Starvation of photoreceptors induced by reduced dysregulated ocular blood flow is proposed as a common pathway for the pathogenesis of retinitis pigmentosa (RP). The current study evaluated the safety and efficacy of ophthalmic nerve stimulation (ONS) as an ocular blood flow neuromodulator, combined with ascorbic acid (AA) as a potent anti-oxidant in the treatment of RP. Additionally, the initial characteristics of rod responders were identified. Forty participants with simple, non-syndromic RP presented with a characteristic triad of RP (the bone spicule pigmentation, attenuation of retinal blood vessels, and waxy optic disc pallor), were en-rolled in a prospective open-label single-armed interventional study. The severity of the disease was clinically graded into six stages. Patients with an established diagnosis of RP; aged ≥ 4 years, with best corrected visual acuity (BCVA) ≥ 20/400 were included. All participants were daily treated with bilateral ONS sessions combined with intravenous administration of AA for two weeks. The primary efficiency endpoint was 6 months’ changes in scotopic vision as measured by a 10-item, 100-point, Low Luminance Questionnaire-10 (LLQ-10). The secondary efficiency points included best corrected visual acuity (BCVA) and contrast sensitivity. Rod responders were defined by ≥ 25 points increment of LLQ-10 score at 6 months after treatment. The results showed that ONS combined with AA treatment significantly improved low luminance vision, BCVA, and contrast sensitivity in patients with RP (p≤ 0.05). At 6-month visit, twenty-four (60%) patients were identified as rod responders and 16 (40%) patients were rod-non-responders. The mean change in LLQ-10 score was (46.35 ±16.81) in rod responders versus (4.9 ± 7.6) in non-responders (p < 0.0001). A clinically significant improvement of BCVA (≥0.2 logMAR) and contrast sensitivity (≥0.3 log unit) were demonstrated in 50% of the right eyes of rod responders. No serious adverse effects were reported and headache in 5 patients (12.5%) was the only en-countered side effect in this study. In conclusion, ocular neuromodulation is a safe therapeutic strategy for RP. It significantly improved night vision, BCVA, and contrast sensitivity. Determinants of rod responders include a shorter duration of night blindness, an earlier stage of the disease, and a relatively thicker ganglion cell layer at baseline. Additionally, two therapeutic scenarios were recognized; an early disease-modifying intervention that restores night vision and reverses the disease process and a late cone rescue intervention that improves/maintains central vision.

Background/ObjectivesMental health and substance use disorders (MHD, SUD) affect cardiac allograft and VAD recipients and impact their quality of life and compliance. Limited research on MHDs and SUDs in transplant and MCS candidates and recipients. This study compares the incidence of MHDs and SUDs in transplant list, VAD, and post-transplant patients with that in heart failure patients. MethodsStudy cohorts were derived from the TriNetX using ICD-10 codes. Differences in incidence were examined using the log-rank test. Adults with mental health disorders before the window of time were excluded. Propensity score matching was performed using TriNetX to balance demographic and medical comorbidities. Statistical significance was set at p<0.05. All comparisons were made between propensity-matched cohorts. ResultsTransplant waitlist patients showed a statistically significant increase in the incidence of anxiety, panic disorder, adjustment disorder, depression, mood disorder, alcohol use disorder, and eating disorder. Post-transplant patients showed a statistically significant increase in the incidence of depression and opioid use compared to the heart failure population. VAD patients showed a statistically significant increase in the incidence of depression and a statistically significant decrease in panic disorder and anxiety. ConclusionsThe results pave the pathway for further investigations on prevention and coping strategies because deterioration of mental health will significantly impact compliance with medications as well as patient survival and quality of life. The use of opioids for pain management in the early postoperative period should be further investigated to assess its impact on long-term substance use and addiction. .

Background and Objectives: Age-related macular degeneration (AMD) is one of the major causes of central vision loss in the older age group and its dry form accounts for the majority of cases. Although several causes and mechanisms for the development and progression of AMD have previously been identified, the pathogenesis of this complex disease is still not entirely understood. As the inflammation and involvement of the immune system are strongly suggested to have a central role to promote the degenerative process and to stimulate the onset of complications, we aimed to analyze the prevalence of serum anti-retinal (ARA) and anti-endothelial cell antibodies (AECA) in patients with dry AMD and to determine their relationship with the clinical features of the disease, notably area of geographic atrophy (GA). Materials and Methods: We enrolled 41 patients with dry AMD and 50 sex- and age-matched healthy controls without AMD. The presence of ARA was determined by indirect immunofluorescence using monkey retina as an antigen substrate, while the presence of AECA was determined using cultivated human umbilical vein endothelial cells and primate skeletal muscle. Results: ARA were detected 36 (87.8%) AMD patients (titers range from 1:20 to 1:320) and in 16 (39.0%) (titers range from 1:10 to 1:40) of controls (p=0.0000). Twenty of the 41 patients (48.8%) were positive for AECA, while in a control group AECA were present only in 5 sera (10.0%). The titers of AECA in AMD patients ranged from 1:100 to 1:1000 and in the control group the AECA titers were 1:100 (p=0.0001). There were no significant correlations between the presence of AECA and disease activity. Conclusions: This study provides evidence for the possible involvement of an autoimmune process against retina and retinal vessel antigens in the pathogenesis of geographic atrophy associated with dry AMD.

Health-Related Quality of Life (HRQoL) encompasses the comprehensive evaluation of an indi-vidual's health and well-being across multiple dimensions. Mindfulness, recognized as a scientifi-cally supported strategy for anxiety management, plays a role in enhancing both physical and mental health. The Gut-Brain Axis (GBA) serves as the bidirectional communication link between the gastrointestinal system and the central nervous system. This study aims to explore the associa-tion between Mindfulness and factors influencing the GBA in both healthy individuals and those with Inflammatory Bowel Diseases (IBD). A cross-sectional investigation involved 338 adults, in-cluding 50 IBD patients, utilizing validated Greek scales for Mindfulness (MAAS-15), Mediterra-nean Diet (14-MEDAS), and HRQoL (EQ-5D-5L). The questionnaire gathered demographic, an-thropometric, and lifestyle data. Among healthy participants, EQ-5D-5L showed a moderate cor-relation with the MAAS-15 scale (r=0.389, p

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

Abstract: Peptide pools composed of short amino acid sequences have proven to be versatile tools in various research areas and clinical applications. They are powerful tools for epitope mapping, immunotherapy, and vaccine development. Their importance lies in their ability to map complex protein structures, enabling a comprehensive understanding of immune responses and facilitating the identification of potential therapeutic agents. The application of peptide pools also extends to the field of personalized medicine, offering tailored solutions for diseases such as cancer and infectious diseases. Peptide pools are complex mixtures of immunostimulatory antigens primarily intended for T-cell stimulation. They are commercially available in many different compositions and variants. However, unlike other reagents that consist of only one or a few compounds, peptide pools are highly complex products with limited stability. This makes their quality control a major challenge. Quantitative peptide analysis usually requires sophisticated methods, in most cases isotope-labeled standards and reference materials. None of these are routinely available for these products. Synthesis and purification of all labeled peptides might be required. Usually, this approach would be prohibitively laborious and expensive. Therefore, an approach is needed to provide a practical and feasible method for quality control of peptide pools. With insufficient quality control, the use of such products could lead to incorrect experimental results, which would worsen the well-known reproducibility crisis in the biomedical sciences. Here we propose the use of ultra-high performance liquid chromatography (UHPLC) with two detectors, a standard UV detector (at 214 nm) for quantitative analysis and a high-resolution mass spectrometer (HRMS) for identity confirmation. To be cost-efficient and fast, quantification and identification are performed in one chromatographic run. An optimized protocol is shown, and different peak integration methods are compared and discussed. This work was performed using a peptide pool known as CEF, which consists of 32 peptides derived from cytomegalovirus (CMV), Epstein-Barr virus (EBV) and influenza virus, ranging from 8 to 12 amino acids in length.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Many drastic actions are taken by cocaine users for the sake of experiencing high dopamine levels, which depends on iron for its synthesis. Dopamine depletion and iron deficiency are also involved in the symptoms of restless leg syndrome (RLS). The intersecting biochemical pathways of cocaine use, iron deficiency, and RLS have not been adequately investigated. This case report reveals the successful treatment of a patient with these conditions. A 63-year-old male with a history of cocaine use disorder, insomnia, and RLS sought emergency care for suicidality. Upon admission, he was also found to be iron-deficient. He revealed that his RLS worsened when he attempted to abstain from cocaine. He also used alcohol to sustain the effects of cocaine when the cost of cocaine was too high. During hospitalization, his mood, cravings, and RLS were resolved with adjunctive iron supplementation as well as 300 mg of Wellbutrin. If iron-deficient, replenishment of adequate dopaminergic receptor density and function via supplementation may play an essential role in the prevention of cocaine use and cessation of cocaine withdrawal. Further research is warranted to validate these findings and understand the implications of iron supplementation in addiction medicine.

