Identification of the differentially-expressed genes is important for clarification of the complex molecular mechanisms under drought conditions. In this experiment, transcriptome profiles of sensitive and tolerant tomato genotypes under drought stress were analyzed. Three up-regulated genes were selected, included CAB3 (Chlorophyll a-b binding protein3), SAMDC (S-adenosylmethionine decarboxylase proenzyme), and ACS9 (1-aminocyclopropane-1-carboxylate synthase 9). After bioinformatics analysis, tomato genotypes were subjected to drought stress and gene expression was determined using Real-Time-PCR. Physiological parameters of genotypes were also measured by spectrophotometer-based methods. According to the results, these three genes play a key role in stress tolerance. Expression of the CAB3 gene in both sensitive and tolerant genotypes was not significantly different compared to the control, but the SAMDC gene decreased in both genotypes and the ACS9 gene decreased in sensitive genotype and increased in tolerant genotype. The physiological analysis also showed that under stress conditions, the photosynthetic system of the plant was disrupted and the chlorophyll content was reduced, but, proline content and antioxidant enzymes activity increased, in which their quantity in the tolerant genotype was significantly higher than sensitive. Under drought stress, due to damage to the lipid membrane, Malondialdehyde content also increased, in which the sensitive genotype was more affected.

Indiana Vesiculovirus (IVV; formerly as Vesicular stomatitis virus and Vesicular stomatitis Indiana virus) causes a disease in livestock that is very similar to the foot and mouth disease thereby an outbreak may lead to significant economic loss. Long-read sequencing (LRS) -based approaches revealed a hidden complexity of the transcriptomes in several viruses already. This technique was utilized already for the sequencing of the IVV genome, but our study is the first for the application of this technique for the profiling of IVV transcriptome. Since LRS is able to sequence full-length RNA molecules, and thereby providing more accurate annotation of the transcriptomes than the traditional short-read sequencing methods. The objectives of this study were to assemble the complete transcriptome of using nanopore sequencing, to ascertain cell-type specificity and dynamics of viral gene expression and to evaluate host gene expression changes induced by the viral infection. We carried out a time-course analysis of IVV gene expression in human glioblastoma and primate fibroblast cell lines using a nanopore-based LRS approach and applied both amplified and direct cDNA sequencing, as well as cap-selection for a fraction of samples. Our investigations revealed that, although the IVV genome is simple, it generates a relative complex transcriptomic architecture. In this study, we also demonstrated that IVV transcripts vary in structure and exhibit differential gene expression patterns in the two examined cell types.

Mucosal melanomas (MM) are rare aggressive cancers in humans and one of the most common forms of oral cancers in dogs. Similar biological and histological features are shared between MM in both species making dogs a powerful model for comparative oncology studies of melanomas. Although exome sequencing recently identified recurrent coding mutations in canine MM, little is known about changes in non-coding gene expression and more particularly in canine long non-coding RNAs (lncRNAs), which are commonly dysregulated in human cancers. Here, we sampled a large cohort (n= 52) of canine normal/tumor oral MM from three predisposed breeds (poodles, Labrador retrievers and golden retrievers) and used deep transcriptome sequencing to identify more than 400 differentially expressed (DE) lncRNAs. We further prioritized candidate lncRNAs by comparative genomic analysis to pinpoint 26 dog-human conserved DE lncRNAs, including SOX21-AS, ZEB2-AS and CASC15 lncRNAs. Using unsupervised co-expression networks analysis with coding genes, we inferred potential functions of DE lncRNAs suggesting associations with cancer-related genes, cell cycle and carbohydrate metabolism GO terms. Finally, we exploited our multi-breed design to identify DE lncRNAs per breed. This study provides a unique transcriptomic resource for studying oral melanoma in dogs and highlights lncRNAs that may potentially be diagnostic or therapeutic targets for human and veterinary medicine.

