wide Area Network (WAN). The End Nodes (ENs) can connect to any GW by discovering and acquiring its periodic beacons. This provides GW diversity and hence improves coverage. If the GWs are within vicinity to each other, and they keep sending periodic beacons to be discovered, the result is interference and collisions. In this study, the impact of such intra-network interference is analyzed to determine the maximum number of GWs that can co-exist within a given urban neighborhood. The paper shows the relationship between beacon collisions and the resulting packet loss rates in a given urban environment. The expected collision rates are calculated for the Medium Access Control (MAC) layer. The eventual packet loss rates are calculated with the MAC and Physical (PHY) layers combined. For this purpose, a new co-channel interference model is presented. The model calculates the average Carrier to Interference ratio (C/I) averaged across all the colliding events. It takes into account the partial overlap durations and the relative power of each colliding signal. The model shows that a collision does not always cause a packet loss. Packet losses occur if there is a collision and if the C/I is below a threshold. The performance evaluation is presented using a combination of analytical and simulation methods. The analytical methods provide the theoretical foundation, and have been used to validate the simulation results. Furthermore, the system models are developed from experimental data obtained from measurements with real hardware. Numerical results are provided with a low bit rate Gaussian Frequency Shift Keying (GFSK) modulation at the PHY layer, which is derived from the IEEE 802.15.4 standard specification. This paper provides guidance on selecting the right GFSK modulation parameters for such low bit-rate and narrow bandwidth IoT applications. The analysis and simulation results show that larger beacon intervals help in reducing beacon loss rates, at the cost of larger beacon acquisition latency. On the flip side, the gateway discovery latency reduces with increasing GW density thanks to abundance of beacons.

Sweetpotato is an important miscellaneous grain crop in China, which is threatened by a variety of diseases and insect pests in the process of cultivation and production. sweetpotato stem rot is one of the common sweetpotato diseases, which seriously affects the yield and quality of sweetpotato. However, there are few studies on the mechanism of resistance to stem rot in sweetpotato. In this study, transcriptome sequencing analysis was carried out on the samples at different stages (T1, T2, T3) of stem rot pathogen infecting Xushu 48, and 44839 (T1-VS-T2), 81436 (T1-VS-T2) and 61932 (T2-VS-T3) differentially expressed genes (DEGs) were obtained. The DEGs were mainly concentrated in Alanine, aspartate and glutamate metabolism (ko00250), Carbon fixation in photosynthetic organisms (ko00710) and Amino sugar and nucleotide sugar metabolism (ko00520) and some candidate genes related to plant pathogen infection, such as receptor-like protein kinase (RLK5, RLK7), LRR receptor-like serine/threonine-protein kinase (SERK1), bHLH137, ERF9, MYB73 and NAC053, were screened. The results of this study provide genetic resources for the research on stem rot resistance of sweetpotato and provide theoretical basis for sweetpotato resistance breeding.

Poa crymophila is a perennial, cold-tolerant, native grass species, widely distributed to the Qing-hai-Tibet Plateau. However, the molecular mechanism behind the cold stress tolerance and role of key regulatory genes and pathways of P. crymophila are poorly understood yet. Therefore, the present study investigated the physiological and transcriptome responses of P. crymophila’s roots, stems, and leaves under cold stress to explore the molecular mechanism of cold tolerance. Results of the present study suggested that cold stress significantly changed the physiologic characteristics of roots, stems, and leaves of P. crymophila. In addition, the transcriptome results showed that 4434, 8793, and 14942 differentially expressed genes (DEGs) were identified in roots, stems, and leaves, respectively; however, 464 DEGs were commonly identified in these three tissues. The Gene On-tology (GO) results showed that a large numbers of DEGs were significantly enriched in the pho-tosynthetic related categories in leaves. In addition, the “response to stimulus” category was sig-nificantly enriched in roots and stems. The Kyoto Encyclopedia of Genes and Genomes (KEGG) results showed that DEGs involved in “phenylpropanoid biosynthesis” were significantly enriched in roots, “photosynthesis” and “circadian rhythm-plant” pathways significantly enriched in stems and leaves, starch and sucrose metabolism, and galactose metabolism were pathways significantly enriched in three tissues. Weighted gene coexpression network analysis (WGCNA) identified Hub genes involved in P. crymophila cold response. This study provides new insights into the molecular mechanisms underlying the cold tolerance of P. crymophila belowground and aboveground tissues. In addition, specific genes involved in Ca2+ signaling, ROS scavenging system, hormones, circadian clock, photosynthesis, and transcription factors (TFs) were identified in P. crymophila. The identi-fication of key genes may provide valuable resources for further functional genomic and breeding studies.

Colorectal cancer is a high-incidence tumor that has a high mortality rate due to its frequent metastasis to the liver. The difference in genes, proteins, and immune microenvironment between the primary and metastatic sites causes them to show different responses to treatment. Colorectal cancer liver metastasis patients also tend to show poorer treatment response and prognosis. Therefore, in this paper, we summarize the heterogeneity exhibited after colorectal cancer liver metastasis from five aspects (gene, transcriptome, protein, metabolism, and immunity), and we found that except for the genetic heterogeneity, the other four aspects exhibite significant heterogeneity, which might serve as a new therapeutic direction and a prognostic marker for patients with liver metastasis. Finally, the therapeutic modalities regarding tumors are rapidly evolving, and we have also summarize the new clinical therapeutic modalities currently proposed based on these heterogeneities, aiming to provide new therapeutic ideas for the clinical treatment of patients with colorectal cancer liver metastases.

In this perspective article, we ponder topographical enhancements of artificial neural networks. In our recent paper in JMLR, we proved a quasi-equivalence between the network width and depth and also discussed the power of intra-links, which can be viewed as network height. In 1982, Hopfield published a network to model human associative memory, which contains many loops for dynamic evolution toward fixed points. Based on noising-denoising loops, diffusion models are recently developed to enable Bayesian modeling and inference with big data. Furthermore, we envision development of multi-AI-agent systems through “netware” engineering as a quantum leap of software engineering for emergent behaviors and autonomous AI at individual and population levels. We believe that the novel use of links and loops in space and time via multi-scale coupling would catalyze the next-generation neural networks.

Aspergillus montevidensis is an important domesticated fungus that has been applied to produce many traditional fermented foods under high osmotic conditions. However, the detailed mechanisms of tolerance to osmotic stress remain largely unknown. Here, we construct a target-deleted strain (ΔLeuRS) of A. montevidensis and found that the ΔLeuRS mutants grew slowly and suppressed the development of the cleistothecium compared to the wide-type strains (WT) under salt-stressed conditions. Furthermore, differentially expressed genes (P<0.0001) governed by LeuRS were involved in salt tolerance, ABC transporter, amino acid metabolism, sugar metabolism, and reproduction process. The ΔLeuRS strains compared to WT strains under short- and long-term salinity stress especially altered accumulation levels of metabolites, such as amino acids and derivatives, carbohydrates, organic acids, and fatty acids. The study provides new insights into the underlying mechanisms of salinity tolerance and lays a foundation for favor improvement of foods fermented with A. montevidensis.