Although migraine belongs to the main causes of disability worldwide the mechanisms of its pathogenesis are poorly known, which is among the reasons that this disease is underdiagnosed and undertreated. As migraine diagnosis is based on the subjective assessment of symptoms, there is a need to establish objective markers of its occurrence and severity. Tryptophan (TRP) metabolism has been associated with the pathogenesis of neurological and psychiatric disorders. In the present work, we investigated an association between migraine and the urine concentration of TRP and its metabolites 5-hydroxyindoleacetic acid (5-HIAA), kynurenine (KYN), kynurenic acid (KYNA) and quinolinic acid (QA) in 21 low-frequency episodic migraine patients and 32 controls. Migraine patients displayed lower urinary levels of 5-HIAA and KYNA, but KYN and QA were enhanced as compared with the controls. Consequently, the patients were characterized by different values of the 5-HIAA/TRP, KYN/TRP, KYNA/KYN, and KYNA/QA ratios. Furthermore, urinary concentration of 5-HIAA was negatively correlated with Migraine Disability Assessment score, monthly migraine, and monthly headache days. A negative correlation between Patient Health Questionnaire 9 scores assessing depression. In conclusion, the urinary 5-HIAA level may be an easy-to-determine marker of migraine occurrence and severity and may contribute to the identification of migraine patients with depression.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

Multiple myeloma (MM) accounts for about 10 to 15% of all diagnosed hematologic malignancies and about 1-2% of all cancer cases. Approximately 80-90% of MM patients develop bone disease and the changes rarely regress. It is only possible to stop or slow their progression. A major role in bone destruction in MM is attributed to the Wnt signaling pathway, and its action can be modified by various types of interventions including training and diet. Therefore, the aim of this project was to evaluate the effects of a Nordic Walking (NW) training cycle and intermittent fasting (IF) on the levels of selected bone turnover markers associated with the Wnt pathway in patients with MM. Results from 35 patients divided into training (NW and IF NW) and non-training (IF and control) groups were included in the analysis. A 6-week training cycle involving 60-minute workouts 3 times a week was conducted. Body mass and composition and the levels of: vitamin D, calcium and phosphorus, beta2-microglobulin and albumin were examined before and after completion of training cycle. Markers of bone turnover were also determined: sclerostin (SOST), Dickkopf-related protein 1 (DKK-1), osteoprotegrin (OPG), osteopontin (OPN) and Tartrate-resistant acid phos-phatase 5b (TRACP 5b). There was no negative effect of IF or combined training and fasting on the nutritional status of the patients (the level of albumines was unchanged). Both training groups showed an increase in serum concentrations of the active metabolite of vitamin D (IF NW and NW: p=0.001 and p=0.022, re-spectively). The change in the concentration of this vitamin negatively correlated with the con-centration of TRACP 5b (r=-0.413, p=0.014). Evaluating the concentrations of markers related to bone turnover, a reduction in the concentrations of SOST (time: p=0.026, time vs. group: p=0.033) and TRACP 5b (time: p

Background: Mental capacity is a fundamental aspect that enables patients to fully par-ticipate in various healthcare procedures. To assist healthcare professionals (HCPs) in assessing patients' capacity, especially in the mental health field, several standardized tools have been developed. These tools include the MacArthur Competence Assessment Tool for Treatment (MacCAT-T), the MacArthur Competence Assessment Tool for Clinical Research (MacCAT-CR), and the Competence Assessment Tool for Psychiatric Advance Directives (CAT-PAD). The core dimensions explored by these tools include Understanding, Appreciation, Reasoning, and Expression of a choice. Objective: This meta-analysis aimed to investigate potential differences in deci-sion-making capacity within the healthcare context among groups of patients with bi-polar disorder (BD) and schizophrenia spectrum disorder (SSD). Methods: A systematic search was conducted on Medline/Pubmed, and Scopus. Addi-tionally, Google Scholar was manually inspected, and a manual search of emerging re-views and reference lists of the retrieved papers was performed. Eligible studies were specifically cross-sectional, utilizing standardized assessment tools, and involving pa-tients diagnosed with BD and SSD. Data from the studies were independently extracted and pooled using random-effect models. Hedges g was used as a measure for outcomes. Results: Six studies were identified, with three studies using the MacCAT-CR, two studies the MacCAT-T, and one the CAT-PAD. The participants included 189 individuals with BD and 324 individuals with SSD. The meta-analysis revealed that patients with BD performed slightly better, and the difference was statistically significant, compared to patients with SSD, particularly in the domain of Appreciation (ES=0.23, 95% CI: 0.01 to 0.04, p=0.037). There was no statistically significant difference between the two groups for Understanding (ES=0.09, 95% CI: - 0.10 to 0.27, p=0.352), Reasoning (ES=0.18, 95% CI: - 0.12 to 0.47, p=0.074), and Expression of a choice (ES = 0.23, 95% CI: - 0.01 to 0.48, p=0.60). In the sensitivity analysis, furthermore, when considering only studies involving patients in symptomatic remission, the difference for Appreciation also resulted in non-significant (ES=0.21, 95% CI: -0.04 to 0.46, p=0.102). (ES=0.21, 95% CI: -0.04 to 0.46, p=0.102). Conclusions: These findings indicate that there are no significant differences between patients with BD and SSD during remission phases, while differences are minimal during acute phases. The usefulness of standardized assessment of capacity at any stage of the illness should be considered, both for diagnostic-therapeutic phases and for research and advance directives. Further studies are necessary to understand the reasons for the overlap in capacity between the two diagnostic categories compared in this study.

Lower limb exoskeletons have the potential to reduce the prevalence of work-related musculoskeletal disorders; however, they often lack user-oriented control strategies. Human-in-the-loop (HITL) controls can adapt an exoskeleton’s assistance in real-time, to optimize the user-exoskeleton interaction. This study presents a HITL control for a knee exoskeleton to minimize the users’ physical effort, a parameter innovatively evaluated by their interaction torque with the exoskeleton (a muscular effort indicator) and metabolic cost. This work innovates by estimating the user’s metabolic cost within the HITL control through a machine-learning model. The regression model was able to estimate the metabolic cost, in real-time, with a root-mean-squared error of 0.66 W/kg and a mean absolute percentage error of 26%, making faster (10s) and less noisy estimations than a respirometer (K5, Cosmed) device. The HITL reduced the user’s metabolic cost and interaction torque by 7.3% and 32.3%, respectively, when compared to a zero-torque control. The developed HITL control surpassed both a non-exoskeleton and a zero-torque condition regarding the user’s physical effort, even for a simple task such as slow walking. Furthermore, the user-specific control enabled a lower metabolic cost than the non-user-specific assistance. This proof-of-concept demonstrated the potential for HITL controls in assisted working.

Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

In this case series, we examine the impact of the Titan-iR Pro® deep spectrum biotherapeutic device on brain function in healthy individuals. Here we present 15 participants, aged 26-68 years, who enrolled in this open-label study, designed to assess the effect of a single 15-minute course of deep spectrum biotherapy on brain function. Although symptom-free upon enrollment, participants had diverse medical histories with some displaying early signs of cognitive decline. As part of the evaluation, all participants engaged in electroencephalogram (EEG) recording sessions that focused on assessing event-related potential (ERP) evaluations, including audio P300 amplitudes and latencies (speeds), neurocognitive testing, and physical reaction times. Following the Titan-iR Pro intervention an improvement in EEG-based cognitive markers was observed. These results underscore the importance of further investigation into the potential of advanced and deep spectrum photobiomodulation in the prevention and treatment of cognitive decline and other neurological disorders.

During choriogenesis in insects, chorion (eggshell) is formed by surrounding follicular epithelial cells in ovarioles. However, the regulatory endocrine factor(s) activating choriogenesis and the chemical components on eggshell deserve further exploration. In two representative Coleopterans, a Coccinellid Henosepilachna vigintioctopunctata and a Chrysomelid Leptinotarsa decemlineata, genes encoding the 20-hydroxyecdysone (20E) receptor heterodimer, ecdysone receptor (EcR) and ultraspiracle (USP), and two chitin biosynthesis enzymes UDP-N-acetylglucosamine pyrophosphorylase (UAP) and chitin synthase (ChS1), were highly expressed in ovaries of the young females. RNA interference (RNAi)-aided knockdown of either HvEcR or Hvusp in H. vigintioctopunctata inhibited oviposition, suppressed the expression of HvChS1, and lessened the positive signal of Calcofluor staining on the chorions, which suggests the reduction of a chitin-like substance (CLS) deposited on eggshells. Similarly, RNAi of LdEcR or Ldusp in L. decemlineata constrained oviposition, decreased the expression of LdUAP1 and LdChS1, and declined CLS contents in the resultant ovaries. Knockdown of LdUAP1 or LdChS1 caused similar defective phenotypes, i.e., reduced oviposition and CLS contents in the L. decemlineata ovaries. These results, for the first time, indicate that 20E signaling activates choriogenesis in two Coleopteran species. Moreover, our findings propose the deposition of a CLS on the chorions.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The process of sexual reproduction in eukaryotes starts when gametes from two different sexes encounter each other. Paramecium, a unicellular eukaryote, undergoes conjugation and uses a gametic nucleus to enter the sexual reproductive process. The molecules responsible for recognizing mating partners, hypothetically called mating-type substances, are still unclear. We have identified an O3-type mating substance polypeptide and its gene sequence using protein chemistry, molecular genetics, immunofluorescence, RNA inter-ference, and microinjection. The O3-type substance is a polypeptide found in the ciliary membranes, located from the head to the ventral side of cells. The O3-type substance has a kinase-like domain in its N-terminal part located outside the cell and four EF-hand motifs that bind calcium ions in its C-terminal part located inside the cell. RNA interference and immunofluorescence revealed that this polypeptide positively correlated with the expression of mating reactivity. Microinjection of an expression vector incorporating the O3Pc-MSP gene induced additional O3 mating type in the recipient clones of different mating types or syngen. Phylogenetic analysis indicates this gene is widely present in eukaryotes and exhibits high homology among closely related species. The O3Pc-MSP gene had nine silent mutations compared to the complementary mating type of the E3 homologue gene.

