Pv11, an insect cell line established from the midge Polypedilum vanderplanki, is capable of ametabolic desiccation tolerance, so-called anhydrobiosis. We previously discovered that heat shock factor 1 (HSF1) contributes to the acquisition of desiccation tolerance by Pv11 cells, but the mechanistic details have yet to be elucidated. Here, by analyzing the gene expression profiles of newly established HSF1-knockout and -rescue cell lines, we show that HSF1 has a genome-wide effect on gene regulation in Pv11. HSF1-knockout cells exhibit a reduced desiccation survival rate, but this is completely restored in HSF1-rescue cells. By comparing mRNA profiles of the two cell lines, we reveal that HSF1 induces anhydrobiosis-related genes, especially genes encoding late embryogenesis abundant proteins and thioredoxins, but represses a group of genes involved in basal cellular processes, thus promoting an ametabolic state in the cell. In addition, HSF1 binding motifs are enriched in the promoters of anhydrobiosis-related genes and we demonstrate binding of HSF1 to these promoters by ChIP-qPCR. Thus, HSF1 directly regulates the transcription of anhydrobiosis-related genes and consequently plays a pivotal role in the induction of anhydrobiotic ability in Pv11 cells.

Accurate forecasting of icing thickness has a great significance for ensuring the security and stability of power grid. In order to improve the forecasting accuracy, this paper proposes an icing forecasting system based on fireworks algorithm and weighted least square support vector machine (W-LSSVM). The method of fireworks algorithm is employed to select the proper input features with the purpose of eliminating the redundant influence. In addition, the aim of W-LSSVM model is to train and test the historical data-set with the selected features. The capability of this proposed icing forecasting model and framework is tested through the simulation experiments using real-world icing data from monitoring center of key laboratory of anti-ice disaster, Hunan, South China. The results show that the proposed W-LSSVM-FA method has a higher prediction accuracy and it may be a promising alternative for icing thickness forecasting.

The present studies were undertaken to address the role of fetuin-A in the growth and invasion potential in a triple negative breast cancer (TNBC) cell line, MDA-MB-468. Basal like TNBC that express high levels of ectopic fetuin-A have poorer prognosis for the patients compared to those that express low levels of the protein. We overexpressed fetuin-A in MDA-MB-468 and then determined the invasive potential of fetuin-A overexpressing cells vs controls transfected with empty vector. We also determined the adhesion and growth potential of the cells in the presence of only fetuin-A in serum free medium and also in complete medium. Our data suggest that fetuin-A overexpression significantly enhances the invasive potential of the cells and also the expression of Toll like receptor 4 (TLR4) on these cells. More importantly, the cells rely on fetuin-A-TLR4 signaling network for growth and invasion because the specific TLR4 inhibitor CLI-095 (resatorvid) abrogates fetuin-A mediated growth and invasion. Taken together, the data suggest that fetuin-A-TLR4 signaling network plays a significant role in the growth and invasion potential of TNBC.

Motion related human activity recognition using wearable sensors can potentially enable various useful daily applications. So far, most studies view it as a stand-alone mathematical classification problem without considering the physical nature of human motions. Consequently, they suffer from data dependencies and encounter the dimension disaster problem and the over-fitting issue, and their models are never human-readable. In this study, we start from a deep analysis on natural physical properties of human motions, and then propose a useful feature selection method to quantify each feature's classification contribution capability. On one hand, the "dimension disaster" problem can be avoid to some extent, due to the affined dimension of key features; On the other hand, over-fitting issue can be depressed since the knowledge implied in human motions are nearly invariant, which compensates the possible data inadequacy. The experiment results indicate that the proposed method performs superior to those adopted in related works, such as decision tree, k-NN, SVM, neural networks.

Cancer cells require substantial amounts of energy and substrates for their metabolic hyperactivity, enabling the synthesis of new cells at the expense of healthy ones. Preliminary in vitro data suggest that a mix of free essential amino acids (EAA-mix) can promote cancer cell apoptosis by enhancing autophagy. This study aimed to confirm, both in vitro and in vivo, whether EAA intake could influence the development of colon cancer in mice. We investigated changes in cancer proliferation in CT26 cells treated with EAA-mix, and in mice fed with EAA rich modified diets (EAARD) as compared to those on a standard laboratory diet (StD). CT26 cells were injected subcutaneously (s.c.) or intraperitoneally (i.p.). After 21 days, tumors were removed and measured. In vitro data corroborated that EAA-mix impairs cancer growth by inducing autophagy and apoptosis. In vivo data revealed that mice on StD developed significantly larger (s.c.) and more numerous (i.p.) cancers than those on EAARD. EAA administration appears to influence cancer cell survival with notable anti-proliferative properties.

Choline and choline metabolites are essential for all cellular functions. They have also been reported to be crucial for neural development. In this work, we studied the functional characteristics of the choline uptake system in human neural stem cells (hNSCs). Additionally, we investigated the effect of extracellular choline uptake inhibition on the cellular activities in hNSCs. We found that the mRNAs and proteins of choline transporter-like protein 1 (CTL1) and CTL2 were expressed at high levels. Immunostaining showed that CTL1 and CTL2 were localized in the cell membrane and partly in the mitochondria, respectively. The uptake of extracellular choline was saturable and performed by a single uptake mechanism, which was Na+-independent and pH-dependent. We conclude that CTL1 is responsible for extracellular choline uptake, and CTL2 may uptake choline in the mitochondria and be involved in DNA methylation via choline oxidation. Extracellular choline uptake inhibition caused intracellular choline deficiency in hNSCs, which suppressed cell proliferation, cell viability, and neurite outgrowth. Our findings contribute to the understanding of the role of choline in neural development as well as the pathogenesis of various neurological diseases caused by choline deficiency or choline uptake impairment.

Tumor-associated macrophages are a key component in the tumor microenvironment, secreting extracellular vesicles (EVs) such as exosomes and other various factors for intercellular communication. However, macrophage-derived EVs heterogeneity and their cytotoxicity to cancer cells has not been well understood. Here, we aimed to separately isolate various types of macro-phage-EVs by size exclusion chromatography (SEC) method and investigate EV transmission and cytotoxicity to oral cancer cells. For fluorescence-labeling of cellular and EV membranes, palmitoylation signal-fused GFP and tdTomato were expressed in THP-1 monocytic cells and HSC-3 oral cancer cells, respectively. We found that fluorescence-labeled EVs secreted by macrophages were highly transmissive to oral cancer cells than those from parental monocytic cells. In a co-culture system and conditioned medium (CM), a macrophage-secreted unidentified factor was cytotoxic to oral cancer cells. We fractionated macrophage-derived EVs by the SEC method and performed western blotting to characterize various EV types. Three fractions were characterized: small exosomes (EXO-S: < 50 nm) fraction containing HSP90α, HSP90β, CD63 (EV marker) and β-actin; large exosomes (EXO-L: 50-200 nm) fraction containing CD9 (EV marker) and HSP90β; large EVs (100-500 nm) fraction. Notably, the macrophage-derived small exosomes fraction was cytotoxic to oral cancer cells, while large exosomes and large EVs were not. There-fore, it was implicated that macrophage-derived small exosomes are cytotoxic with high trans-mission potential to cancer cells.

Inflammation plays a key role in the development and progression of type-2 diabetes (T2D), a disease characterised by peripheral insulin resistance and systemic glucolipotoxicity. Visceral adipose tissue (AT) is the main source of inflammation early in disease course. Macrophages are innate immune cells that populate all peripheral tissues, including AT. Dysregulated AT macrophage (ATM) responses to microenvironmental changes are at the root of aberrant inflammation and development of insulin resistance, locally and systemically. The inflammatory activation of macrophages is regulated at multiple levels: cell surface receptor stimulation, intracellular signalling, transcriptionally and metabolically. This review will cover the main mechanisms involved in AT inflammation and insulin resistance in T2D. First, we will describe the physiological and pathological changes in AT that lead to inflammation and insu- lin resistance. We will next focus on the transcriptional and metabolic mechanisms described that lead to the activation of ATMs. We will discuss more novel metabolic mechanisms that influence macrophage polarisation in other disease or tissues contexts that may be relevant to future work in insulin resistance and T2D.

Progress in macrophage research is crucial for numerous applications in medicine, including cancer and infectious diseases. However, the existing methods to manipulate living macrophages are labor intense and inconvenient. Here we show that macrophage membranes can be reconstituted after storage for months at 4C, with their CD206 receptor selectivity and specificity being similar to that in the living cells. Then, we have developed a mannose ligand, specific to CD206, linked with PEG as IR spectroscopy marker to detect binding with the macrophage receptor. PEG was selected due to its unique adsorption band of C-O-C group at IR spectra, which does not overlap with other biomolecule’s spectroscopic feature. Next, competitive binding assay versus the PEG-bound ligand, has enabled selection of other higher-affinity ligands specific to CD206. Further, those higher-affinity ligands were used to differentiate activated macrophages in patient’s bronchoalveolar (BAL) or nasopharyngeal (NPL) lavage. CD206- control cells (HEK293T) showed only non-specific binding. Therefore, biochips based on reconstituted macrophage membranes as well as PEG-trimannoside as an IR spectroscopic marker, can be used to develop new methods facilitating macrophage research and macrophage-focused drug discovery.

Cell-to-cell distant mechanical communication has been demonstrated by using in-vitro and in-vivo models. However, the molecular mechanisms underlying long-range cell mechanoresponsive interactions remain to be more elucidated. This study further examined the roles of α-Catenin and Piezo in traction force-induced rapid branch assembly of airway smooth muscle (ASM) cells on Matrigel hydrogel containing type I collagen. Our findings demonstrate that siRNA-mediated downregulation of α-Catenin or chemical inhibition of Piezo activity significantly reduced both cell directional movement and branching assembly. In regarding the role of N-cadherin in regulating branch assembly but not directional migration, our results further confirmed that siRNA downregulation of α-Catenin caused a remarked reduction of focal adhesion formation, as assessed by focal Paxillin and Integrin α5 localization. These observations implied that mechanosensitive α-Catenin was involved in both cell-cell and cell-matrix adhesions. Additionally, Piezo showed partial localization with Paxillin in focal adhesions, which was inhibited by α-Catenin downregulation with siRNA. This provides a plausible clue for Piezo mechanosensing traction force in the hydrogel. Collectively, our findings highlight the significance of α-Catenin in regulating cell-matrix interactions along with possible interpretation for Piezo mechanosensation at focal adhesions during cell-cell distant mechanical communication.

Polypharmacy and malnutrition are common health issues among older adults. In older people, there is a high prevalence of polypharmacy and malnutrition, and preliminary data also indicates that there is a significant of Food Supplements (FS) use, increasing the risk of duplication of thera-pies and several adverse reactions and drug-FS and FS-FS interactions. The intervention of health professionals in mitigating these risks is essential. This review not only underscores and discusses the potential association between polypharmacy, malnutrition, and food supplements but also presents current scientific evidence on polypharmacy, malnutrition, and the use of food supplements by the elderly. The work reviews the challenges, advantages and risks of using FS for the elderly who are polymedicated and/or malnourished, focusing on the good practices needed to support healthy ageing. In this regard, the paper intends to help health professionals better deal with the issue of polypharmacy and the use of multiple FS to overcome the malnutrition problem and improve the health and well-being of older adults.

Chemical combinations are believed to reduce drug toxicity, delay cancer cell growth, and achieve enhanced efficacy compared with single active drugs. This research investigated the synergistic effect of DOX and Zm-093, a new sulfonamide derivative, on improving the potential for inducing apoptosis in breast cancer (BC) cell lines. First, the Zm-093 compound was synthesized and its structure was confirmed by FT-IR and NMR. Then, the IC50 values for DOX and Zm-093 were calculated to be 1.21 and 51.24 μM, respectively. To investigate the synergistic effect, Compusyn software was utilized to calculate the combination index (CI). Different methods, including western blotting, flow cytometry, and TUNEL, were used to evaluate the potential synergistic effects of these compounds on inducing apoptosis in MCF-7 cells. Combining the indexes obtained at all concentrations revealed synergistic results. The proapoptotic proteins Bax, tBid, and caspase-3, however, increased 2.4, 3.3, and 5.7 times more than those in the control group. Flow cytometry analysis and the TUNEL method in cells treated with DOX and Zm-093 showed that apoptosis was significantly higher than in other groups. The results confirmed the synergistic effect of DOX and ZM-093 on apoptotic factors expression in MCF-7 cells.

Background: Three drug-combinations, ipilimumab-nivolumab (Ipi-Nivo), pembrolizumab-axitinib (Pembro-Axi) and avelumab-axitinib (Ave-Axi), have received regulatory approvals in USA and Europe for the treatment of metastatic renal cell carcinoma with clear cell component (mRCC). However, no head-to-head comparison data are available to identify the best option. Therefore, we aimed to compare these new treatments in the first-line setting. Methods: We conducted a systematic search in Pubmed, the Cochrane library and clinicaltri-al.gov website from January 2015 to October 2019, for any randomized controlled trials of treatment-naïve patients with mRCC. The process was performed according to PRISMA guide-lines. We performed a Bayesian network meta-analysis with two different approaches. The out-comes for analysis were overall survival, progression-free survival, and objective response rate. Results: Our search identified 3 published phase 3 randomized clinical trials (2835 patients). In the contrast-based model, Ave-Axi (SUCRA: 83%) and Pembro-Axi (SUCRA: 80%) exhibited the best ranking probabilities for PFS. For OS, Pembro-Axi (SUCRA: 96%) was the most pref-erable option against Ave-Axi and Ipi-Nivo. Objective response rate analysis showed Ave-Axi as the best (SUCRA= 94%) and Pembro-Axi as second best option. In the parametric models, risk of progression was comparable for Ave-Axi and Ipi-Nivo, whereas Pembro-Axi exhibited a lower risk during the first 6 months of treatment and a higher risk afterward. Furthermore, Pembro-Axi exhibited a net advantage in terms of OS over the two other regimens, while Ave-Axi was the least preferable option. Conclusions: Overall evidences suggested pembrolizumab plus axitinib may be the best option.

