Exposure to quasi-electrostatic field induced currents is a hazard of live-line transmission work. These steady-state induced currents are typically less than 1 mA, and their sensory effects range from imperceptible to painful depending on the person and conditions such as contact area and duration. Permanent injury from these currents is unlikely but they can distract workers, increasing the risk of injury from falls or other dangers. Identifying contact current severity and training workers can help reduce risk of accidents. Measuring induced currents along a climbing route is time consuming and simulation is challenging because of geometric complexity of the worker, transmission structure, conductor bundles, and electric fields in the climbing space. This research explores calculation of worker contact current using a recently developed adaptation of the charge simulation method. The method uses Fourier principles to improve computational efficiency when explicitly modeling all bundle subconductors. The research also examines reasonable simplifications for modeling lattice structures and human geometry. Calculated results compare well to measured currents for a worker climbing a 400 kV lattice structure. This indicates the method is a practical option for calculating the severity of steady-state contact currents. A simple calculation is suggested for estimating these currents.

The average working person can spend between 35-60 hours a week in the workplace, making it an influential place for mental well-being while also being a place for socio-economic contribution. Workplace incivility can diminish positive mental health outcomes and negatively impact work engagement through increased social anxiety. To investigate this, 118 working adults aged between 19 to 67 years old in Singapore were recruited for a survey comprising of demographics questions, the Workplace Incivility Scale, Brief DSM-5 Social Anxiety Disorder Severity Scale, Utrecht Work Engagement Scale-9 over the period of November 2022 to April 2023. Correlational, regression and mediation analysis showed workplace incivility scale scores to significantly pre-dict social anxiety after controlling for covariates, supporting our hypothesis that employees exposed to work-place incivility would have higher levels of social anxiety that mediated work engagement after controlling for age and gender. The findings here show workplace incivility to be a possible intervention target for social anx-iety to reduce negative impacts on work engagement in order to improve employee experience and retention for organizations.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

This article presents the development of a Faith-Informed Advocacy Model that integrates faith-based principles and values into advocacy efforts within Christian social work. Drawing from the intersection of Christian ethics and social work principles, this model provides a framework for Christian social workers to engage in advocacy work that is grounded in their faith and guided by ethical principles. The article includes case studies that illustrate the application of the model in real-world scenarios.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

: This study investigates the workplace experiences of mothers of children with intellectual disabilities. These mothers may face challenges in balancing motherhood, disability, and employment. Therefore, it is important to understand the challenges they are facing and the mechanisms they use to cope with caregiving and work responsibilities in managing the stress that develops throughout this ongoing experience. The purpose of this research was to investigate the workplace experiences of single mothers of children with intellectual disabilities. A review of the literature was conducted. For this research, a qualitative methodology was adopted to gain an in-depth understanding of the mothers’ experiences. A narrative method was used for data collection. Thematic analysis was utilized to obtain a clear understanding. The findings suggest that mothers of children with intellectual disabilities face difficulties in balancing between caregiving for their child with a disability and their job responsibilities, in addition to showing that there is a lack of flexibility in the workplace, less awareness from colleagues and bosses of the challenges these mothers face, and a lack of organizational legislation that supports these mothers. According to our findings, workplaces should provide assistance to mothers of children with intellectual disabilities in order to ensure that they are not disadvantaged in their employment.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

The United Nations Convention on the Rights of Persons with Disabilities (hereafter CRPD) has provided a radical imperative for the reform of mental health and capacity legislation around the world. The interpretation of the CRPD has been controversial, ranging from complete abolition of detention, forcible treatment and substitute decision making, to acceptance that elements of these measures need to be retained but based on non-discriminatory criteria, additional safe-guards and a comprehensive shift towards supported decision-making. While the potential ef-fects of the CRPD on mental health social work and social work generally are considerable given their shared commitment towards social justice, to date there has been no review of research evi-dence exploring their relationship. In addressing this knowledge gap, this study held a prelimi-nary discussion with practitioners and academics at the European Association of Social Work Mental Health Special Interest Group in Amsterdam 2022, followed by a scoping literature re-view on the question: What impact, if any, has the CRPD had on social work practice? The review produced four main findings: impact on legislation; positive impact on practice; limited impact on practice; and impact on social work education and research. In sum, while there were some positive indications of social work and mental health social work practice being influenced by the CRPD, these were scant. Barriers to change included tendencies among some social workers to practise substitute decision-making, in part related to resourcing and policy contexts, and under-standings of disability aligned to individualised/medical rather than social perspectives. The results indicate that legal reform on its own is insufficient to impact social work practice, and that realising the potential of the CRPD will necessitate good quality training, as well as improv-ing social workers’ knowledge of the human rights of people with mental impairment.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p < 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p < 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Background: The seasonal variation of peptic ulcers is a rhythmic phenomenon reported worldwide, exhibiting diverse patterns and controversies. Unfortunately, it has remained an unresolved mystery for more than 90 years. Numerous studies have found that this phenomenon was closely associated with multiple environmental factors, but the underlying mechanism has never been elucidated. Objectives: This study aims to elucidate the seasonal variation of peptic ulcers and identify the role of environmental factors in the disease. Methods: Based on a recently identified etiology of peptic ulcers, two inverse operations in calculus, differentiation and integration, are iterated to analyze the existing data. First, the fluctuation curve in the seasonal variation is differentiated twice into the monthly incidences caused by multiple individual environmental factors, and the fluctuation curve due to each individual environmental factor is generated separately. Second, the monthly incidences caused by the individual environmental factors are integrated twice to reproduce the fluctuation curves in the seasonal variation of peptic ulcers. Results: The differentiations of the fluctuation curves in the season variation reveal a parallel relationship between the psychological impacts of each individual environmental factor and the monthly incidences of peptic ulcers. The integrations of the monthly incidences caused by 3 environmental factors reproduce the fluctuation curves in 3 representative seasonal patterns of peptic ulcers but make the parallel relationships invisible. Discussion: The parallel relationships revealed a causal role of environmental factors in peptic ulcers, whereas the reproduction of the fluctuation curves elucidated that multiple environmental factors cause the seasonal variation of peptic ulcers by Superposition Mechanism. The regional differences in environmental factors result in the diverse patterns, as well as the controversy questioning the seasonality of peptic ulcers. Significantly, the data analyses exemplify the application of a new concept, Superposition Mechanism, which might be an indispensable methodological complement to life science and medicine.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

In recent research, a growing body of empirical evidence, suggests that prosocial impact at work can play a significant role in enhancing creativity and innovativeness. Drawing from Self Determination Theory, we hypothesized that basic psychological needs and benevolence satisfaction could serve as a mediating factor in the relation between employees perceived social impact and innovative work behavior and creativity, thus illuminating the manner in which contentment of psychological needs fosters inventive proclivities within the organizational milieu. Results from a study in Greece and Canada (N=528) showed that both perceived social impact and prosocial motivation are positively associated with innovative work behavior and creativity while autonomy and competence satisfaction mediate the relation between perceived social impact and the work outcomes examined within this study. Moreover, prosocial motivation was found to moderate the relation between benevolence satisfaction and innovativeness. Findings extend prior research on the role of prosociality on creative behavior at work and provide supporting evidence for the organizations that encourage and support employees’ initiatives to make a positive difference in the lives of others.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