The COVID-19-medical emergency has ended worldwide, yet there is still a need to evaluate the psychological impact of these years of unprecedented changes on students’ life. Methods: This study aims to assess and compare COVID-19-related stressors (Relationships-and-Academic-Life; Isolation; Fear-of-Contagion) and psychophysical symptoms reported by university students in April-2020, April 2021, and April 2022. The predictive role of COVID-19-related stressors on psychophysical symptoms within each time was also tested. Data were collected among 637 university students in April-2020 (n = 197), April-2021 (n = 200), April-2022 (n = 240). Results: In April-2022, perceived Isolation and Fear-of-Contagion decreased from the peak registered in April-2021, but stress related to Relationships-and-Academic-Life remained noteworthy high. A sharp and ongoing increase in psychophysical symptoms was found, with more than 50% of students reporting clinical levels of Sleep-Disorders, Depression, Psychoticism, and Interpersonal-Sensitivity. In April-2022, students still perceiving stress related to Relationships-and-Academic-Life and Isolation were at risk for Anxiety, Somatization, and Sleep-Disorders, while those still perceiving stress related to Fear-of-Contagion were also at risk for Depression, Obsessive-Compulsive, and Psychoticism. Conclusion: Findings emphasized the long-lasting detrimental effects of the COVID-19-related stress. Interventions must pinpoint the complex post-pandemic adjustment process and their effects on university students' psychophysical health.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Introduction: Substance-induced psychotic disorder (SIPD) is a mental health condition linked to the use of a psychotropic substance whose pathogenesis has not been totally clarified. The present retrospective observational study has the objective to identify differences in clinical features and peripheral biomarkers in SIPD patients according to the main substance of abuse.Methods: A total sample of 218 patients was divided in 3 groups according to the type of consumed substance: alcohol, cannabis and psychostimulants. The 3 groups were compared for continuous variables by one-way analyses of variance (ANOVAs) and for qualitative variables by χ² tests. After removing alcohol-induced psychotic disorder group, the same analyses were repeated. Statistically significant variables from these latter analyses were included in a binary logistic regression model to confirm their reliability as predictors for cannabis- or psychostimulants-induced psychotic disorders. Results: Psychotic cannabis abusers were younger (p<0.01) and had an earlier age at onset (p<0.01). On the contrary, alcohol consumers resulted to have a longer duration of illness (p<0.01), more previous hospitalizations (p=0.04), more frequent medical comorbidity (p<0.01), higher mean Modified Sad Person Scale scores (p<0.01). Finally, psychostimulant abusers had more frequently a lifetime history of poly-substance use disorders (p<0.01). Binary logistic regression revealed that higher mean Brief Psychiatric Rating Scale scores (p<0.01) higher sodium (p=0.012) and haemoglobin(p=0.040) plasma levels were predictors of cannabis misuse in SIPD patients.Conclusions: Different clinical factors and biochemical parameters con be associated to SIPD according to the main substance of abuse, thus requiring a specific management by clinicians.

Assessment of health-related quality of life (HRQoL) after pediatric traumatic brain injury (TBI) has been limited in children and adolescents due to a lack of disease-specific instruments. To fill this gap, the Quality of Life after Traumatic Brain Injury for Children and Adolescents (QOLIBRI-KID/ADO) was developed for the German-speaking population. Reference values from a comparable general population are essential for comprehending the impact of TBI on health and well-being. This study examines the validity of the German QOLIBRI-KID/ADO in a general pediatric population in Germany and provides reference values for use in clinical practice. Overall, 1997 children and adolescents aged 8-17 years from the general population and 300 from the TBI population participated in the study. The questionnaire was tested for reliability and validity. A measurement invariance (MI) approach was used to assess the comparability of the HRQoL construct between both samples. Reference values were determined by percentile-based stratification according to factors that significantly influenced HRQoL in regression analyses. The QOLIBRI-KID/ADO demonstrated strong psychometric properties. The HRQoL construct was measured largely equivalently in both samples, and reference values could be provided. The QOLIBRI-KID/ADO was considered reliable and valid for assessing HRQoL in a general German-speaking pediatric population, allowing for clinically meaningful comparisons between general and TBI populations.

Currently, hepatitis B virus (HBV) core antibody (anti-HBc antibody) and HBV core-related antigen (HBcrAg) are widely used as serum markers for diagnosis based on the HBV core region. While anti-HBc is very significant for clinical diagnosis, the clinical significance of quantitative assay of anti-HBc antibody has been reevaluated with improvements in diagnostic performance, including its association with clinical stage and prediction of carcinogenesis and reactivation. In addition, concerning the new HBcrAg, a high-sensitivity assay method has recently been established, and its diagnostic significance, including the prediction of reactivation, is being reevaluated. On the other hand, the quantitative level of anti-HBc antibody expressed in different units among assay systems, complicating the interpretation of the results. However, it is difficult to standardize assay systems as they vary in advantages, and caution is needed in interpreting the assay results. In this review, the clinical usefulness and remaining problems of anti-HBc antibody and HBcrAg were summarized.

Cannabis use disorder (CUD) is a growing public health concern, with rising prevalence and significant impact on individuals across age groups. This systematic review examined pharmacological and psychosocial interventions for CUD among adolescents, young adults, transitioning adults, and older adults. Database searches were conducted for randomized controlled trials of CUD interventions reporting outcomes such as cannabis use, abstinence, withdrawal symptoms, and treatment retention. In total, 53 studies were included. Pharmacological treatments such as cannabinoid agonists, gabapentin, and N-acetylcysteine demonstrated modest benefits predominantly in alleviating withdrawal and craving. Psychosocial approaches including motivational interviewing, cognitive behavioral therapy, and contingency management conferred greater abstinence and retention, either alone or combined with pharmacotherapy. However, age-specific efficacy remains unclear. Technology-based interventions represent promising alternatives to expand access and improve cost-effectiveness. In conclusion, cannabis disorders require expanded, affordable treatment tailored to individuals’ developmental stage. Further research should clarify the utility of harm reduction outcomes and establish age-specific best practices.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Despite extensive use of intravitreal anti-vascular endothelial growth factor (anti-VEGF) biologics for over a decade, neovascular age-related macular degeneration (nAMD) or choroidal neovascularization (CNV) continues to be a major cause of irreversible vision loss in developed countries. Many nAMD patients demonstrate persistent disease activity or experience declined responses over time despite anti-VEGF treatment. The underlying mechanisms of anti-VEGF resistance are poorly understood, and no effective treatment strategies are available to date. Here we review evidence from animal models and clinical studies that supports the roles of neovascular remodeling and arteriolar CNV formation in anti-VEGF resistance. Cholesterol dysregulation, inflammation, and ensuing macrophage activation are critically involved in arteriolar CNV formation and anti-VEGF resistance. Combination therapy by neutralizing VEGF and enhancing cholesterol removal from macrophages is a promising strategy to combat anti-VEGF resistance in CNV.

Pachychoroid neovasculopathy (PNV) is a pachychoroid-spectrum disease. As blood circulation throughout the choroid may be involved in PNV pathogenesis, analysis using ultra-wide-field (UWF) fundus imaging is crucial. We evaluated choroidal thickness after half-fluence photodynamic therapy (PDT) combined with intravitreal aflibercept injection for PNV using UWF swept-source optical coherence tomography. Seventeen eyes with PNV that underwent half-fluence PDT with adjuvant single intravitreal aflibercept injection were analyzed. To compare choroidal thicknesses in the central and peripheral choroids, we set subfields <3, <9, and 9–18 mm from the fovea. The <9- and 9–18-mm subfields were divided into four quadrants. Choroidal thickness in each subfield decreased significantly after half-fluence PDT (P<0.001); this reduction was more pronounced in the central area. We also investigated the relationship between the dominant side of the deep choroidal veins that harbor choroidal vein efflux from the macula. When choroidal thickness in the supratemporal and infratemporal 9x9-mm subfields were evaluated, the ratio of choroidal thickness reduction was not significantly different between the dominant and non-dominant sides. The dominant side was not associated with the extent of choroidal thickness reduction in PNV. In conclusion, half-fluence PDT caused thinning of the entire choroid, especially in the central area, in PNV.

The co-occurrence of substance use disorders (SUDs) and psychiatric conditions, often referred to as comorbidity or concurrent disorders, presents intricate challenges in both diagnosis and treatment. This comprehensive narrative review aims to synthesize and critically evaluate the existing evi-dence surrounding the management of individuals with comorbid SUDs and psychiatric disorders. Comorbidity in these domains carries profound implications for clinical practice, research, and policymaking, emphasizing the need for a holistic understanding of the intricate dynamics that arise when these conditions coexist. This review explores recent research findings, evidence-based guidelines, and emerging trends within the field, offering valuable insights for clinicians, re-searchers, and policymakers seeking to navigate the complex terrain of comorbidity in substance use and psychiatric disorders.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

This study investigated the impact of seven-strain probiotic supplementation on the frequency of T helper 17 (Th17) cells, regulatory T (T-reg) cells, Treg/Th17 ratio, and their gene expression in individuals with severe traumatic brain injury (STBI). Probiotics can influence the gut microbiota, modulate the immune response, and prevent or alleviate certain immune diseases. However, it is necessary to clarify whether probiotics can effectively impact Th cells in STBI patient. Despite the great attention to improving the immune system in most diseases, there is currently no accurate mechanism for the use of probiotics in diseases with damage to the head injury, which can be a basis for the use of probiotics. The primary objective of this study is to address this research gap. The present study was a randomized, double-blind, placebo-controlled trial that enrolled 48 STBI patients. They were treated with probiotics or placebo: 4 capsule/day for 14 days. The pre- and post-study evaluation included examining the frequency of Treg, Th17 cells, as well as the expression of associated immunological parameters (Foxp3 and RORγt) and Treg/Th17 ratio in both groups. No significant differences were found between the two groups in terms of subject characteristics (P>0.05). GCS scores at 14 days were significantly higher in the probiotic compared to the placebo group. The probiotic group showed a significant decrease in Th17 cell and RORγt gene expression (P = 0.022 and P< 0.001, respectively), a notable increase in T-reg and FoxP3 gene expression (P= 0.025 and P< 0.001, respectively), and a higher Treg/Th17 ratio compared to the placebo group. Our study provides promising evidence of the beneficial effects of seven-strain probiotic supplementation on Th cells in individuals with STBI.