In this work, we tried to emphasize whole transcriptome expression changes in the Wistar rats brainstem two hours after acute stress. Most of the genes were upregulated. We detected massive shift of neuropeptides Crh, Trh,Cga, Tshb, Uts2b, Tac4, Lep and neuropeptide receptors Hcrtr1, Sstr5, Bdkrb2, Crhr2 signaling, as well as Glutamate Grin3b, Grm2 and GABA Gpr156, Acetylcholine Chrm4,Chrne, Adreno- Adra2b receptors expression uprising. Intensive increase in expression of intermediate filaments Krt83/Krt86/Krt80/Krt84/Krt87/Krt4/Krt76 and motor proteins Myo7a, Klc3 was detected. Remarkably, at this time we also observed signs of microglia activation. Both expression of anti-inflammatory cytokines Il13, Ccl24 and proinflammatory cytokin’s receptors Il9r, Il12rb1, Tnfrsf14, Tnfrsf13c, Tnfrsf25, Tnfrsf1b were increased. In the Wnt signaling pathway, we have seen increased expression of ligands-receptors Wnt1, Wnt11, Ror2, and also negative regulators Notum, Sfrp5, Sost. Also we conducted cDNA libraries normalization with duplex specific nuclease and compared results. On the basis of our RNAseq data, we chose reference genes for RT-qPCR best suitable for experiments with acute stress.

Neptunea cumingii is an economically important marine shellfish found in the Yellow Sea and Bohai Sea areas of China. However, due to environmental factors, such as global warming, Neptunea cumingii resources are in decline along the coast of China. In this study, samples of Neptunea cumingii were collected in Zhangzidao and Yantai during spring, summer， autumn, and winter to clarify the gene expression patterns and regulatory mechanisms in the gills in different seasons. Transcriptome analysis was conducted using Neptunea cumingii gill tissues and genes with significantly different expression levels were extracted for functional verification. The most genes with differences in expression（DEGs） were found in comparisons of the winter and summer samples. Gene enrichment analysis based on Gene Ontology and Kyoto Encyclopedia of Genes and Genomes terms showed that these DEGs were mainly involved in immune and metabolic pathways, and they had significant effects on oxidative stress, body metabolism, and protein synthesis in Neptunea cumingii. Further screening of DEGs identified 34 genes related to temperature regulation comprising 13 genes with roles in innate immunity in shellfish, 12 genes related to oxidative stress, and nine genes related to protein synthesis and energy metabolism. Eleven DEGs were randomly selected for qPCR verification and the results were consistent with the transcriptome analysis results. In summary, the transcriptome results differed significantly between seasons in the gill tissues of Neptunea cumingii. The expression levels of immune regulatory genes could be promoted in Neptunea cumingii during the high temperature season, whereas the expression of these genes may be inhibited in the low temperature season. The results obtained in this study provide insights into the molecular defense mechanisms that might allow Neptunea cumingii to adapt to climate change.

Bacillus subtilis NCD-2 showed a promising biocontrol effect against plant soil-borne diseases, and was developed as a commercial microbial fungicide against cotton verticillium wilt in China. Spores were main ingredient of the fungicide and played the crucial role in biological control of plant diseases. Therefore, the key to reducing the cost of fungicide was to find ways to increase the number of spores of strain NCD-2 during fermentation. In this study, 755 substances were evaluated by Phenotype Microarray technology, and 5 kinds of carbon sources and 1 kind of nitrogen source were found to promote the metabolism of strain NCD-2. Among carbon sources L-arabinose showed strongest ability to promote the bacteria growth and sporulation of strain NCD-2. When L-arabinose was used as a single carbon source, it could increase the bacteria concentration and the sporulation efficiency of strain NCD-2 by 2.04 times and 1.99 times, respectively, compared with D-glucose. Moreover, L-arabinose could significantly decrease the autolysis of strain NCD-2 revealed by microscopy observation. The mechanism for promoting the sporulation by L-arabinose was analysed by RNA-seq sequencing. Results showed that total of 790, 923 and 1270 genes were up-regulated and 639, 850 and 1001 genes were down-regulated under L-arabinose supplies when cultured at 8 h, 12 h and 16 h, respectively. Fourteen differentially expressed genes associated with arabinose transportation and sporulation were selected for qRT-PCR analysis, and the result showed basically consistent expression trend with transcriptome. Notably, genes associated with arabinose metabolism, sporulation, spore resistance to heat and spore coat formation were significantly up-regulated, and genes associated with sporulation-delaying protein were significantly down-regulated under L-arabinose supplies. msmX gene which was involved in arabinose transport in Bacillus genus was deleted, and the mutant decreased the growth and sporulation by 53.71% and 86.46%, respectively, when compared to strain NCD-2 wild type. Complementary of the mutant by importing intact msmX gene could restore the growth and sporulation of the mutant strain. In conclusion, arabinose played an important role in regulating the growth and sporulation of strain NCD-2.

Gibberella ear rot (GER) caused by Fusarium graminearum (teleomorph Gibberella zeae) is one of the most destructive diseases in maize that severely reduces grain yield and contaminates several potential mycotoxins. However, few efforts had been devoted to dissect the genetic basis of maize GER resistance. In the present study, a genome-wide association study (GWAS) was conducted in a maize association panel consisting of 303 diverse inbred lines. The phenotypes of GER severity were evaluated using kernel bioassay across multiple time points in the laboratory. Then, three models including fixed and random model circulating probability unification model (FarmCPU), general linear model (GLM) and mixed linear model (MLM), were conducted simultaneously in GWAS to identify single-nucleotide polymorphisms (SNPs) significantly associated with GER resistance. A total of four individual significant association SNPs with the phenotypic variation explained (PVE) ranging from 3.51 to 6.42% were obtained. Interestingly, the peak SNP (PUT-163a-71443302-3341) with the greatest PVE value, was co-localized in all models. Subsequently, 12 putative genes were captured from the peak SNP that several of these genes were directly or indirectly involved in disease resistance. Overall, these findings contribute to understand the complex plant-pathogen interactions in maize GER resistance. The regions and genes identified herein provide a list of candidate targets for further investigation, in addition to the kernel bioassay that can be used for evaluating and selecting elite germplasm resources with GER resistance in maize.

(1) Background: The imaging energy range of a typical Compton camera is limited due to the fact that scattered gamma photons are seldom fully absorbed when the incident energies are above 3 MeV. Further improving the upper energy limit of gamma-ray imaging has important application significance in active interrogation of special nuclear materials and chemical warfare agents, as well as range verification of proton therapy; (2) Methods: To realize gamma-ray imag-ing in a wide energy range of 0.3~7 MeV, a principle prototype, named a portable three-layer Compton camera, was developed using the scintillation detector that consist of an silicon photo-multiplier array coupled with a Gd3Al2Ga3O12:Ce pixelated scintillator array. Implemented in a list-mode maximum likelihood expectation maximization algorithm, a far-field energy-domain imaging method based on two-interaction and three-interaction events was applied to estimate the initial energy and spatial distribution of gamma-ray sources. The simulation model of detec-tors was established based on Monte Carlo simulation toolkit Geant4. The reconstructed images of a 133Ba, a 137Cs and a 60Co point-like sources were successfully obtained with our prototype in laboratory tests and compared with simulation studies; (3) Results: The proportion of effective imaging events accounted for about 2%, which made our prototype realize reconstructing the distribution of a 0.05 μSv/h 137Cs source in 10 seconds. The angular resolution for resolving two 137Cs point-like sources was 15°. Additional simulated imaging of the 6.13 MeV gamma-rays from 14.1 MeV neutron scattering with water preliminarily demonstrated the imaging capability for high incident energy; (4) Conclusions: We concluded that the prototype had good imaging per-formance in a wide energy range (0.3~7 MeV), which showed potential in several MeV gam-ma-ray imaging applications.