A thorough analysis and comparison of the fatty acid profiles of stipe and blade from Laminaria hyperborea, a kelp species found in the northern Atlantic, is presented. Lipids were extracted and fractionated into neutral lipids, free fatty acids and polar lipids, then derivatized to fatty acid methyl esters prior to GC-MS analysis. A total of 42 fatty acids were identified and quantified, including the n-3 fatty acids α-linolenic acid, stearidonic acid and eicosapentaenoic acid. An n-6/n-3 ratio of 0.8:1 was found in blade and 3.5:1 in stipe, respectively. The ratios vary between the lipid fractions within stipe and blade, with the lowest ratio in the polar lipid fraction of blade. The fatty acid amounts are higher in blade than in stipe, and the highest amounts of n-3 fatty acids are found within the neutral lipid fractions. The amounts of polyunsaturated fatty acids are 3.4 times higher in blade than stipe. This study highlights the compositional differences between the lipid fractions of stipe and blade from L. hyperborea. The amount of polyunsaturated fatty acids, compared to saturated- and monounsaturated fatty acids, as well as the n-6/n-3-ratio, is known to influence human health. In the pharmaceutical, food, and feed industries this can be of importance for production and sale of different health products. Additionally, lipids are today among the unused by products of alginate production, exploiting this material for commercial interest should give both economical and environmental benefits.

Abstract: The VSI represents a significant advancement in the assessment of gastrointestinal-specific anxiety among patients with Irritable Bowel Syndrome (IBS) and other Chronic Inflammatory Bowel Diseases (IBD). However, an Italian version of the instrument is not yet available for the reference population. This study utilized a national sample of 500 individuals, including healthy controls and patients with Ulcerative Colitis and Crohn's Disease, to test the validity and reliability of the Italian VSI. Using back-translation methodology to ensure translation fidelity, the research applied a questionnaire and the VSI through an online format to 500 participants. Data analysis revealed that the Italian VSI had excellent psychometric properties, demonstrating high internal consistency (Cronbach’s α = 0.95) and construct validity. The scale proved sensitive in detecting significant differences in visceral sensitivity among groups, highlighting its utility as a clinical and research assessment tool. Specifically, the Italian VSI exhibited a unidimensional factorial structure and maintained a strong correlation with other measures of anxiety and the severity of gastrointestinal symptoms, confirming its role in enhancing the understanding and management of IBS and IBD in Italy.

Fluorescent bioprobes are invaluable tools for visualizing live cells and deciphering complex biological processes by targeting intracellular biomarkers without disrupting cellular functions. In addition to protein-binding concepts, fluorescent probes utilize various mechanisms, including membrane, metabolism, and gating-oriented strategies. This study introduces a novel fluorescent mechanism distinct from existing ways. Here, we developed a B-cell selective probe, CDrB, with unique transport mechanisms. Through SLC-CRISPRa screening, we identified two transporters, SLCO1B3 and SLC25A41, by sorting out populations exhibiting higher and lower fluorescence intensities, respectively, demonstrating contrasting activities. We confirmed that SLCO1B3, with comparable expression levels in T and B cells, facilitates the transport of CDrB into cells, while SLC25A41, overexpressed in T lymphocytes, actively exports CDrB. The observation suggests that SLC25A41 plays a crucial role in discriminating between T and B lymphocytes. Furthermore, it reveals the potential for reversible localization of SLC25A41 to demonstrate its distinct activity. This study is the first report to unveil a novel strategy of SLC by exporting the probe. We anticipate that this research will open up new avenues for developing fluorescent probes.

Pancreatic Ductal Adenocarcinoma (PDAC) is the most frequent infiltrating type of pancreatic cancer. The poor prognosis is due to the absence of specific biomarkers, aggressiveness and treatment resistance. PDAC is a deadly malignancy bearing distinct genetic alterations, the most common being those that cause cancer-causing versions of the KRAS gene. Cannabigerol (CBG) is a non-psychomimetic cannabinoid with anti-inflammatory property. Regarding CBG anticancer ef-fect, up to now there are only few evidence in human cancers. We investigated CBG effects on PDAC cell lines, PANC-1 and MIAPaCa-2. It was investigated CBG activity on cell viability, cell death and its effect of EGFR-RAS-associated signalling. Moreover, the potential synergistic effect of CBG in combination with gemcitabine (GEM) and paclitaxel (PTX) was investigated. MTT was applied to investigate CBG effect on PDAC cell lines viability. Annexin-V and Acridine Orange staining followed by cytofluorimetric analysis and Western blot were used to evaluate CBG effect on cell death. Modulation of EGFR-RAS-associated pathways was determined by Western Blot analysis and Milliplex multiplex assay. Moreover, by MTT data and Synergy finder software analysis the effect of the combination of CBG and chemotherapeutic drugs, was determined.

The regulation of cell death is a fundamental issue in cell biology and continues to be intensely investigated worldwide. The significance of research in this field persists because understanding the determinants of cell lifespan directly impacts the maintenance of multicellular organism homeostasis and, consequently, is crucial for addressing biomedical challenges associated with various diseases. It is recognized that the initiation of cell death can be prompted by both specific signals (such as cytokines or hormones) and nonspecific stimuli, including radiation, temperature increase, or oxidants. When these factors affect a cell, numerous signaling pathways are triggered in the cell, leading to neutralization of the effects of their negative effects or, in case of irreparable damage, to cell elimination. This removal of damaged cells occurs through apoptosis or programmed cell death, a highly regulated process. Numerous signaling molecules participate in orchestrating the apoptotic process, many of which also govern other essential functions within the organism. Physiological factors capable of triggering the apoptotic program in cells include nitric oxide (NO), which serves as one of the key signaling molecules regulating the functions of the cardiovascular, nervous, and immune systems of the organism. The unique chemical nature of NO, along with its numerous intracellular targets and physiologically active redox forms, raises questions about the specific mechanisms through which NO exerts its damaging effects on cells. Utilizing pharmacological preparations- such as sources (donors) of exogenous nitric oxide- represents an approach to investigating the initiation and execution of the apoptotic program in sensitive target cells. Furthermore, this approach holds promise as a direction for discovering new selective drugs.

Colon cancer is a common malignancy of digestive tract and has high incidence and mortality worldwide. As a normal flora in the human gastrointestinal tract, lactic acid bacteria have been proved to have health benefits, such as immune-regulation, anti-infection, and anti-tumor. In the present study, the inhibitory effects of 19 heat-inactivated plant-derived lactic acid bacteria on human colon cancer cell HCT116 were investigated. The results showed that heat-inactivated plant-derived lactic acid bacteria strain 729 had the strongest inhibitory effect on HCT116 cells among all tested bacteria. Treatment with heat-inactivated bacteria strain 729 could inhibit the proliferation of HCT-116 cells in dose-dependent manner, with 54.52% inhibition at a final concentration of 1×10⁸ CFU/mL. Moreover, the heat-inactivated bacteria strain 729 could block the cell cycle, induce apoptosis, and promote cellular ferroptosis by downregulating the expression of GPX4 and xCT at protein level. According to the 16S rDNA sequencing, the plant-derived lactic acid bacteria strain 729 was Lactobacillus plantarum. Collectively, the results indicates that lactic acid bacteria strain 729 may be developed as special ingredients targeting colon cancer, but further in vivo studies are required.

TTF1-NP(5,2′,4′-trihydroxy-6,7,5′-trimethoxyflavone nanoparticles), derived from the traditional Changbai Mountain medicinal plant Sorbaria sorbifolia (SS), has been showedits anti-cancer effect in various liver cancer cell types and tissues. The present study was designed to evaluate the antitumor mechanism of the TTF1-NP against HepG2 hepatoma cells and HepG2 cells-induced hepatocarcinoma (HCC) in nude mouse model. Here we demonstrated that TTF1-NP inhibits tube formation of HUVECs and HepG2 cell migration and invasion, and inhibits tumor growth in nude mice implanted with HepG2 cells through the downregulation of STAT3 protein and activation, along with VEGF, KDR, bFGF, MMP2 and MMP9 levels. We further revealed that TTF1-NP decreased the DNA-binding capacity of STAT3. Together our results provide a mechanism by which TTF1-NP suppresses cancer cell migration, invasion and angiogenesis through the action of STAT3 and suggests TTF1-NP as a potential therapy for hepatocellular cancer treatment.

Background: Developing an efficient and standardized method to isolate and characterize adipose-derived stem cells (ASCs) from the stromal vascular fraction (SVF) of the adipose tissue for clinical application represents one of the major challenges in cell therapy and tissue engineering. Methods: In this study, we proposed an innovative, non-enzymatic protocol to collect clinically useful ASCs within freshly isolated SVF from adipose tissue by centrifugation of the infranatant portion of lipoaspirate and to determine the characteristic cytofluorimetric pattern, prior to in vitro culture. Results: The SVF yielded a mean of 73,32 \pm\ 10,89% cell viability evaluated with CALCEINA-FITC, i.e. cell-permeant dye. The ASCs were positive for PC7-labeled mAb anti-CD34 and negative for both PE-labeled mAb anti-CD31 and APC-labeled mAb anti-CD45. The frequency of ASCs estimated according to the panel of cell surface markers used was 51,06%\ \pm 5,26% versus the unstained ASCs subpopulation that was 0,74%\pm0,84% (P<0.0001). The ASCs events/\muL were 1602,13/\muL \pm 731,87/\muL. Conclusion: Our findings suggested that ASCs found in freshly isolated adipose SVF obtained by centrifugation of lipoaspirate can be immunophenotypically identified with a basic panel of cell surface markers. These findings aimed to provide standardization and contribute to reducing the inconsistency on reported cell surface antigens of ASC derived from the existing literature.

Human Cytomegalovirus (HCMV) infection is a serious complication in hematopoietic stem cell transplant (HSCT) recipients due to virus-induced myelosuppression and impairment of stem cell engraftment. Despite the clear clinical link between myelosuppression and HCMV infection, little is known about the mechanism(s) by which the virus inhibits normal hematopoiesis because of the strict species specificity and the lack of surrogate animal models. In this study, we developed a novel humanized mouse model system that recapitulates the HCMV-mediated engraftment failure after hematopoietic cell transplantation. We observed significant alterations in the hematopoietic populations in peripheral lymphoid tissues following engraftment of a subset of HCMV+ CD34+ HPCs within the transplant suggesting that a small proportion of HCMV-infected CD34+ HPCs can profoundly affect HPC differentiation in the bone marrow microenvironment. This model will be instrumental to gain insight into the fundamental mechanisms of HCMV myelosuppression after HSCT and provides a platform to assess novel treatment strategies.

Cardiac hypertrophy is an important and independent risk factor for the development of heart failure. To better understand the mechanisms and regulatory pathways involved in cardiac hypertrophy, there is a need for improved in vitro models. In this study, we investigated how hypertrophic stimulation affected human induced pluripotent stem cell (iPSC)-derived cardiomyocytes (CMs). The cells were stimulated with endothelin-1 (ET-1) for 8, 24, 48, 72, or 96h. Parameters including cell size, ANP-, proBNP-, and lactate concentration were analyzed. Moreover, transcriptional profiling using RNA-sequencing was performed to identify differentially expressed genes following ET-1 stimulation. The results show that the CMs increase in size by approximately 13% when exposed to ET-1 in parallel to increases in ANP and proBNP protein and mRNA levels. Furthermore, the lactate concentration in the media was significantly increased indicating that the CMs consume more glucose, a hallmark of cardiac hypertrophy. Using RNA-seq, a hypertrophic gene expression pattern was also observed in the stimulated CMs. Taken together, these results show that hiPSC-derived CMs stimulated with ET-1 display a hypertrophic response. The results from this study also provide new molecular insights about the underlying mechanisms of cardiac hypertrophy and may help accelerate the development of new drugs against this condition.

Background: Cord blood represents a link between intrauterine and early extrauterine development. Cord blood cells map an important time frame in human immune imprinting processes. It is unknown whether sex of the newborn affects the lymphocyte subpopulations in cord blood. Methods: 9 B and 21 T cell subpopulations were characterized by flow cytometry in human cord blood from 16 male and 21 female newborns, respectively. Results: Except for marginal zone B cells and transitional B cells, B cell count in all subsets was higher in cord blood of male newborns than in female newborns. Frequency of naive thymus negative Th cells was significantly higher in male cord blood whereas the remaining T cell subpopulations showed a higher count in cord blood of female newborns. Conclusion: Our study is the first revealing sex differences in B and T cell subpopulations of human cord blood. These results indicate that sex might have a higher impact for the developing immune system urging the need to expand research in this area.

Campylobacter jejuni is a zoonotic bacterium, causing intestinal infection in humans. One characteristic feature of the pathogenicity process is the ability of this bacterium invading the epithelial cells. Several factors have been identified to contribute to this process and some recent analyses revealed changes in the bacterium cell on molecular level. However, our knowledge is still limited about responses of the host that accompany the bacterial internalisation and survival process. This study focused on molecular events on transcriptomic level detected between the 1st and the 3rd hour of internalisation in INT407 epithelial cells. From the 41.769 human genes tested, altogether 19,060 genes and 22,734 pseudogenes and introns were shown by whole transcriptome analysis to be affected in different extent. Most affected functions regulate transcription (28%), signal transduction (21%), apoptosis (15%), immune responses (9%), transmembrane transport (6%), cell-cell signaling (3%), cell-cell adhesions (3%) and carbohydrate metabolism (3%) and to a lesser extent other functions. Our results provide insight into a scenario where, the invaded cell focuses on survival, but, at the same time, flashing the possibility of pushing the process toward the death of the invaded and metabolically disrupted cell.

Ebola virus disease (EVD) represents a global health threat. The etiological agents of EVD are 6 species of Orthoebolaviruses, with Orthoebolavirus zairense (EBOV) having the greatest public health and medical significance. EVD disease pathogenesis occurs as a result of broad cellular tropism of the virus, robust viral replication and a potent and dysregulated production of cytokines. In vivo, tissue macrophages are some of the earliest cells infected and contribute significantly to virus load and cytokine production. While EBOV is known to infect macrophages and to generate high titer virus in the liver, EBOV infection of liver macrophages, Kupffer cells, has not previously been examined in tissue culture or experimentally manipulated in vivo. Here, we employed primary murine Kupffer cells (KC) and an immortalized murine Kupffer cell line (ImKC) to assess EBOV-eGFP replication in liver macrophages. KCs and ImKCs were highly permissive for EBOV infection and IFN-γ polarization of these cells suppressed their permissiveness to infection. The kinetics of IFN-γ-elicited antiviral responses were examined using a biologically-contained model of EBOV infection termed EBOV ΔVP30. The antiviral activity of IFN-γ was transient, but a modest ~3-fold reduction of infection persisted for as long as 6 days post treatment. To assess the interferon stimulated gene products (ISGs) responsible for protection, the efficacy of secreted ISGs induced by IFN-γ were evaluated. Secreted ISGs blocked recombinant VSV expressing EBOV GP (rVSV/EBOV GP) infection, but failed to block EBOV ΔVP30. Our studies define new cellular tools for the study of EBOV infection that can potentially aid the development of new antiviral therapies. Furthermore, our data underscore the importance of macrophages in EVD pathogenesis and those IFN-γ-elicited ISGs that help to control EBOV infection.