This paper explores the multifaceted impact of biofilms, bacterial communities enveloped in extracellular polymeric substance (EPS). Biofilms play a dual role, acting as environmental champions and health threats. They interact with heavy metals, either causing pollution or aiding environmental remediation. Beneficial biofilms generate electricity and repair concrete cracks, offering sustainable solutions. Conversely, they contribute to infections, posing health risks. The study emphasizes the need for in-depth research, utilizing bibliographic methods to analyze global biofilm research. By identifying keywords, core countries, and pivotal organizations, the paper informs future investigations, offering insights into biofilm research evolution and practical applications.

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

This paper provides an exhaustive narrative review of third-generation antipsychotics (TGAs), focusing on aripiprazole, cariprazine, brexpiprazole, and lurasidone for managing substance-induced psychosis. It includes a comprehensive literature review to evaluate the efficacy and tolerability of these medications. The paper emphasizes the distinct challenges in treating substance-induced psychosis, which is a psychiatric condition triggered by the misuse or withdrawal of various substances, leading to symptoms like hallucinations and delusions, and is distinct from primary psychotic disorders. It underscores the potential of TGAs in addressing both psychotic symptoms and substance-related issues, while highlighting the need for more research on long-term effects and advocating for an integrated approach combining pharmacological and psychological interventions

Age-related macular degeneration (AMD) is an eye disease and the most common cause of vision loss in the Western World. In its advanced stage, AMD occurs in two clinically distinguished forms: dry and wet, but only wet AMD is treatable. However, the treatment based on repeated injections with vascular endothelial growth factor A (VEGFA) antagonists may at best stop the disease progression and prevent or delay vision loss but without an improvement of visual dysfunction. Moreover, it is a serious mental and financial burden for patients and may be linked with some complications. The recent first success of intravitreal gene therapy with ADVM-022, which transformed retinal cells to continuous production of aflibercept, a VEGF antagonist, after a single injection, has opened a revolutionary perspective in wet AMD treatment. Promising results obtained so far in other ongoing clinical trials support this perspective. In this narrative/hypothesis review, we present basic information on wet AMD pathogenesis and treatment, the idea of gene therapy in retinal diseases, update evidence on completed and ongoing clinical trials with gene therapy for wet AMD, and perspectives on the road to the clinic of “one and done” therapy for wet AMD to replace a lifetime of injections. Gene editing targeting the VEGFA gene is also presented as another gene therapy strategy to improve wet AMD management.

Background: Dual disorders (DD) involve the coexistence of substance use disorder (SUD) with another mental illness, often from psychotic and affective categories. This study explores the ef-fectiveness of brexpiprazole, a third-generation antipsychotic, in individuals diagnosed with schizophrenia spectrum disorder (DSM-V) and comorbid AUD/SUD (DSM-V). Methods: Eighteen enrolled patients underwent psychometric assessments at baseline and one month into brexpiprazole treatment administered at a mean dosage of 2 mg/day. Results: Brexpiprazole demonstrated significant reductions in psychopathological burden (PANSS total score, p=0.004), improved CGI total score (p=0.042), and decreased MOAS total score (p=0.012). Quality of life improved in SF-36 subscales (p<0.05). Substance craving reduction, though observed, did not reach statistical significance. Conclusions: This study provides initial evidence supporting brexpiprazole's efficacy and safety with positive effects on psychopathology and quality of life, emphasizing the need for tailored, comprehensive treatment strategies in this complex patient population.

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Nonmedical prescription stimulant use (NPSU) is an ongoing public health crisis in the United States. There exists, however, a dearth of research investigating specific childhood risk factors that may contribute to this illicit use. Adverse childhood experi-ences (ACEs) may be a significant risk factor to address in the prevention and treatment of NPSU, as research has provided evi-dence for increased substance use, potentially including prescription stimulant misuse, among individuals who have experienced trauma. A systematic review of the literature was conducted to gather and synthesize research articles specifically examining the relationship between nonmedical prescription stimulant use in adults and the experience of adverse childhood experiences (ACEs). Four studies met all inclusion criteria and were included in the review. The results demonstrated that nonmedical use of prescription stimulants in adults is significantly associated with ACEs, with a higher numerical count of ACEs associated with a greater likelihood of nonmedical prescription stimulant use. Gaps in the literature were identified, specifically noting a lack of information available regarding the relationship between ACEs and NPSU within gender- and racially-diverse populations. The findings have implications for informing interventions related to ACEs and the misuse of prescription stimulant medication in adults.

Opioid use disorder has increased in the world in recent years and Iran ranks first in terms of opium smoking in the world. In fact, opium smoking by traditional methods, in addition to dependence on morphine, is a behavioral addiction in Iran. The body position during opium smoking is usually non-standard and non-ergonomic. Over time, changes in muscle tissue, tendons and ligaments, and the connective tissue go from elasticity to neuromuscular plasticity. This study aims to compare sway back posture and musculoskeletal problems between opium smokers and non-drug users. In this comparative and cross-sectional study, 80 opium smokers were compared with 74 non-drug users in terms of sway angle (sway back posture), and musculoskeletal complaints (NORDIC questionnaire) and the association of possible risk factors was investigated. Data were analyzed by Kolmogorov-Smirnov, Correlation Coefficient and paired-t tests using SPSS version 23. There were significant differences between two groups in terms of sway back posture (P=0.007), and neck (<0.001), upper back (<0.001) and lower back (0.006) musculoskeletal complaints. Homelessness, the lifetime duration of opium smoking (in months), and the duration of daily opium smoking (in minutes) had significant correlation with sway back posture and musculoskeletal complaints. Homelessness was the strongest predictor and had strongest correlation. Overall, an increase in the duration of sitting in non-ergonomic positions could lead to increase in sway angle and sway back posture and increase in musculoskeletal complaints of neck, upper back and lower back due to the non-neutral posture of opium smoking. It seems that plasticity and structural and functional adaptations of the posture occurs due to opium smoking and further studies are recommended.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

The COVID-19 pandemic has led to a substantial revolution in the incorporation of digital solutions in healthcare. This systematic review investigates the enduring physical and psychological consequences individuals experience up to two years post-recovery. Additionally, it focuses on examining the influence of mHealth interventions on these effects. Significantly, 41.7% of survivors experience lingering symptoms that have not been addressed, while 14.1% encounter difficulties in returning to work. The presence of anxiety, compromised respiratory functioning, and persistent symptoms highlight the immediate requirement for specific therapies. Telehealth, particularly telerehabilitation, presents itself as a possible way to address these difficulties. The study thoroughly examines 10 studies encompassing 749 COVID-19 patients, investigating the efficacy of telerehabilitation therapies in addressing various health markers. Telerehabilitation-based breathing exercises yield substantial enhancements in functional performance, dyspnea, and overall well-being. The results emphasize the potential of telerehabilitation to have a favorable effect on patient outcomes, however more research is needed to strengthen the existing evidence basis as one of the most important limitation is the limited number of trials and the evaluation of varied therapies. The analysis highlights the significance of digital solutions in post-COVID care and calls for ongoing research to improve comprehension and implementation of telehealth interventions in a swiftly changing healthcare environment.

To investigate factors associated with the success of switching to faricimab for type 1 macular neovascularization (MNV) refractory to intravitreal aflibercept (IVA). This retrospective cohort study included patients with type 1 MNV who were switched to faricimab because they were refractory to IVA at two centers. The main outcome was an extension of the treatment interval after 6 months, and factors related to the success or failure of the extension and visual and anatomical outcomes were assessed. The analysis included 43 eyes of 43 patients. Extended dosing intervals of more than 2 weeks were identified in 14 eyes (32.6%). A short dosing interval before the switch, the absence of polypoidal lesions, and a thin central choroidal thickness before the switch were identified as factors involved in successful extension. For patients with refractory type 1 MNV, switching to faricimab is a safe and potential option to extend from existing dosing intervals.

Treatment with tumor-selective photosensitive substances, such as photodynamic therapy and photoimmunotherapy, has been reported to enable the visualization of tumor drug accumulation in real time and identify the required light irradiation dose by fluorescence imaging. However, fluorescence observation is difficult during treatments performed under gastrointestinal endoscopy because of the challenges associated with including the fluorescence filter in the camera part. To address this issue, this study developed a device that integrates a narrow camera and a laser diffuser to enable fluorescence imaging through a forceps port. This device was employed to demonstrate that a laser diffuser with an NIR fluorescence imaging sensor could be delivered through a 3.2-mm-diameter port. In addition, fluorescence images of Cetuximab-IR700 were successfully observed in two mice, and the fluorescence intensity confirmed that the fluorescence decayed within 330 s. This device is expected to have practical application as a tool to identify the optimal irradiation dose for tumor-selective photosensitive substances under endoscopy.