Recently, smart mobility intelligent traffic services have become a critical task in Intelligent Transportation Systems (ITS). This involves not only the use of advanced sensors and controllers but also the ability to respond to real-time traffic situations at intersections, alleviate congestion, and generate policies to prevent traffic jams. DRL (Deep Reinforcement Learning) provides a natural framework for processing tasks. In DRL, each intersection can control itself and coordinate with neighbors to achieve optimal network-wide policies. However, comparing approaches remains a challenging task due to the existence of numerous possible configurations. This research performs a critical comparison of various traffic controllers found in the literature. It demonstrates that using a nonlinear approximator for coordination mechanisms and enhancing observability at each intersection are key performance drivers.

Hispanics are disproportionately affected by low rates of physical activity and high rates of chronic diseases. Hispanics generally and Mexican Americans specifically are underrepresented in research on physical activity and its impact on mental well-being. Some community-based interventions have been effective in increasing physical activity among Hispanics. This study examined data from a sample of low-income Hispanic participants in free community exercise classes to characterize the association between self-reported frequency of exercise class attendance, intensity of physical activity, and participant well-being. As part of two cross-sectional samples recruited from a stratified random sample of community exercise classes, 302 participants completed a questionnaire consisting of a modified version of the Godin-Shephard Leisure-Time Exercise Questionnaire (LTEQ) and the Mental Health Continuum Short Form (MHC-SF). Adjusted binary logistic regression analyses indicated that those who achieve moderate and strenuous self-reported physical activity have 130% higher odds (p = 0.0422) of positive mental well-being after adjustment for age, attendance, and self-reported health. This study provides evidence that physical activity intensity and time are associated with flourishing mental health among Hispanics. The study provides insight into the planning and development of community-based physical activity programming tailored to low-income populations.

In recent years, frequent occurrences of low temperature disasters due to global climate change have significantly impacted the normal growth of crops. Research has indicated that inorganic selenium (which is more toxic) can not only enhance the effects of low temperature stress but also increase selenium content on plants; however, there is a scarcity of studies investigating the impacts of organic selenium and nano-selenium on crops. In order to investigate whether organic selenium and nano-selenium can enhance low-temperature tolerance and increase selenium content in pak choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), different concentrations (0, 5, 10, 20 mg L-1) of exogenous selenium were applied in this experiment to assess their effects on plant growth, nutritional quality and antioxidant properties. RNA-Seq technology was used to sequence the transcriptome of the leaves. Based on the transcriptome data, a Weighted Gene Co-expression Network Analysis (WGCNA) was employed to construct a network that associates with physiological traits related to stress resistance. Two highly correlated gene co-expression modules were identified, and within them, nine hub genes associated with endocytosis, antioxidant stress, absorption, transport, and metabolism of selenium were discovered. The results indicated that the beneficial effects on yield and total selenium content under low temperature were attributed to (1) protection of photosynthetic pigments for enhancing photosynthetic capacity by the up-regulation of LHca2, LHcb1, LHca1, LHcb4 in KEGG pathway: photosynthesis-antenna proteins; (2) activation of antioxidant system for efficient ROS homeostasis such as SOD, POD and CAT by the genes such as Superoxide dismutase, Monodehydroascorbate and (3) selenium absorption by endocytosis, seleninum transportation by ABC transporter gene family and selenium metabolism related genes such as Cysteine synthase, Glutaredoxin. These findings provide a foundation for further investigation into the molecular mechanisms underlying the effects of organic selenium and nano-selenium on cyanochloride production at low temperatures.

Cancer researchers are fascinated by the chemistry of diverse natural products which show exciting potential as anticancer agents. In this study, we aimed to investigate the anticancer properties of watermelon rind extract (WRE) by examining its effects on cell proliferation, apoptosis, senescence, and global gene expression in human renal cell adenocarcinoma cells (HRAC-769-P) in vitro. Our metabolome data analysis of WRE exhibited untargeted phyto-constituents and targeted citrulline (22.29 µg/mg). HRAC-769-P cells were cultured in RPMI-1640 media and treated with 22.4, 44.8, 67.2, 88.6, 112, 134.4, and 156.8 mg mL-1 for 24, 48, and 72 hrs. At 24 hrs after treatment, (88.6 mg ml-1 of WRE) cell proliferation significantly reduced, more than 34% compared to the control. Cell viability decreased 48 and 72 hours after treatment to 45% and 37%, respectively. We also examined poly caspase, SA-beta-galactosidase (SA-beta-gal), and wound healing activities using WRE. All treatments induced an early poly caspase response and a significant reduction in cell migration. Further, we analyzed the transcript profile of the cells grown at 44.8 mg ml-1 of WRE after 6 hours using RNA sequencing (RNAseq) analysis. We identified 186 differentially expressed genes (DEGs), including 149 upregulated genes and 37 downregulated genes, in cells treated with WRE compared to the control. The differentially expressed genes were associated with NF-Kappa B signaling and TNF pathways. Crucial apoptosis-related genes such as BMF, NPTX1, NFKBIA, NFKBIE, and NFKBID might induce intrinsic and extrinsic apoptosis. Another possible mechanism is a high quantity of citrulline may lead to induction of apoptosis by the production of increased nitric oxide. Hence, our study suggests the potential anticancer properties of WRE and provides insights into its effects on cellular processes and gene expression in HRAC-769-P cells.

In recent, Chae found that, at weak gravitational acceleration g_N≲10⁻⁹ms⁻², the observed orbit of the wide binary stars is not accordant with current theory of binary star. Here, we present, this finding should be an observational evidence for that Newtonian theory of orbit perturbation is still valid in galactic scale.

Pigs are susceptible to cold stress due to the absence of brown fat caused by the partial deletion of uncoupling protein 1 during their evolution. Some local pig breeds in China, exhibit potential cold adaptability, but research has primarily focused on fat and intestinal tissues. Skeletal muscle plays a key role in adaptive thermogenesis in mammals, yet the molecular mechanism of cold adaptation in porcine skeletal muscle remains poorly understood. This study investigated the cold adaptability of two pig breeds, Mashen pigs (MS) and Large White pigs (LW), in a 4-day cold (4°C) or room temperature (25°C) environment. We recorded phenotypic changes and collected blood, and longissimus dorsi muscle for transcriptome sequencing. Finally, a candidate gene was randomly selected for functional exploration in porcine skeletal muscle satellite cells. A decrease in body temperature and body weight in both LW and MS pigs under cold stress, accompanied by increased shivering frequency and respiratory frequency. However, MS pigs demonstrated stable physiological homeostasis, indicating a certain level of cold adaptability. LW pigs primarily responded to cold stress by regulating heat production and Glycolipid energy metabolism. MS pigs exhibited a distinct response to cold stress, involving regulation of heat production, energy metabolism pathways, robust fatty acid oxidation ability, and stronger immune response. Furthermore, the functional exploration of PRSS8 in porcine skeletal muscle satellite cells revealed it affected cellular energy metabolism and thermogenesis by regulating ERK phosphorylation. These findings shed light on the diverse transcriptional responses of skeletal muscle in LW and MS pigs under cold stress, offering valuable insights into the molecular mechanisms underlying cold adaptation in pigs.