The early generative phase of cauliflower (Brassica oleracea var. botrytis) curd ripening is sensitive to the water deficit. Mitochondrial responses under drought within Brassica genus are poorly understood. The main goal of this study was to investigate the mitochondrial biogenesis of three cauliflower cultivars varying with drought tolerance. Diverse quantitative changes (down-regulations mostly) in the mitochondrial proteome were assayed by 2D PAGE coupled with LC-MS/MS. Respiratory (e.g. CII, CIV and ATP synthase subunits), transporter (including diverse porin isoforms) and matrix multifunctional proteins (e.g. components of RNA editing machinery) appeared diversely affected in their abundance under two drought levels. Western immunoassays showed also cultivar-specific responses of selected mitochondrial proteins. Dehydrin-related tryptic peptides found in few 2D spots that appeared immunopositive with dehydrin-specific antisera highlighted the relevance of mitochondrial dehydrin-like proteins for the drought response. The level of selected messengers participating in drought response was also determined. We conclude that the mitochondrial biogenesis was strongly, but diversely affected in various cauliflower cultivars and associated with drought tolerance on the proteomic and functional levels. However, transcriptomic and proteomic regulations were largely uncoordinated due to the suggested altered availability of messengers for translation, mRNA/ribosome interactions and/or miRNA impact on transcript abundance and translation.

Organic solar cells are contributing extensively to the production of future large area and cost-effective sources of renewable energy with a compact environmental impact. Moreover, due to tunable optical properties of the active medium, the semi-transparent organic solar cell can be fabricated and become a promising nominee for building Integrated Photovoltaics (BIPV), vehicles, and mobile electronic devices. Therefore, three newly synthesized polymers used as were host materials for the active medium and blended with beetroot dye. Hence, based on BHJ structure two ternary systems have been constructed and utilized to fabricate semitransparent solar cells and characterized. The results show that the natural dye has a crucial impact on solar cell characteristic parameters. Consequently, large value of V_OC close to 1V were obtained for ternary systems and acceptor material named PINDOLE exhibits potentials for electron transport layer (ETL) and shows an improvement in both fill factor and device efficiency.

In the autonomous navigation of mobile robots, precise positioning is crucial. In forest environments with weak satellite signals or in sites disturbed by complex environments, satellite positioning accuracy has difficulty in meeting the requirements of autonomous navigation positioning accuracy for robots. This article proposes a binocular vision SLAM/UWB tightly coupled localization method. The core of this algorithm is based on an Extended Kalman Filter (EKF), which utilizes the displacement increment output by binocular vision ORB-SLAM and the positioning coordinates calculated via UWB positioning as measurement information to achieve data fusion. The research utilized the constructed experimental platform to collect images and UWB ranging data in outdoor environments and experimentally validated the combined positioning method. The experimental results show that this algorithm outperforms the use of the individual UWB or visual SLAM localization methods in terms of positioning accuracy. Compared with traditional single positioning algorithms, this algorithm exhibits better practicality and stability, and can effectively suppress the impact of UWB non line of sight errors. The average error under normal line of sight conditions is 0.058 m, the root mean square error (RMSE) is 0.080, and the average error under non-line-of-sight conditions is 0.081 m, with an RMSE of 0.084. There is no significant jump or drift. Through the tightly coupled processing of binocular vision SLAM and UWB positioning, more reliable and accurate mobile robot positioning can be achieved, providing a useful reference for the autonomous navigation of mobile robots in complex environments.

Plant protein phosphatase 2Cs (PP2Cs) serve as negative regulators of protein kinase cascades activated in different processes and play important roles in plant development and abiotic-stress-mediated signaling pathways. In this study, a genome-wide study was conducted on the CqPP2C gene family. A total of putative 117 CqPP2C genes were identified. Comprehensive analyses of physical and chemical feature, chromosome localization and subcellular localization were conducted. According to phylogenetic analysis, CqPP2Cs were divided into 13 subfamilies. CqPP2Cs in the same subfamily had similar gene structure, conserved motif and all the CqPP2C proteins had the type 2C phosphatase domains. Gene duplication revealed that segmental duplication was the major driving force for CqPP2Cs expansion and all duplicated CqPP2Cs evolved from purifying selection. The expression of CqPP2Cs in various tissues under different abiotic stresses was analyzed using RNA-seq data. The results revealed that CqPP2C genes were involved in regulating development and stress responses of quinoa. Real-time quantitative reverse transcription PCR (qRT-PCR) analysis of six CqPP2C genes in subfamily A revealed that they were up-regulated or down-regulated under salt and drought treatments. Furthermore, the results of yeast two-hybrid assays revealed that subfamily A CqPP2Cs interacted not only with subclass III CqSnRK2s, but also with subclass II CqSnRK2s. Subfamily A CqPP2Cs could interact with CqSnRK2s in different combinations and intensities to respond to various biological processes and stresses. Overall, our results will be useful for understanding the functions of CqPP2C in regulating ABA signals and responding to abiotic stress.