New resources of food, pharmaceuticals or biotechnological products are needed. The huge biodiversity of aero-terrestrial lichen-symbiont microalgae remains unexplored. Viability of these for human consumption demands the demonstration of the absence of toxic effects. In vitro biocompatibility of crude homogenates of axenic microalga Asterochloris erici, symbiotic in the lichen Cladonia cristatella, was analyzed after treatment of cultured L929 fibroblasts with different doses of microalgal homogenates. The results show that crude homogenates of A. erici do not induce fibroblast cytotoxicity but seem to have some cytostatic effect inducing slight cell cycle alterations and intracellular reactive oxygen species (ROS) increase at the highest dose. Carotenoid analysis demonstrates high content of lutein, a xanthophyll with antioxidant and cytostatic properties in vivo. These findings confirm that Asterochloris erici can be considered suitable for the development of alimentary or pharmaceutical applications. The cytostatic effects should be further investigated for antitumor agents.

Background. Azithromycin (AZM) is widely used in cystic fibrosis (CF) treatment following clinical trials demonstrating improved lung function and fewer pulmonary exacerbations. While the precise mechanisms remain elusive, immunomodulatory actions are thought to be involved. We previously reported impaired phagocytosis and defective anti-inflammatory M2 macrophage polarization in CF macrophages. This study systematically analyzed the effect of AZM on the functions of unpolarized and M1/M2 polarized macrophages in CF. Methods: Monocytes, isolated from the venous blood of patients with CF (pwCF) and healthy controls (HCs) were differentiated into monocyte-derived macrophages (MDMs) and infected with P. aeruginosa. P. aeruginosa uptake and killing by MDMs in the presence or absence of AZM was studied. M1 and M2 macrophage polarizations were induced and their functions and cytokine release were analyzed. Results: Following AZM treatment, both HC and CF MDMs exhibited a significant increase in P. aeruginosa uptake and killing, however, lysosomal acidification remained unchanged. AZM treatment led to higher activation of ERK1/2 in both HC and CF MDMs. Pharmacological inhibition of ERK1/2 using U0126 significantly reduced P. aeruginosa uptake in HC MDMs. M1 macrophage polarization remained unaffected, however, AZM treatment led to increased IL-6 and IL-10 release in both HC and CF M1 macrophages. AZM also significantly increased the phagocytic index for both pHrodo E. coli and S. aureus in CF M1 macrophages. In CF, AZM treatment promoted anti-inflammatory M2 macrophage polarization, with an increased percentage of CD209+ M2 macrophages, induction of the M2 gene CCL18, along with its secretion in the culture supernatant. However, AZM did not restore endocytosis in CF, another essential feature of M2 macrophages. Conclusions: This study highlights the cellular functions and molecular targets of AZM which may involve improved uptake of both gram-positive and gram-negative bacteria, restored anti-inflammatory macrophage polarization in CF. This may in turn shape the reduced lung inflammation observed in clinical trials. In addition, we confirmed the role of ERK1/2 activation for bacterial uptake.

Separase is a key cysteine protease to separate sister chromatids through digestion of cohesion ring that inhibits chromosome segregation as trigger of metaphase–anaphase transition in eukaryotes and highly regulated its activity by binding with securin and cyclinB-CDK1 complex. Those bindings prevent proteolytic activity of separase until the onset of anaphase. Chromosome missegregation and aneuploidy are frequently observed in malignancies. However, there are some difficulties for biochemical examinations due to instability of separase in vitro and a few spatiotemporal resolution approaches monitoring live separase activity throughout mitotic processes. Here we have developed FRET-based molecular sensors including GFP variants with separase cleavable sequences as donor and covalently attached fluorescent dye as acceptor molecules applicable to conventional live cell imaging and flow cytometric analysis because of efficient live cell uptake. We investigated performance of equivalent molecular sensors localized or not localized inside nucleus under cell cycle control using flow cytometry. Synchronized cell cycle progression rendered significant separase activity detections in both molecular sensors. We obtained consistent outcomes with localized molecular sensor introduction and cell cycle control by fluorescent microscopic observations. We thus established live cell separase activity monitoring systems specifically or statistically that could lead to elucidate separase properties in detail.

This paper proposes a definition of fractional line integral, generalising the concept of fractional definite integral. The proposal replicates the properties of the classic definite integral, namely the fundamental theorem of integral calculus. It is based on the concept of fractional anti-derivative used to generalise the Barrow formula. To define the fractional line integrals the Gr\"unwald-Letnikov and Liouville directional derivatives are introduced and their properties described. The integral is defined first for broken line paths and afterwards to any regular curve

Theoretical and experimental approaches have been applied to study the polymer physics under-lying compaction of DNA in the bacterial nucleoid. Knowledge of the compaction mechanism is necessary to obtain a mechanistic understanding of the process of segregation of replicating chromosome arms (replichores) during the cell cycle. In the first part of this review light microscope observations are discussed that have demonstrated that the nucleoid has a lower refractive index and thus a lower density than the cytoplasm. A polymer-physical explanation for this phenomenon was given by the theory of Theo Odijk pro-posed in 1998. By assuming a phase separation between nucleoid and cytoplasm and by imposing equality of osmotic pressure and chemical potential between the two phases, a minimal energy situation is obtained in which soluble proteins are depleted from the nucleoid, thus explaining its lower density. The theory is compared with recent views for DNA compaction that are based on mere exclusion of polyribosomes from the nucleoid or on the transcriptional activity of the cell. These new views raise the question of whether they can still explain the lower refractive index or density of the nucleoid. In the second part of this review the question is discussed how DNA segregation occurs in Esche-richia coli, in the absence of the so-called active ParABS system, present in the majority of bacteria. How is entanglement prevented of nascent chromosome arms, generated at the origin in the pa-rental network of the E. coli nucleoid? The observations of the groups of Sherratt and Hansen in 2006, that the four nascent chromosome arms synthesized in the initial replication bubble, segre-gate to opposite halves of the sister nucleoids implies that extensive intermingling of daughter strands does not occur. Based on the hypothesis that leading and lagging replichores synthesized in the replication bubble, fold into micro-domains that do not intermingle, a passive "four-excluding-arms model" for segregation is proposed. This model implies that the key for seg-regation already lies in the structure of the replication bubble at the very start of DNA replication; it explains the different patterns of chromosome arms as well as the segregation distances between replicated loci as experimentally observed.

The paper presents the possibility of using KINECT v2 module to control an industrial robot by means of gestures and voice commands. It describes elements of creating software for off-line and on-line robot control. The application for KINECT module was developed in C# language in Visual Studio environment, while the industrial robot control program was developed in RAPID language in RobotStudio environment. The development of a two-threaded application in RAPID language allowed to separate two independent tasks for the IRB120 robot. The main task of the robot is performed in thread no. 1 (responsible for movement). Simultaneously working thread no. 2 ensures continuous communication with the KINECT system and provides information about the gesture and voice commands in real time without any interference in thread no. 1. The applied solution allows the robot to work in industrial conditions without negative impact of communication task on the time of robot’s work cycles. Thanks to the development of a digital twin of the real robot station, tests of proper application functioning in off-line mode (without using a real robot) were conducted. Obtained results were verified online (on the real test station). Tests of correctness of gesture recognition were carried out, the robot recognized all programmed gestures. Another test carried out was the recognition and execution of voice commands. A difference in the time of task completion between the actual and virtual station was noticed - the average difference was 0.67 s. The last test carried out was to examine the impact of interference on the recognition of voice commands. With a 10dB difference between the command and noise, the recognition of voice commands was equal to 91.43%. The developed computer programs have a modular structure, which enables easy adaptation to process requirements.

Porphyromonas gingivalis is a periodontopathogenic bacterium that can adhere and colonize periodontal tissues leading to inflammatory process, and consequently tissue destruction. New therapies using flavonoids such as hesperidin are being studied, and its promising properties have been highlighted. The aim of this study was to evaluate the effect of hesperidin on epithelial barrier function, reactive oxygen species (ROS) production and on inflammatory response caused by P. gingivalis in in vitro models. Integrity of the epithelial tight junctions challenged by P. gingivalis was determined by monitoring the transepithelial electrical resistance (TER). P. gingivalis adherence to a gingival keratinocyte monolayer and a basement membrane model were evaluated by a fluorescence assay. A fluorometric assay was used to determine the ROS production in gingival keratinocytes. The level of pro-inflammatory cytokines and matrix metalloproteinases (MMPs) secretion was evaluated by ELISA, while to assess NF-κB activation, the U937-3xjB-LUC monocyte cell line transfected with a luciferase reporter gene was used. Hesperidin protected against gingival epithelial barrier dysfunction caused by P. gingivalis and reduced the adherence of P. gingivalis to the basement membrane model. Hesperidin dose-dependently inhibited P. gingivalis-mediated ROS production by oral epithelial cells as well as the secretion of IL-1β, TNF- IL-8, MMP-2 and MMP-9 by macrophages challenged with P. gingivalis. Additionally, it was able to attenuate NF-κB activation in macrophages stimulated with P. gingivalis. These findings suggested that hesperidin has a protective effect on the epithelial barrier function, in addition to reduce ROS production and attenuate the inflammatory response associated with periodontal disease.

Studies of mast cell biology is dependent on relevant and validated in vitro models. We here present detailed information concerning the phenotype of both freshly isolated human skin mast cells (MCs), and of in vitro cultures of these cells that was obtained by analyzing their total transcriptome. Transcript levels of MC-related granule proteins and transcription factors were found to be remarkably stable over a 3-week culture period. Relatively modest changes were also seen for important cell surface receptors including the high affinity receptor for IgE, FCER1A, the low affinity receptor for IgG, FCGR2A, and the receptor for stem cell factor, KIT. FCGR2A was the only Fc receptor for IgG expressed by these cells. Comparisons of the present transcriptome against previously reported transcriptomes of mouse peritoneal MCs and mouse bone marrow derived MCs (BMMCs) revealed both similarities and major differences. Strikingly, cathepsin G was the most highly expressed granule protease in human skin MCs, in contrast to the almost total absent of this protease in both mouse MCs. Transcript levels for the majority of cell surface receptors were also very low compared to the granule proteases in both mouse and human MCs, with a difference of almost two orders of magnitude. An almost total absence of T cell granzymes was observed in human skin MCs, indicating that granzymes have no or only a minor role in human MC biology. Ex vivo skin MCs expressed high levels of selective immediate early genes and transcripts of heat-shock proteins. In validation experiments, we determined that this expression was an inherent property of the cells and not the result of the isolation process. Three to four weeks in culture results in an induction of cell growth related genes accompanying their expansion by 6-10-fold, which increases the number of cells for in vitro experiments. Collectively, we show that cultured human skin MCs resemble their ex vivo equivalents in many respects and are a more relevant in vitro model compared to mouse BMMCs for studies of MC biology, in particular human MC biology.

Circulating tumor cells (CTCs) are cells released from the primary tumor and intravasate into the blood or lymphatic vessels, where they are transported to distant sites and act as seeds that initiate cancer metastases. Recent advances in CTC research have shown their relevance as prognostic markers for early and metastatic disease detection, predictive biomarkers for relapse, and response to medical intervention or therapy. The rapidly evolving landscape of CTC biology has opened new avenues for understanding cancer progression, metastasis, and treatment response. Additionally, translating these findings into clinical applications holds promise for improving cancer diagnostics, prognosis, and personalized therapeutic strategies. This review discusses the significance of CTCs in cancer research and their associated challenges. We explore recent developments in the detection and characterization of CTCs and their implications in cancer research and clinical practice.

The heterogeneous nature of human breast cancer (HBC) can still lead to therapy inefficacy and high le-thality and new therapeutics are needed as well as new spontaneous animal models to benefit translational HBC research. Dogs are primarily investigated since they spontaneously develop tumors which share many features with human cancers. In recent years, different natural phytochemicals including berberine, a plant alkaloid, have been reported to have antiproliferative activity in vitro in human cancers and in rodent animal models. In this study, we report the antiproliferative activity and mechanism of action of berberine, of its active metabolite berberrubine, and of eight analogues, on a canine mammary carcinoma cell line and in transgenic zebrafish models. We demonstrate both in vitro and in vivo the significant effects of specific analogues on cell viability, via induction of apoptosis, also identifying their role in inhibiting the Wnt/β-catenin pathway and activating the Hippo signals with a downstream reduction of CTGF expres-sion. Particularly the berberine analogues NAX035 and NAX057 show the highest therapeutic efficacy, de-serving further analyses to elucidate their mechanism of action more in detail, and in vivo studies on spon-taneous neoplastic diseases aiming at improving veterinary treatments of cancer as well as translational cancer research.

Multi-rotor drones, a kind of unmanned equipment which is widely used in military, commercial consumption and other fields, has been developed very rapidly in recent years. However, their short flight time has hindered the expansion of their application range. This can be addressed by utilizing hydrogen fuel cells, which exhibit high energy density, strong adaptability to ambient temperature, and no pollution emissions, as the power source. Accordingly, the application of hydrogen fuel cells as the power source in multi-rotor drones is a promising technology that has attracted significant research attention. This paper summarizes the development process of hydrogen fuel cell mul-ti-rotor drones and analyzes the key obstacles that need to be addressed for the further development of hydrogen fuel cell multi-rotor drones, including structural lightweight, hydrogen storage methods, energy management strategies. Additionally, prospects for the future development of hydrogen fuel cell multi-rotor drones are presented.

Maternal type 2 diabetes mellitus (T2DM) has been shown to result in fetal programming of the hypothalamus-pituitary-adrenal (HPA) axis, leading to adverse fetal outcomes. T2DM is preceded by prediabetes and shares similar pathophysiological complications. However, no studies have investigated the effects of maternal prediabetes on fetal HPA axis function and postnatal offspring development, hence this study. Pre-diabetic (PD) and non-pre-diabetic (NPD) female Sprague Dawley rats were mated with non-prediabetic males. After gestation, male pups born from the PD and NPD groups were collected. Markers of HPA axis function, adrenocorticotropin hormone (ACTH) and corticosterone were measured in all dams and pups. Glucose tolerance and expression of mineralocorticoid (MR) and glucocorticoid (GR) receptors were further measured in all pups at birth and their developmental milestones. The results demonstrated increased basal concentrations of ACTH and corticosterone in the dams from the PD group by comparison to NPD. Furthermore, the results show an increase in pups ACTH and corticosterone concentrations, impaired glucose tolerance and dysregulated MR and GR expression in the PD group at all developmental milestones. These observations reveal that pregestational prediabetes is associated with maternal dysregulation of the HPA axis, impacting offspring HPA axis development along with impaired glucose handling.