The advent of remote work has ushered in a new era of economic transformation, redefining the dynamics of local economies, and unleashing the multiplier effect on a national scale. This abstract explores the profound implications of remote work on local economies, dissecting how the multiplier effect operates within a nation's economic landscape. The multiplier effect is a fundamental economic concept that highlights how changes in spending and investment can create a ripple effect, leading to a magnified impact on an economy. This concept gains new significance in the context of remote work, as it triggers a chain reaction of economic activities that radiate from remote workers to their local communities. The increased flexibility and reduced geographical constraints of remote work have reshaped the allocation of resources. The continued reliance on remote work may lead to a reduction in demand for commercial real estate in urban centers, necessitating adaptive urban planning strategies. In conclusion, the rise of remote work has initiated a transformative era for local economies, driven by the multiplier effect. By amplifying the impacts of spending and investment, remote work fosters job diversification, innovation, and infrastructure development within communities. As remote work continues to reshape the landscape of work and life, understanding and harnessing its multiplier effect remains paramount for policymakers, businesses, and local communities alike. The multiplier effect is a concept in economics that illustrates how changes in spending can lead to larger impacts on a nation's economy through a chain reaction of economic activities. It demonstrates that an initial injection of spending, whether from government expenditure, investment, or consumption, doesn't just have a one-time impact. Instead, it sets off a series of interconnected spending and income-generation processes that result in a larger overall increase in economic activity. t's important to note that the multiplier effect can work in reverse as well. If there's a decrease in spending, it can lead to a decrease in economic activity and income through the same chain reaction process. This concept highlights the interconnected nature of economic activities and emphasizes the significance of changes in spending patterns on a nation's overall economic health. The magnitude of the multiplier effect is influenced by factors such as the marginal propensity to consume (the proportion of additional income that households spend), leakages (savings and taxes that reduce the multiplier effect), and the extent to which additional spending creates additional production capacity within the economy. Understanding the multiplier effect is essential for policymakers, as it helps them gauge the potential impacts of changes in fiscal and monetary policies on the economy.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

We explored the impacts of the remote and return to in-person work periods on sleep and well-being as reported by faculty (n = 22) and non-teaching staff (n=21) with and without disabilities. Our results show that contrary to expectations, the Covid-19 remote teaching/working period resulted in better sleep, as well as greater well-being, than the return to in-person. With respect to sleep, faculty members had slightly more negative outcomes than staff, most evident in heightened anxiety and work aspects. Faculty with disabilities had somewhat worse sleep and well-being during the remote period than faculty without disabilities. During the return to in-person work, both faculty and non-teaching staff reported more negative than positive sleep and well-being outcomes. In particular, during the in-person period faculty members experienced slightly more negative sleep outcomes related to anxiety and work, while staff members experienced slightly more negative sleep outcomes related to the need to commute and lifestyle. Our findings show that there were benefits and disadvantages to both remote and in-person work periods, suggesting a hybrid work schedule should be considered in more detail, particularly as an optional reasonable accommodation for faculty and staff with disabilities. Our study highlights that training to keep faculty abreast of the latest technological innovations, ways to promote work-life balance and steps to remedy classroom size and building ventilation to prevent the spread of disease all need urgent attention.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast < colon < pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

Background: The presence of a leadership role in the nursing manager appears to be closely related to a positive and productive work environment within health settings. In some contexts, such as Mexico, the profile of the nursing manager has not been formally defined, and, sometimes those who occupy these positions do not always have sufficient training, and therefore this vocation, which is related to the social image of the nursing profession. This study aims to understand the influence of the vocation for leadership that the nursing manager has and how it can influence the work environment, through the analysis of experiences lived by health professionals with a management profile of different health environments; Methods: Qualitative study of an approximation to grounded theory using Corbin & Strauss as reference, using semi-structured individual interviews as a technique, and with the participation of 10 Mexican nursing managers from second-level care hospitals; Results: The meaning of the vocation for the interviewed managers is based in the first instance on the love of the profession and the vocation to be a nurse, then on the development of leadership for decision-making in practice and is fed back with the positive effects that it generates in the work environment, helping them to better organize human resources and professional activities, and strengthening themselves with specific training on the subject and the experience acquired. ; Conclusions: An understanding model is provided about the phenomenon where two central categories were identified, the first central category is the "Management vocation and natural nursing leadership" which is the basis; The second central category is the "Explanation and influence of the managerial vocation, natural leadership and work environment in nursing". Two connection categories were also created; the connection category one "Motives, meaning, and practical vocation of managerial nursing" and the connection category two "Description of the managerial vocation, natural leadership, and work environment", said connection categories emanate from the central category one, to connect with the central category two, which contains the interaction of the managerial vocation, natural leadership, and work environment in nursing.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

Background and Objectives: The current study aimed to determine the impact of fasciotomy on mortality and morbidity in children and adults with crush-related AKI following the 2023 Kahramanmaraş earthquakes. Materials and Methods: The study included individuals who had suffered crush injuries after the 2023 Kahramanmaraş earthquakes and were identified as having acute kidney injury (AKI). Patients with AKI were divided into two groups based on age: those under 18 years and those over 18 years. A comparative analysis was conducted between the mortality and morbidity rates of patients who underwent fasciotomy and those who did not. Disseminated intravascular coagulopathy (DIC), sepsis, and adult respiratory distress syndrome (ARDS) have all been identified as contributors to morbidity. Results: The study was conducted with a total of 40 patients (21 males and 19 females) aged between four and 83 years. A total of 21 patients underwent fasciotomy and the patients underwent varying numbers of fasciotomy, ranging from zero to 11. The mortality rate was 12.5%, corresponding to five adult patients. No instances of mortality were reported in the paediatric cohort. The application of fasciotomy in instances of crush-induced AKI did not result in elevated levels of mortality in either the paediatric or adult demographic. Within the adult population, a substantial difference in the duration of dialysis was observed between individuals who underwent fasciotomy and those who did not. A statistically significant increase in the number of fasciotomy incisions was observed in patients diagnosed with sepsis compared with those without sepsis. The study found a significant positive correlation between the number of fasciotomy incisions and dialysis days. Conclusions: Neither adult nor paediatric patients with crush-induced AKI showed an increased risk of death after fasciotomy. The number of fasciotomy incisions significantly correlated with the development of sepsis. Despite experiencing delays in hospital admission for paediatric patients, the incidence of both crush syndrome and mortality rates among children remained relatively low.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Telemedicine and remote survey of physiological parameters may significantly increase the health and safety of people working in extreme environmental conditions, like firefighters, maintain rescuers, soldiers, and others. We highlight this problem and give an overview of the historical development and the actual status of systems available. Ruggedized systems, as small, lightweight, and flexible as possible, are needed to optimize the goal of increasing occupational health and safety of persons at risk and maximizing their performance during missions.

Considering the controversial benefits of video-assisted thoracoscopic surgery (VATS), we intended to evaluate the impact of surgical approach on cardiac function after lung resection using myocardial work analysis. Echocardiographic data of 45 patients (25 thoracotomy vs. 20 VATS) were retrospectively analyzed. All patients underwent transthoracic echocardiography (TTE) 2 weeks before and after surgery, including two-dimensional speckle tracking and tissue doppler imaging. No notable changes in left ventricular (LV) function, assessed mainly using the LV global longitudinal strain (GLS), global myocardial work index (GMWI), and global work efficiency (GWE), were observed. Right ventricular (RV) TTE values, including tricuspid annular plane systolic excursion (TAPSE), tricuspid annular systolic velocity (TASV), and RV free-wall GLS (RVFWGLS), indicated greater RV function impairment in the thoracotomy group than in the VATS group [TAPSE (mm): 17.90 ± 3.80 vs. 20.60 ± 3.50, p &lt; 0.018; TASV (cm/s): 12.40 ± 2.90 vs. 14.60 ± 2.50, p &lt; 0.010; RVFWGLS (%): −11.50 ± 8.50 vs. −17.50 ± 9.70, p &lt; 0.033), respectively]. Unlike RV function, LV function remained preserved after lung resection. The thoracotomy group exhibited greater RV function impairment than did the VATS group. Further studies should evaluate the long-term impact of surgical approach on cardiac function.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

This scholarly article provides an overview of the present and future issues and trends in social work on a global scale. Drawing upon recent bibliographic references and a review of the literature, this article explores the challenges faced by social workers in various regions and highlights emerging trends that are reshaping the field. The analysis incorporates insights from renowned authors and researchers to provide a comprehensive understanding of the current state and anticipated future of social work practice, education, and research worldwide.