(1) Background: The imaging energy range of a typical Compton camera is limited due to the fact that scattered gamma photons are seldom fully absorbed when the incident energies are above 3 MeV. Further improving the upper energy limit of gamma-ray imaging has important application significance in active interrogation of special nuclear materials and chemical warfare agents, as well as range verification of proton therapy; (2) Methods: To realize gamma-ray imag-ing in a wide energy range of 0.3~7 MeV, a principle prototype, named a portable three-layer Compton camera, was developed using the scintillation detector that consist of an silicon photo-multiplier array coupled with a Gd3Al2Ga3O12:Ce pixelated scintillator array. Implemented in a list-mode maximum likelihood expectation maximization algorithm, a far-field energy-domain imaging method based on two-interaction and three-interaction events was applied to estimate the initial energy and spatial distribution of gamma-ray sources. The simulation model of detec-tors was established based on Monte Carlo simulation toolkit Geant4. The reconstructed images of a 133Ba, a 137Cs and a 60Co point-like sources were successfully obtained with our prototype in laboratory tests and compared with simulation studies; (3) Results: The proportion of effective imaging events accounted for about 2%, which made our prototype realize reconstructing the distribution of a 0.05 μSv/h 137Cs source in 10 seconds. The angular resolution for resolving two 137Cs point-like sources was 15°. Additional simulated imaging of the 6.13 MeV gamma-rays from 14.1 MeV neutron scattering with water preliminarily demonstrated the imaging capability for high incident energy; (4) Conclusions: We concluded that the prototype had good imaging per-formance in a wide energy range (0.3~7 MeV), which showed potential in several MeV gam-ma-ray imaging applications.

DEXTER (Detection of EXplosives and firearms to counter TERrorism) is a project funded by NATO’s Science for Peace and Security (SPS) program with the goal of developing an integrated system capable of remotely and accurately detecting explosives and firearms in public places without impeding the flow of pedestrians. The active microwave component of the DEXTER project is referred to as MIC (Microwave Imaging Curtain), supported by the French SGDSN (General Secretariat of Defense and National Security), and utilizes a radar system capable of generating 3D images in real time to address non-checkpoint detection of explosives and fire-arms. The project, led by the ONERA (France), is based on a radar imaging system developed by the Fraunhofer FHR institute, using a MIMO architecture with an Ultra Wide-Band waveform. Although high-resolution 3D microwave imaging is already being used in expensive body scanners to detect firearms concealed under clothing, MIC's innovative approach lies in utilizing a high-resolution 3D imaging device that can detect larger dangerous objects carried by moving individuals at a longer range, in addition to providing discrete detection in pedestrian flow. Automatic detection and classification of these dangerous objects is carried out on 3D radar im-ages using a deep-learning network. This paper will outline the project's objectives and constraints, as well as the design, architecture, and performance of the final system. Additionally, it will present real-time imaging results ob-tained during a live demonstration in a relevant environment.

Ganoderma boninense is the major causal agent for the basal stem rot (BSR) disease in oil palm, causing the progressive rot of the basal part of the stem. Despite its prominence, key pathogenicity determinants for the aggressive nature of hemibiotrophic infection remain unknown. In this study, genome sequencing and annotation of G. boninense T10 were carried out using the Illumina sequencing platform and comparative genome analysis was performed with previously reported G. boninense strains (NJ3 and G3). The pan-secretome of G. boninense was constructed and comprised of 937 core orthogroups, 243 accessory orthogroups, and 84 strain-specific orthogroups. A set of core candidate effector proteins (CEPs) were found to be enriched with catalytic protein classified as the carbohydrate-active enzymes, hydrolases as well as non-catalytic proteins. Differential expression analysis revealed an upregulation of CEP genes which was linked to the suppression of PTI signaling cascade while the downregulation of CEP genes was linked to the inhibition of PTI by preventing host defense elicitation. Genome architecture analysis revealed the one-speed architecture of the G. boninense genome and the lack of preferential association of CEP genes to the transposable elements. The findings obtained from this study would aid in the characterization of pathogenicity determinants and molecular biomarkers of BSR disease.