Much research has been conducted to determine how hair regeneration is regulated, as this could provide therapeutic, cosmetic, and even psychological interventions for hair loss. The current study focused on the hair growth effect and effective utilization of fatty oil obtained from Bryde's whales through high-throughput DNA microarray approach in conjunction with immunohistochemical observations. The research also examined the mechanisms and factors involved in hair growth. In an experiment using female C57BL/6J mice, the vehicle control group (VC: propylene glycol: ethanol: water), the positive control group (MXD: 3% minoxidil), and the experimental group (WO: 20% Whale Oil) were topically applied to the back of the mouse. The results showed that 3% MXD and 20% WO were more effective than VC in promoting hair growth, especially 20% WO. Furthermore, in hematoxylin and eosin-stained skin tissue, an increase in the number of hair follicles and subcutaneous tissue thickness was observed with 20% WO. Whole-genome transcriptomic analysis also showed that 20% WO may have lower stress- and inflammation-related responses than 3% MXD. Therefore, whale oil can be expected to be used as a safe hair growth agent.

Background: Microscopic examination of acid-fast stained sputum smears for detecting mycobacterial acid-fast bacilli (AFB) remains the most economical and readily available method for laboratory diagnosis of tuberculosis (TB). However, this conventional approach has limitations, including low sensitivity and labor-intensive procedures. Methods: An automated microscopy system incorporating artificial intelligence (AI) and machine learning for AFB identification was evaluated. The study was conducted at an Infectious Disease Hospital in Jiangsu Province, China, utilizing an intelligent microscope system (TB-Scan, Wellgen Medical, Kaohsiung). A total of 1,000 sputum smears were included in the analysis, with the system capturing digital microscopic images and employing an image recognition model to automatically identify and classify AFB. Referee technicians provided the gold standard for discrepant results. Results: The automated system demonstrated an overall accuracy of 95.00% (950/1,000), sensitivity of 91.24% (177/194), and specificity of 95.91% (773/806). Notably, the system identified 21 smears as positive that were previously reported as negative, with referee technicians confirming 17 of these as true positive and retracting the test results accordingly. Recalculating the performance, the accuracy increased to 96.70% (967/1,000), sensitivity to 91.94% (194/211), and specificity to 97.97% (773/789), with a false negative rate of 8.06% (17/211) and a false positive rate of 2.03% (16/789). Conclusions: The incorporation of AI and machine learning into an automated microscopy system demonstrated the potential to enhance the sensitivity and efficiency of AFB detection in sputum smears compared to conventional manual microscopy. This approach holds promise for widespread application in TB diagnostics and potentially other fields requiring labor-intensive microscopic examination.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Background: Multiple drug delivery systems obtained by loading nanoparticles (NPs) with different drugs with different physicochemical properties present a promising strategy to achieve synergistic effects between drugs or overcome undesired effects. This study aims to develop a new NP by loading Quercetin (Que) and valproic acid (VPA) onto chitosan. In this context, our study investigated the antioxidant activities of chitosan NPs loaded with single and dual drugs containing Que against oxidative stress. Method: The synthesis of single (Que or VPA) and dual-drug (Que and VPA) loaded chitosan NPs, characterization of the NPs, conducting in vitro antioxidant activity studies, and analysis of the cytotoxicity and antioxidant activity of the NPs in SH-SY5Y cell lines were performed. Result: The NP applications that protected cell viability to the greatest extent against H2O2-induced cell damage were, respectively, 96 µg/ml of Que-loaded chitosan NP (77.30%, 48 h), 2 µg/ml of VPA-loaded chitosan NP (70.06%, 24 h), 96 µg/ml of blank chitosan NP (68.31%, 48 h), and 2 µg/ml of Que and VPA-loaded chitosan NP (66.03%, 24 h). Conclusion: Our study establishes a successful paradigm in developing drug-loaded NPs, with uniform and homogeneous distribution of drugs onto NPs. Chitosan NPs loaded with both single and dual drugs possessing antioxidant activity were successfully developed.

The massive amount of human biological, imaging and clinical data produced by multiple and diverse sources, necessitates integrative modeling approaches able to summarize all this information into answers to specific clinical questions. In this paper, we present a hypermodeling scheme able to combine models of diverse cancer aspects regardless of their underlying method or scale. Describing tissue-scale cancer cell proliferation, biomechanical tumor growth, nutrient transport, genomic-scale aberrant cancer cell metabolism, and cell signaling pathways that regulate the cellular response to therapy, the hypermodel integrates mutation, miRNA expression, imaging, and clinical data. The constituting hypomodels as well as their orchestration and links are described. Two specific cancer types, Wilms tumor (nephroblastoma) and non-small cell lung cancer, are addressed as proof of concept study cases. Personalized simulations over the actual anatomy of a patient have been carried out. The hypermodel has also applied to predict tumor control after radiotherapy and the relationship between tumor proliferative activity and response to neoadjuvant chemotherapy. Our innovative hypermodel holds promise as a digital twin based clinical decision support system and the core of future in silico trial platforms, although additional retrospective adaptation and validation is necessary.

Macrophages and dendritic cells (DCs) acquire functionally distinct properties in response to various environmental stimuli; the interaction of these cells with myeloid-derived suppressor cells (MDSCs) in tumor microenvironments regulates cancer progression. Immunodeficient mice lacking T cells are less likely to reject human cancer cells because of major histocompatibility complex (MHC) mismatches. The xenograft tumor microenvironment, comprising human cancer and mouse host cells, exhibits more complex bidirectional signaling and function than a syngeneic tumor microenvironment. Here human and mouse colorectal cancer cells were transplanted into nude mice to elucidate differences in macrophage, DC, and MDSC functions in human xenograft and mouse allograft tumor models. Plasma interferon-γ and interleukin-18 concentrations in the former model after intraperitoneal lipopolysaccharide (LPS) administration were significantly higher than those in the latter model and non-transplanted control group. Splenic MHC class I, II, and CD80 expression increased in CD11b+ and MDSC populations after LPS administration in only the xenograft tumor model. The number of CD80- and MRC1-expressing cells decreased upon LPS administration in only the xenograft tumor. These results suggxest that macrophages and DCs function normally in xenograft tumor models, whereas their functions in response to LPS administration vary in allograft tumor models.

This study investigates the relationship between Corporate Social Responsibility (CSR) dimensions and employees' satisfaction and retention for sustainability in banks. Carroll (1991) proposed a theoretical approach that consists of four components (economic, legal, ethical, and philanthropic) to analyze CSR activities and their effects on employee’s satisfaction and retention in the company. Simple random sampling was used to get the information from 221 participants. The entire form of the dataset is utilized to execute regression and correlation analysis using SPSS. In order to find out the relationship between economic, legal, ethical, and philanthropic factors and employee's satisfaction and retention, regression beta coefficient and correlation coefficients were used to analyze. This study also examines the relationship between job satisfaction and intentions to retain with an organization. The findings demonstrate that the CSR aspects of ethical and philanthropic have a considerable and favorable influence on employee's satisfaction. The outcome also demonstrates a good and prominent influence of legal CSR on the satisfaction of employee's to retain with the firm. Moreover, this study demonstrates that economic aspect of CSR has no significant impact on employee's retention and satisfaction. Correlation analysis depicts that economic CSR is positively and significantly connected with employee's retention and satisfaction. This research came to the conclusion that enhancing employees view regarding CSR activities such as economic, legal, ethical, and philanthropic will increase employee's satisfaction. Therefore, executives and managers in the banks should take steps to influence how employees see CSR areas in order to raise employee's satisfaction and retention in the banks for sustainability.

Still, the most common in vitro model for absorption, distribution, metabolism and excretion (ADME) purposes is the Caco-2 cell line. However, clear differences in gene- and protein expression towards the small intestine and an at best fair prediction accuracy of intestinal drug absorption restrict the usefulness as model for intestinal epithelial cells. To overcome these limitations, we evaluated a panel of low-passaged patient-derived colorectal cancer cell lines of the HROC collection concerning similarities to small intestinal epithelial cells and their potential to predict intestinal drug absorption. After initial screen of a larger panel, ten cell lines with confluent outgrowth and long-lasting barrier forming potential were further characterized in close detail. Tight junctional complexes and microvilli structures were detected in all lines, differentiated epithelial cells were abundant in 7/10. All lines expressed multiple transporter molecules, with expression levels in three lines being close to those of small intestinal epithelial cells. Compared to the Caco-2 model, three HROC lines demonstrated both higher similarity to jejunal epithelial tissue cells and higher regulatory potential of relevant drug transporters. In sum, these lines would be better suited human small intestinal epithelium models for basic and translational research; especially for ADME studies.

1). BACKGROUND: Cell wall deficient mycobacteria (CWDM) have seldom been isolated in bacterial culture from human subjects. particularly in clinical disease, such as Crohn’s disease. Techniques have focused on the use of polymerase chain reaction (PCR) for the detection of CWDM in association with inflammatory bowel disease. (IBD). This paper is a report of the development of methods to demonstrate the presence of CWDM using the Ziehl-Neelsen (ZN) stain. This is in addition to the detection of the growth of CWDM in fluid media. 2). METHODS: The use of the ZN stain is suitable for the demonstration of CWDM in clinical samples and cultures, when the staining methods that were common prior to the 1970’s, are adopted. Specific culture media are developed and tested in parallel. Alterations in the concentration of basic fuchsin, and changes in the decolourising solutions are necessary. Decolourising solutions such as 20% concentrated sulphuric acid in water are preferable for detection of CWDM in cultures. 3). RESULTS: CWDM can be readily demonstrated using the simple methods outlined in this report. The ability to visualise the presence of CWDM opens the door to the development of specific fluid media for the isolation of CWDM in culture. 4). CONCLUSION: The ZN stain methods optimised for the demonstration of Mycobacterium tuberculosis complex (MTBC) are not suitable for research into infectious causes of inflammatory bowel disease (IBD), as well as for the detection of CWDM in latent tuberculosis. Revisiting the techniques for the detection of CWDM may also refocus attention on inflammatory diseases considered to be idiopathic, but having hallmarks of an infectious process.

The advent of the genome editing era brings forth the promise of adoptive cell transfer using engineered chimeric antigen receptor (CAR) T-cells for targeted cancer therapy. CAR T-cell immunotherapy is probably one of the most encouraging developments for the treatment of hematological malignancies. In 2017, two CAR T-cell therapies were approved by the U. S Food and Drug Administration; one for the treatment of pediatric Acute Lymphoblastic Leukemia (ALL), the other for adult patients with advanced lymphomas. However, despite significant progress in the area, CAR T-cell therapy is still in its early days and faces significant challenges, including the complexity and costs associated with the technology. B-cell lymphoma is the most common hematopoietic cancer in dogs, with an incidence approaching 0.1% and a total of 20-100 cases per 100,000 individuals. It is a widely accepted naturally occurring model for human non-Hodgkin’s lymphoma. Current treatment is with combination chemotherapy protocols, which prolong life for less than a year in canines and are associated with severe dose-limiting side effects, such as gastrointestinal and bone marrow toxicity. To date, one canine study generated CAR T-cells by transfection of mRNA for CAR domain expression. While this was shown to provide a transient anti-tumor activity, results were modest, indicating that stable, genomic integration of CAR modules is required in order to achieve lasting therapeutic benefit. This Commentary summarizes the current state of knowledge on CAR T-cell immunotherapy in human medicine and its potential applications in animal health, while discussing the potential of the canine model as a translational system for immuno-oncology research.

Cancer remains as a worldwide cause of death. Investigational research efforts have included the administration of tumors-derived extracts to healthy animals. Having previously demonstrated that administration of non-transmissible, human cancers-derived homogenates induced malignant tumors in mice; we examined here the consequences of administering 50 or 100 µg of protein of crude homogenates from samples of mammary carcinoma, pancreatic adenocarcinoma, and melanoma. The protocol conceived six inoculations per week during three months. Concurrent control group received homogenates of healthy donor skin cosmetic surgery fragments. Mammary carcinoma homogenate administration did not provoke animals’ deterioration or mortality. Multiple foci of lung adenocarcinomas with broad expression of malignity histomarkers, coexisting with small cell-like carcinomas were found. Disseminated cells, positive to classic epithelial markers were detected in lymphoid nodes. Pancreas tumor and melanoma homogenates administrations severely deteriorated animals’ health. Pancreas tumor induced lung poorly-differentiated adenocarcinomas, as a remarkable pancreatic islets hyperplasia. Melanoma affected lungs with atypical adenomatous hyperplasia and solid pseudopapillary adenocarcinoma. Giant atypical hepatocytes with variegated nuclei were also observed. Kidney parenchyma exhibited dispersed foci of neoplastic cells within a desmoplastic matrix. A noticeable nuclear overlapping with hyperchromatic nuclei, mitotic figures, and prominent nuclear atypia was identified in epidermal cells. None of these changes were ever detected in any mouse of the control groups. This study confirms and extends our hypothesis that tumor homogenates contain and may act as a vector for “malignancy drivers”, which ultimately implement a carcinogenesis process in otherwise healthy mice.

The polygenic and multifactorial nature of many psychiatric disorders has hampered the personalized medicine approach implementation in clinical practice. However, induced pluripotent stem cell (iPSC) technology has emerged as an innovative tool for patient-specific disease modeling to expand the pathophysiology knowledge and treatment perspectives in the last decade. Current technologies enable adult human somatic cell reprogramming into induced pluripotent stem cells (iPSCs) to generate neural cells and direct neural cell conversion to model organisms that exhibit phenotypes close to human diseases, thereby effectively representing relevant aspects of neuropsychiatric disorders. iPSCs reflect patient pathophysiology and pharmacological responsiveness, particularly when cultured under conditions that recapitulate spatial tissue organization in brain organoids. Recently, the application of iPSCs has been frequently associated with gene editing that targets the disease-causing gene to deepen the illness pathophysiology and conduct drug screening. Moreover, gene editing has provided a unique opportunity to repair the putative causative genetic lesions in patient-derived cells. Here, we review the use of iPSC technology to model and potentially treat neuropsychiatric disorders by illustrating the key studies on a series of mental disorders, including schizophrenia, major depression disorder, bipolar disorder, and autism spectrum disorder. The future perspective will involve the development of organ-on-a-chip platforms that control the microenvironmental conditions to reflect individual pathophysiological by adjusting physiochemical parameters according to personal health data. This strategy could open new ways to build a disease model that considers individual variability and tailors personalized treatments.