Alternative splicing (AS) is a gene regulatory mechanism modulating gene expression in multiple ways. AS is prevalent in all eukaryotes including plants. AS generates two or more mRNAs from the precursor mRNA (pre-mRNA) to regulate transcriptome complexity and proteome diversity. Advances in next-generation sequencing, omics technology and bioinformatics tools, and computational methods provide new opportunities to quantify and visualize AS-based quantitative trait variation associated with plant growth, development, reproduction, and stress tolerance. Domestication, polyploidization and environmental perturbation may evolve novel splicing variants associated with agronomically beneficial traits. To date, pre-mRNAs from many genes are spliced into multiple transcripts that cause phenotypic variation for complex traits, both in model plant Arabidopsis and field crops. Cataloguing and exploiting such variation may provide new paths to enhance climate resilience, resource-use efficiency, productivity, and nutritional quality of staple food crops. This review provides insights into AS variation alongside gene expression analysis to select for novel phenotypic diversity for use in breeding programs. AS contributes to heterosis, enhances plant symbiosis (mycorrhiza and rhizobium), and provides a mechanistic link between the core clock genes and diverse environmental clues.

Autophagy is an evolutionarily conserved mechanism for degrading and recycling different cellular components in both normal development and stress conditions. Our recent research demonstrated that autophagy-mediated compartmental cytoplasmic deletion is essential for pollen germination. However, how autophagy regulates pollen germination to ensure its fertility remains largely unknown. Here, we applied multi-omic analyses to investigate the downstream pathways of autophagy in the process of pollen germination. Although ATG2 and ATG5 play similar roles in regulating pollen germination, high-throughput transcriptomic analysis reveals that silencing ATG5 has greater impact on the transcriptome than silencing ATG2. Cross-comparisons of transcriptome and proteome analysis reveal that gene expression at mRNA level and protein level are differentially affected by autophagy. Furthermore, high-throughput metabolomics analysis demonstrates that pathways related amino acid metabolism and aminoacyl-tRNA biosynthesis can be affected by both ATG2 and ATG5 silencing. Collectively, our multi-omic analyses reveal a central role of autophagy in cellular metabolism, which is critical for the initiation of pollen germination and the guarantee of pollen fertility.

Climate change-induced temperature fluctuations pose a significant threat to crop production, particularly in the Southern Hemisphere. This study investigates the transcriptome and physiological responses of rapeseed to post-flowering temperature increases, providing valuable insights into the molecular mechanisms underlying rapeseed tolerance to heat stress. Two rapeseed genotypes, Lumen and Solar, were assessed under control and heat stress conditions in field experiments conducted in Valdivia, Chile. Results showed that seed yield and seed number were negatively affected by heat stress, with genotype-specific responses. Lumen exhibited a 9.3% average seed yield reduction, while Solar showed a 28.7% reduction. RNA-seq analysis of siliques and seeds revealed tissue-specific responses to heat stress, with siliques being more sensitive to temperature stress. Hierarchical clustering analysis identified distinct gene clusters reflecting different aspects of heat stress adaptation in siliques, with a role for protein folding in maintaining silique development and seed quality under high temperature conditions. In seeds, three distinct patterns of heat-responsive gene expression were observed, with genes involved in protein folding and response to heat showing genotype-specific expression. Gene coexpression network analysis revealed major modules for rapeseed yield and quality, as well as the trade-off between seed number and seed weight. Overall, this study contributes to understanding the molecular mechanisms underlying rapeseed tolerance to heat stress and can inform crop improvement strategies targeting yield optimization under changing environmental conditions.

Plant cell and tissue culture has been a crucial component of efforts to enhance crops and advance plant biotechnology ever since the beginning of the XX century when Hildebrand discovered the theory of totipotency – a somatic plant cell still has the capacity to develop into every cell that makes up a whole plant. Further standardization of the techniques for use in crop improvement has resulted from the original interest with the creation of the numerous plant tissue culture techniques through the various advancement. The most important approach used in plant tissue culture is the cultivation of differentiated tissue that results in the development of an undifferentiated mass of parenchymatous cells and their subsequent differentiation by organogenesis or somatic embryogenesis. This has been playing a significant role in the creation of virus-free seedlings and fast clonal multiplication, and it is also a crucial component in transgenic' regeneration. Additionally, cell cultures with a variety of mutations emerging in it offers chances to enhance crops. For the purpose of identifying homozygous recombinants in a single generation, haploid cell culture offers an additional benefit. Wide hybridization and the embryo rescue procedure have helped to produce haploid embryos and homozygous lines of doubled haploids which are difficult and time consuming to produce using traditional methods. Developed haploid embryos from the male gametophyte, carried out in cultures of immature anthers or isolated microspores, are referred to as androgenesis and could be the most efficient way to create lines of doubled haploids. The cell cultures also offer the chance to extract a variety of beneficial biochemicals. Induction of mutations in cultured cells and tissue in vitro to produce beneficial cultivars and manipulation of the centromere-specific histone CENH3 also become possible in recent years. Compared to traditional methods, in vitro cultures offer a number of both scientific and practical advantageous for scientists and plant breeders. However, the usefulness of individual methods should be examined by analyzing their advantages and disadvantages. When it comes to oat (Avena sativa L.) the efficient method of plant regeneration is still missing compared to the most common cereals, possibly because this cereal is known as recalcitrant for in vitro culture. An effort has been made to provide a succinct overview of the various in vitro techniques utilized or potentially involved in breeding of oat (Avena sativa L.) in this review. The present work aims to summarize the crucial methods of A. sativa cultivation under tissue culture conditions with a focus on the progress that has been made in biotechnological techniques which are used in breeding of this species.