The experiments described in this research article were designed to test the effect of rare variants into genomic prediction in dairy cattle. Common polymorphisms are able to explain only a small proportion of the underlying genetic variation of complex phenotypes. Variants representing functional mutations with large effects on complex phenotypes are expected to be rare due to natural (humans) or artificial (livestock) selection pressure. Therefore, it is important to check whether the use of rare variants could increase the accuracy of ranking of animals by providing the tool for more precise differentiation among the bulls with high additive genetic merit. The goal of our study was to verify whether including rare variants in a genomic selection model allows for a more accurate description of the additive genetic background of traits under selection in dairy cattle. We used the linear mixed model for comparison SNP estimates for Holstein-Friesian cattle of the two data sets – a set containing only single nucleotide polymorphisms defined by minor allele frequency ≥ 0.01, which is routinely used in the Polish genomic evaluation system (46,216 SNPs), and a set containing SNPs selected based only on the call rate (54,378 SNPs). Based on the SNP estimates we also calculated DGV and GEBV and compared them between both data sets. In all the analyses we used production, fertility, conformation and udder health traits. We also assessed the time required for the two most computationally demanding components of genomic selection: preparing genotype data, and estimation of SNP effects between those two data sets. The results of our study indicated that the analysis including rare variants resulted in changes in the individual ranking of the top 100 male and female candidates, but had no effect on the outcome of the quality of EBV prediction as expressed by the Interbull validation test.

The electronic structure and some of its derived properties of Li2CaGeO4 compound have been investigated. The calculations have been performed using the full-potential linearized augmented plane wave plus local orbitals method and ultra-soft pseudo-potentials . The optimized lattice parameters are found to be ingood accord with experiment. Features such as bulk modulus and its pressure derivative, electronic band structure and density of states are reported. The elastic anisotropy of the crystal is discussed and visualized. Moreover, the optical properties reveal that Li2CaGeO4 compound are suitable candidates for optoelectronic devices in the visible and ultraviolet (UV) regions.

Orbit and clock products are used in real-time GNSS precise point positioning without knowing their quality. This study develops a new approach to detect orbit and clock errors through comparing geometry-free and geometry-based wide-lane ambiguities in PPP model. The reparameterization and estimation procedures of the geometry-free and geometry-based ambiguities are described in detail. The effects of orbit and clock errors on ambiguities are given in analytical expressions. The numerical similarity and differences of geometry-free and geometry-based wide-lane ambiguities are analyzed using different orbit and clock products. Furthermore, two types of typical errors in orbit and clock are simulated and their effects on wide-lane ambiguities are numerically produced and analyzed. The contribution discloses that the geometry-free and geometry-based wide-lane ambiguities are equivalent in terms of their formal errors. Although they are very close in terms of their estimates when the used orbit and clock for geometry-based ambiguities are precise enough, they are not the same, in particular, in the case that the used orbit and clock, as a combination, contain significant errors. It is discovered that the discrepancies of geometry-free and geometry-based wide-lane ambiguities are coincided with the actual time-variant errors in the used orbit and clock at the line-of-sight direction. This provides a quality index for real-time users to detect the errors in real-time orbit and clock products, which potentially improves the accuracy of positioning.