This study examines the effect of a corporate citizenship-oriented high performance work system (CC-oriented HPWS) and the interactive influence of CC-oriented HPWS and person-organization fit (PO fit) on creativity at the individual level. Our analysis of field data collected from 303 employees in two branch companies with a two-phase collection method provides empirical support for our theoretical model. The results indicate that high performance work system (HPWS) reflecting corporate citizenship (CC) correlates positively with individual creativity. In addition, the moderating effect of PO fit is significant in the relationship between CC-oriented HPWS and creativity at the individual level. On this basis, this paper discusses the theoretical and practical implications of these findings for future research.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Forest harvesting generates variable amounts of residue that represent a fire hazard and a hindrance to regeneration and must be managed accordingly. In South Africa, burning is the most common residue management method, but there is an interest in introducing safer and more effective techniques, such as mulching. For that reason, a productivity study was conducted in the Eastern Cape province to gather information on the productivity, cost, and work quality of the three main alternatives: manual broadcasting, manual broadcasting followed by mulching with an adapted farm tractor and mulching with a purpose-built mulcher. Manual broadcasting required 16 h/ha, mulching with a farm tractor 3.6 h/ha, and mulching with a purpose-built mulcher 0.9 h/ha (one pass). Manual broadcasting was the cheapest option, at a cost of 400 ZAR/ha. Mulching with a farm tractor and a purpose-built mulcher incurred a cost of 3 267 ZAR/ha and 4 083 ZAR/ha, respectively. Manual broadcasting achieved a minimal reduction of residue size, with 50% of the slash (branches and stem wood) having a mean length above 40 cm. When mulching with a farm tractor was applied, 49% of the slash (branches and stem wood) length reduced to about 30 cm. When a purpose-built mulcher was used, only 10% of the slash elements exceeded 40 cm length.

Quantitative research on positive aspects of work-life integration and the well-being of families with children with disabilities is scarce, especially in the national context. The aim of this study was to examine the contributions of some personal and environmental resources in explaining work-to-family (WFF) and family-to-work (FWF) facilitation and mental health of parents of children with disabilities residing in Croatia. The mediational role of WFF and FWF in the relationship between the resources and mental health was tested, while controlling for some general socio-demographic variables. A total of 571 employed parents of a child/children with disabilities completed an online self-assessment questionnaire. The results showed higher WFF (19%) was predicted by higher levels of social support at work, a higher level of education, posttraumatic growth (PTG) of personal strength, and recovery management. Higher FWF (46%) was predicted by higher levels of social support in the family, PTG of personal strength, the emotional regulation strategy of reorienting to planning, optimism, a lower age, the male gender, a greater number of children, and a higher level of education. A higher level of mental health (47%) was predicted directly by higher levels of optimism, recovery management, FWF, emotional regulation strategies of positive refocusing and planning, and a greater number of children, and indirectly by all the predictors of FWF, through a higher level of FWF (but not WFF).

We previously showed that mice with knockout in the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) gene encoding the PGC-1a protein and nuclear factor erythroid 2 like 2 (NFE2L2) gene, showed some features of the age-related macular degeneration (AMD) phenotype. To further explore the mechanism behind the involvement of PGC-1a in AMD pathogenesis we used young (3-month) and old (12-month) mice with knockout in the PPARGC1A gene and age-matched wild-type (WT) animals. An immunohistochemical analysis showed age-dependent different expression of markers of oxidative stress defense, senescence and autophagy in the retinal pigment epithelium of KO animals as compared with their WT counterparts. Multivariate inference testing showed that senescence and autophagy proteins had the greatest impact on the discrimination between KO and WT 3-month animals, but proteins of antioxidant defense also contributed to that discrimination. A bioinformatic analysis showed that PGC-1a might coordinate the interplay between genes encoding proteins involved in antioxidant defense, senescence and autophagy in the aging retina. These data support importance of PGC-1a in AMD pathogenesis and confirm the utility of mice with PGC-1a knockout as an animal model to study AMD pathogenesis.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

Work in the copper mining industry is often associated with exposure to respirable dust and respirable crystalline silica. This exposure has the potential to cause silicosis, a non-curable occupational respiratory lung disease. This study aimed at establishing the relationship between knowledge, attitudes, work behaviour and practice, compliance with safety standards and exposure to respirable dust. A cross-sectional descriptive survey was conducted on 528 mine workers. Statistical package for social sciences (SPSS) was used for descriptives. Structural Equation Modelling (SEM) with latent variables and partial least-squares (LVPLS) analysis was employed to determine the relationship among these variables. The results indicated that of the four (4) hypotheses, two (2) were supported and two (2) were rejected showing that there is a significant relationship between exposure to respirable dust and work behaviour and practice, as well as compliance with safety standards. Knowledge and attitudes towards respirable dust exposure did not significantly influence exposure. According to the results from the survey, positive work behaviour and practice as well as compliance with safety standards was significantly associated with exposure to respirable dust. It is recommended that the mine should focus on the miners’ work behaviour and practice and compliance with safety standards.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Organophosphate pesticides (OPs) are toxic substances that contaminate aquatic environments, interfere with the development of the nervous system, and induce Neurodevelopmental Toxicity (NDT) in animals and humans. The canonical mechanism of OP neurotoxicity involves the inhibi-tion of acetylcholinesterase (AChE), but other mechanisms non-AChE are also involved and not fully understood. We used network toxicology and molecular docking to identify molecular targets and toxicity mechanisms common to OPs. Targets related to diazinon-oxon, chlorpyrifos oxon, and paraoxon OPs were predicted using the Swiss Target Prediction and PharmMapper databases. Targets related to NDT were compiled from GeneCards and OMIM databases. In order to construct the protein-protein interaction (PPI) network, the common targets between OPs and NDT were imported into the STRING. Networks topological analyses identified EGFR, MET, HSP90AA1, and SRC as hub nodes common to the three OPs. Using Reactome pathway and gene ontology we found that signal transduction, axon guidance, cellular responses to stress, and glutamatergic signaling activation play key roles in OP-induced NDT.

Visual impairment and blindness are a growing public health problem, as they reduce the quality of life of millions of people. The management and treatment of these diseases represent a scientific and therapeutic challenge, since the different cellular and molecular actors involved in the pathophysiology are still being identified. The visual system components, particularly the retinal cells, are extremely sensitive to genetic or metabolic alterations, and immune cells activated by insults contribute to biological events that culminate with vision loss and irreversible blindness. Several ocular diseases are linked to retinal cell loss, and diseases such as retinitis pigmentosa, age-related macular degeneration, glaucoma and diabetic retinopathy are characterized by pathophysiological hallmarks that represent possibilities to study and develop novel treatments for retinal cells degeneration. Here, we present a compilation of revisited information on retinal degeneration, including pathophysiologic and molecular features, biochemical hallmarks and possible directions for novel treatments, aiming to assist as a guide for innovative research. The expansion of knowledge of the mechanistic bases of the pathobiology of eye diseases, including information on the complex interactions of genetic predisposition, chronic inflammation, and environmental and aging-related factors will allow the identification of new therapeutic strategies.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Lipofuscin accumulates with age as intracellular fluorescent granules originating from incomplete lysosomal digestion of phagocytosed and autophagocytosed material. The purpose of this review is to provide an update on the current understanding of the role of oxidative stress and/or lysosomal dysfunction in lipofuscin accumulation and its consequences, particularly for retinal pigment epithelium (RPE). Next, the fluorescence of lipofuscin, spectral changes induced by oxidation, and its contribution to retinal fluorescence are discussed. This is followed by reviewing recent developments in fluorescence imaging of the retina, and the current evidence on the prognostic value of retinal fluorescence for the progression of age-related macular degeneration (AMD), the major blinding disease affecting elderly people in developed countries. The evidence of lipofuscin oxidation in vivo, and the evidence of increased oxidative damage in AMD retina ex vivo lead to the conclusion that imaging of spectral characteristics of lipofuscin fluorescence may serve as a useful biomarker of oxidative damage which can be helpful in assessing the efficacy of potential antioxidant therapies in retinal degenerations associated with accumulation of lipofuscin and increased oxidative stress. Finally, amendments to currently used fluorescence imaging instruments are suggested, to be more sensitive and specific for imaging spectral char-acteristics of lipofuscin fluorescence.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