Glucose is an important carbon sources for microbial growth, and its content in infertile soils is essential for the growth of the bacterium. Since the mechanism of oligotrophic bacterium adaptation in barren soils is unclear, the research employed RNA Seq technology to examine the impact of glucose concentration on the low nutrient bacteria BS-G1 in soil affected by desertification. RNA-Seq revealed that differentially expressed genes（DEG）histidine metabolism, glutamate synthesis, HIF-1 signalling pathway, sporulation, and TCA cycle pathway of BS-G1 were significantly enriched in 0.015 g/L glucose concentration, compared with 10 g/L glucose concentration. DEG amino acids system, two-component system, Metal Ion Transport, and nitrogen metabolism system of B. subtilis BS-G1 were significantly enriched in 5 g/L glucose concentration, compared with 10 g/L glucose concentration. In addition, The present study identified its regulation pattern and key genes under the low glucose environment (7 mRNAs, 16 sRNAs). This study primarily investigates the variances in the regulatory pathways of oligotrophic bacteria BS-G1, which holds substantial importance in comprehending the mechanism underlying the limited sugar tolerance of oligotrophic bacteria.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Alfalfa is an important forage crop around the world. LncRNAs are considered to be a class of functional biomacromolecules, while little is known about lncRNAs in alfalfa. In this study, RNAs from different tissues of alfalfa were sequenced and anlyzed with full-length transcriptome sequencing technology, yielding the full-length transcripts dataset of alfalfa. Based on sequencing and public RNA-seq data, lncRNAs of alfalfa were predicted genome-wide by CPC2 and PLEK. The results showed most lncRNAs shared low sequence conservation with those in other plant species, part of which seems originate from plastid genome. We also identified 88563 lncRNAs, approximately 99.8% of total lncRNAs, with possibility of coding small ORFs using two prediction tools. Our research generated the biggest sequence set of alfalfa lncRNAs, and revealed some plastid originated lncRNAs with high sequence conservation.

This paper proposes a compact wideband split ring resonator (SRR) based C-shaped antenna for 5G new radio (NR) band n258 millimeter wave (mm-Wave). The proposed antenna covers a wideband frequency range from 24.1 GHz to 28.3 GHz with a reflection coefficient below -10 dB. Stubs are used at each C-shaped element for impedance matching of the antenna. The proposed antenna comprises SRRs with stubs to increase the bandwidth and gain simultaneously for better performance in mm-Wave applications. A simple SRR structure is modeled to function as a reactive impedance surface with inductive property for frequencies less than 30.2 GHz. The proposed antenna realizes an impedance bandwidth of 16.1% and covers a wideband of 4.2 GHz (24.1 GHz -28.3 GHz). The use of stubs and SRR has improved the performance of the proposed antenna at mm-Wave frequencies. Specifically, the deployment of the SRR is able to produce an improved gain for the overall direction of the antenna. The simulation and measured results agree well and maintain a 7.49 dBi gain with a bandwidth of 4.2 GHz. An average efficiency of 90% can be attained in the operating range of the antenna. The designed antenna is applicable for 5G NR Band n258.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Chinese pepper rust is a live parasitic fungal disease caused by Coleosporium zanthoxyli, which seriously affects the cultivation and industrial development of Z. armatum. Cultivating and planting resistant cultivars is considered the most economical and environmentally friendly strategy to control this disease. Therefore, the mining of excellent genes for rust resistance and analysis of the mechanism of rust resistance are the key strategies to achieve the targeted breeding of rust resistance. However, there is no relevant report on pepper rust resistance at present. The aim of the present study was to further explore the resistance mechanism of pepper by screening the rust-resistant germplasm resources in the early stage. Combined with the analysis of plant pathology, transcriptomics, and metabolomics, we found that the genes and metabolites related to phenylpropanoid metabolism were highly enriched in resistant varieties after pathogen infection, which indicated that phenylpropanoid metabolism might mediate the resistance of Z. armatum. This finding was further confirmed by real-time quantitative polymerase chain reaction analysis, which revealed that the expression levels of core genes involved in phenylpropane metabolism in disease-resistant varieties were high. In addition, the difference in flavonoid content in the leaves between resistant and susceptible varieties further supported the conclusion that the flavonoid pathway is one of the main pathways involved in resistance formation in Chinese pepper, and MeJA is involved in the formation of resistance. Our research results not only help to better understand the resistance mechanism of Z. armatum rust but also contribute to the breeding and utilization of resistant varieties.

To explore the expression characteristics and biological functions of related genes of medicago terrestris under long day conditions, and to lay a foundation for revealing the molecular mechanism of medicago terrestris under long day conditions. The leaves of 'R108' tribulus Medicago sativa at branch stage (A), bud stage (B), initial flowering stage (C) and full flowering stage (D) were sequenced by RNA-Seq technology. The genome of Medicago sativa, a related species of Tribulus tribulus, was used as a reference genome for sequence comparison. The transcriptomes of three adjacent periods (A vs B, B vs C, C vs D) were analyzed for differentially expressed genes and photoperiod related differentially expressed genes were screened. A total of 6875 differentially expressed genes were detected. GO functional analysis showed that differentially expressed genes were mainly involved in biological processes, cell components and molecular functions, among which the most differentially expressed genes were involved in cell components. KEGG enrichment analysis showed that differentially expressed genes were mainly involved in circadian rhythm, photosynthesis - antenna protein, ribosome metabolism and other pathways. The number of single nucleotide variants detected by cSNP analysis was 312875, and the frequency of A/G and C/T were the highest. The function of eggNOG was divided into 23 categories, with a total of 26745 genes having similarities, 9008 genes were classified as function unknown, 2669 genes were classified as signal transduction mechanism, 2194 genes were classified as transcription, etc. In different developmental stages (A vs B, B vs C, C vs D), 3463 up-regulated and 3412 down-regulated differentially expressed genes were found. The difference between up-regulated and down-regulated genes was the most obvious between bud stage and initial flowering stage. In addition, a total of 79 flowering genes were found, of which 51 differential genes were screened out to participate in photoperiodic regulation pathway, 23 differential genes were up-regulated, and 28 differential genes were down-regulated. The ratio of gene-LOC11410562(GI), gene-LOC11435974(CO), gene-LOC11422615(TOC1) and gene-LOC11432385(LHY) was higher than that of gene-LOC25500742(PHYA) and gene-LOC11 431402(ELF3), gene-LOC11434778(Col13), gene-LOC25498015(Col6), and gene-LOC11415514(Col9) were preexpressed. The above differentially expressed genes were significantly expressed in different development stages of Terrestris alfalfa, which laid a foundation for further study of the molecular mechanism of Terrestris alfalfa.

The morphology of virgin reactor powder (RP) of high-density polyethylene HDPE with MW = 160,000 g/mol was investigated with the help of DSC, SEM, SAXS and WAXS methods. The morphological SEM analysis showed, that the main morphological units of RP are macro- and micro-shish kebab structures with significantly different geometric dimensions, as well as individual lamellae of folded chain crystals. Quantitative analysis of an asymmetric SAXS reflection made it possible to reveal the presence of several periodic morphoses in the RP with long periods from 20 nm to 60 nm and to correlate them with the observed powder morphology. According to the DSC crystallinity data, the thickness of the lamellae in each long period was estimated. Their surface energy was calculated in the framework of the Gibbs-Thompson theory. The presence of regular and irregular folds on the surface of the different shish-kebab lamellae is discussed. The percentage of identified morphoses in the RP was calculated. It has been suggested that the specific structure of HDPE RP is due to the peculiarity of polymer crystallization during suspension synthesis in a quasi-stationary regime, in which local overheating and inhomogeneous distribution of shear stresses in a chemical reactor are possible.