Background: Treatment resistance of glioblastoma multiforme to chemo- and radiotherapy remains a challenge yet to overcome. Especially MGMT promoter unmethylated patients have only little benefit from chemotherapy treatment using temozolomide since MGMT counteracts its therapeutic efficacy. Therefore, new treatment options in radiotherapy need to be developed to inhibit MGMT and increase radiotherapy response. Methods: Lomeguatrib, a highly specific MGMT inhibitor was used to inhibit MGMT protein expression in vitro. Radiosensitivity of established human glioblastoma multiforme cell lines in combination with lomeguatrib was investigated using the clonogenic survival assay. Inhibition of MGMT was analyzed using Western Blot. Cell cycle distribution and apoptosis were investigated to determine the effects of lomeguatrib alone as well as in combination with ionizing radiation. Results: Lomeguatrib significantly decreased MGMT protein expression and reduced radiation-induced G2/M arrest. A radiosensitizing effect of lomeguatrib was observed when administered at 1 µM and increased radioresistance at 20 µM. Conclusion: Low concentrations of lomeguatrib elicit radiosensitization, while high concentrations mediate a radioprotective effect.

Metal-catalyzed lipid oxidation is a major factor in food waste, as it reduces shelf life. Addressing this issue, our study investigates the potential of hydrolysates derived from potato protein, a by-product of potato starch production, as metal chelating antioxidants. Through sequential enzymatic hydrolysis using Alcalase or Trypsin combined with Flavourzyme, we produced various hydrolysates, which were then fractionated via ultrafiltration. Using a combination of peptidomics and bioinformatics, we predicted the presence of metal-chelating and free radical scavenging peptides across all hydrolysate fractions, with a trend indicating a higher content of antioxidant peptides in lower molecular weight fractions. To validate these predictions, we utilized Surface Plasmon Resonance (SPR) and a 9-day emulsion storage experiment. While SPR demonstrated potential in identifying antioxidant activity, it faced challenges in differentiating between hydrolysate fractions due to significant standard errors. In the storage experiment, all hydrolysates showed lipid oxidation inhibition, though not as effectively as EDTA. Remarkably, one fraction (AF13) was not significantly different (p < 0.05) from EDTA in suppressing hexanal formation. These results highlight SPR and peptidomics/bioinformatics as promising yet limited methods for antioxidant screening. Importantly, this study reveals the potential of potato protein hydrolysates as antioxidants in food products, warranting further research.

This paper investigates an innovative photovoltaic cell configuration, denoted as “Au/CuSCN/RbGeI3/CdTe/ZnO/TiO2/FTO", using SCAPS-1D simulation. The research focuses on optimizing device performance by analyzing key components, including ZnO as the electron transport layer (ETL), RbGeI3 as the perovskite absorber layer, CuSCN as the hole transport layer (HTL), and CdTe as the active buffer layer. A comparison is made with the standard “Au/CuSCN/CH3NH3SnI3/CdTe/ZnO/TiO2/FTO" configuration under dark and illuminated conditions. Through an in-depth investigation involving temperature effects, generation rate analysis, RbGeI3 absorber layer thickness, Nd level, and interface defect levels, an optimized design for a unit area is achieved. The proposed solar cell demonstrates outstanding performance metrics, including an open circuit voltage (Voc) of 0.94V, a short circuit current density (Jsc) of 34.52mA/cm2, a fill factor (FF) of 77.77%, and an energy conversion efficiency (η) of 25.40%. These values significantly outperform the reference models with energy conversion efficiencies of 10.11% and 21.09%. Real-world applicability is validated by implementing these optimized characteristics in a photovoltaic system for Pakistan’s geographical location using PVSyst software. The suggested solar cell achieves a remarkable performance ratio (PR) of 85.6%, surpassing the PR of the reference basic solar cell model at 83%. The findings of this research offer a promising and superior solar cell design, incorporating innovative materials and optimization techniques to achieve exceptional energy conversion efficiency and overall performance. This study’s outcomes have the potential to advance photovoltaic technology and contribute to sustainable energy solutions worldwide.

An event of increasing interest during host-pathogen interactions is the differentiation of patrolling monocytes (MOs) and the polarization of naive MOs into macrophage subsets (MФs). Therapeutic strategies aimed at modulating this event are under investigation. This review focuses on the mechanisms of induction, development, and profile of MФs polarized toward classically proinflammatory (M1) or alternatively anti-inflammatory (M2) phenotypes in response to bac-teria, fungi, parasites, and viruses. It highlights nuclear (PPARγ), cytoplasmic, and cell surface receptors (pattern recognition receptors/PPRs), microenvironmental mediators, and immune signaling. MФs polarize into phenotypes: M1 MФs, activated by IFN-γ, pathogen-associated mo-lecular patterns (PAMPs, e.g. LPS)/DAMPs and membrane-bound PPRs ligands (TLRs/CLRs lig-ands); or M2 MФs (a, b, c and d), induced by IL-4, -10 and -13, antigen-antibody complexes, and helminth PAMPs. The kinetics of M1 and M2 polarization evolve in a pathogen-specific manner, with or without canonicity, and can vary widely. Ultimately, this can result in varying degrees of host protection or more severe disease outcome. While the host is driving an effective MФs po-larization, pathogens are attempting to shift it to increase pathogenicity. The latter results from a bias toward an ineffective M1 or M2 response due to microbial virulence factors, culminating in pathogen evasion of host defenses. Plasticity of M1/M2 phenotypes is also ensured by cellu-lar/genomic reprogramming. Because modulation of this event can occur at multiple points, providing a therapeutic/vaccine design target to boost microbicidal (M1) or tissue repair (M2) response during the inflammation-to-resolution transition; new insights and emerging perspec-tives may have clinical implications.

Macrophages are the key effector cells of innate immunity which show two polarized states: M1, classically activated and M2, alternatively activated. Tumor-associated macrophages (TAMs) which usually show M2 polarization, are immunosuppressive cells that enhance tumor metastasis and invasion. Also, enrichment of TAMs is known to be closely associated with poor prognosis of cancer patients. Therefore, TAMs are considered to be promising targets for immunotherapy. Importantly, tumor-derived exosomes emerged as a crucial player in immune regulation which can remodel the tumor microenvironment towards immunosuppressive state. Of note, few studies have shown that exosomes could induce polarization of macrophages towards M2 type in tumor condition, while others showed activation of M1 or mixed phenotype. Considering the role of TAMs in cancer, there is an urgent need to decipher the exosome-mediated cross-talk between tumor cells and macrophages.For this, we used murine model of Dalton’s lymphoma (DL), wherein, firstly, we evaluated increased exosome burden by assessing exosome level in serum as well as in various tissues of tumor-bearing host. Next, proteomic profiling of lymphoma-derived exosomes was done which revealed the presence of immunomodulatory proteins. Of note, these proteins were known to alter the macrophage polarization. In order to assess the effect of these exosomes on macrophages, we performed in vitro study using RAW264.7 cells. In vitro study revealed that frequent uptake of exosomes mediated a morphological change in macrophages which reduced their phagocytic activity. In parallel, exosomes increased reactive oxygen species (ROS) level and inhibited LPS-induced nitric oxide (NO) level in macrophages. Also, exosomes upregulated the expression of arginase-1 (an M2 marker) in macrophages but decreased the LPS-induced nitric oxide synthase 2 (NOS2) (an M1 marker) expression. Moreover, we observed a pro-tumoral cytokine profile in macrophages incubated with exosomes. Our study suggests that exosome load increases in lymphoma-bearing hosts systemically. Importantly, lymphoma-derived exosomes mediate the activation of macrophages towards pro-tumoral M2 type. Our results give an insight into the exosome-mediated tumor and immune cell cross-talk which could serve as an important prospect for targeting in cancer immunotherapy.

Fundus image registration plays a crucial role in the clinical evaluation of ocular diseases, such as diabetic retinopathy and macular degeneration, necessitating meticulous monitoring. The alignment of multiple fundus images enables the longitudinal analysis of patient progression, widening the visual scope, or augmenting resolution for detailed examinations. Currently, prevalent methodologies rely on feature-based approaches for fundus registration. However, certain methods exhibit high feature point density, posing challenges in matching due to point similarity. This study introduces a novel fundus image registration technique integrating U-Net for the extraction of feature points employing FIVES for its training and evaluation, a novel and large dataset for blood vessels segmentation, prioritizing point distribution over abundance. Subsequently, the method employs medial axis transform and pattern detection to obtain feature points characterized by the Fast Retina Keypoint (FREAK) descriptor, facilitating matching for transformation matrix computation. Assessment of the vessel segmentation achieves 0.7559 for Intersection Over Union (IoU), while evaluation on the Fundus Image Registration Dataset (FIRE) demonstrates the method’s comparative performance against existing methods, yielding a registration error of 0.596 for area under the curve, refining similar earlier methods and suggesting promising performance comparable to prior methodologies.

Background: The study aimed to investigate the association between environmental tobacco smoke exposure and the risk of wheezing among rural and urban preschool children in Mpumalanga province, South Africa, an area associated with poor air quality. Methods: In this study, parents/caregivers of preschool children (n=3145) completed a modified International Study of Asthma and Allergies in Childhood (ISAAC) questionnaire. Data were analysed using multiple logistic regression models. Results: The overall prevalence of Wheeze ever was 15.14%, with a higher prevalence in urban pre-schoolers than rural pre-schoolers (20.71% vs 13.30 %, P<0.000). Moreover, the total prevalence of asthma ever was 2.34%. The prevalence was greater in urban pre-schoolers than in rural pre-schoolers (3.92% vs 1.81%, P<0.001). In the final adjusted model, both urban and rural area children who lived with one or more people who smoked in the same household (WE: OR 1.44, 95% CI 1.11-1.86) (CW: OR 2.09, 95% CI 1.38-3.16) and (AE: OR 2.49, 95% CI 1.12-5.54) were found to have an increased likelihood of having Wheeze Ever, Current Wheeze and Asthma Ever as compared to those who lived with non-smokers. Conclusions: The implementation of smoking limits and prohibition is crucial in areas that are frequented or utilized by children. Hence, it is imperative for healthcare providers to actively champion the rights of those who do not smoke within the society, while also endorsing legislative measures aimed at curtailing the extent of tobacco smoke exposure.

The aim of this study was to examine the oxidation of human serum albumin (HSA) caused by oxidative stress after an exhaustive exercise such as ultra-marathon race. Thus, blood samples from 12 adult runners who underwent a 103 km mountain ultra-marathon race were collected pre- and 24, 48 and 72 h post race. HSA was partially purified using affinity chromatography and then was subjected to Western blot analysis for disulfide dimers determination, indicating oxidation. The results were correlated with those from a previous study in which the same samples were analyzed using different oxidative stress markers and a good correlation with protein carbonyls (PC) at all time points was observed. Moreover there was a significant correlation with static oxidation-reduction potential (sORP) at 24 h, and a negative correlation with capacity oxidation-reduction potential (cORP) at 24 and 48 h. In addition, an individual analysis of albumin dimers exhibited great inter-individual differences. This inter-individual variability in the oxidation of HSA may suggest different interventions (e.g. through diet) in order to confront the effects on athletes’ organism after a strenuous exercise. In conclusion, this study supported the importance of the assessment of albumin dimers as a predictive marker for exercise-induced oxidative stress.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

The existence of low-cost and accurate tools that can equip the First Responders (FRs) to detect trapped victims and provide insights about their health condition in the aftermath of a disaster, is imperative. To address the problem of detecting trapped victims behind walls or debris, we have developed a tool that exploits an Ultra-Wide Band (UWB) radar sensor for data collection and Machine Learning (ML) algorithms for data analysis. To evaluate the efficacy of our approach, we collected data from nine humans, both in standing and lying down positions. Next, we applied various ML algorithms to the collected dataset for two discrete sub-tasks that are of interest from an FR’s perspective. The first task is the detection of the victim’s presence, where the algorithms attained more than 95% accuracy and F1-Score. The second task is the estimation of the distance between the radar sensor and the victim, where the tool showed an average error of less than 40 cm.

The ability to detect the presence as well as classify the activities of individuals behind visually obscuring structures is of significant benefit to police, security and emergency services in many situations. This paper presents the analysis from a series of experimental results generated using a through-the-wall (TTW) Frequency Modulated Continuous Wave (FMCW) C-Band radar system named Soprano. The objective of this analysis was to classify whether an individual was carrying an item in both hands or not using micro-Doppler information from a FMCW sensor. The radar was deployed at a standoff distance, of approximately 0.5 m, outside a residential building and used to detect multiple people walking within a room. Through the application of digital filtering, it was shown that significant suppression of the primary wall reflection is possible, significantly enhancing the target signal to clutter ratio. Singular Value Decomposition (SVD) signal processing techniques were then applied to the micro-Doppler signatures from different individuals. Features from the SVD information have been used to classify whether the person was carrying an item or walking free handed. Excellent performance of the classifier was achieved in this challenging scenario with accuracies up to 94%, suggesting that future through wall radar sensors may have the ability to reliably recognize many different types of activities in TTW scenarios using these techniques.

Nonlinear nonparametric statistics (NNS) algorithm offers new tools for curve fitting. A relationship between k-means clustering and NNS regression points is explored with graphics showing a perfect fit in the limit. The goal of this paper is to demonstrate NNS as a form of unsupervised learning, and supply a proof of its limit condition. The procedural similarity NNS shares with vector quantization is also documented, along with identical outputs for NNS and a k nearest neighbours classification algorithm under a specific NNS setting. Fisher's iris data and artificial data are used. Even though a perfect fit should obviously be reserved for instances of high signal to noise ratios, NNS permits greater flexibility by offering a large spectrum of possible fits from linear to perfect.

Based on screening in computational biology and biological in vitro assays, five natural products isolated from extracts of the herbal medicine toad skin, such as cinobufagin (CBFi), bufalin (BFi), arenobufagin (ABFi), telocinobufagin (TBFi), bufotalin (BFTi), were subjected to molecular docking calculations with the use of SARS-CoV-2 main protease (PDB 6LU7 and 7BTF) and top-scoring ligand-receptor complexes were obtained. The results showed that the binding energy of ABFi to the 3CL protein was -17.044kcal/mol, which was higher than CBFi and TBFi. However, the binding energy of ABFi to the RdRp protease was -23.250 kcal/mol, which was much lower than that of CBFi and TBFi, EVEN lower than that of ABFi to the 3CL protein. ABFi also has polar interactions with amino acids such as Glu811, Ser814, Ser681 and Thr680 of RdRp enzyme. The results revealed that ABFi had a moderate inhibitory effect on the cell proliferation of SARS-CoV-2 in vitro, with an inhibition rate of 61.12%, even weaker than Remdesivir. This new discovery provides us with new ideas for in-depth studies on the development of natural products with this class of structural generalizations as inhibitors of SARS-CoV-2, and provides an experimental basis for the next step of mechanistic studies.