Purpose: This study evaluates the performance of the Early Intervention Physiotherapist Framework (EIPF) for injured workers. This study provides a proper follow-up period (3 years) to examine the impacts of the EIPF program on injury outcomes such as return to work (RTW) and time to RTW. This study also identifies the factors influencing the outcomes. Methods: The study was conducted on data collected from compensation claims of people who were injured at work in Victoria, Australia. Injured workers who commenced their compensation claims after the first of January 2010 and had their initial physiotherapy consultation after the first of August 2014 are included. To conduct the comparison, we divided the injured workers into two groups: physiotherapy services provided by EIPF-trained physiotherapists (EP) and regular physiotherapists (RP) over the three-year intervention period. We used three different statistical analysis methods to evaluate the performance of the EIPF program. We used descriptive statistics to compare two groups based on physiotherapy services and injury outcomes. We also completed survival analysis using Kaplan-Meier curves in terms of time to RTW. We developed univariate and multivariate regression models to investigate whether the difference in outcomes achieved after adjusting for significantly associated variables. Results: The results showed that physiotherapists in the EP group on average dealt with more claims (over twice as many) than those in the RP group. Time to RTW for the injured workers treated by the EP group was significantly lower than for those who were treated by the RP group, indicated by descriptive, survival and regression analyses. Earlier intervention by physiotherapists led to earlier RTW. Conclusion: This evaluation showed that the EIPF program achieved successful injury outcomes three years after implementation. Motivating physiotherapists to intervene earlier in the recovery process of injured workers by initial consultation helps to improve injury outcomes.

Work on callings has burgeoned in the past 20 years, yet recent reviews exposed a lack of conceptual clarity and disagreements around its definition, components and measures. One lingering point of contention revolves around the element of prosociality: Is a calling orientation primarily motivated by self-interest, prosocially orientated, or a mix of both? This conceptual paper reviews and examines the pro-self and prosocial component of a calling outlook, by examining and comparing the ways in which they feature in different calling subtypes: Classic, neoclassic, and modern callings. Our analysis suggests that these subtypes vary in where they are located on a pro-self – prosocial continuum: Classic callings are located on the prosocial side of the axis, modern callings are located on pro-self side of the axis, and neoclassic callings can be situated in the middle of the con-tinuum, integrating self-orientated and other-orientated motivations. Our analysis further suggests that these calling subtypes draw on divergent value systems: Classic callings are propelled by self-transcendent values, modern callings are driven by self-actualization motivations, and neoclassic callings integrate both value systems. We therefore argue that the subjective experiences of pursuing a calling within each subtype pathway differ, alt-hough they may culminate in similar outcomes. The paper offers a novel framework for analyzing people’s calling that draws on their values.

Introduction: The primary objective of researchers in the biology of ageing is to gain a comprehensive understanding of the ageing process while developing practical solutions that can enhance the quality of life for older individuals. This involves a continuous effort to bridge the gap between fundamental biological research and its real-world applications. Purpose: In this narrative review, we attempt to link research findings concerning the hormetic relationship between neurons and germ cells, and translate these findings into clinically relevant concepts. Methods: We conducted a literature search using PubMed, Embase, PLOS, Digital Commons Network, Google Scholar and Cochrane Library from 2000 to 2023, analyzing studies dealing with the relationship between hormetic, cognitive, and reproductive aspects of human ageing. Results: The process of hormesis serves as a bridge between the biology of neuron-germ cell interactions on one hand, and the clinical relevance of these interactions on the other. Details concerning these processes are discussed here, emphasizing new research which strengthens the overall concept. Conclusions: This review presents a scientifically and clinically relevant argument, claiming that maintaining a cognitively active lifestyle may decrease age-related degeneration, and improve overall health in ageing.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

The merge areas of freeway work zones include relatively significant safety hazards that have continuously led to urgent safety issues to be solved by the management departments. In order to make up for the cumbersome process of independent identification of rear-end collision and lane change collision on complex road sections, an appropriate identification method of traffic conflicts in the merge area of freeway work zone was explored, this study collected vehicle running tracking data from the merge areas of multiple work zones, using an unmanned aerial vehicle video technique. Based on an inter-frame difference method and the principle of a spatio-temporal context visual tracking algorithm, the vehicles were detected and tracked, and the coordinate data of the vehicles in continuous motion were parsed using MATLAB extension tools. Based on the behavior characteristics of vehicle conflict avoidance, a new identification method for evading severe traffic conflicts is proposed according to the initial velocity, acceleration and accident rate of section traffic. Then, a statistical analysis was performed on the spatial distribution characteristics of the traffic conflicts in typical merge areas. The impacts of the road conditions in work zones, vehicle factors, and traffic flow factors on the traffic conflicts were analyzed. A binomial logistic model was established to identify the main influencing factors. The results show that in the merge area of the freeway work zone, there are serious traffic conflicts between vehicles in the following two situations: (Ⅰ) v∈[7,13.5] m/s and a∈[-3.96,-0.65]m/s2; and (Ⅱ) v∈[13.5,24.3] m/s, and a∈[-3.96,-1.57] m/s2. The probabilities of serious traffic conflicts in the first and last 25 m of the merge area are greater than those in the other sections. The smaller the space between the upstream work zone and the merge area, the greater the probability of serious traffic conflicts between vehicles. When the average vehicle speed is relatively high, the probability of serious conflicts is the highest, i.e., by a multiple of 5.95 from the baseline. Moreover, the probability of serious conflicts between vehicles is higher for larger vehicles, i.e., 4.765 times that for small vehicles. The research results can serve as a reference for freeway management departments to improve the safety levels of merge areas during road work. For example, the probability of serious conflicts can be effectively reduced by setting up reasonable speed limit signs in the work zone, increasing the spacing between work zone and merge area, and appropriately diverting large vehicles.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

Flexibility is perceived as a primary reason for working as a gig worker. However, there are not enough studies that investigate gig workers' motivations. Hence, this study aims to examine the motivation of white-collar gig workers using a sample size of 327 gig workers in Mongolia, a developing country’s labor market. The purpose of this study is to investigate intrinsic and extrinsic motivation factors for white-collar gig workers and their impact on behavioral intentions such as those of remote workers, freelancers, and any representatives of digital gig workers, not location-based gig workers. The primary data used in this study were collected through questionnaires from an online platform that attracts white-collar gig workers. The characteristics of this group are analyzed using Smart PLS4.0 software through the PLS-SEM technique to test the hypothesized relationships. Overall, the study contributes to an extension of current literature by understanding the white-collar digital gig workforce’s motivations and reasons behind it.

Hydrogen powered vehicles use high-pressure reservoirs from which the gas is transferred to the low-pressure fuel-cell via a classical pressure reduction valve. In these systems no expansion work is recovered and the question is addressed of the potential to increase the global efficiency by using an expansion machine between the reservoir and the electrochemical reactor. This paper investigates the feasibility of such an expansion machine, evaluates the mechanical constraints in terms of forces, torques and produced power by numeric simulation. It further evaluates the energetic contribution to the whole conversion chain from the hydrogen reservoir to the common electrical network on board. A low energy contribution of the expansion system addresses the question of the real benefit of such an investment.

The concept of ecosystem services (ESs) provides a valuable approach to communicate societies' dependence on natural ecosystems, assisting in the evaluation of measures to protect vegetation in watersheds that promote water-related ESs. Vegetation cover and land use are important factors related to the capacity of ecosystems to provide soil loss regulation and sediment retention services, which are highly relevant for sediment management in watersheds draining into reservoirs with multiple water uses. This study aims to assess the relationship between potential changes in land use and land cover and the sediment retention service provided by riparian vegetation in a watershed draining into a hydroelectric reservoir in the Brazilian Cerrado. Sediment load was selected as a physical variable that affects different water uses in reservoirs, with these uses being dependent on the quality or quantity of stored water. Scenarios were analyzed to represent landscape reconfigurations from a baseline condition in order to account for the recovery of riparian vegetation by the agricultural sector, as foreseen in the Brazilian Forest Code. To map and quantify variations in annual sediment retention, the InVEST model was used, which allows estimating an integrated response of the drainage basin to large-scale land use changes over time and space. The results show that for the drainage basin of the Corumbá IV Hydroelectric Power Plant (HPP), the recovery of riparian areas occupied by annual crops has the potential to generate greater benefits to water use in the reservoir. In the studied catchment area, 14% of the total vegetation deficit in riparian areas is occupied by crops, while 86% is occupied by pastures. This highlights the buffering role of riparian vegetation as an effective practice for managing sediment flows originating from sheet erosion in agricultural landscapes. The methodology employed in this study allows for the quantification and mapping of the effects of soil and water conservation measures in river basins. This enables the prioritization of sectoral efforts for the restoration of native vegetation, considering the highest returns in benefits perceived by water users affected by sediment input in reservoirs. The study's results reinforce the importance of conserving vegetation in riparian areas and their surroundings for sediment retention, highlighting the role of these areas as assets in providing water-related ecosystem services.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