Mint is considered to have a greater number of phenolic acids, flavonoids, antioxidants and other bioactive components, and is widely used as food, medicine, spices, and flavoring agents. Thus, chemical composition is an important parameter for assessing the quality of mint. In this study, two mint cultivars were sampled, purple mint and green mint. The purple mint had much higher anthocyanin and total flavone content compared with green mint. Transcriptome and metabolome technique were employed to elucidate the regulation network of mint pigment and flavone. A total of 167,901 unigenes were obtained by high-throughput RNA-Seq and 34,608 genes were differentially expressed. The differentially expressed genes (DEGs) were mainly involved in lignin metabolic process and flavonoid biosynthetic process. A total of 143 differentially expressed metabolites (DEMs) were enriched in isoflavonoid biosynthesis, flavonoid biosynthesis, flavone and flavonol biosynthesis, and anthocyanin biosynthesis pathways. The co-analysis results of DEGs and DEMs showed that the flavone and flavonol biosynthesis pathway (ko00944) contained the most DEMs, followed by flavonoid biosynthesis pathway (ko00941) and anthocyanin biosynthesis pathway (ko00942). Furthermore, the most important nine genes and metabolites were screened using O2PLS model. The results will provide a theoretical basis for revealing pigment and flavone biosynthesis network of mint.

Neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, are caused by a combination of multiple events that damage neuronal function. A well-characterized biomarker of neurodegeneration is proteinaceous aggregates accumulation in the brain. However, the gradually worsening symptoms of neurodegenerative diseases are unlikely to be solely due to the result of a mutation in a single gene, but rather a multi-step process involving epigenetic changes. Multiple epigenetic studies have revealed that modification of histones accompanied by both the local and global remodeling of the chromatin structure and alternations in transcriptional patterns are closely associated with the pathogenesis of neurodegenerative diseases. Unlike DNA mutations, epigenetic alterations are reversible, and therefore raise the possibilities for therapeutic intervention including dietary modifications. Additionally, reactive oxygen species may contribute to the pathogenesis of Alzheimer’s disease and Parkinson’s disease. Given that the antioxidant properties of plant-derived phytochemicals are likely to exhibit pleiotropic effects against ROS-mediated epigenetic alternation, dietary intervention may be promising for the management of neurodegeneration in these diseases. In this review, the state-of-the-art applications using single-cell multi-modal omics approaches including genetics, and epigenetics, and dietary approaches for the identification of novel biomarkers and therapeutic approaches for the treatment of neurodegenerative diseases are discussed.

DEXTER (Detection of EXplosives and firearms to counter TERrorism) is a project funded by NATO’s Science for Peace and Security (SPS) program with the goal of developing an integrated system capable of remotely and accurately detecting explosives and firearms in public places without impeding the flow of pedestrians. The active microwave component of the DEXTER project is referred to as MIC (Microwave Imaging Curtain), supported by the French SGDSN (General Secretariat of Defense and National Security), and utilizes a radar system capable of generating 3D images in real time to address non-checkpoint detection of explosives and fire-arms. The project, led by the ONERA (France), is based on a radar imaging system developed by the Fraunhofer FHR institute, using a MIMO architecture with an Ultra Wide-Band waveform. Although high-resolution 3D microwave imaging is already being used in expensive body scanners to detect firearms concealed under clothing, MIC's innovative approach lies in utilizing a high-resolution 3D imaging device that can detect larger dangerous objects carried by moving individuals at a longer range, in addition to providing discrete detection in pedestrian flow. Automatic detection and classification of these dangerous objects is carried out on 3D radar im-ages using a deep-learning network. This paper will outline the project's objectives and constraints, as well as the design, architecture, and performance of the final system. Additionally, it will present real-time imaging results ob-tained during a live demonstration in a relevant environment.

Bromodomain (BRD)-containing proteins are involved in many biological processes, most notably epigenetic regulation of transcription, and BRD protein dysfunction has been linked to many diseases, including tumorigenesis. However, the role of BRD proteins in the pathogenesis of uterine fibroids (UFs) is entirely unknown. The present study aimed to determine the expression pattern of BRD9 protein in UFs and matching myometrium and further assess the impact of BRD9 inhibitors on UF phenotype and epigenetic/epitranscriptomic changes. Our studies demonstrated that the levels of BRD9 were significantly upregulated in UFs compared to matched myometrium, suggesting that the aberrant BRD protein expression may contribute to the pathogenesis of UFs. We then evaluated the potential roles of BRD9 using its specific inhibitor I-BRD9. Targeted inhibition of BRD9 suppressed the UF tumorigenesis with increased apoptosis and cell cycle arrest, decreased cell proliferation, and extracellular matrix deposition in UF cells. The latter is the key hallmark of UFs. Unbiased transcriptomic profiling coupled with downstream bioinformatics analysis further and extensively demonstrated that targeted inhibition of BRD9 impacted the cell cycle- and ECM-related biological pathways, reprogrammed the UF cell epigenome and epitranscriptome, and altered miRNA-mediated gene regulation in UFs. Taken together, our data support the critical role of BRD9 in UF cells and the strong interconnection between BRD9 and other pathways controlling the UF progression. Targeted inhibition of BRD proteins might provide a non-hormonal treatment option for this most common benign tumor in women of reproductive age.

In recent years, many studies have reported that several distinct families of transcription factor (TF) genes play crucial roles in the response of plants to abiotic stress. Although some of these families got systematically studied in many species, little knowledge exists about these genes in oil palm (Elaeis guineensis Jacq.). In this study, 20 genes differentially expressed in the leaves of oil palm plants subjected to salinity or drought stress and encoding TFs belonging to four families of TFs - MYB, HD-ZIP, NF-Y, and HSFF - got selected for further characterization. The genes underwent a structural and functional annotation, besides having their RNA-Seq expression profile validated by the qPCR technique, and a correlation analysis of their response under both stresses got performed. The annotation analysis of the promoter region showed the presence of seven cis-acting elements, all already reported to be involved in plants' response to abiotic stress. The structural and functional characterization of the proteins encoded by the selected genes showed that some groups present patterns of conserved regions and are orthologs to genes already linked to salinity or drought resistance in other plant species. It was possible to confirm the RNA-Seq expression profile of 19 genes, only gene 4 showed the opposite response when using qPCR. Through correlation analysis, it was possible to observe a high level of similarity in the behavior of the 20 genes in response to drought or salinity stress, a behavior already reported in other species. The results presented here shed light on the role of 20 TFs in the leaves of young oil palm plants under severe levels of soil salinity or water deprivation. The high level of similarity in the molecular response to both stresses allowed the identification of genes that might grant strategies aiming to develop oil palm plants with a tolerance to both salinity and drought at once.