Hemangioblasts give rise to endothelial progenitor cells (EPCs), which also express the cell surface markers CD133 and C-kit. They may differentiate into the outgrowth endothelial cells (OECs) that control neovascularization in the developing embryo. Reduced levels of EPC in circulation have been linked to human cardiovascular disorders, according to numerous studies. Furthermore, preeclampsia and senescence have been linked to levels of EPCs produced from cord blood. Uncertainties surround how preeclampsia affects the way EPCs function. It is reasonable to speculate that preeclampsia may have an impact on the function of fetal EPCs during the in utero period; however, given the present literature's suggestion that maternal vasculopathies, including preeclampsia, damage fetal circulation. Additionally, the differentiation potential and general activity of EPCs may serve as an indicator of the health of the fetal vascular system since they promote neovascularization and repair during pregnancy. Thus, the purpose of this review is to compare, through assessment of their quantity, differentiation potency, angiogenic activity, and senescence, the angiogenic function of fetal EPCs obtained from cord blood for normal and pregnancy problems. This will shed light on the relationship between the angiogenic function of fetal EPCs and pregnancy complications, which could have an effect on the management of long-term health issues like metabolic and cardiovascular disorders in offspring with abnormal vasculature development.

In this study, we investigated the features of co-infection with SARS-CoV-2 and nonpathogenic strain LEV8 of coxsackievirus A7 or enterovirus A71 for Vero E6 cells and Syrian hamsters. The investigation of co-infection with SARS-СoV-2 and LEV-8 or EV-A71 in the cell model was shown that a competitive inhibitory effect for these viruses were especially significant against SARS-CoV-2. Pre-infection with enteroviruses in animals caused more than a 100-fold decrease in the levels of SARS-CoV-2 virus replication in the respiratory tracts and more rapid clearance of the lower respiratory tract from infectious SARS-CoV-2. Co-infection with SARS-CoV-2 and LEV-8 or EV-A71 also reduced the severity of clinical manifestations of the SARS-CoV-2 infection for animals. Additionally, the histological data illustrated that co-infection with nonpathogenic coxsackievirus decreased the level of pathological changes by SARS-CoV-2 in the lungs. Research into the chemokine/cytokine profile demonstrated that the studied enteroviruses efficiently triggered this part of antiviral immune response, which can be associated with significant inhibition of SARS-CoV-2 infection. These results demonstrate that there exists a strong viral interference between the studied nonpathogenic strain of coxsackievirus A7 or enteroviruses A71 and SARS-CoV-2 pathogenic for humans in vitro and in vivo.

Schistosomiasis, acquired by skin-penetrating cercariae of dioecious digenean schistosomes during freshwater contact, afflicts nearly 260 and 440 million people with active infections and residual morbidity, respectively; about 10 million women at reproductive age contract schistosomiasis during gestation every year. Acute schistosomiasis is characterized by pre-patent pro-inflammatory CD4+ T-helper 1 or CD4+ Th1/T-helper 17 reactivity against immature schistosomulae. Chronic schistosomiasis is dominated by post-patent anti-inflammatory CD4+ T-helper 2 reactivity against ova epitopes; flukes co-exist in immunocompetent definitive hosts as they are capable of evading their defense mechanisms. Preventive measures should be complemented by vaccination, inducing long-term protection against transmission, infection, and disease recurrence, given the latest advancements in schistosomal vaccines. Transmission models incorporating vaccination available in PubMed, Embase and Web of Science up to December 31, 2023 are presented. Besides conceptual model differences, predictions meant to guide decision- and policymaking reveal continued worm harboring facilitating transmission besides residual infections, and increased susceptibility to re-infection and rebound morbidity, both shifted to later life stages following the intervention. Consequently, a vaccination schedule is pivotal considering the optimal age for initial immunization, i.e., pre-schoolchildren or schoolchildren, in a cohort-based or population-based manner while incorporating potential non-adherers promoting ongoing transmission; longevity over magnitude of vaccine protection to antigenic schistosomal moieties is crucial including accounting for existing pre-acquired immunity from natural exposure, in utero priming besides herd immunity, and induced by chemotherapy. Combining as one multi-component approach long-term effects of vaccination with short-term effects of chemotherapy as regular repeated vaccine-linked therapy in contrast to a single-component intervention seems most promising for achieving WHO’s endpoints of transmission elimination and morbidity control.

The mechanisms underlying the establishment of asymmetric structures during development remain elusive. The wing of Drosophila is asymmetric along the Anterior-Posterior (AP) axis, despite that its growth signals that drive its growth are presumably symmetric. Here, we investigated the contribution of cell recruitment, a process that drives wing fate differentiation in Drosophila, to the asymmetric shape and pattern of the adult wing. Genetic impairment of cell recruitment results in a significant reduction in adult wing asymmetry, primarily affecting the region between longitudinal vein 5 and the wing margin (L5-M). Morphometric analysis reveals that the lack of cell recruitment results in a more symmetric wing with respect to the AP, suggesting a contribution of cell recruitment to the establishment of asymmetry in the adult wing. A close examination of the expression of the wing selector gene vestigial (vg) in wing disc does not support this hypothesis. However, the circularity of the Vg pattern significantly increase in recruitment-impaired wing disc, suggesting that while the decrease of the L5-M region in the adult wing may not be attributed to cell recruitment, it could contribute to the overall asymmetry of the adult wing. We conclude that cell recruitment, a widespread mechanism that participates in growth and patterning of several developing systems, could drive, at least partially, the asymmetric shape of the Drosophila wing.

Merkel cell carcinoma (MCC) is a rare, highly aggressive skin cancer characterized by two etiologies: the first one, observed in most cases, is attributed to Merkel cell polyomavirus (MCPyV), a DNA tumor virus, while the second one is due to ultraviolet (UV) radiation exposure. Currently, there are limited diagnostic, prognostic, and therapeutic biomarkers available for MCC. MicroRNAs (miRNAs) are small RNA molecules that do not code for proteins but regulate various cellular processes, including cell cycle progression, proliferation, differentiation, and apoptosis. The dysregulation of miRNAs has been associated with a wide range of cancers since they can act as either tumor suppressors or oncogenes. This paper aims to collect, summarize and re-organize the recent discoveries concerning miRNAs, whose dysregulation in the pathogenesis and progression of MCC is slowly emerging. Furthermore, the potential clinical applications of miRNAs as diagnostic biomarkers, possible differentiation between MCPyV-related and unrelated MCC, predictors of response to therapy and prognostics are also discussed. From this review, it emerges that miRNAs may have, in the near future, the potential to become clinically significant in improving the diagnostic accuracy, prognostic evaluation, and therapeutic options of MCCs. Finally, the new perspectives on the poorly explored field of artificial intelligence in MCC are provided.

Human adipose stem cell-derived extracellular vesicles (hASC-EVs) are key mediators of paracrine signaling with promising therapeutic applications. Although hASC-EVs are derived from human cells and are less immunogenic, their immunogenicity cannot be completely excluded. Here, we evaluate the immune responses of ICR and C57BL/6 mice to high doses of hASC-EVs for 10 days after injection. Lymphocyte subpopulations are analyzed using flow cytometry at 0.5, 1, 3 and 24 h post injection. In the spleen and blood of C57BL/6 mice, neutrophils sharply increased at 0.5 h and decreased at 3 h following hASC-EV treatment. We observe increased proportions of monocytes, macrophages, and natural killer cells at 3 h but returned to similar level of vehicle control at 24 h post injection in the spleen and blood of ICR mice. Although the in vivo experiments reveal different immune responses to hASC-EV treatment in C57BL/6 and ICR strains, no major changes occur in human peripheral blood mononuclear cell composition after applying hASC-EVs in vitro. In conclusion, unlike those in mice, immune responses to hASC-EVs in humans are not detectable, indicating a minimal risk of fatal side-effects from hASC-EV-based therapies.

Immune cells such as T cells and macrophages express α7 nicotinic acetylcholine receptors (α7 nAChRs), which contribute to the regulation of immune and inflammatory responses. Earlier findings suggest α7 nAChR activation promotes the development of regulatory T cells (Tregs) in mice. Using human CD4+ T cells, we investigated the mRNA expression of the α7 subunit and the human-specific dupα7 nAChR subunit, which functions as a dominant-negative regulator of ion channel function, under resting conditions and T cell receptor (TCR)-activation. We then explored the effects of the selective α7 nAChR agonist GTS-21 on proliferation of TCR-activated T cells and Treg development. Varied levels of mRNA for both the α7 and dupα7 nAChR subunits were detected in resting human CD+ T cells. mRNA expression of the α7 nAChR subunit was profoundly suppressed on days 4 and 7 of TCR-activation as compared to day 1, whereas mRNA expression of the dupα7 nAChR subunit remained nearly constant. GTS-21 did not alter CD4+ T cell proliferation but significantly promoted Treg development. These results suggest the potential ex vivo utility of GTS-21 for preparing Tregs for adoptive immunotherapy, even with high expression of the dupα7 subunit.

REV-ERBα and its paralog, REV-ERBβ encoded by NR1D1 and NR1D2 genes, are key nuclear receptors that link the circadian timing system and metabolic homeostasis. Since heme is an endogenous ligand, REV-ERBs have been considered key components of the circadian molecular clock that can be pharmacologically targeted to treat various circadian rhythm-related diseases, such as cardiometabolic, inflammatory, and neuropsychiatric diseases, as well as cancer. REV-ERBs are believed to be functionally redundant and compensatory, although they often affect the expression of gene subsets in an isoform-specific manner. Therefore, this study aimed to identify the redundant and distinct roles of each isoform in controlling its target genes by comparing the transcriptome profiles of a panel of mutant U2OS human osteosarcoma cells in which either NR1D1 or NR1D2 was ablated. Indeed, our transcriptomic analyses revealed that most REV-ERB-regulated genes were controlled by redundant or even additive actions. However, the RNA expression profiles of each single mutant cell line also provided strong evidence for isoform-dependent actions. For example, REV-ERBα were more responsible for regulating the NF-κΒ signaling pathway, whereas a group of extracellular matrix components required REV-ERBβ to maintain their expression. We found that REV-ERBs have isoform-selective functions in the regulation of certain circadian output pathways, despite their overlapping roles in the circadian molecular clock. Thus, the development of isoform-selective REV-ERB modulators may help treat metabolic disturbances and certain types of cancer.

Herbs and Plants have been the most important form of medicine in India since ancient times. the plant kingdom is a goldmine of potential drugs and active molecules. Medicinal plants played a vital role in manufacturing human health and improving the quality of human life for thousands of years. During the last decade, the use of traditional medicine has expanded globally and gained popularity. Medicinal plants have healing properties due to the presence of various complex chemical substances of different compositions. Medicinal plants have served humans well as valuable components of medicines, flavorings, beverages, cosmetics, and dyes. Ficus religiosa is one of the medically important plants belonging to the family of Moraceae. It has been used broadly by Ayurvedic practitioners in India to treat various diseases. The present work is an endeavor to improve the effectiveness of synthetic drugs in combination with plant extracts.

Galectins are a family of beta-galactoside-binding proteins that are characterised by their carbohydrate recognition domain (CRD) and include galectin-1 and galectin-3. These galectins have been implicated in numerous diseases due to their pleiotropic nature, including cancer and fibrosis, with therapeutic inhibitors being clinically developed to block the CRD. One of the early methods developed to characterise these galectins was hemagglutination of red blood cells. Although insightful this approach has been hampered by a lack of sensitivity and accurate quantification of the agglutination observed. In this study we aimed to validate a more precise and quantitative method to enable further investigation of differences between galectins in respect to agglutination induction in different blood groups as well as characterisation of small molecule inhibitors. Quantification of hemagglutination was shown to be optimal using U-bottom plates imaged and analysed with FIJI ImageJ rather than flat bottom plates read for absorbance on an optical density plate reader. Galectin-3-induced red blood cell agglutination efficacy increased significantly from blood group O to A to B. However, for both the galectin-1 monomer and concatemer a more comparable effect was observed between blood group B and O but with more potent effects than in blood group A. Inhibition assays for both galectin-3 and galectin-1 induced-hemagglutination were able to demonstrate clear concentration-responses and expected selectivity profiles for a set of small molecule glycomimetics, confirming historical profiles obtained in biochemical binding and functional cellular assays.

Lung cancer is almost the most common cause of cancer death in the world. Clinically, the conventional therapy to eradicate the cancer cells is chemotherapy but a better drug remains required. In this study, the effects of three bufadienolides, kalantuboside B, kalantuboside A and bryotoxin C, isolated from Kalanchoe tubiflora (Harvey) were evaluated and characterized in CL1-5 highly metastatic human lung cancer cells. Contrary to the apoptosis-promoting activity in other cancer cells, these three bufadienolides did not induce apoptosis in CL1-5 cancer cells. Instead, they activated an autophagy pathway, as indicated by the increase of autophagosomes formation. The induction of autophagy by these three bufadienolides was demonstrated to link to down-regulation of p-mTOR as well as up-regulation of LC3-II, ATG5, ATG7, Beclin-1. Moreover, among these three compounds, kalantuboside B in which a monosaccharide is attached at the bufadienolide aglycon, exhibited a better autophagy induction. Our findings revealed an alternative mechanism of drug action by bufadienolides in lung cancer cells and provided evidence for the possibility of treating highly metastatic human lung cancer through an autophagy pathway.