An experimental investigation on the heat pump performance improvement equipped with the two-phase ejector called “an ejector-expansion heat pump (EEHP)” is proposed. The system performance of the EEHP is compared with a vapour-compression heat pump (VCHP). The improvement potential is determined and discussed. The heat pump test system is constructed which is based on a water-to-water heat pump. It can be experimented with both EEHP and VCHP. The two-phase ejector with the cooling load up to 2500 W is installed for experiment. The results show that the EEHP always produces a higher heating rate and COP than the VCHP throughout the specified working conditions. The heating COP is increased by 5.7-12.2% depending on the working conditions. It is also that under the same heat sink and heat source temperature, the EEHP can produce lower compressor discharge temperature and lower compressor pressure ratio than the VCHP. This is evidence that the two-phase ejector can provide better compressor working characteristics which yields a longer compressor lifetime. It is demonstrated that a key to the performance of the EEHP is the expansion pressure ratio. A larger expansion pressure ratio yields a higher improvement potential when compared with the VCHP.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

The application of warm-mixing technology brings considerable economical and environment benefits by decreasing the mixing temperature during warm asphalt mixture(WMA) production. However, the possible water residue also generates concerns in moisture susceptibility. For deep investigation on the influencing factors and mechanism of the moisture susceptibility of WMA, surface free energy(SFE) test and laboratory tests are applied in this research. A novel indicator based on SFE namely effective adhesion work is proposed to assess the asphalt-aggregate adhesion with different moisture contents. Then, given the mixing procedure of dry mixing method, an advanced three-phase model as form of asphalt-aggregate-warm mixing additive is introduced improving from the conventional two-phase asphalt-aggregate model for better reflecting the separate addition of warm mixing additive during mixing. Afterwards, the influence of aggregate types, asphalt type, aggregate moisture contents, warm-mixing agent types and warm-mixing process on the moisture susceptibility of WMA is analyzed utilizing the models and indicators proposed. Finally, the validity of the SFE indicator is verified by comparing the calculation of effective adhesion work with freeze-thaw splitting test result. The results show that all of the above factors impact the moisture susceptibility of WMA by influencing the interfacial adhesion, with the effect of moisture content being the most significant. Meanwhile, effective adhesion work and the three-phase model brought out in this research are proven to be feasible to characterize the adhesion properties of WMA, offering theoretical support to the research on warm mixing technology.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

After three years of the onset of the pandemic, there is scarce evidence about how COVID-19 disease affect the female reproductive system, and consequently, the menstrual cycle. Since the common causes of secondary amenorrhea are considered as exclusion criteria in the studies about menstrual changes following SARS-CoV-2 infection, the prevalence of this event and the influencing factors in formerly menstruating women remains unknown. A retrospective observational cross-sectional study was conducted on Spanish adult women (N= 17,512), using an online survey; a subpopulation of SARS-CoV-2-infected-formerly menstruating women was included in the present analysis (n= 72). Collected data included general characteristics, medical history, and specific information about COVID-19 disease. 38.9% of the respondents experienced menstrual-related disturbances after suffering from the COVID-19 disease, unexpected vaginal bleeding being the most common (20.8%). Other alterations related with the length – “shorter” by 12.5% − and the flow − “heavier than usual” 30.3% − of the menstrual bleeding were reported. The binary logistic regression showed that being a perimenopausal woman (AOR 4.608, CI 95%, 1.018 – 20.856, p = 0.047) and having heavy menstrual bleeding (AOR 4.857, CI 95%, 1.239 – 19.031, p=0.023) are influential factors. This evidence could help health professionals to provide scientifically up-to-date information to their patients, empowering them to actively manage their reproductive health, especially in those societies where menstrual health is still a taboo.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Three facts characterize the hailstorm of 30 August 2022 in the Catalan village of La Bisbal d'Empordà and its surroundings: first, the most dramatic, the death of a child hit by a hailstone. Second, the damage to most of the roofs and cars in the town. Finally, because of the record of hail size (more than 10 cm) in Catalonia in at least the last 30 years. This research focuses on the radar field comparison and the observations provided by an electronic survey of the study area. The results reveal that weather radar sub-estimated the hail size because of different factors. On the opposite, some reporters provided an inaccurate hour. The difference of three months between the hail event and the electronic survey is the probable cause of this mistake in the time estimation. However, the survey delay helped to avoid answers with larger hail sizes than those provided by the official spotters.

Proactivity is a particularly important attribute of knowledge-intensive organizations, where the work required to increase the potential of knowledge-intensive employees is crucial. A priority challenge for these firms is also to understand the increasing importance of the functioning of cognitive mechanisms leading to increased knowledge workers' well-being following the implementation of the psychological contract. The aim of this article is to identify the relationship between inclusive leadership, the fulfillment of the psychological contract, two dimensions of well-being: workplace and life well-being and knowledge workers' proactivity. Based on survey data collected through the CAWI method from 1.000 knowledge workers employed in Polish companies in the business services sector, the research hypotheses were tested using a stepwise equation modelling (SEM) technique, leading to a model containing all the main constructs. The results obtained indicate that inclusive leadership positively impacts the fulfillment of the psychological contract. Furthermore, the fulfillment of the psychological contract positively affects proactive working behavior with and the wellbeing of knowledge workers. Along with proactive work behavior, two dimensions of well-being, were examined as outcome variables. The analysis also shows that knowledge-intensive organizations, intending to build the proactivity of their employees and nurture a high level of well-being in their lives and in the workplace, should take care to fulfil the expectations and obligations of the psychological contract. However, one way to achieve this is for managers to use an inclusive management style, which supports an atmosphere of a safe working environment in a diverse setting and leads to employees feeling comfortable sharing their opinions and ideas. The study of inclusive leadership in the context of knowledge-intensive organizations provides human resource professionals and employee man-agers with important insights into how inclusive leadership can effectively contribute to the psychological contract, which will consequently lead to proactive work behavior and also improve employees' workplace and life well-being.

Previous research on video game player aggression has focused on violent content, while recent studies have examined competitive factors. Few research has examined the solely impacts of competitive factors in video games without violent content on aggression, and it is still unknown what neurological processes of these effects. The present study is the first to examine the the electrophysiological characteristics of short-term competitive video game exposure and aggression. Thirty-five participants played a video game in either competitive or solo mode for 15 minutes, followed by an ERP experiment based on the Oddball paradigm and the hot sauce paradigm to measure aggressive behavior. Results showed that playing competitive game mode was associated with faster judgment to aggressive words, larger P300 amplitudes, and selection of more chili powder. The P300 amplitude partially mediated the relationship between competitive game exposure and aggressive behavior. These findings support the general aggression model.

Negative work behavior (NWB) threatens employee well-being. There are numerous constructs that reflect NWBs, such as bullying, aggression, and discrimination and they are often examined in isolation of each other, limiting scientific integration of these studies. We aim to contribute to this research field by developing a diagnostic tool with content validity on the full spectrum of NWBs. First, we provide a full description of how we tapped and organized content from 44 existing NWB measurement instruments and 48 studies. Second, we discussed our results with experts (N = 3) in this research field to check for missing studies and to discuss our integration results. This two-stage process yielded a questionnaire measuring physical, material, psychological, sociocultural, and digital NWB. Furthermore, the questions include a range of potential actors of NWB, namely internal (employees, managers) and external actors (clients, customers, public, family members) at work and their roles (i.e., target, perpetrator, perpetrator's assistant, target's defender, outsider, and witness of NWBs). Finally, the questionnaire measures what type of harm is experienced (i.e., bodily, material, mental, and social harm).