Glacier dynamics play an important role in the mass balance of many glaciers, ice caps and ice sheets. In this study we exploit Radarsat-2 (RS-2) Wide Fine (WF) data to determine the surface speed of Svalbard glaciers in the winters of 2012/2013 and 2013/2014 using Synthetic Aperture RADAR (SAR) offset and speckle tracking. The RS-2 WF mode combines the advantages of the large spatial coverage of the Wide mode (150 x 150 km) and the high pixel resolution (9m) of the Fine mode and thus has a major potential for glacier velocity monitoring from space through offset and speckle tracking. Faster flowing glaciers (1.95 m d^-1 - 2.55 m d^-1) which are studied in detail are Nathorstbreen, Kronebreen, Kongsbreen and Monacobreen. Using our Radarsat-2 WF dataset, we compare the performance of two SAR tracking algorithms, namely the GAMMA Remote Sensing Software and a custom written MATLAB script (GRAY method) that has primarily been used in the Canadian Arctic. Both algorithms provide comparable results, especially for the faster flowing glaciers and the termini of slower tidewater glaciers. A comparison of the WF data to RS-2 Ultrafine and Wide mode data reveals the superiority of RS-2 WF data over the Wide mode data.

RNA transcripts play a crucial role as witnesses of gene expression health. Identifying disruptive short sequences in RNA transcription and regulation is essential for potentially treating diseases. Let’s delve into the mathematical intricacies of these sequences. We’ve previously devised a mathematical approach for defining a “healthy” sequence (10.14218/GE.2023.00079). This sequence is characterized by having at most four distinct nucleotides (denoted as nt≤4). It serves as the generator of a group denoted as fp. The desired properties of this sequence are as follows: fp should be close to a free group of rank nt−1, it must be aperiodic, fp should not have isolated singularities within its SL2(C) character variety (specifically within the corresponding Groebner basis). Now, let’s explore the concept of singularities. There are cubic surfaces associated with the character variety of a four-punctured sphere denoted as S24. When we encounter these singularities, we find ourselves dealing with some algebraic solutions of a dynamical second-order differential (and transcendental) equation known as the Painlevé VI equation (10.3390/dynamics4010001). In certain cases, S24 degenerates, in the sense that two punctures collapse, resulting in a “wild” dynamics governed by the Painlevé equations of an index lower than VI. In our paper, we provide examples of these fascinating mathematical structures within the context of miRNAs. Specifically, we find a clear relationship between decorated character varieties of Painlevé equations and the character variety calculated from the seed of oncomirs. These findings should find applications in cancer research.

Flax seed is one of the richest plant sources of linolenic acid (LIN) and also contains unsaturated linoleic acid (LIO) and oleic acid (OLE). Stearoyl-ACP desaturases (SAD) and fatty acid desaturases (FAD) play a key role in the synthesis of flax fatty acids (FA). We sequenced flax seed transcriptomes at the 3, 7, 14, 21, and 28 day after flowering (DAF) for ten flax varieties with different oil FA compositions grown under three temperature/watering conditions. Expression levels of 25 genes of SAD, FAD2, and FAD3 families were evaluated. FAD3b, FAD3a, FAD2b-2, SAD3-1, SAD2-1, SAD2-2, SAD3-2, FAD2a-1, and FAD2a-2 had the highest expression levels, which changed significantly during seed development. These genes probably play a key role in the FA synthesis in flax seeds. High temperature and insufficient watering shifted the maximum expression levels of the FAD and SAD genes to earlier development stages, while the opposite trend was observed for low temperature and excessive watering. Differences in FAD and SAD expression profiles under different growth conditions could contribute to the FA composition of linseed oil. Stop codons in the FAD3a gene, resulting in reduced LIN content, decreased the level of the FAD3a transcript. Some difference in reaching the maximum expression level during seed development was observed between 1) SAD3-1, SAD3-2, and FAD2b-2 and 2) SAD2-1, SAD2-2, FAD2a-1, FAD2a-2, FAD3a, and FAD3b. These groups possibly contribute somewhat differently to the synthesis of FA at different development stages.

Colorectal cancer is a high-incidence tumor that has a high mortality rate due to its frequent metastasis to the liver. The difference in genes, proteins, and immune microenvironment between the primary and metastatic sites causes them to show different responses to treatment. Colorectal cancer liver metastasis patients also tend to show poorer treatment response and prognosis. Therefore, in this paper, we summarize the heterogeneity exhibited after colorectal cancer liver metastasis from five aspects (gene, transcriptome, protein, metabolism, and immunity), and we found that except for the genetic heterogeneity, the other four aspects exhibite significant heterogeneity, which might serve as a new therapeutic direction and a prognostic marker for patients with liver metastasis. Finally, the therapeutic modalities regarding tumors are rapidly evolving, and we have also summarize the new clinical therapeutic modalities currently proposed based on these heterogeneities, aiming to provide new therapeutic ideas for the clinical treatment of patients with colorectal cancer liver metastases.