This study addresses the influence of working conditions on Work-Related Quality of Life (WRQOL) among Spanish healthcare professionals. The research seeks to elucidate the mediating roles of job engagement and burnout, and the moderating effects of resilience and self-efficacy, in this relationship. Methods: The study included 374 healthcare workers from Spain, encompassing physicians, nurses, and nursing assistants. It employed a methodological approach using validated instruments to assess psychosocial risks, work-life quality, job engagement, burnout, and resilience. Data were gathered through self-reported questionnaires. Results: Key findings indicate a negative association between working conditions and WRQOL. Job engagement and burnout significantly mediated this relationship, accounting for 19% to 33% of the variance in WRQOL. Notably, lack of support emerged as a strong negative factor for work-related quality of life. Additionally, resilience moderated the relationship between lack of support and burnout. Conclusions: The study concludes that improving working conditions could increase WRQOL. Interventions aimed at enhancing engagement and addressing burnout may be effective. The moderating role of resilience suggests that strategies to enhance resilience could also be beneficial. These findings hold significant implications for policy formulation and human resources planning in healthcare, emphasizing the need for enhanced workplace support and the development of resilience among health workers.

Humans are often exposed to various environmental contaminants, among which phthalates are prevalent due to their extensive use as plasticizers in various consumer goods. Di(2-ethylhexyl) phthalate (DEHP), a widely used phthalate, is recognized as an endocrine disruptor chemical (EDC). DEHP is reported to affect various organs. Few studies have addressed the effects of phthalates on bone. However, the effects of DEHP on the bone forming cells (osteoblasts) are obscure. The present study was peformed to determine the cytotoxic effects of DEHP on human osteoblasts in vitro and to delineate the mechansims. In this study, we exposed the human osteo-blastic cell line MG-63 to various concentrations of DEHP (1, 25, 50 and 100 µM) for 24, 48 and 72 h. Cell viability was assessed by MTT assay. Total RNA and protein were collected after 48 h treatment with 1 and 100 µM DEHP and determined for the mRNA and/or protein expression of alkaline phosphatase (ALP), sex steroid receptors (androgen and estrogen receptors), receptor activator of nuclear factor kappa-Β ligand (RANKL), runt-related transcription factor 2 (RUNX2) and peroxisome proliferator-activated receptor alpha (PPARα). The mRNA expression was stud-ied by real-time RT-PCR analysis and the protein expression was determined by western blot analysis. Statistical analyses were done by one-way analysis of variance (ANOVA) followed by the Students–Newman–Keuls (SNK) test. The exposure of MG-63 cells to DEHP caused a signifi-cant decrease in osteoblast viability in all the treatment groups and at all the time points stud-ied. Interestingly, DEHP exposure decreased the mRNA expression of ALP, a bone formation marker. DEHP had differential effects on estrogen receptor alpha (ERα) mRNA and protein ex-pression. However, DEHP treatment downregulated the mRNA and protein expression of ERβ, and androgen receptor (AR). Surprisingly, DEHP downregulated the RANKL mRNA expression. DEHP decreased the protein expression of RUNX2, the key transcription factor and master regu-lator of bone formation. Furthermore, DEHP increased the PPARα protein expression in the os-teoblasts. Importantly, DEHP increased the reactive oxygen species (ROS) molecules and thus oxidative stress in osteoblasts, as observed by increased hydrogen peroxide, hydroxyl radical levels and lipid peroxidation. On the other hand, it decreased the enzymatic and non-enzymatic antioxidant levels namely catalase, superoxide dismutase, glutathione peroxidase activity and reduced glutathione. Our study demonstrated that in vitro exposure to DEHP reduces the osteo-blast viability possibly through alterations in the oxidant-antioxidant system and modulation of the key genes involved in bone formation, highlighting the cytotoxic effects of DEHP on bone forming cells.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

Ultra-low radioactive titanium alloy is a promising material for the manufacture of low-background detectors, which are being developed for experiments in astroparticle physics and neutrino astrophysics. Structural titanium is manufactured on an industrial scale from titanium-sponge. The ultra-low-background titanium-sponge can be produced on an industrial scale with a contamination level of less than 1 mBq/kg of uranium and thorium isotopes. The pathways of contaminants during the industrial production of structural titanium have been analyzed. The measurements have been carried out using two methods: inductively coupled plasma spectroscopy (ICP-MS) and gamma-spectroscopy using high-purity germanium detectors (HPGe). It has been shown that the level of contamination with radioactive impurities does not increase during remelting of titanium-sponge and mechanical processing. We examined titanium-alloys samples obtained at different stages of titanium production, namely, an electrode compaction, a vacuum arc remelting with a consumable electrode (VAR), and a cold rolling of titanium-sheets. It has been found out that all studied samples will be a source of uranium and thorium contamination of the final titanium-alloys. It has been established that the only product allowed obtaining ultra-low-background titanium was the VT1-00 which is manufactured without master alloys addition..

High-grade gliomas are extremely fatal tumors, marked by severe hypoxia and therapeutic resistance. Autophagy is a cellular degradative process that can be activated by hypoxia, ultimately resulting in tumor advancement and chemo-resistance. Our study aimed to examine the link between autophagy markers expression in low (LGG) and high-grade gliomas (HGG). In 39 glioma cases, we assessed protein expression of autophagy markers LC3B, p62, and DRAM by immunohistochemistry (IHC) and mRNA expression of autophagy genes; PI3K, AKT, m-TOR, PTEN, ULK1, ULK2, UVRAG, Beclin 1 and VPS34 using RT-qPCR. Livak’s method was used to analyze the relative changes in gene expression and multi-variate Anova test and Spearman's correlation tests were performed for statistical significance. LC3B, p62, and DRAM expression were positive in 64.1%, 51.3%, and 28.2% of glioma cases respectively. The expression of LC3B and p62 was notably higher in HGG compared to LGG. VPS34 exhibited a significant differential expression and increased fold change and demonstrated strong positive correlations with Beclin1 (rs=0.768), UVRAG (rs=0.802), and ULK2 (rs=0.786) in HGG compared to LGG, thus highlighting the potential link between autophagy and glioma progression. We Provide preliminary data for functional analysis of autophagy using cell culture model and to identify potential targets for therapeutic interventions

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

The assessment of Health-Related Quality of Life (HRQoL) in Thalassemia offers a holistic approach to the disease and facilitates better communication between physicians and patients. This study aimed to evaluate the HRQoL of Transfusion-Dependent Thalassemia (TDT) patients in Greece. This was a multicentre, cross-sectional study conducted in 2017, involving 283 adult TDT patients. All participants completed a set of two QoL questionnaires, the generic SF-36v2 and the disease-specific TranQol. Demographic and clinical characteristics were used to predefine patient subgroups. Significant factors identified in univariate analysis were entered into a multivariate analysis to assess their effect on HRQoL. The SF-36 scores of TDT patients were consistently lower, compared to the general population in Greece. The mean summary score of TranQol was relatively high (71±14%), exceeding levels observed in national surveys in other countries. Employment emerged as the most significant independent factor associated with better HRQoL, whereas age had the most significant negative effect. This study represents the first comprehensive QoL assessment in a representative sample of the TDT population in Greece. The implementation of TranQol allowed for the quantification of HRQoL in Greece, establishing a baseline for future follow-up, and identifying more vulnerable patient subgroups.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

The official recommendations to manage COVID-19 in the outpatient setting focus on high-cost drugs (remdesivir, nirmatrelvir-ritonavir, molnupiravir), suffering from many problems. Therefore, one may consider also other treatments meeting these criteria: • promising effectiveness, based on favorable randomized controlled trials (RCTs) of sufficient validity. Even without definitive evidence, physicians and informed patients can consider them if they are also: • safe, to the state of knowledge • with a very favorable opportunity cost • biologically plausible/not implausible • accessible • without major commercial sponsors in the trials promoting them, and with researchers without major conflicts of interests. The main focus is on a limited group of functional foods and some their active ingredients, with further mention of other substances of different origin, yet fully meeting all the aforementioned criteria. The functional foods and substances described and discussed certainly do not cover all the known effective therapies for COVID-19 (in one case also for Long-COVID), but the only therapies proposed in this paper currently satisfy all the above criteria. The supporting scientific evidence will favor meta-analyses of RCTs that include the most definitive outcome: all-cause mortality, i.e. the outcome that most fully informed people tend to prioritize. Furthermore, the reported evidence favors clinical studies of the most valid design, i.e. RCTs.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The effect of Amaranthus cruentus L. seed oil (AmO) on collagen biosynthesis and wound healing was studied in cultured human dermal fibroblasts exposed to UVA radiation. It has been found that UVA radiation inhibited collagen biosynthesis, prolidase activity, expression of β1-integrin receptor, phosphorylated ERK1/2 and TGF-β, while increased the expression of p38 kinase. The AmO at 0.05-0.15% counteracted the above effects induced by UVA radiation in fibroblasts. UVA radiation also induced the expression and nuclear translocation of pro-inflammatory NF-κB fac-tor and enhanced the COX-2 expression. AmO effectively suppressed the expression of these pro-inflammatory factors induced by UVA radiation. Expressions of β1 integrin and IGF-I re-ceptors were decreased in the fibroblasts exposed to UVA radiation, while AmO counteracted the effects. Furthermore, AmO stimulated fibroblast’s migration in a wound healing model, thus facilitating the repair process following exposure of fibroblasts to UVA radiation. This data suggest the potential of AmO to counteract UVA-induced skin damage.

This review explores the application of the conservative management model for pain to sports-related concussions (SRCs), framing concussions as a distinct form of pain syndrome with a pathophysiological foundation in central sensitization. Drawing parallels with proven pain management models, we underscore the significance of a proactive approach to concussion management. Recognizing concussions as a pain syndrome allows for the tailoring of interventions in alignment with conservative principles. This review first covers the epidemiology and controversies surrounding prolonged concussion recovery and persistent post-concussion symptoms (PPCS). Next, the pathophysiology of concussions is presented within the central sensitization framework, emphasizing the need for early intervention to mitigate the neuroplastic changes that lead to heightened pain sensitivity. Five components of the central sensitization process specific to concussion injuries are highlighted as targets for conservative interventions in the acute period: peripheral sensitization, cerebral metabolic dysfunction, neuroinflammation, glymphatic system dysfunction, and pain catastrophizing. These proactive interventions are emphasized as pivotal in accelerating concussion recovery and reducing the risk of prolonged symptoms and PPCS, in line with the philosophy of conservative management.