Piscirickettsia salmonis is an intracellular bacterial fish pathogen that causes piscirickettsiosis, a disease with numerous negative impacts in the Chilean salmon farming industry. Although transcriptomic studies of P. salmonis and its host have been performed, dual host-pathogen proteomic approaches during infection are still missing. Considering that gene expression not always corresponds with observed phenotype, and bacteriological culture studies inadequately reflect infection conditions, to improve the existing knowledge for the pathogenicity of P. salmonis we present here a global proteomic profiling of Salmon salar macrophage-like cell cultures infected with P. salmonis LF-89. The proteomic analyses identified several P. salmonis proteins from two temporally different stages of macrophages infection; some of them related to key functions for bacterial survival in other intracellular pathogens. Metabolic differences were observed in early-stage infection bacteria, compared to late-stage infections. Virulence factors related to membrane, LPS and surface component modifications, cell motility, toxins and secretion systems also varied between the infection stages. Pilus proteins, beta-hemolysin and the T6SS were characteristic of the early-infection stage, while fimbria, upregulation of 10 toxins or effector proteins, and the Dot/Icm T4SS were representative of the late-infection stage bacteria. Previously described virulence-related genes in P. salmonis plasmids were identified by proteomic assays during infection in SHK-1 cells, accompanied by an increase of mobile-related elements. By comparing the infected and un-infected proteome of SHK-1 cells, we observed changes in cellular and ROS homeostasis, innate immune response, microtubules and actin cytoskeleton organization and dynamics, alteration in phagosome components, iron transport and metabolism, and amino acids, nucleoside and nucleotide metabolism, together with an overall energy and ATP production alteration. Our global proteomic profiling and the current knowledge of the P. salmonis infection process allowed us to propose a model of the macrophage-P. salmonis interaction.

Human Activity Recognition (HAR) technology enables continuous behavior monitoring, particularly valuable in healthcare. This study investigates the viability of using an ear-worn motion sensor for classifying daily activities, including lying, sitting/standing, walking, ascending stairs, descending stairs, and running. Fifty healthy participants (between 20 and 47 years old) engaged in these activities while under monitoring. Various machine learning algorithms, ranging from interpretable shallow models to state-of-the-art deep learning approaches designed for HAR, were employed for classification. Results demonstrate the ear sensor's efficacy, with deep learning models achieving 98% accuracy rate of classification. The obtained classification models are agnostic regarding which ear the sensor is worn and robust against moderate variations in sensor orientation (e.g., due to differences in auricle anatomy), meaning no initial calibration of the sensor orientation is required. The study underscores the ear's efficacy as a suitable site for monitoring human daily activity and suggests its potential for combining HAR with in-ear vital signs monitoring. This approach offers a practical method for comprehensive health monitoring by integrating sensors in a single anatomical location. This integration facilitates individualized health assessments, with potential applications in tele-monitoring, personalized health insights, and optimizing athletic training regimes.

The rapid growth of the global wearable technologies market is projected to reach $61.30 billion by 2030 which reflects a shift towards personalised health monitoring embedded in everyday activities. This paper explores the potential of embroidered interdigitated transducer (IDT)-based sensors for non-invasive, continuous monitoring of human biomarkers, particularly glucose levels, in human sweat. The study employs innovative embroidery techniques to create flexible fabric-based sensors with gold-coated IDTs. Experimental results demonstrate the sensor’s capability to detect water droplets and glucose concentrations, showcasing promising applications for health monitoring. The embroidered IDT-based sensors offer a unique approach for seamless integration into clothing, paving the way for personalised, continuous health data capture.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a pleiotropic myelopoietic growth factor and proinflammatory cytokine, clinically used for multiple indications and serving as a promising target for treatment of many disorders, including cancer, multiple sclerosis, rheumatoid arthritis, psoriasis, asthma, COVID-19. We have previously shown that dimeric Ca2+-bound forms of S100A6 and S100P proteins, members of the multifunctional S100 protein family, are specific to GM-CSF. To probe selectivity of these interactions, the affinity of recombinant human GM-CSF to dimeric Ca2+-loaded forms of 18 recombinant human S100 proteins was studied by surface plasmon resonance spectroscopy. Of them, only S100A4 protein specifically binds to GM-CSF with equilibrium dissociation constant, Kd, values of 0.3-2 μM, as confirmed by intrinsic fluorescence and chemical crosslinking data. Calcium removal prevents S100A4 binding to GM-CSF, whereas monomerization of S100A4/A6/P proteins disrupts S100A4/A6 interaction with GM-CSF and induces a slight decrease in S100P affinity for GM-CSF. Structural modelling indicates the presence in the GM-CSF molecule of a conserved S100A4/A6/P-binding site, consisting of the residues from its termini, helices I and III, some of which are involved in the interaction with GM-CSF receptors. The predicted involvement of the ‘hinge’ region and F89 residue of S100P in GM-CSF recognition was confirmed by mutagenesis. Examination of S100A4/A6/P ability to affect GM-CSF signaling showed that S100A4/A6 inhibit GM-CSF/S100-induced suppression of viability of monocytic THP-1 cells. The ability of the S100 proteins to modulate GM-CSF activity is relevant to progression of various neoplasms and other diseases, according to bioinformatics analysis. The direct regulation of GM-CSF signaling by extracellular forms of the S100 proteins should be taken into account in the clinical use of GM-CSF and development of the therapeutic interventions targeting GM-CSF or its receptors.

Macrophage-derived chemokine belongs to the CC subfamily. It is produced by dendritic cells (DCs) and macrophages with or without external stimulation. We have previously shown a statistically significant depletion of MDC/CCL22 concentrations in a number of studies concerning COVID-19. These shifts in concentrations demonstrated stability unrelated to the SARS-CoV-2 genetic variant and remained noticeable even in convalescent patients. In this work, we analyze MDC/CCL22 dynamics in various diseases, including those that manifest with inflammation in lung tissue. In addition, we provide our hypothesis on such a decrease in MDC/CCL22 concentrations in COVID-19. If its secretion by producer cells is unperturbed, then it is possible for viral products to bind to this chemokine and to block its functional activity. There is, however, another possible explanation directly linked to depletion in DC subpopulations and the inhibition of their function. We also discuss MDC/CCL22's role in the immunology of novel coronavirus infection, based on both our own data and other studies.

Many spectroscopic diagnostics are routinely used as a technique to infer the plasma parameters from line emission spectra but their accuracy depends on the numerical model or code used for the fitting process. However, the validation of a line shape code requires some steps : comparison of the line shape code with other similar codes for some academic (simple) cases and then more complex ones, comparison of the fitting parameters obtained from the best fit of the experimental spectra with those obtained with other diagnostic techniques and/or comparison of the fitting parameters obtained by different codes to fit the same experimental data. Here we compare the profiles of the hydrogen Balmer β line in a helium plasma computed by six codes for a selected set of plasma parameters and we report on the plasma parameters inferred by each of them from the fitting to a number of experimental spectra measured in a helium corona discharge where the pressure was in the range 1- 5 bar.

The Italian herbal products market is the most prosperous in Europe. The proof is represented by the use of these products in several marketing categories, ranging from medicine to nutrition and cosmetics. Market and legislation in Italy are at the same time cause and consequence of this peculiar situation. In fact, the legislation on botanical food supplements in Italy is very permissive and at the same time the market shows an overall satisfaction of users and strong feedback in terms of consumption, which brings a widening use of medicinal plants, formerly the prerogative of pharmaceuticals, to other fields such as nutrition. This review summarizes the market and normative panorama of herbal products in Italy, highlighting the blurred boundaries of health indications, marketing authorizations and quality controls between herbal medicines and non pharmaceutical products, such as food supplements, cosmetics and other herbal-based “parapharmaceuticals”.

Our previous studies showed that in patients with brain diseases neurotrophic factors in lacrimal fluid (LF) may change more prominently than in blood serum (BS). Since glial cell line-derived neurotrophic factor (GDNF) is involved in control of neuronal networks in epileptic brain, we aimed to assess GDNF levels in LF and BS as well as BDNF, hypothalamic-pituitary-adrenocortical and inflammation indices in BS of patients with focal epilepsy (PWFE), epilepsy and comorbid depression (PWFE+MDD) compared with major depressive disorder (PWMDD) and healthy controls (HC). GDNF levels in BS were similar in patients and HC and higher in PWFE taking valproates. GDNF levels in LF were significantly lower in all patient groups compared to controls, and independent of drugs used. LF and BS GDNF concentrations positively correlated in HC, but not patient groups. BDNF level was lower in BS of patients compared with HC and higher in PWFE+MDD taking valproates. Logistic regression models demonstrated that GDNF decrease in LF may be an important predictor of focal epilepsy. Probability of focal epilepsy can be evaluated using GDNF in LF and BDNF in BS; MDD - GDNF in LF, cortisol and TNF-α in BS; epilepsy with MDD - GDNF in LF, TNF-α and BDNF in BS.

Infection by the Severe Acute Respiratory Syndrome-Coronavirus-2 (SARS-CoV-2) results in the novel coronavirus disease COVID-19, which has posed a serious threat globally. Infection of SARS-CoV-2 during pregnancy is associated with complications like preterm labor and premature rupture of membranes; a proportion of neonates born to the infected mothers are also positive for the virus. During pregnancy, the placental barrier protects the fetus from pathogens and ensures healthy development. However, whether or not SARS-CoV-2 can infect the placenta is unknown. Herein, utilizing single-cell RNA-seq data, we report that the SARS-CoV-2 binding receptor ACE2 and the S protein priming protease TMPRSS2 are co-expressed by a subset of syncytiotrophoblasts (STB) in the first trimester and extra villous trophoblasts (EVT) in the second trimester human placenta. The ACE2- and TMPRSS2-positive (ACE2+TMPRSS2+) placental subsets express mRNA for proteins involved in viral budding and replication. These cells also express mRNA for proteins that interact with SARS-CoV-2 structural and non-structural proteins in the host cells. We also discovered unique signatures of genes in ACE2+TMPRSS2+ STBs and EVTs. The ACE2+TMPRSS2+ STBs are highly differentiated cells and express genes involved mitochondrial metabolism and glucose transport. The second trimester ACE2+TMPRSS2+ EVTs are enriched for markers of endovascular trophoblasts. Further, both these subtypes abundantly expressed genes in Toll like receptor pathway, the second trimester EVTs (but not first trimester STBs) are also enriched for component of the JAK-STAT pathway that drive inflammation. To conclude, herein we uncovered the cellular targets for SARS-CoV-2 entry and show that these cells can potentially drive viremia in the developing human placenta. Our results provide a basic framework towards understanding the paraphernalia involved in SARS-CoV-2 infections in pregnancy.

Biomimetic materials are substances that replicate natural structures. There are several methods for producing such materials with highly developed surfaces from a wide range of polymers, but electrospinning is of particular interest due to its simplicity of implementation and the ability to modify the produced fibrous materials resembling structures found in living organisms. This study explores new biomimetic materials based on polyhydroxyalkanoates, specifically poly-3-hydroxybutyrate, modified with chlorophyll derivatives. The research investigates the impact of chlorophyll derivatives on the morphology, supramolecular structure, and key properties of nonwoven materials. The obtained results are of interest for the development of new biomimetic environmentally friendly materials for biomedicine with special properties.

The positional cloning of single nucleotide polymorphisms (SNPs) of the neutrophil cytosolic factor 1 (Ncf1) gene, advocating that a low oxidative burst drives autoimmune disease, demands an understanding of the underlying molecular causes. A cellular target could be T cells, which have been shown to be regulated by reactive oxygen species (ROS). However, the pathways by which ROS mediate T cell signaling remain unclear. The adaptor molecule linker for activation of T cells (LAT) is essential for coupling T cell receptor-mediated antigen recognition to downstream responses, and it contains several cysteine residues that have previously been suggested to be involved in redox regulation. To address the possibility that ROS regulate T cell-dependent inflammation through LAT, we established a mouse strain with cysteine-to-serine mutations at positions 120 and 172 (LATSS). We found that redox regulation of LAT through C120 and C172 mediate its localization and phosphorylation. LATSS mice had reduced numbers of double-positive thymocytes and naïve peripheral T cells. Importantly, redox insensitivity of LAT enhanced T cell-dependent autoimmune inflammation in collagen-induced arthritis (CIA), a mouse model of rheumatoid arthritis (RA). This effect was reversed on an NCF1-mutated (NCF1m1j), ROS-deficient, background. Overall, our data shows that LAT is redox-regulated, acts to repress T cell activation, and is targeted by ROS induced by NCF1 in antigen-presenting cells (APCs).

We performed Bayesian network meta-analysis (NMA) to suggest frontline treatments for patients with high PD-L1 expression (at least 50%). A total of 5,237 patients from 22 studies were included in this NMA. In terms of progression-free survival, immune checkpoint inhibitors (ICIs) plus bevacizumab plus chemotherapy had the highest surface under the cumulative ranking curve (SUCRA) value (98.1%), followed by ICI plus chemotherapy (82.9%). In terms of overall survival (OS), dual immunotherapy plus chemotherapy had the highest SUCRA value (79.1%), followed by ICI plus bevacizumab plus chemotherapy (73.4%). However, there was no significant difference of survival outcomes among treatment regimens combined with immunotherapy. Moreover, ICI plus chemotherapy failed to reveal a significant OS superiority to ICI monotherapy (hazard ratio = 0.978, 95% credible internal: 0.771-1.259). In conclusion, this NMA indicates that ICI plus chemotherapy with/without bevacizumab might to be the best options in terms of OS for NSCLC with high PD-L1 expression. Considering there was no significant difference of survival outcomes among treatment regimens incorporating immunotherapy and ICI plus chemotherapy failed to show significant survival benefits over ICI monotherapy, however, ICI monotherapy may be reasonable as first-line treatment for advanced NSCLC with high PD-L1 expression and no targetable aberrations.

Background: The phase III KEYNOTE-604 study confirmed the benefit of pembrolizumab combined with chemotherapy in the first-line treatment of extensive-stage small-cell lung cancer(ES-SCLC). Intergrated the clinical benefits of pembrolizumab and its high cost into account, this study aim to assess the cost-effectiveness of adding pembrolizumab to standard first-line etoposide-platinum (EP) for patients with ES-SCLC from the the US payer perspective. Methods: A Markov model was developed to compared the costs and quality-adjusted life-years (QALYs) of pembrolizumab plus EP and placebo plus EP over a 10-year time horizon. Clinical efficacy, treatment utilization and safety data were pooled from the KEYNOTE-604 trial. Utilities were obtained from published resources. Costs were mainly collected from Medicare in 2020. Sensitivity analyses were performed to examined the robustness of our model. Results: Adding pembrolizumab to standard first-line EP, resulted in better effectiveness than the use of EP alone for ES-SCLC by 0.22 QALYs. Pembrolizumab plus EP was dominated economically by placebo plus EP, leading to an incremental cost-effectiveness ratio(ICER) of $334,373/ QALY. Deterministic sensitivity analyses indicated that the uncertainty in model parameters exerts no substantial effect on our results. Probability sensitivity analysis indicated that probabilities for pembrolizumab plus EP being cost-effective within a wide rang of willingness to pay were modest. Conclusion: From the US payer perspective, the first-line treatment for ES-SCLC with pembrolizumab plus EP was not cost-effective compare with placebo plus EP. Although pembrolizumab combination chemotherapy was beneficial to the survival of ES-SCLC, price reduction may be the necessary measure to improve its cost-effectiveness.