Pigs are susceptible to cold stress due to the absence of brown fat caused by the partial deletion of uncoupling protein 1 during their evolution. Some local pig breeds in China, exhibit potential cold adaptability, but research has primarily focused on fat and intestinal tissues. Skeletal muscle plays a key role in adaptive thermogenesis in mammals, yet the molecular mechanism of cold adaptation in porcine skeletal muscle remains poorly understood. This study investigated the cold adaptability of two pig breeds, Mashen pigs (MS) and Large White pigs (LW), in a 4-day cold (4°C) or room temperature (25°C) environment. We recorded phenotypic changes and collected blood, and longissimus dorsi muscle for transcriptome sequencing. Finally, a candidate gene was randomly selected for functional exploration in porcine skeletal muscle satellite cells. A decrease in body temperature and body weight in both LW and MS pigs under cold stress, accompanied by increased shivering frequency and respiratory frequency. However, MS pigs demonstrated stable physiological homeostasis, indicating a certain level of cold adaptability. LW pigs primarily responded to cold stress by regulating heat production and Glycolipid energy metabolism. MS pigs exhibited a distinct response to cold stress, involving regulation of heat production, energy metabolism pathways, robust fatty acid oxidation ability, and stronger immune response. Furthermore, the functional exploration of PRSS8 in porcine skeletal muscle satellite cells revealed it affected cellular energy metabolism and thermogenesis by regulating ERK phosphorylation. These findings shed light on the diverse transcriptional responses of skeletal muscle in LW and MS pigs under cold stress, offering valuable insights into the molecular mechanisms underlying cold adaptation in pigs.

In recent years, many studies have reported that several distinct families of transcription factor (TF) genes play crucial roles in the response of plants to abiotic stress. Although some of these families got systematically studied in many species, little knowledge exists about these genes in oil palm (Elaeis guineensis Jacq.). In this study, 20 genes differentially expressed in the leaves of oil palm plants subjected to salinity or drought stress and encoding TFs belonging to four families of TFs - MYB, HD-ZIP, NF-Y, and HSFF - got selected for further characterization. The genes underwent a structural and functional annotation, besides having their RNA-Seq expression profile validated by the qPCR technique, and a correlation analysis of their response under both stresses got performed. The annotation analysis of the promoter region showed the presence of seven cis-acting elements, all already reported to be involved in plants' response to abiotic stress. The structural and functional characterization of the proteins encoded by the selected genes showed that some groups present patterns of conserved regions and are orthologs to genes already linked to salinity or drought resistance in other plant species. It was possible to confirm the RNA-Seq expression profile of 19 genes, only gene 4 showed the opposite response when using qPCR. Through correlation analysis, it was possible to observe a high level of similarity in the behavior of the 20 genes in response to drought or salinity stress, a behavior already reported in other species. The results presented here shed light on the role of 20 TFs in the leaves of young oil palm plants under severe levels of soil salinity or water deprivation. The high level of similarity in the molecular response to both stresses allowed the identification of genes that might grant strategies aiming to develop oil palm plants with a tolerance to both salinity and drought at once.

Rapeseed (Brassica napus L.) is a globally important oilseed crop with various uses, including consumption of its succulent stems as a seasonal vegetable, but its uniaxial branching habit limits the stem yield. Therefore, developing a multi-stem rapeseed variety has become increasingly crucial. In this study, a nature mutant of wild type from germplasm resources with stable inheritance of the multi-stem trait (MS) was obtained and showed abnormal shoot apical meristem (SAM) development and increased main stem number compared to WT. Histological and scanning electron microscopy analyses revealed multiple SAMs in the MS mutant, while only a single SAM was found in WT. Compared to WT, the mutant exhibited increased accumulation of cytokinins (CKs), transcriptome and RT-qPCR analyses showed the expression of genes involved in CK biosynthesis and metabolism pathways were altered in MS mutant. These findings provide insight into the mechanism of multiple main stems formation in Brassica napus L. and lay a theoretical foundation for breeding multi-main stem rapeseed vegetable varieties.