The construction industry is notable contributors to atmospheric dust particulate emissions. The particulate matter (PM) produced in construction processes contains a range of chemically hazardous substances, posing significant health risks (HR) to individuals. The occupational health hazards research in construction has become a focal point of interest internationally. Initiated in the early 2000s, there has been a growing demand within the construction research community for the creation of a unified PM database that encapsulates a wide array of construction activities. Previous studies have endeavored to establish a PM database for various construction contexts, yet they have fallen short in thoroughly addressing the diversity of construction materials and the levels of toxic substances (TS) within the PM. This study validates the proof of value that HR associated with construction processes can be measured using PM and TS datasets generated from various work processes using a variety of construction materials. This was accomplished through a semi-automated Building Information Modeling (BIM)-based plugin, which streamlines the assessment of occupational HR in construction projects alongside ongoing work processes. To validate the practicality of the Health Risk Index (HRI) determination via this BIM plugin, a case study on a real renovation project was executed. This system provides construction supervisors with a tool to visually assess the HR of daily operations, thereby facilitating the adoption of preemptive measures to protect the health of construction workers.

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

In hepatocellular carcinoma (HCC), recurrence usually occurs after curative surgical resection. Currently, no approved adjuvant therapy has been shown to reduce recurrence rates. In this report, the in vivo mouse effect of sequential combination treatment with recombinant mouse interferon-alpha (rmIFN-α) and an anti-mouse-PD1 antibody on hepatitis B virus (HBV) clearance was evaluated. A phase I clinical trial was then conducted to assess the safety, tolerability, and inhibitory activity of sequential therapy with ropeginterferon alfa-2b and nivolumab in HCC recurrence in patients who have undergone curative surgery for HBV-related HCC. In animal modeling, HBV suppression was significantly greater with rmIFN-α and anti-PD1 sequential combination treatment than with their treatment alone. In the Phase I study, eleven patients completed the sequential therapy with ropeginterferon alfa-2b every two weeks at the dose of 450 µg for six doses, followed by three doses of nivolumab every two weeks up to 0.75 mg/kg. A notable decrease or clearance of HBV surface antigen was observed in two patients. Dose-limiting toxicity of grade 3 alanine transaminase and aspartate aminotransferase increases was observed in one patient. The maximum tolerated dose was determined. Currently no HCC recurrence has been observed. The treatment modality was well tolerated. The data support further clinical development of sequential combination therapy as a post-surgery prophylactic measure against the recurrence of HBV-related HCC.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

Abstract: Uranium is a toxic radioactive element and is usually found in the environment in hexavalent form. It has become a necessity to remove uranium, which can enter the environment in excessive amounts through nuclear industrial activities, from access waters. Melamine formaldehyde organo clay nano composite foam (MFCNCF) was prepared as a novel adsorbent by hardening with thermal treatment. Structural, crystallographic textural and surface morphological characterization of the prepared adsorbent was made by FTIR and XRD spectroscopic and SEM and HRTEM microscopic techniques. This study aims to investigate the adsorption of U(VI) from aqueous solution by MF organo clay nanocomposite and its dependence on various variables such as initial uranium concentration, adsorption time, adsorbent dosage, initial pH, and temperature. Additionally, adsorption isotherm analysis and adsorption kinetics and thermodynamics were also examined. For this purpose, the batch adsorption experiments were carried out and the equilibrium concentration of U(VI) in the aqueous solution was measured with a UV-Vis spectrophotometer at a wavelength of 433 nm, which corresponds to its maximum absorptivity. The results regarding adsorption kinetics show that 30 min is sufficient to reach adsorption equilibrium and the data show a high fit to the pseudo-second-order kinetic model. Isotherm analysis also revealed a high fit of the data to the Type III isotherm and the Halsey model. Based on this fit, an adsorption mechanism involving two regions (electrostatic and complex formation) was proposed for the current adsorption system. The adsorption isosteric enthalpy and entropy values for the first and second regions are 3.65 and -51.02kJ/mol and 1.77 and -167.28J/mol, respectively. It was found in kmol. Experimental results showed that the prepared nanocomposite foam adsorbent is an effective and potential alternative for the effective removal of U(VI) from aqueous solutions.

Aging is a major risk factor for the higher incidence and prevalence of chronic conditions, such as cancer, cardiovascular and metabolic diseases, and neurodegenerative diseases. Closely linked with the onset of all these age-related diseases is immunosenescence, a condition defined as progressive reconfiguration of the immune functions leading to an increased susceptibility to infectious diseases, poorer response to vaccination, increased prevalence of cancer, rheumatoid arthritis, and other chronic diseases characterized by a pro-inflammatory state named inflammaging. Given that immunosenescence frames age-related diseases, it is natural to ask how these illnesses are related under the context of innate and adaptative components of the immune system. Knowledge processing by Formal Concept Analysis (FCA) of age-related diseases framed in an immunosenescence multivalued context shows that a hierarchy among these diseases emerges with a subconcept-superconcept nested structure, with two clusters, first made of metabolic diseases, cancer, and cardiovascular diseases. Second metabolic and neurodegenerative diseases and rheumatoid arthritis. Metabolic diseases seem to be a pivot illness and they must be a primary target given their global incidence and prevalence and their cost-effective treatments like regular physical activity, weight loss, healthy diet, stopping smoking, and reducing or managing stress. Another implication of the ontological analysis of age-related diseases is about the nature of immunosenescence, suggesting that initial symptoms of age-related diseases are mainly related to innate immune mechanisms, and developing of severe symptoms of age-related diseases like cancer, cardiovascular or neurodegenerative diseases depends on the activation of acquired immunity processes.

Prediabetes, a pivotal phase in glucose metabolism between normalcy and diabetes, exerts a profound influence on the aging process and the risk of age-related diseases. This comprehensive review delves into the intricate web of blood-based biomarkers that collectively expedite senescence, marking the transition from a state of health to age-related complications. Key findings underscore the significance of diverse biomarkers, such as telomere length, p16INK4a, senescence-associated secretory phenotype (SASP) factors, DNA methylation clocks, advanced glycation end products (AGEs), inflammatory and oxidative stress markers, circulating hormones, and additional factors like folate, B12, osteocalcin, and more. Not only do these biomarkers serve as indicators of senescence, but they actively fuel chronic inflammation, oxidative stress, and metabolic dysregulation, all of which contribute to accelerated aging. The implications of this understanding are profound, as prediabetes emerges as a critical period in an individual's life, influencing various physiological systems, including the vascular and neural systems, metabolic functions, hormonal regulation, and bone health. Recognizing the profound influence of prediabetes on senescence provides a foundation for personalized intervention strategies to mitigate age-related complications and promote healthy aging. Future research directions call for a more diverse array of biomarkers, in-depth exploration of their roles, and the development of tailored precision medicine strategies to ensure a holistic understanding and effective management of prediabetes-induced senescence and its implications for aging. This knowledge has far-reaching implications for public health and clinical practice, emphasizing the need for early detection and intervention in prediabetic individuals to enhance the quality of life in an aging population with diverse needs.

We report the first correction by Prime editing of a mutation in the RYR1 gene, paving the way to gene therapies for RYR1-related myopathies. The RYR1 gene codes for a calcium channel named Ryanodine receptor 1, which is expressed in skeletal muscle fibers. The failure of this channel causes muscle weakness in patients, which degenerates into motor disabilities. Currently, there are no effective treatments for these diseases, which are mainly caused by point mutations. Prime editing allows the modification of precise nucleotides in the DNA. Our results showed a 59% correction rate of the T4709M mutation in the RYR1 gene in human myoblasts by RNA delivery of the Prime editing components. It is to be noted that the T4709M is recessive, and thus, persons having a heterozygous mutation are healthy. These results are the first demonstration that it is possible to correct mutations in the RYR1 gene.