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

The aim of this study was to investigate the work engagement and burnout in healthcare professionals in a private health unit in Greece. A cross-sectional study was conducted with a sample of 151 professionals (doctors, nurses, administrative staff and professionals of other specialties). The questionnaire included demographic and work-related information and the Utrecht Work Engagement Scale and Maslach Burnout Inventory. Analysis was performed by SPSS v.26. With regard to the work engagement, the participants presented a medium score in absorption and a medium to high score in vigor and dedication. In addition, they presented low score in depersonalization, a medium score in emotional exhaustion and a high score in personal accomplishment. Those who had a working contract for an indefinite period had higher score in all the dimensions of burnout. Vigor, dedication and absorption were negatively correlated with emotional exhaustion and depersonalization and positively with personal accomplishment. Healthcare professionals in private health sector in Greece present moderate work engagement and experience moderate levels of burnout. Work engagement is associated with burnout and plays an important role in its prevention. There are some significant differences in work engagement and burnout based on several demographic and work-related characteristics.

Background: Globally, women’s responsibility for unpaid care work (UCW) remains a barrier to gender equality and women’s empowerment. Rwanda, a low-income country, has a legal and policy framework for promoting gender equality but remains a patriarchal society with women responsible for UCW. Reseaux des Femmes, a local NGO, has been delivering a programme targeted at reducing and redistributing the UCW of women with the objective of gender transformational change. However, there has been no impact evaluation of their intervention to date. Methods/Design: The impact evaluation will be a proof-of-concept critical realist cluster control trial (CRcCT) to evaluate for which women, how and under what circumstances the intervention reduces and redistributes women’s UCW, promote gender equality and women’s empowerment, and improves women’s quality of life. Four clusters of villages in each of five districts in Rwanda will be randomly allocated to the intervention or control arms, and all eligible households, those headed by a couple with at least one child under 12 years, will be recruited. This will yield a sample of around 550 intervention households and 550 control. Discussion: This protocol describes the design of mixed-methods research to evaluate an intervention in Rwanda aimed at reducing and redistributing the time women spend on UCW, thereby promoting gender equality and women’s empowerment. This paper will contribute to our understanding of interventions for transforming gender relations from a scholarly perspective. From a policy perspective, it will act as a proof of concept of Reseaux des Femmes’ Programme.

The kinetic energy transfer between the atmosphere and oceans, called wind work, affects ocean dynamics including near-inertial oscillations and internal gravity waves, mesoscale eddies, and large-scale zonal jets. For the most part, recent numerical estimates of global wind work amplitude are almost 5 times larger than those reported 10 years ago. This large increase is explained by the impact of the broad range of spatial and temporal scales covered by winds and currents, the smallest of which have only recently been uncovered by increasingly high resolution modeling efforts. However, existing satellite observations do not fully sample this broad range of scales. The present study assesses the capabilities of ODYSEA, a conceptual satellite mission to estimate the amplitude of wind work in the global ocean. To this end, we use an ODYSEA measurement simulator fed by the outputs of a km-scale coupled ocean-atmosphere model to estimate wind work globally. Results indicate that compared with numerical truth estimates, the ODYSEA instrument performs well globally, except for latitudes north of 40∘N during summer due to unresolved storm evolution. This performance is explained by the wide-swath properties of ODYSEA (a 1,700 km wide swath with 5 km posting for winds and surface currents), its twice-a-day (daily) coverage at mid-latitudes (low latitudes), and the insensitivity of the wind work to uncorrelated errors in estimated wind and current.

The study is focused on identifying areas of individualization in those mature organizations in which employees are free to make changes. In addition, factors affecting work-life balance and overlap between the jobs employees do and would like to do are determined. A critical review of the literature and a diagnostic survey, including interviews, questionnaires and observations, were used in the research process, together with the analysis of data concerning working conditions. Employees' opinions (n=300) on individualization areas, job crafting and overlap between performed and preferred jobs were analyzed. Calculations were done using IBM SPSS. According to the results, the maintenance of work-life balance (WLB) and the implementation of job crafting positively affect employee efficiency, counteracting professional burnout and a decrease in motivation. It turns out that employees of mature organizations are familiar with the areas of individualization and in some cases have freedom to implement job crafting. They like the work they do, which translates into well-maintained work-life balance. However, a big challenge for mature organizations is the constantly changing economic environment, the long-term nature of work-life balance programmes and their deferred effects. The results of the research can be an important starting point for extended studies.

Tightly regulated and robust mitochondrial activities are critical for normal hearing. Previously, we demonstrated that Fus1 KO mice with mitochondrial dysfunction exhibit premature hearing loss. Molecular analysis of the cochlea revealed hyperactivation of the mTOR pathway, oxidative stress, altered mitochondrial morphology and quantity, suggesting compromised energy sensing and production. Here, we investigated whether pharmacological modulation of metabolic pathways using rapamycin (RAPA) or 2-deoxy-D-glucose (2-DG) supplementation can protect against hearing loss in female Fus1 KO mice. Additionally, we aimed to identify mitochondria- and Fus1-dependent molecular pathways and processes critical for hearing. We found that inhibiting mTOR or activating alternative mitochondrial energetic pathways to glycolysis protected hearing in the mice. Comparative gene expression analysis revealed dysregulation of critical biological processes in the KO cochlea, including mitochondrial metabolism, neural and immune responses, and cochlear hypothalamic–pituitary–adrenal axis signaling system. RAPA and 2-DG mostly normalized these processes, although some genes showed a drug-specific response or no response at all. Interestingly, both drugs resulted in a pronounced upregulation of critical hearing-related genes not altered in the non-treated KO cochlea, including cytoskeletal and motor proteins, and Ca2+-linked transporters and voltage-gated channels. These findings suggest that pharmacological modulation of mitochondrial metabolism and bioenergetics may restore and activate processes critical for hearing, thereby protecting against hearing loss

The frequency of selected polymorphisms, one in each gene coding for proteins with antioxidative properties (CAT, SOD2, GPX1, NQO1) was compared between patients suffering from pain-related temporomandibular disorders (TMDp;n=85) and control subjects (CTR;n=85). According to the Oral Behaviours Checklist score participants were divided into high-frequency parafunction (HFP;n=98) and low-frequency parafunction (LFP;n=72) groups. In addition, we have investigated the association of selected polymorphisms with participants' psychological (anxiety, depression) and psychosomatic (hypervigilance, somatosensory amplification) characteristics. Polymorphisms rs1001179, rs4880, rs1050450, rs689452 were genotyped using the genomic DNA extracted from buccal mucosa swabs and real-time TaqMan genotyping assays. No differences in genotype distribution between TMDp patients and control subjects were found. Still, TMDp patients who were homozygous for minor allele A, related to the GPX1 polymorphism rs1050450 reported significantly more waking-state oral behaviours compared to GA+GG genotype carriers (score: 30 vs. 23, p=0.019). Frequency of genotype AA for rs1050450 polymorphism was higher in HFP compared to LFP participants (14.3% vs. 4.2%, p =0.030). Most important predictors of waking-state oral behaviours were depression, anxiety, AA genotype (rs1050450) and female sex. Explored genetic factors were not found to be significant risk factors for either TMDp or sleep-related oral behaviours. The association of waking-state oral behaviours with selected gene polymorphisms additionally supports previous assumptions that the daytime bruxism is more closely linked to various stress manifestations, which might also be reflected through the variability related to cellular antioxidative activity.

The human polyamines spermine and spermidine are essential for cell function, and their properties have been extensively studied. However, research results of experiments conducted without understanding the properties of polyamines have been evaluated and published by reviewers who appear to have little knowledge of the properties of polyamines. It is sad that some studies repeat what was done more than half a century ago before polyamines were characterized. First, I explain the basic properties of polyamines that researchers need to know. Then, the relationship between changes in polyamine levels in the body and age- and lifestyle-related diseases is discussed. In addition, the epigenetic mechanism of action of polyamines in relation to healthy longevity and, conversely, age- and lifestyle-related diseases and the progression of senescence are discussed. Spermine, which increases with a polyamine-rich diet, acts to suppress aberrant gene methylation and proinflammatory status associated with aging. Meanwhile, chronic inflammation associated with aging induces the enzyme activity of spermine oxidase, which breaks down spermine and produces acrolein, resulting in reduced spermine levels. Acrolein, a toxic aldehyde that increases with age- and lifestyle-related diseases, is thought to accelerate these diseases.