We performed a comprehensive analysis of angiosarcoma (AS) genomic biomarkers and their associations with the site of origin. We aimed to describe the genomic landscape of AS in a cohort of 143 cases of AS profiled by Caris Life Sciences. Data of Next Generation Sequencing (NGS) with a 592 gene panel was available for the entire cohort. Fifty-three cases had data of Whole Exome Sequencing (WES) which we used to study the microenvironment phenotype. Immuno-therapy (IO) response biomarkers: Tumor Mutation Burden (TMB), Microsatellite Instability (MSI) and PD-L1 status were included. IO-response markers were present in 36.4% of the cohort and in 65% of head and neck AS (H/N-AS) (p<0.0001). H/N-AS cases had predominantly muta-tions in TP53 (50.0%, p=0.0004), POT1 (40.5%, p<0.0001) and ARID1A (33.3%, p=0.5875). In breast AS, leading alterations were MYC amplification (63.3%, p<0.0001), HRAS (16.1%, p=0.0377), and PI3KCA (16.1%, p=0.2352). A microenvironment with a high immune signature, associated with better response to IO, was present in 13% of the cases. This signature was evenly distributed among different primary sites. We found that the molecular biology for AS varies significantly according to the primary site. Our findings can facilitate the design and optimiza-tion of therapeutic strategies for AS to overcome resistance to IO and targeted therapies.

In the last couple of years, the implementation of long-read sequencing (LRS) technologies for transcriptome profiling has uncovered an extreme complexity of viral gene expression. In this study, we carried out a systematic analysis on the pseudorabies virus transcriptome by combining our current data obtained by using Pacific Biosciences Sequel and Oxford Nanopore Technologies MinION sequencings with our earlier data generated by other LRS and short-read sequencing techniques. As a result, we identified a number of novel genes, transcripts, and transcript isoforms, including splice and length variants, and also confirmed earlier annotated RNA molecules. One of the major findings of this study is the discovery of a large number of 5’-truncated putative mRNAs embedded into larger host mRNAs. A large fraction of these RNA molecules contain in-frame ORFs, which may encode N-terminally truncated polypeptides. These study demonstrates that the PRV transcriptome is much more complex than previously appreciated.

Plants grown under fluctuating light impact plant developments compared with those grown under non-fluctuating light conditions. However, our knowledge on the underlying regulatory mechanisms is still quite limited, particularly from the transcriptional perspective. In order to investigate the influence of different light intensity distributions on tomato plant development, we designed three fluctuating light intensity distributions with the non-fluctuating light intensity as control and compared the transcriptional differences after five weeks of treatment. We found plant height and aerial/root weight were significantly reduced under all fluctuating light treatments. Transcriptome analysis revealed that the number of up and down regulated genes had a distinct distribution pattern between different treatments and control. The largest difference between the numbers of down and up regulated genes was found between treatment 1 and 3, reaching to a total of 416 genes. The number and type of the top 20 enriched pathways differed between treatments and control. The largest number of genes enriched was involved in the biosynthesis of secondary metabolites. These results provide insights into the transcriptional regulations of tomato under different light intensity distributions.

To understand SARS-CoV-2 microevolution, this study explored the genome-wide frequency, gene-wise distribution, and molecular nature of all point-mutations detected across its 71,703 RNA-genomes deposited in the GISAID repository, till 21 August 2020. Globally, nsp1/nsp2/nsp3/ nsp11 and orf7a/orf3a/S were the most mutation-ridden non-structural and structural genes respectively. Phylogeny based on 4,618 spatiotemporally-representative genomes revealed that entities belonging to the early lineages are mostly spread over Asian countries (including India, the biggest hotspot of the pandemic) whereas the recently-derived lineages are more globally distributed. Of the total 16,602 polymorphism-bearing sites in the pan-genome, 11,037 and 4,965 involved transitions and transversions, which in turn were predominated by cytidine-to-uridine and guanosine-to-uridine conversions, respectively. Positive selection of nonsynonymous mutations (dN/dS >1) in most of the structural, but not non-structural, genes indicated that SARS-CoV-2 has already harmonized its replication/transcription machineries with the host’s metabolic system, while it is still redefining virulence/transmissibility strategies at the molecular level.