The evolutionary theory of aging, particularly antagonistic pleiotropy (AP), provides an account of the ultimate origins of aging. What remains unclear is the nature of the proximate mechanisms by which AP gives rise to diseases of aging, like cardiovascular disease and Alzheimer’s disease. Damage-centric theories focusing on loss of genetic and cellular function have been proposed, as well as programmatic theories focusing on unwanted gene and cellular function. The latter include the hyperfunction and developmental theory that view aging as the futile continuation, or run-on, of growth and developmental programmes into later life. Yet neither type of theory has performed well in explaining late-life disease aetiology, particularly with respect to disease onset, presentation and progression. What is proposed here in this review is a new programmatic theory of aging. We argue that the emergence of many specific diseases may involve quasi-programmes that are not the result of run-on, but rather are triggered by other factors in late life. Such triggers may be non-programmatic (e.g. infection, mechanical injury) or programmatic. Moreover, the consequent pre-pathological and pathological changes may in some cases trigger further changes, leading to futile and destructive cascades of quasi-programmes and pathology. The origins of triggered quasi-programmes can be traced to biological constraint i.e. the inability of organisms to optimise all functions at once. And, to some extent, the new theory presented here revises the understanding of AP. That is, because any gene can be triggered in an erroneous manner, every gene is potentially an AP gene that risks pathology, though level of risk varies according to constraint. To help validate the theory, we test it against several complex diseases of aging. The new model in this review attempts to provide a blueprint understanding that, to a certain extent, closes the gap in the causal chain of events between evolutionary causes of aging and the aetiology of age-related diseases. It also helps to explain why certain disorders mimic accelerated aging and how interventions, such as the suppression of IIS and mTOR retard many aspects of aging; notably, though, unlike prior programmatic theories, the new theory is not mTOR-centric. Finally, it provides new perspectives on possible treatment of aging.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Aging induces numerous physiological alterations, with immunosenescence emerging as a pivotal factor. This phenomenon has attracted both researchers and clinicians, prompting pro-found questions about its implications for health and disease. Among the contributing factors, one intriguing actor in this complex interplay is human cytomegalovirus (CMV), a member of the herpesvirus family. Latent CMV infection exerts a profound influence on the aging immune system, potentially contributing to age-related diseases. This review delves into the intricate relationship between immunosenescence and CMV, revealing how chronic viral infection im-pacts the aging immune landscape. We explore the mechanisms through which CMV can im-pact both the composition and functionality of immune cell populations and induce shifts in in-flammatory profiles with aging. Moreover, we examine potential role of CMV in such pathol-ogies as cardiovascular diseases, cancer, neurodegenerative disorders, COVID-19, and Long COVID. This review underlines the importance of understanding the complex interplay be-tween immunosenescence and CMV. It offers insights into the pathophysiology of aging and age-associated diseases, as well as COVID-19 outcomes among the elderly. By unraveling the connections between immunosenescence and CMV, we gain a deeper understanding of aging's remarkable journey and the profound role that viral infections play in transforming the human immune system.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Healthcare workers' stress, burnout, and job dissatisfaction were exacerbated by the Covid-19 pandemic, whose mid-term negative effects are still present. The aim of this study was to investigate in healthcare workers the effect of the dimensions of burnout (Psychophysical exhaustion, Relational deterioration, and Professional inefficacy) on Career satisfaction. These relationships were evaluated by considering the direct and mediated effects of Disillusion. For these purposes, the Link Burnout Questionnaire (LBQ) and the Career Satisfaction Scale (Occupational Stress Indicator - OSI) were administered to 295 healthcare professionals working at three Italian public hospitals in Cagliari, Italy. The analyses were conducted using the Partial Least Square Structural Equation Model (PLS-SEM) method. Findings highlight that healthcare workers were in a condition of work distress, high risk of burnout, and career dissatisfaction. Also recognized was the direct negative effect of burnout dimensions on career satisfaction. Finally, the mediated negative effect of Disillusion in the relationship between burnout and career satisfaction was identified. This study emphasizes the relevance of the dimension of Disillusion, and its “bright side” Fulfilment, in healthcare workers, specifically referring to the disregarded relationship between burnout and career satisfaction.

Background: Patients with infectious complications related to the presence of cardiac implantable electronic devices (CIED) constitute a heterogeneous group, including local pocket infection (PI) and lead related infectious endocarditis (LRIE). The diagnosis of CIED-related infection is often difficult and requires complex imaging and microbiological tests. The aim of the current study was to evaluate the usefulness of new simple hematological parameters in detecting infectious complications in patients with CIED and assessing their extent. Methods: The retrospective analysis of clinical data of 2909 patients (36.37% with CIED-related infections), undergoing transvenous lead extraction (TLE) procedures in three high-volume centres in the years 2006-2020, was conducted. The sensitivity and specificity of new hematological markers were evaluated: the neutrophil to lymphocyte ratio (NLR), neutrophil to platelet ratio (NPR), and lymphocyte to platelet ratio (LPR) in the diagnosis of infectious complications, assessment of the spread of the infectious process and differentiation of additional structures related to the presence of leads. Results: In patients with CIED infections, compared to the non-infectious group, high inflammatory parameters were confirmed, and the highest specificity of the new markers in detecting the infectious process was demonstrated. (79.47% for NPR and 72.82% for NLR). Analysis of laboratory parameters in infectious and non-infectious patients with the presence of additional lead-related masses showed the highest specificity of NPR (82,78%) in predicting the diagnosis of vegetation. Comparison of laboratory parameters in patients with LRIE and PI showed higher NLR % (4.24 vs 2.56; p<0.001, area under curve (AUC) in a receiver operating characteristic (ROC) curve: 0.67 and 0.78 respectively) and higher NPR (0.03 vs 0.02; p<0.001; AUC: 0,51 and 0,55) in patients with LRIE. The highest sensitivity in the detection of coexistence LRIE with PI has been demonstrated for NLR (87.33%). Conclusions: Novel hematological markers may be helpful in the recognition of the inflammatory process in patients with CIED, differentiation of vegetation and vegetation-like masses, and the extent of infection in patients with PI.

: Healthcare workers are affected by mental health issues, burnout and turnover, and this burden is even greater during epidemics and pandemics, such as COVID-19. The purpose of this research is to provide an overview of the measures introduced or supported in the institutions of Quebec’s health and social services network during the COVID-19 pandemic with the aim of protecting healthcare workers’ mental health. An online questionnaire survey was administered in 2021 among human resources department personnel in health and social services network institutions involved in workplace mental health in Quebec. A total of 223 key informants representing 31 of the 34 public health and social services institutions in the province of Quebec in Canada responded to the questionnaire. Measures that focus on the needs of staff, involve all levels of authority and the ones that provide flexibility, support and recognition at work were more successful, according to the advisors surveyed. Future research into whether the same measures are considered effective or ineffective outside of a pandemic context is needed.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Akebia trifoliata is an economically important self-incompatible fruit tree in the family Lardiza-balaceae. Asexual propagation is the main strategy used to maintain excellent agronomic traits. However, the generation of adventitious roots during asexual propagation is very difficult. To study the important role of the WUSCHEL-related homeobox (WOX) transcription factor in fruit and adventitious root growth and development, we characterized this transcription factor family in the whole genome of A. trifoliata. A total of 10 AktWOXs were identified, with the fol-lowing characteristics: length (657~11328 bp), exon number (2~5), isoelectric point (5.65~9.03), amino acid number (176~361 AA), and molecular weight (20.500~40.173 kDa). 10 AktWOXs were classified into modern (6), intermediate (2), and ancient clades (2) and that all AktWOXs had undergone strong purifying selection during evolution. The expression profile of AktWOXs dur-ing A. trifoliata fruit development and adventitious root formation indicated that AktWOXs are widely involved in the development of the three fruit tissues, flesh, seeds and rind, and play an important role in the regulation of adventitious root development. Overall, this is the first study to identify and characterize the WOX family in A. trifoliata and will be helpful for further re-search on A. trifoliata fruit development and adventitious root formation.

Premenstrual syndrome (PMS) continues to impact the health outcomes and emotional well-being of reproductive-age women, globally. Several studies have provided conflicting evidence concerning the role of dietary approaches in improving PMS symptoms. Accordingly, this study aimed to evaluate the possible influence of a healthy diet and motivational strategies on PMS symptoms and health-related quality of life among Omani adolescents. This open-label, randomized, prospective controlled trial was conducted in two randomly selected secondary schools, in Al Seeb Willayah, in Muscat region. Adolescents with PMS symptoms, who were at grade 10 or 11, aged 16 years or above, had regular menstrual cycles and not known to have psychiatric disorder, were included in this study. Participants in the intervention group received an individual face-to-face dietary consultation and motivational phone consultation. The health outcomes, including the PMS symptoms in both groups, and quality of life, were recorded via a daily record of severity of problems questionnaire (DRSP) and the 14-item Self-Reporting-Based Perceived Stress Scale tools, respectively. The primary outcome was the differences in the mean premenstrual symptom scores between the two groups. Secondary outcomes included the quality of life and stress levels of participants. The study period was from 1 February and ended 30 June 2021. SPSS was used to analyze the data and intention-to-treat analysis was utilized.A total of 72 adolescents with PMS were randomized to the intervention and control groups (n=36 each). Both groups were similar at baseline (P-value&gt;0.05). No significant association was found between healthy-diet and PMS symptoms (P-value&gt;0.05). In addition, no significant association was found between healthy-diet and quality of life at follow-up (P-value=0.216). The outcomes of this study refuted any possible relationships between healthy diet and PMS symptoms. Accordingly, dietary consultations may not facilitate the clinical management of PMS symptoms in adolescent females.

Background and Objectives: Chemokines have various biological functions and potential roles in the development or progression of neuroinflammatory diseases. However, the specific pathogenic roles of chemokines in age-related macular degeneration (AMD), the leading cause of blindness in older individuals, remain elusive. Chemokines interact with their receptors expressed in the endothelium and on leukocytes. The sulfation of tyrosine residues in chemokine receptors increases the strength of ligand–receptor interaction and modulates signaling. Therefore, in the present study, we aimed to construct a human recombinant sulfated CXCR3 peptide trap (hCXCR3-S2) and mouse recombinant sulfated CXCR3 peptide trap (mCXCR3-S2) to demonstrate in vivo effects in preventing choroidal neovascularization and chemotaxis. Materials and Methods: First, the effect of hCXCR3-S was validated in vitro. Interestingly, hCXCR3-S2 inhibited the migration and invasion of two human cancer cell lines. Subsequently, the in vivo efficacy of mCXCR3-S2 was investigated using a mouse model of neovascular AMD. Results: Intravitreal injection of mCXCR3-S2 attenuated choroidal neovascularization and macrophage recruitment in neovascular lesions. These in vitro and in vivo effects were significantly stronger with CXCR3-S2 than with wild-type CXCR3 peptides. Conclusion: These findings demonstrate that the sulfated form of the CXCR3 peptide trap is a valuable tool that could be supplemented with antivascular endothelial growth factors in AMD treatment.