Just 2 years ago, 35% of Americans were involved with gig work. According to Statista, over half of Americans will be freelancing through online gig work by 2027. Research on how consumers select gig workers, or taskers, is still mostly underexplored. The purpose of this study is to investigate the potential impact of a tasker's gender and self-presentation in their profile picture on consumer perceptions and choices. We proposed that taskers who have a professional headshot as the profile picture will receive higher ratings on competence, warmth, and trustworthiness than taskers whose profile picture is a selfie. We also proposed that taskers who smile in their profile picture will receive higher ratings on competency, warmth, and trustworthiness than taskers who do not smile. Furthermore, we predicted that professionalism has a stronger positive impact on perceptions of male taskers than on female taskers for our third hypothesis. Lastly, we hypothesized that gender bias exists on gig platforms, such that smiling will have a stronger positive effect on female taskers’ competence, warmth, and trustworthiness than on male taskers. Our study had 292 Kennesaw State University students who were tested online through Qualtrics. Our first and second hypotheses are not supported but our last two have partial support. There is a significant main effect of gender, and we find that male taskers are rated significantly higher on competence, warmth, and trustworthiness, compared to female taskers. Professional photos give male taskers an advantage over professional female taskers and female taskers are punished more for not smiling than male taskers. Future directions include looking into factors such as Race, Age, or background setting could be investigated. Conducting similar tests in a larger and more externally valid setting could yield more concrete results. Continuation into this new area of gig work could lead the way into revolutionizing how freelancers conduct their public appearance or how gig work platforms could handle this new market.

Oxidative stress (OS) is involved in the pathogenesis of retinal neurodegenerative diseases like age-related macular degeneration (AMD) and diabetic retinopathy (DR) and an important target of therapeutic treatments. New therapeutics are tested in vivo despite limits in transferability and ethical concerns. Retina cultures using human tissue can deliver critical information and significantly reduce the number of animal experiments along with increased transferability. We cultured up to 32 retina samples derived from one eye, analyzed models’ quality, induced OS, and tested efficiency of antioxidative therapeutics. Bovine, porcine, rat, and human retinae were cultured in different experimental settings for 3-14 d. OS was induced by high-glucose or hydrogen peroxide (H2O2) and treated by Scutellarin, pigment epithelium-derived factor (PEDF), and/or granulocyte macrophage-colony stimulating factor (GM-CSF). Tissue morphology, cell viability, inflammation, and glutathione level were determined. Retina samples showed only moderate necrosis (23.83±5.05 increased to 27.00±1.66 AU PI-staining over 14 d) after 14 days in culture. OS was successfully induced (reduced ATP content of 288.3±59.9 vs. 435.7±166.8 nM ATP in controls); antioxidants reduced OS-induced apoptosis (from 124.20±51.09 to 60.80±319.66 cells/image after scutellarin-treatment). Enhanced mammalian animal and human retina cultures allow reliable, highly transferable research on OS-triggered age-related diseases and pre-clinical testing during drug development.

Age-related Macular Degeneration (AMD) is the major cause of elders’ vision loss, early screening and treatment are the most efficient way to reduce the rate of blindness. AI-based methods based on ophthalmic images play great potential for AMD diagnosis. However, low levels of accuracy, robustness, and explainability are challenges for AI approaches applied in clinics. Thus, this study proposed a multi-type of data source fusion method and a multi-model fusion approach for AMD detection. Typical unsupervised (Hierarchical Clustering and K-Means), typical supervised (SVM, VGG-16, and ResNet) methods, and proposed methods (multi-source data fusion-based method and multi-model fusion-based approach) are compared based on Optical Coherence Tomography (OCT), Fundus Autofluorescence (FAF), regular color fundus photography (CFP) and Ultra-Wide field Fundus (UWF) images. Data preprocessing and enhancements of each type of data are discussed. A feature extraction based on unsupervised ML models, feature combination and normalization, and multi-layer perception (MLP) algorithm are involved in the proposed multi-source data fusion-based method. Supervised ML and DL models and a voting mechanism are involved in the multi-model fusion-based approach. Findings show that the proposed methods present a high performance of accuracy and robustness. A real-world UWF database is involved from Shenzhen Aier Hospital. Practical and theoretical contributions are delivered. A reference value for medical diagnosis based on multiple digital images is contributed.

Number of studies claim that tobacco control (TC) regulations are associated with reductions in smoking-related hospitalisation rates, however very few have estimated the impact of TC laws (TCL) at both countrywide and regional levels, and none of them - in relation to compliance with TC regulations. This study evaluates the effects of Russian TCL on hospital admission (HA) rates for pneumonia countrywide and in 10 Russian regions and the extent of these effects in connection with the compliance to TCL. Methods: HA rates for pneumonia during 2005–2019 were analysed to compare the periods before and after the adoption of TCL in 2013. An interrupted time series design and a Poisson regression model were used to estimate the immediate and long-term effects of TCL on pneumonia annual hospitalisation rates after the TCL adoption, compared with the pre-law period. The 10 Russian regions were compared using the TCL Implementation Scale (TCIS) developed on the basis of the results of Russian TC policy evaluation survey; Spearman’s rank correlation and linear regression models were employed. Results showed a 14.3% reduction in HA rates for pneumonia (RR 0.88; p=0.01) after the adoption of TCL in Russia with significant long-term effect after 2013 (RR 0.86; p=0.006). Regions with better enforcement of TCL exhibited greater reductions in pneumonia HA rates (rsp=−0.55; p=0.04); (=−4.21; p=0.02). Conclusions: TCL resulted in a sustained reduction in pneumonia hospitalisation rates, but these effects, varying by region, may depend on the scale of the TCL enforcement.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

Aspects are presented on the interpretation of certainties by assessing risks with maximum level in order to establish reasonable limits of acceptance, tolerance or assumption of risks, supplementing environmental risk factors with external, social, financial elements and introducing a category in the work system analysis.Comparative aspects between INCDPM and MEvAR methods are presented as proposals in the associated tables.The conclusions highlight the current aspects implemented in the method and their usefulness.

This comprehensive treatise is written for the special occasion of the author’s 70th birthday. It presents his lifelong endeavors and reflections with original reasoning and re-interpretations of the most critical and misleading issues in thermodynamics; since now, we have the advantage to look at the historical developments more comprehensively and objectively than the pioneers. Starting from Carnot (grand-father of thermodynamics-to-be) to Kelvin and Clausius (fathers of thermodynamics), and other followers, the most relevant issues are critically examined and put in historical and contemporary perspective. From original reasoning of energy forcing and displacement to logical-proofs of the fundamental laws, to ubiquity of thermal motion and heat, and indestructibility of entropy, including new concept of “thermal roughness” and inevitability of dissipative irreversibility, to “dissecting Carnot true reversible-equivalency” and critical concept of “Carnot-Clausius heat-work equivalency (CCHWE)” regarding interchangeability of heat and work, and to demonstrating “no hope” for the “challengers” of the Second Law of thermodynamics, among others, are offered. It is hoped that the novel contributions presented will enhance comprehension and resolve some of the fundamental issues, as well as promote collaboration and future progress.

Amphetamine is a psychostimulant drug with a high risk of toxicity and death when misused. Abuse of amphetamines is associated with an altered organic profile, which includes omega fatty acids. Low omega fatty acid levels are linked to mental disorders. Using the Comparative Toxicogenomic Database (CTD), we investigated the chemical profile of the brain in amphetamine-related fatalities and the possibility of neurotoxicity. We classified amphetamine cases as low (0-0.5 g/ml), medium (&gt;0.5 to 1.5 g/ml), and high (&gt;1.5 g/ml) based on amphetamine levels in brain samples. All three groups shared 1-octadecene, 1-tridecene, 2,4-di-tert-butylphenol, arachidonic acid, docosahexaenoic acid (DHA), eicosane, and oleylamide. We identified chemical-disease associations using the CTD tools and predict an association between docosahexaenoic and arachidonic acids and curated conditions like autistic disorder, disorders related to cocaine, Alzheimer's disease, and cognitive dysfunction. An amphetamine challenge may cause neurotoxicity in the human brain due to a decrease in omega-3 fatty acids and an increase in oxidative products. Therefore, in cases of amphetamine toxicity, supplement therapy may necessitate preventing omega-3 fatty acid deficiency.