Drought and salinity are among the most important abiotic stress factors that limit the productivity in economically important plants. Although genes from wild relatives or unadapted germplasm have often been used for stress tolerance breeding, only few studies have examined wild relatives to understand the genetic and molecular basis of stress tolerance. In this study, we monitored the changes in gene expression profiles of leaf and root tissues of two wild barleys (Hordeum spontaneum L.) accessions from Israel after treatment with salt (NaCl) and drought (PEG) stress. We identified a total of 641 differentially expressed genes across 24 conditions (2 accessions, 2 stress conditions, 2 tissues and 3 time points). Our gene expression analyses revealed large numbers of differentially expressed genes in different accessions by different stress treatments. In addition, the number of genes altered in the leaves of stress-exposed plants of both genotypes was higher than those altered in the roots. Interestingly, there was a relatively little overlap between the leaf and the root stress-responsive gene expression patterns, suggesting that different stress-associated processes might be operating in these tissues during stress adaptation. Overall, our results revealed a number of candidate genes and plant processes associated with stress tolerance in wild barley. Wild barley would be a useful source of new genetic variation for drought and salt stress tolerance. Our results could provide new insights into the mechanisms of drought and salt stress tolerance in wild barley and should be useful for genetic improvement of salt-drought tolerance in cultivated barley.

In the recent decades, per- and polyfluoroalkyl substances (PFAS) have garnered widespread public attention due to their persistence in the environment and detrimental effects on the health of living organisms, spurring the generation of several transcriptome-centered investigations to understand the biological basis of their mechanism. In this study, we collected 2144 publicly available samples from 7 distinct animal species to examine the molecular responses to PFAS exposure and to determine if there are conserved responses. Our comparative transcriptional analysis revealed that exposure to PFAS is conserved across different tissues, molecules and species. We identified and reported several genes exhibiting consistent and evolutionarily conserved transcriptional response to PFAS, such as ESR1, HADHA and ID1, as well as several pathways including lipid metabolism, immune response and hormone pathways. This study provides the first evidence that distinct PFAS molecules induce comparable transcriptional changes and affect the same metabolic processes across inter-species borders. Our findings have significant implications for understanding the impact of PFAS exposure on living organisms and the environment. We believe that this study offers a novel perspective on the molecular responses to PFAS exposure and provides a foundation for future research into developing strategies for mitigating the detrimental effects of these substances in the ecosystem.

This paper has designed a four-channel wide dynamic microwave rectifier circuit for the shortcomings of uneven output voltage of each branch of the multi-channel rectification technology. A voltage-doubling rectifier circuit with identical structure was used in each branch. The four rectifier branches shared the same load at the output terminal, allowing the rectifier circuit to have an RF-DC conversion efficiency greater than 50% over the input power range from 12mW to 274mW, widened by 274% compared to a single channel. Not only the advantages of multi-channel technology with wide dynamics were retained, but also the output voltage was highly consistent and could be directly output in parallel without complex power electronics conversion.

Maternal obesity and gestational diabetes mellitus (GDM) are linked with impaired placental function and early onset of non-communicable cardiometabolic diseases in offspring. Previous studies have highlighted that the dietary non-esterified fatty acids (NEFAs), palmitate (PA) and oleate (OA), key dietary metabolites associated with maternal obesity and GDM, are potential modulators of placental lipid processing. Using the BeWo cell line model, the current study integrated transcriptomic (mRNA microarray), metabolomic, and lipidomic readouts to characterize the underlying impacts of exogenous PA and OA on placental villous trophoblast cell metabolism. Targeted gas chromatography and thin layer chromatography highlighted that saturated and monounsaturated NEFAs differentially impact BeWo cell lipid profiles. Furthermore, cellular lipid profiles differed when exposed to single and multiple NEFA species. Additional multi-omic analyses suggested that PA exposure is associated with enrichment in β-oxidation pathways, while OA exposure is associated with enrichment in anti-inflammatory and antioxidant pathways. Overall, this study further demonstrated that dietary PA and OA are important regulators of placental lipid metabolism. Encouraging appropriate dietary advise and implementing dietary interventions that maintain appropriate placental function by limiting excessive exposure to saturated NEFAs such as PA, will continue to be crucial in the clinical management of at-risk obese and GDM pregnancies.

Middle East region experiences a high prevalence of hypovitaminosis D, yet most genetic studies on Vitamin D have focused on European populations. Furthermore, there is a lack of research on the genomic risk factors affecting the elderly population, who are more susceptible to health burden. We investigated the genetic determinants of 25-hydroxyvitamin D levels in elderly Lebanese individuals (n=199) through a whole exome-based genome-wide association study. We identified new loci with suggestive evidence of an association with Vitamin D levels, including rs141064014 in the MGAM gene (P-value of 4.40 × 10−06) and rs7036592 in PHF2 (P-value of 8.43 × 10−06). A meta-analysis of the Lebanese data and the largest European genome-wide association study confirmed consistence replication of numerous variants, including rs2725405 in SLC38A10 (P-value of 3.73 x 10-08). Despite the lower performance of European-derived polygenic risk scores compared to the European estimations, it still effectively predicted Vitamin D deficiency among elderly Lebanese individuals. Our findings provide novel insights into the genetic mechanisms of Vitamin D deficiency in Middle Eastern elderly populations, facilitating the development of personalized approaches for more effective management of hypovitaminosis D. Additionally, we demonstrated that whole exome-based genome-wide association study is an effective method for identifying genetic components associated with phenotypes.

(1) Background: Breast cancer is a frequent heterogeneous disorder diagnosed in woman and is a high cause of mortality of them in reason to rapid metastasis and disease recurrence. Ferroptosis can inhibit breast cancer cell growth, improve the sensitivity of chemotherapy and radiotherapy and inhibit distant metastases so potentially acts on tumor micro-environment; (2) Methods: Ferroptosis/Extracellular matrix remodeling literature text-mining results were integrated in breast cancer transcriptome cohort according their distant relapse free survival (DRFS) under adjuvant therapy (anthracyclin+taxanes) and also in MDA-MB-231 transcriptome functional experiments with ferroptosis activations (GSE173905); (3) Results: Ferroptosis/Extracellular matrix remodeling text-mining identified 910 associated genes in at list 10 articles. Univariate Cox analyses censored on breast cancer (GSE25066) selected 252 individual significant genes and 171 of them found with an adverse expression. Functional enrichment of these 171 adverse genes predicted basal breast cancer signatures. By text-mining some ferroptosis significant adverse selected genes shared citations in domain of ECM remodeling such as: TNF, IL6, SET, CDKN2A, EGFR, HMGB1, KRAS, MET, LCN2, HIF1A, TLR4. A molecular score based on expression the eleven genes was found predictive of worst prognosis breast cancer at univariate level: basal subtype, short DRFS, high grade values 3 and 4, estrogen and progesterone receptors negative and nodal stages 2 and 3. This eleven gene signature was validated as regulated by ferroptosis inductors (erastin and RSL3) in triple negative breast cancer cellular model MDA-MB-231.; (4) Conclusions: Crosstalk between ECM remodeling-Ferroptosis functionalities allowed to define a molecular score which have been characterized as an independent adverse parameter in prognosis of breast cancer patients. Gene signature of this molecular score have been validated to be regulated by erastin/RSL3 ferroptosis activators. This molecular score could be promising to evaluate ECM impact of ferroptosis target therapies in breast cancer.