Assessment of renal function is critical to diagnose and manage renal age-related decline, disease (KD), and failure, which are prevalent in the elderly population. Glomerular filtration rate (GFR) is widely used as an indicator of kidney function, but its direct measurement is challenging, as are its age and gender caveats. This makes difficult the differential diagnosis, between age-related physiological decline and KD and/or failure. Currently, the inflammation-based modified Glasgow prognostic score (mGPS) is emerging as promising biomarker of several inflammatory acute/chronic diseases. In this study, the large variability of eGFR with age and gender was evaluated, as the association of eGFR values with mGPS levels. A population of 57449 adult participants (age ≥18 years) was enrolled. Appropriate circulating biomarkers were measured to detect eGFR and mGPS values. The data obtained demonstrated a significant decrease of eGFR in men vs. women across the four selected age classes (18-40, 40-60, 60-80, 80-100 years), eGFR classes were significantly associated with mGPS (p<0.001), as age-classes and gender with mGPS categories. Accordingly, the percentage of people having a mGPS score= 2 significantly increased across the eGFR classes: with a 11% in the G1/eGFR class to achieve the 44% in G5/eGFR. Thus, the combination of mGPS with eGFR could represent the best benchmark risk model for differentiating age-related renal decline from a very KD, and for a better identification of different degrees of KD severity.

Background: we aim to investigate attitudes toward vaccination, by analyzing empirical factors associated with vaccine acceptance in the Lazio region mpox vaccination (MpoxVax) campaign in Italy. Methods: all subjects who accessed to MpoxVax and signed the informed consent were prospectively enrolled in the MPOX-VAC Study and were asked to fill out an anonymous survey. Two endpoints were selected: ‘delayed acceptance’ and ‘early acceptance’, defined as access for vaccination &gt;60 and ≤30 days from the vaccination campaign starting (VCS), respectively. Results: over the study period 1717 individuals underwent vaccination: 129 (7%) &gt;60 [1588 (92.5%) ≤60] and 676 (60%) ≤30 days from VCS. A bisexual orientation, a lower education level and a worse perceived physical and mental health were associated with delayed access to vaccination. Being Pre-Exposure Prophylaxis (PrEP) users and, marginally, HIV positive, having a high perceived risk for mpox infection and reporting high-risk behaviors like the use of recreational drugs/chems, sex under the influence of drugs and/or alcohol and higher number of principal sexual partners, were associated with early access to vaccination. Conclusions: according to our data, risk awareness was a major determinant of early mpox vaccination acceptance. Conversely, worse perceived health status and a low educational level were critical factors associated with delayed vaccination.

Biological, environmental, behavioral, and social factors can influence sleep and lead to sleep disorders or diseases. Sleep disorders are common, numerous and heterogeneous in terms of their etiology, pathogenesis, and symptomatology. Management of sleep-wake circadian disorders (SWCD) includes education to sleep hygiene, behavioral strategies, psychotherapy (cognitive behavioral therapy (CBT), particularly), instrument-based treatments (i.e. positive airway pressure therapy, hypoglossal nerve stimulation), and pharmacotherapy. Depending on the disease, therapy varies and is executed sequentially, or can be a combination of several forms of therapy. Drugs used for SWCD include traditional sleep or wake-promoting agents, chronotherapeutic agents. Recently, novel medications, which are more precisely acting on specific neurochemical systems (i.e. orexin system) important for sleep and wake, are also increasingly being used. In this review, the pharmacotherapy of common sleep disorders (insomnia, sleep-related breathing disorder, central disorders of hypersomnolence, circadian rhythm sleep wake disorders, parasomnias, and sleep-related movement disorders) embedded in the overall therapeutic concept of each disorder is presented. There is also an outlook on possible future pharmacotherapies.

Migraine is a neurovascular disorder that can be debilitating for individuals and society. Current research focuses on finding effective analgesics and management strategies for migraines by targeting specific receptors and neuropeptides. Nevertheless, the responder rates of recently approved calcitonin gene-related peptide (CGRP) monoclonal antibodies (mAbs) and receptor inhibitors remain around 50 percent. To address the need for novel therapeutic targets, researchers are exploring the potential of another secretin family peptide, pituitary adenylate cyclase-activating polypeptide (PACAP), as a ground-breaking treatment avenue for migraine. Preclinical models have revealed how PACAP affects the trigeminal system, which is implicated in headache disorders. Clinical studies have demonstrated the significance of PACAP in migraine pathophysiology; however, a few clinical trials remain inconclusive: the pituitary adenylate cyclase-activating peptide 1 receptor mAb, AMG 301 showed no benefit for migraine prevention, while the PACAP ligand mAb, Lu AG09222 significantly reduced the number of monthly migraine days over placebo in a phase 2 clinical trial. Meanwhile, another secretin family peptide vasoactive intestinal peptide (VIP) is gaining interest as a potential new target. In light of recent advances in PACAP research, we emphasize the potential of PACAP as a promising target for migraine treatment, highlighting the significance of exploring PACAP as a member of the antimigraine armamentarium, especially for patients who do not respond to or contraindicated to anti-CGRP therapies. By updating our knowledge on PACAP and its unique contribution to migraine pathophysiology, we can pave the way for reinforcing PACAP and other secretin peptides, including VIP, as a novel treatment option for migraines.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Sous-vide is a process in which food is vacuum-sealed and prepared in a water bath, heated to a precise temperature, and circulated in a sous-vide machine. This cooking technique is increasingly common in homes and catering establishments due to its simplicity and affordability. However, manufacturers' and chefs' recommendations for low-temperature and long-term sous-vide cooking in media raise food safety concerns, particularly when preparing beef tenderloin. In this study, Salmonella enterica was found to be inactivated by heat and sage essential oil (EO) in beef tenderloin from musculus psoas major that had undergone sous-vide processing. To determine whether heat treatment was likely to increase the sous-vide efficiency, S. enterica and sage EO were mixed. After being vacuum-packed and injected with S. enterica, the samples were cooked sous-vide for the prescribed time at 50, 55, 60, or 65 °C. On days 1, 3, and 6, the amounts of S. enterica, total bacteria, and coliform bacteria were measured in both groups of sous vide beef tenderloin. Mass spectrometry was used to identify bacterial strains on various days and categories. Each day that was measured, the test group exposed to a temperature of 50 °C for 5 minutes had a higher number of all microbiota. The most isolated microorganisms from the control and treated groups were Pseudomonas fragi, and in the treated group also S. enterica. It has been shown that adding sage essence oil (EO) in combination with the sous-vide gastronomic method leads to the stabilization and safety of beef tenderloin.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background and Aims: Paramedics attend an unprecedented number of drug poisoning events daily in British Columbia (BC), Canada due to the ongoing public health crisis related to an increasingly toxic and unregulated supply of illicit drugs. Paramedics have the potential to support alternative models of care to reduce harm, but their perspectives towards harm reduction initiatives are polarized. Understanding the drug-related substance use content in paramedic curriculum documents is important for deploying effective harm mitigating programs. The objective of this study was to understand what drug-related substance use content currently exists within paramedic curriculum documents in British Columbia. Methods: We performed a document analysis of curriculum documents in BC’s paramedic training institutions, the primary program textbook, and the 2011 National Occupational Competency Profile (NOCP). We used the Checklist for Assessment and Reporting of Document Analysis (CARDA) tool to perform our analysis. We analysed and coded documents both inductively and deductively and subsequently combined, refined, and used the codes to inform the development of themes via reflexive thematic analysis. Results: Of the 44 documents analysed, 22 included codes relevant to the research questions. Paramedics are primarily taught to care for people who use drugs in an acute drug-poisoning response only, with little consideration of holistic care, and no meaningful mention of harm reduction. Some stigmatizing language was found within the content. Conclusions: Many opportunities to introduce holistic models of care for people who use drugs along the entire continuum of care are unaddressed by paramedic curriculum documents in BC. Curriculum developers should include people who have lived and living experience of drug use in the co-design of educational programs involving their care. Further qualitative analyses are required to evaluate the relationship between paramedic education and provider-based stigma.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p &lt; 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p &lt; 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

Though studies have characterized lizard dung as an unconventional psychoactive substance of abuse, this has not been demonstrated in experimental settings. We evaluated the toxicity and CNS activity of lizard dung in Wistar rats. The acute and subacute toxicity studies were conducted via oral and inhalational routes. Classical models of tail suspension, forced swim, elevated plus maze, hole board, and sodium pentobarbital-induced sleeping time tests were adopted and the lizard dung were administered via both routes. No mortality was observed for all doses of the test substance administered via both routes during the toxicity studies. Significant changes in serum urea, creatinine, bilirubin, ALP, ALT and AST were recorded. Mixed inflammatory infiltrates and oedema were observed in the lungs from the group that inhaled 1.0g darkish part of lizard dung. Lizard dung produced marked reduction in the exploratory behaviour. Our findings indicate depression of the CNS.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Neuroinflammation is considered to be a significant component in a range of neuropathologies. Unfortunately, whilst its role is well recognized, the options for therapeutic intervention are limited. As such, there is a need to identify novel targets in order to increase treatment options. Given its role as both a neurotransmitter and an immune modulator, substance P and its NK1 receptor have been widely studied as a potential therapeutic target. There is evidence that NK1 receptor antagonists may exert beneficial effects in a range of conditions, including traumatic brain injury and stroke. Blocking the NK1 receptor has been shown to reduce blood-brain barrier dysfunction, reduce cerebral oedema, and reduce the levels of pro-inflammatory cytokines. These actions are associated with improved survival and functional outcomes. The NK1 receptor has also been shown to be involved in the inflammatory reaction to CNS infection, and hence antagonist may have some benefit in reducing infection-driven inflammation. However, the NK1 receptor may also play a role in the host immune response to infection, and so here, the potential beneficial and detrimental effects need to be carefully balanced. As such, the purpose of this review is to provide a summary of the involvement of substance P in acute inflammation, particularly in the context of traumatic brain injury and stroke.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.