The gastrointestinal tract is colonized by trillions of different microorganisms, named the gut microbiota, which is key to degrade undigested food such as dietary fibers. The fermentation of these food components leads to the production of short-chain fatty acids (SCFA) acetate, propionate, and butyrate, which exploit several beneficial roles for the host’s health. Their production and absorption happen in different ways in the human intestine and depend on the type of dietary fiber reaching the gut and the microorganisms involved in the fermentation. The supplementation of SCFAs, mostly butyrate, in treating gastrointestinal, metabolic, cardiovascular, and gut-brain-related diseases has been reported in the medical literature. This review aims to give an overview of the production and absorption dynamics of acetate, propionate, and butyrate in the human gut, with a final focus on the role played by these SCFAs on gastrointestinal and metabolic health and the present therapeutic implications.

Chickpea is an essential legume, a staple food in many cultures and contains nutrients with potential health benefits. The chickpea water (CPW) leached out after cooking is usually discarded, which may potentially have significant anti-cancer and other health beneficial properties. This study compared the in-vitro bioactivity of CPW with chickpea polyphenol extract (CPPE) to evaluate its impact on pathways of colorectal cancer progression and development. Morphological observation by APOPercentage, cell viability detection using a cytotoxic assay and cell migration-scratch assay points to measure rate of metastasis were employed. Overall antioxidant activity of CPW and CPPE were measured using ABTS and DPPH free-radical assays. At 50 µg/mL concentration and above, both CPW and CPPE extracts significantly reduce cell viability in HT-29 colon cancer cell lines (p < 0.05). Moreover, a quantitative analysis of the extent of apoptosis demonstrated that at 250 and 500 μg/mL concentrations, both extracts induced significant apoptosis compared to the untreated control. Meanwhile, the cell migration scratch area decreases by 34.42% and 15.27% when treated with CPW and CPPE, respectively. In summary, CPW demonstrated comparable in vitro anti-cancer properties and antioxidant activity in colorectal cancer cells to CPPE. Further, in vivo studies are warranted to evaluate the physiological bioactivity of CPW and CPPE in targeting pathways of cancer development and progression

Metastases cause high mortality in several cancers and immunotherapies are expected to be effective in the prevention and treatment of metastatic disease. However, only a minority of patients benefit from immunotherapies. This creates a need for novel therapies that are efficacious regardless of the cancer types and metastatic environments they are growing in. Preclinical immuno-oncology models for studying metastases have long been limited to syngeneic or carcinogenesis-inducible models that have murine cancer and immune cells. However, the translational power of these models has been questioned. Interactions between tumor and immune cells are often species-specific and regulated by different cytokines in mice and humans. For increased translational power, mice engrafted with functional parts of human immune system have been developed. These humanized mice are utilized to advance understanding the role of immune cells in the metastatic process, but increasingly also to study the efficacy and safety of novel immunotherapies. From these aspects, this review will discuss the role of immune cells in the metastatic process and the utility of humanized mouse models in immuno-oncology research for metastatic cancers, covering several models from the perspective of efficacy and safety of immunotherapies.

Sports video analysis is an interesting and emerging field in the domain of computer vision. It has become a very popular subject among scholars all over the world in the last decade due to the need of automated classification of events such as offsides, in/out situations, goals and so on. The most important problem in sports video analysis is detection and tracking of ball and players. Extraction of court lines is also another important problem since it is necessary in the classification of aforementioned events. In this study, considering some of the previous work on the subject, we develop a method for tracking the ball and players in tennis videos where the camera position and orientation is supposed fixed.

We have carried out a systematic review of the scientific literature published on PM and, more specifically, on its presence in fish and seafood of interest to the population from Mediterranean area. Given its preference and wide acceptability in the scientific community, we followed the PRISMA. The potential functional and clinical toxicity in humans due to MP in fish must be considered by the chemical composition of the microplastics the presence of PM and its additives, associated contaminants and pathogens in fish and shellfish, as well as the possible effects on human health, requires improving legislation on evaluation and providing a basis for consumer protection.

Analysing the human body by direct observation can lead to misinterpretation of underlying trends, whereas in vitro organ models facilitate their understanding. Likewise, in vitro organ models serve as valuable tools for assessing the toxicity of compounds. However, none of the existing models had the features we considered critical for toxicity assessment, so we developed an in vitro liver model for toxicity assessment. We used four different types of primary liver cells: Hepatic sinusoidal endothelial cells, hepatic stellate cells, Kupffer cells and hepatocytes. We cultured them in different combinations of composition and volume of cell medium, hepatocyte proportion of total cells, and addition of extracellular matrix. We added rifampicin, ibuprofen and 5-fluorouracil to this model and observed the microanatomy and physiology changes for a week with preclinical and clinical instruments. Among the different model configurations, we selected the feature combination of the in vitro model that had similar biomarker values to those measured by the clinical instruments used in clinical diagnostics. When we exposed the selected model configuration to rifampicin, ibuprofen and 5-fluorouracil, the viability of Kupffer cells and liver sinusoidal endothelial cells was significantly lower than in the untreated samples. In contrast, we observed negligible viability of hepatocytes compared to the untreated samples. We have built an in vitro liver model that resembles the liver microenvironment and we have analysed it with clinical instrumentation to facilitate the data translation. In this sense, we have established that Kupffer and LSEC cells are suitable candidates for the search for clinical diagnostic markers of liver function.

Atopic dermatitis (AD) is a chronic inflammatory disorder presenting a dysregulated immune response and derangement of the epidermal barrier lipids. The Th2-type cytokines interleukin IL-4 and IL-13 play a prominent role in AD by activating the Janus Kinase/Signal Transduction and Activator of Transcription (JAK/STAT) intracellular signal axis. This study aimed to investigate the role of JAK/STAT in the lipid perturbations induced by Th2 signaling in 3D-epidermal equivalents. We used tofacitinib, a low-molecular-mass JAK inhibitor, to screen for the JAK/STAT-mediated deregulation of lipid metabolism. Th2 cytokines decreased the expression of elongases 1, 3, and 4, and serine-palmitoyl-transferase and increased that of sphingolipid delta(4)-desaturase, and carbonic anhydrase 2. Th2 cytokines inhibited the synthesis of palmitate and caused a depletion of triglycerides. This depletion was associated with altered PC profiles and fatty acid (FA) metabolism. Overall, the ceramide profiles were minimally affected. Except for most sphingolipids and very long chain FAs, the effects of Th2 on lipid pathways were reversed by co-treatment with tofacitinib. An increase in the mRNA levels of CPT1A and ACAT1, reduced by tofacitinib, suggests that Th2 cytokines promote FA beta-oxidation. In conclusion, pharmacological inhibition of JAK/STAT activation prevents the lipid disruption caused by halted homeostasis of FA metabolism.

Addressing the pressing challenge of global warming, reducing greenhouse gas emissions in the transportation sector is a critical imperative. Battery and fuel-cell electric vehicles have emerged as promising solutions for curbing emissions in this sector. In this study, we conducted a comprehensive life cycle assessment (LCA) for typical passenger vehicles, heavy duty trucks and city buses using either proton-exchange membrane fuel cells or Li-ion batteries with different cell chemistries. To ensure accuracy, we supplemented existing studies with data from the literature, particularly for the recycling phase, as database limitations were encountered. Our results highlight that fuel cell and battery systems exhibit large emissions in the production phase. Recycling can significantly offset some of these emissions, but a comparison of the technologies examined revealed considerable differences. Overall, battery electric vehicles consistently outperform fuel cell electric vehicles regarding absolute greenhouse gas emissions. Hence, we recommend prioritizing battery electric over fuel cell vehicles. However, deploying fuel cell electric vehicles could become attractive in a hydrogen economy scenario where other factors, e. g. the conversion and storage of surplus renewable electricity via electrolysis, become important.

The incidence of human papillomavirus (HPV)-associated oropharyngeal squamous cell carcinoma (OPSCC) is rising in the West, but little is known in Asia. This study elucidated changes in the incidence and HPV-positive portion of OPSCC in Hong Kong. Data from population-based cancer registry were used to analyze the incidence of OPSCC in associate with other head and neck cancers. Archived tumour tissues were tested for HPV. From 1986 to 2020, there was a marked decrease in the incidence of nasopharyngeal and laryngeal cancers, but a persistent increase in OPSCC from 36 cases in 1986 to 116 cases in 2020. The average positive rate for high-risk HPV was 36.1% (112/310) among OPSCC diagnosed in 2010-2020. The HPV positive rate in recent years was significantly higher than earlier cases (tonsil SCC: 64.7% (55/85) in 2016-2020 vs. 40.4% (19/47) in 2010-2015, P = 0.007). Patients with HPV-positive tonsil cancers were significantly younger than those negative (mean [SD]: 58.9 [9.9] vs. 64.3 [13.3] years, P = 0.006), but no significant difference between genders. A persistent increase in the incidence of oropharyngeal cancer over the last few decades was observed in Hong Kong, which can be explained by the remarkable increase in HPV-positive tonsil cancers.

We have previously developed several successful decellularization strategies yielding porcine cardiac extracellular matrices (pcECMs), which exhibit tissue-specific bioactivity and bioinductive capacity when cultured with various pluri- and multipotent stem cells. Here, we studied the tissue-specific effects of the pcECM on seeded human mesenchymal stem cells (hMSCs) phenotype using reverse transcribed quantitative polymerase chain reaction (RT-qPCR) arrays for cardio-vascular related genes. We further corroborated interesting findings at the protein level (flow cytometry and immunological stains) as well as bioinformatically using several mRNA sequencing and protein databases of normal and pathologic adult tissue expression, as well as during human embryonic organogenesis. We discovered that upon seeding of human mesenchymal stem cells (hMSCs) on the pcECM they displayed partial MET toward endothelial phenotypes (CD31+) and morphologies, which were preceded by an early spike (~day 3 onward after seeding) in HAND2 expression at both the mRNA and protein levels compared to plate controls. CRISPR-Cas9 knockout (KO) of HAND2 and its associated antisense long non-coding RNA (HAND2-AS1) regulatory region resulted in proliferation arrest, hypertrophy, and senescent-like morphology. Bioinformatic analyses revealed that HAND2 and HAND2-AS1 are highly correlated in expression, are expressed in many different tissue types albeit at distinct yet tightly regulated expression levels. Deviation (down or up regulation) from these basal tissue expression levels are associated with a long list of pathologies. We thus suggest that HAND2 expression levels may finetune cell plasticity possibly affecting senescence and mesenchymal-to-epithelial transition states, through yet unknown mechanisms. Targeting this pathway may represent a promising new therapeutic approach for a wide range of diseases, including cancer, degenerative disorders, and aging. Nevertheless, further investigations are required to better understand the molecular players involved, potential inducers and inhibitors of this pathway, and eventually potential therapeutic applications.

All living cells maintain a charge distribution across their cell membrane (membrane potential) by carefully controlled ion fluxes. These bioelectric signals regulate cell behavior (such as migration, proliferation, differentiation) as well as higher-level tissue and organ patterning. Thus, voltage gradients represent an important parameter for diagnostics as well as a promising target for therapeutic interventions in birth defects, injury, and cancer. However, despite much progress in cell and molecular biology, little is known about bioelectric states in human stem cells. Here, we present simple methods to simultaneously track ion dynamics, membrane voltage, cell morphology, and cell activity (pH and ROS), using fluorescent reporter dyes in living human neurons derived from induced neural stem cells (hiNSC). We developed and tested functional protocols for manipulating ion fluxes, membrane potential, and cell activity, and tracking neural responses to wounding and re-innervation in vitro. Finally, using morphology sensor, we tested and quantified the ability of physiological actuators (neurotransmitters and pH) to manipulate nerve wound re-innervation. These methods are not specific to a particular cell type and should be broadly applicable to the study of bioelectrical controls across a wide range of combinations of models and endpoints.

There is a strong anticipated future for human pluripotent stem cell-derived hepatocytes (hiPS-HEP), but so far their use has been limited due to insufficient functionality. We investigated the potential of hiPS-HEP as an in vitro model for metabolic diseases by combining transcriptomics with multiple functional assays. The transcriptomics analysis revealed that 86% of the genes were expressed at similar levels in hiPS-HEP as in human primary hepatocytes (hphep). Adult characteristics of the hiPS-HEP were confirmed by the presence of important hepatocyte features, e.g. Albumin secretion and expression of major drug metabolizing genes. Normal energy metabolism is crucial for modeling metabolic diseases, and both transcriptomics data and functional assays showed that hiPS-HEP were similar to hphep regarding uptake of glucose, LDL and fatty acids. Importantly, the inflammatory state of the hiPS-HEP was low under standard conditions, but in response to lipid accumulation and ER stress the inflammation marker TNFα was upregulated. Furthermore, hiPS-HEP could be co-cultured with primary hepatic stellate cells both in 2D and in 3D spheroids, paving the way for using these co-cultures for modeling NASH. Taken together, hiPS-HEP have the potential to serve as an in vitro model for metabolic diseases. Furthermore, differently expressed genes identified in this study can serve as targets for future improvements of the hiPS-HEP.

Multiple unique environmental factors such as space radiation and microgravity (µG) pose a serious threat to human gene stability during space travel. Recently, we reported that simultaneous exposure of human fibroblasts to simulated µG and radiation results in more chromosomal aberrations than in cells exposed to radiation alone. However, the mechanisms behind this remain unknown. The purpose of this study was thus to obtain comprehensive data on gene expression using a 3D clinostat synchronized to a carbon (C)-ion or X-ray irradiation system. Human fibroblasts (1BR-hTERT) were maintained under standing or rotating conditions for 3 or 24 h after synchronized C-ion or X-ray irradiation at 1 Gy as part of a total culture time of 2 days. Among 57,773 genes analyzed with RNA sequencing, we focused particularly on the expression of 82 cell cycle-related genes after exposure to the radiation and simulated µG. The expression of cell cycle-suppressing genes (ABL1 and CDKN1A) decreased and that of cell cycle-promoting genes (MKI67, KPNA2, CCNB1, STMN1, and MCM4) increased after C-ion irradiation under µG. The cell cycle may pass through the G1/S and G2 checkpoints with DNA damage due to the combined effects of C-ions and µG, suggesting that increased genomic instability might occur in space.