In China, the demand for rabbit meat is also increasing, and the production for rabbit meat is important. However, the underlying mechanisms of regulate skeletal muscle growth and development in rabbits remain unclear. The purpose of this study was to identify candidate genes related to skeletal muscle growth in rabbits and explore their potential regulatory mechanisms. RNA-seq technique was used to compare the differences of skeletal muscle transcriptome in Fujian white rabbits at different developmental stages (day 20 and 26 of embryos and birth 1, 30 and 60-day-olds) with a total of 25 individual selected. A total of 9737 DEGs that were acquired from the five groups were annotated into three ontologies of the GO database: biological process (BP), cell component (CC), and molecular function (MF). For KEGG analysis, there are 8249 genes were enriched in 1148 pathways, of which 67 pathways were significantly enriched, mainly in Hypertrophic cardiomyopathy (HCM), the PPAR signaling pathway, MAPK signaling pathway. Among all comparison groups, SE was the most abundant AS event. Real-time PCR verified that the expression patterns of differential genes were consistent with the transcriptome sequencing results. These results will provide a molecular regulation mechanism of muscle growth and development in Fujian white rabbits, and should serve an important theoretical basis for improving meat performance and growth rate of Chinese local meat rabbit breeds.

Sweet sorghum is an important bioenergy grass and valuable forage with a strong adaptability to saline environments. However, little is known about the mechanisms of sweet sorghum coping with ion toxicity under salt stresses. Here, we first evaluated the salt tolerance of a sweet sorghum cultivar “Lvjuren” and determined its ion accumulation traits under NaCl treatments; then explored key genes involved in Na+, Cl−, K+ and NO3− transport using transcriptome profiling and qRT-PCR method. The results showed that the growth and photosynthesis of sweet sorghum were unaffected by 50 and 100 mM NaCl treatments, indicative of a strong tolerance of this species to salt stresses. Under NaCl treatments, sweet sorghum could efficiently exclude Na+ from shoots and accumulate Cl− in leaf sheaths to avoid their overaccumulation in leaf blades; meanwhile, it possessed a prominent ability to sustain NO3− homeostasis in leaf blades. Transcriptome profiling identified several differentially expressed genes associated with Na+, Cl−, K+ and NO3− transport in roots, leaf sheaths and leaf blades of sweet sorghum after 200 mM NaCl treatment for 6 and 48 h. Moreover, transcriptome data and qRT-PCR results indicated that HKT1;5, CLCc and NPF7.3-1 should be key genes involved in Na+ retention in roots, Cl− accumulation in leaf sheaths and maintenance of NO3− homeostasis in leaf blades, respectively. Many TFs were also identified after NaCl treatment, which should play important regulatory roles in salt tolerance of sweet sorghum. This work lays a preliminary foundation for clarifying the molecular basis underlying the adaptation of sweet sorghum to adverse environments.

With the vast amount of goods being shipped around the world, there is a need to track and manage various types of assets, particularly shipping containers. Logistics industries dealing with small facilities, shipments, equipment, and vehicles must be tracked. There are many applied asset tracking systems such as Radio-Frequency Identification (RFID), Bluetooth Low Energy (BLE) Beacon, and Long-Range Radio (LoRa). This paper presents these systems and focuses on locating assets using LoRaWAN technology, which has a positive impact on the responsive and sustainable cities in Egypt. IoT-based Long Range (LoRa) is a low-power, wide-area communication technology that uses radio frequencies to transmit data over long distances. The extended range, low power consumption, low maintenance, and the ability to store location data when the end node that needs to connect to the asset is out of the gateway's coverage make LoRa a good choice for developing asset-tracking applications. This paper introduces a real-time tracking experiment as a result of a project implementation, whose goals are aligned with industry, innovation, and infrastructure and Sustainable Cities and Communities, the Sustainable Development Goals (SDGs) No. 9 and 11.

Japanese apricot (Prunus mume) is a culturally and economically important fruit tree in East Asia. ‘Nanko’, the primary cultivar of the Japanese apricot well known in Japan, usually suffers from scab, a disease caused by Venturia carpophila. Scab results in the development of black spots on the fruit surface, which considerably reduces its commercial value. Despite being an economic concern for Japanese apricot, there have been few reports on the phenotypic variation in scab resistance/susceptibility, the underlying genetic factors, and the development of DNA markers. Therefore, in this study, we performed a comprehensive trait analysis for scab resistance and susceptibility for four years and conducted a genome-wide association study (GWAS) to identify the associated loci. The results showed that significant GWAS peaks were detected in 2017 and 2018. Promising candidate gene encoding domains associated with disease resistance were found at the nine single-nucleotide polymorphisms (SNPs) identified in 2017 and 2018. These SNPs were thought to be associated with scab susceptibility of ‘Nanko’ lineages. These findings shed light on the mechanisms of scab resistance in P. mume and will assist future breeding programs to improve scab resistance in ‘Nanko’ lineages.

The current classification of acute myeloid leukemia (AML) relies largely on genomic alterations. AML with mutated Nucleophosmin1 (NPM1-mut) is the largest of the genetically defined groups, involving about 30% of adult AMLs and is currently recognized as a distinct entity in the actual AML classifications. NPM1-mut AML usually occurs in de novo AML and is associated predominantly with a normal karyotype and relatively favorable prognosis. However, NPM1-mut AMLs are genetically, transcriptionally, and phenotypically heterogeneous. Furthermore, NPM1-mut is a clinically heterogenous group. Recent studies have in part clarified the consistent heterogeneities of these AMLs and have strongly supported the need for an additional stratification aiming to improve the therapeutic response of the different subgroups of NPM1-mut AML patients.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with septic cardiomyopathy being a common and severe complication. Despite its significant clinical impact, the molecular mechanisms underlying sepsis-induced cardiomyopathy (SICM) remain incompletely understood. In this study, we performed a comparative analysis of whole transcriptome profiles in two widely used mouse models of septic cardiomyopathy, the cecal ligation and puncture (CLP) model and the lipopolysaccharide (LPS) model. Our aim was to identify key genes and pathways involved in the development of septic cardiomyopathy and to evaluate the similarities and differences between the two models. Our findings suggested that 1) both methods can induce septic heart dysfunction within 24 hours; 2) distinct whole transcriptome expression profiles are revealed; 3) potentially different pathways are involved in causing heart failure in sepsis. The comprehensive comparison provides valuable insights into the molecular basis of septic cardiomyopathy and contributes to the ongoing search for effective treatment strategies, triggered by different factors for SICM.

Ningxiang pig is renowned breed for its exceptional meat quality, but it possesses suboptimal carcass traits. To elucidate the genetic architecture of meat quality and carcass traits in Ningxiang pigs, we assessed heritability and executed a genome-wide association study (GWAS) concerning carcass length, backfat thickness, meat color parameters (L.LD, a.LD, b.LD), and pH at two postmortem intervals (45 minutes and 24 hours) within a Ningxiang pig population. Heritability estimates ranged from moderate to high (0.30 ~ 0.80) for carcass traits and from low to high (0.11 ~ 0.48) for meat quality traits. We identified 21 significant SNPs, the majority of which were situated within previously documented QTL regions. Furthermore, the HMGA1 gene emerged as a pleiotropic gene correlated with carcass length and backfat thickness. The ADGRF1, FKBP5, and PRIM2 genes were associated with carcass length, while the NIPBL gene was linked to backfat thickness. These genes hold potential for use in selective breeding programs targeting carcass traits in Ningxiang pigs.