Migraine is a debilitating neurovascular disorder characterized by recurrent headache attacks of moderate to severe intensity. Calcitonin gene-related peptide (GGRP), which is abundantly expressed in trigeminal ganglion (TG) neurons, plays a crucial role in migraine pathogenesis. Cortical spreading depolarization (CSD), the biological correlate of migraine aura, activates the trigeminovascular system. In the present study, we investigated CGRP mRNA expression in TG neurons in a CSD-based mouse migraine model. Our in situ hybridization analysis showed that CGRP mRNA expression was observed in smaller neuronal populations. CSD did not significantly change the density of CGRP mRNA-synthesizing neurons in the ipsilateral TG. However, the cell sizes of CGRP mRNA-synthesizing TG neurons were significantly larger in the 48 h and 72 h post-CSD groups than in the control group. The proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters less than 14 μm became significantly less at several time points after CSD. In contrast, we found significantly greater proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters of 14–18 μm at 24 h, 48, and 72 h post-CSD. We deduce that the CSD-induced upward cell size shift in CGRP mRNA-synthesizing TG neurons might be causative of greater disease activity and/or less responsiveness to CGRP-based therapy.

(1) Background: Little research has been done on professionals' perceptions of institutions and governments during epidemics. We aim to create a profile of physicians who feel they can raise public health issues with relevant institutions during a pandemic. (2) Methods: A total of 1285 Romanian physicians completed an online survey as part of a larger study. We used binary logistic regression to profile physicians who felt able to raise public health issues with relevant institutions; (3) Results: Five predictors could differentiate between respondents who tended to agree with the trust statement and those who tended to disagree: feeling safe at work during the pandemic, considering the financial incentive worth the risk, receiving training on the use of protective equipment, having the same values as colleagues, and enjoying work as much as before the pandemic; (4) Conclusions: Physicians who trust the system to raise public health issues with the appropriate institutions feel they share the same values as their colleagues, say they were trained in the use of protective equipment used during the pandemic, felt they were safe at work during the pandemic, enjoyed their work as much as before the pandemic, and felt the financial bonus justified the risk.

As the world's population ages and the resulting health problems become more serious, medical and health policies in developed countries are focused on how to prevent and treat the diseases of the aging population and how to maintain their quality of life. Typical age-related diseases include deafness, cataracts, osteoarthritis, chronic obstructive pulmonary disease, diabetes mellitus, and dementia. Although the mechanisms by which these diseases develop differ, they are all caused by the accumulation of molecular and cellular damage over time. In addition, age-related diseases can cause a decline in physical and mental functions and the ability to perform activities of daily living, as well as the loss of roles in society and a sense of fulfillment in life. Therefore, there is a need for treatment and measures to accurately grasp and maintain their quality of life.

Vascular calcification (VC) is associated with increased cardiovascular risks in patients with chronic kidney disease (CKD). Sodium-glucose cotransporter 2 inhibitors, like empagliflozin, can improve cardiovascular and renal outcomes. We assessed the expression of Runt-related transcription factor 2 (Runx2), interleukin (IL)-1β, IL-6, AMP-activated protein kinase (AMPK), nuclear factor erythroid-2-related factor (Nrf2), and heme oxygenase 1 (HO-1) in inorganic phosphate–induced VC in mouse VSMCs to investigate the mechanisms underlying empagliflozin’s therapeutic effects. We evaluated biochemical parameters, mean artery pressure (MAP), pulse wave velocity (PWV), transcutaneous glomerular filtration rate (GFR), and histology in an in vivo mouse model with VC induced by an oral high-phosphorus diet following a 5/6 nephrectomy in ApoE−/− mice. Compared to the control group, empagliflozin-treated mice showed significant reductions in blood glucose, MAP, PWV, and calcification, as well as increased calcium and GFR levels. Empagliflozin inhibited osteogenic trans-differentiation by decreasing inflammatory cytokine expression and increasing AMPK, Nrf2, and HO-1 levels. Empagliflozin mitigates high phosphate–induced calcification in mouse VSMCs through the Nrf2/HO-1 anti-inflammatory pathway by activating AMPK. Animal experiments suggested that empagliflozin reduces VC in CKD ApoE−/− mice on a high-phosphate diet.

Abstract: Self-regulated Learning has become one of educational psychology's most critical research areas. Contemporary research indicates that student creativity is crucial to the success of arts education. However, there is limited research on creativity in arts education in Self-regulated Learning. Therefore, this study aims to define the creativity characteristics that determine the quality of students’ work. This study implemented a creative competition in painting and composition for first-year undergraduates. It evaluated the characteristics of creativity during the three main phases of the task: planning, execution, and completion. We discovered through semi-open questionnaires (n=178)，and using the content analysis method. According to the competition results, the students with the highest scores in Flow, Inspiration, and Idea Generation in the Performance phase had the best quality work. In the Forethought phase, Analogical Thinking and Idea Generation worked best for most students, while in the Performance phase, Flow Sense, Idea Generation, and Idea Manipulation worked best.Data on creativity characteristics at different work phases and final quality might adequately guide and organize educational procedures. These findings can serve as a theoretical foundation for quantifying the creativity phase in Self-regulated Learning and offer arts educators a reference for creativity instruction.

Objectives: We aimed to clarify the endoscopic and clinicopathological features of raspberry-shaped gastric lesions (RSGLs) and to establish an endoscopic diagnostic algorithm for RSGLs. Methods: We collected RSGLs from an endoscopic database at our hospital between May 2009 and August 2021. All RSGLs were histopathologically classified and compared based on their endoscopic and clinicopathological characteristics. Results: Sixty-five RSGLs in 54 patients were classified into five histopathological types: gastric adenocarcinoma of foveolar type (GA-FV, n = 43), gastric adenocarcinoma of fundic-gland type (GA-FG, n = 2), gastric adenocarcinoma of fundic-gland mucosa type (GA-FGM, n = 4), hyperplastic polyp (HP, n = 12), and proton pump inhibitor-related lesion (PPI-L, n = 4). All RSGLs exhibited polygonal or curved marginal crypt epithelium (MCE). GA-FV lesions had homogenously reddish (95%) and irregular microvascular (MV) pattern (91%). GA-FG lesions were heterogeneously reddish with a submucosal tumor shape (100%) and had a regular MV pattern (50%). GA-FGM lesions were homogenously reddish (75%) and occasionally had a submucosal tumor shape (50%) with an irregular MV pattern (75%). HP and PPI-L were homogeneously reddish (93%), with linear or dotted MCE (81%) and a regular MV pattern (100%). Conclusion: Our diagnostic algorithm for RSGLs constructed using endoscopic features might be useful for the endoscopic differential diagnosis of RSGLs.

The study of the surface thermodynamic properties of solid materials is primordial for the determination of the dispersive surface energy, polar enthalpy of adsorption and Lewis’s acid base properties of solid particles. Inverse gas chromatography technique (IGC) at infinite dilution is the best surface technique for the determination of the surface physicochemical properties of materials. (1) Background: This paper was devoted to study the surface properties of solid materials such as alumina particles by using IGC technique. (2) Methods: Different methods and molecular models such as spherical, cylindrical, van der Waals, Redlich-Kwong, Kiselev and geometric models, were used to determine the London dispersive surface energy of solid surfaces. Hamieh model was also used and highlighted the thermal effect on the surface area of solvents. (3) Results: The variations of the dispersive surface energy and the free energy of adsorption were determined for alumina particles as a function of the temperature as well as their Lewis’s acid base constants. Alumina surfaces were proved to exhibit a strong Lewis amphoteric character three time more basic than acidic (4) Conclusions: The new methodology based on Hamieh model gave the more accurate results of the physicochemical properties of the particle surfaces.