Supply chain management requires regular updates of the location of assets, which can be enabled by low power wide area networks, such as Sigfox. While it is useful to localize a device simply by its communication signals, this is very difficult to do with Sigfox because of wide area and ultra narrowband nature. On the other hand, installing a satellite localization element on the device greatly increases its power consumption. We investigated using information about nearby Wi-Fi access points as a way to localize the asset over the Sigfox network, so without connecting to those Wi-Fi networks. This paper reports the location error that can be achieved by this type of outdoor localization. By using a combination of two databases, we could localize the device on all 36 test locations with a median location error of 39 m. This shows that the localization accuracy of this method is promising enough to warrant further study, most specifically the minimal power consumption.

Plant transcriptomes are an extremely dynamic entities shaped spatially and temporally by many intracellular and environmental cues. In this review, we first summarize the complexity and diversity of plant genomes and transcriptomes as a start point for the multitude of transcriptomic responses. Numerous alterations within various tissue and organ-specific transcriptomes as well as the most relevant transcriptomic responses associated with plant acclimation to selected abiotic and biotic stress conditions, from the current studies employing high-throughput transcriptomic analysis are widely discussed. Understanding changes within plant transcriptomes, revealed by in silico functional analysis, allows for the characterization of stress-affected genes and stress acclimatory mechanisms, as well as allows to perform plant metabolic engineering. The latter allow cultivars to produce more secondary metabolites in the future, which are often desirable substances in the biomedical industry. Accordingly, in this review special attention was also paid to characterize the potential of transcriptomic analyses of medicinal species, particularly to search for new cultivars. Extensive characterization of transcriptomic responses in stress would also result in the development of new cultivars that display physiological and molecular mechanisms that allow them to cope with adverse environmental conditions more adequately.

Apple red flesh coloration is a result of the performance of biochemical pathway involved in the biosynthesis of anthocyanins and anthocyanidins. Based on apple genome analysis, high number of regulatory genes, mainly transcription factors such as MYB, which are components of regulatory complex MYB-bHLH-WD40, and several structural genes (PAL, 4CL, CHS, CHI, F3H, DFR, ANS, UFGT) involved in anthocyanin biosynthesis have been identified so far. In this study, we investigated previously unrecognized genes involved in the constitution of red-flesh apple phenotype. These genes could be concerned as molecular markers for early selection of new apple cultivars. Based on comparative transcriptome analysis of apples with different fruit flesh coloration, we successfully identified and characterized ten genes from plant hormone transduction pathway of: auxin (GH3); cytokinins (B-ARR); gibberellins (DELLA); abscisic acid (SnRK2 and ABF); brassinosteroids (BRI1, BZR1 and TCH4); jasmonic acid (MYC2); and salicylic acid (NPR1). In presented studies an analysis of their expression profiles was performed in immature and ripe fruits of red-fleshed cultivars. Generally, we have uncovered, the set of the novel genes, mediating regulation of the abscisic acid, salicylic acid, cytokinins and jasmonic acid signaling and preliminarily described their role in anthocyanin biosynthesis, accumulation and degradation. Their expression was not characterized in apple fruits so far. Presented study, allowed to underline the relationship of genes from hormone signal transduction pathway with UFGT gene, directly responsible for anthocyanin color transformation as well as confirmed their crucial role of plant hormone regulation and anthocyanin accumulation during apple fruit ripening.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, are caused by a combination of multiple events that damage neuronal function. A well-characterized biomarker of neurodegeneration is proteinaceous aggregates accumulation in the brain. However, the gradually worsening symptoms of neurodegenerative diseases are unlikely to be solely due to the result of a mutation in a single gene, but rather a multi-step process involving epigenetic changes. Multiple epigenetic studies have revealed that modification of histones accompanied by both the local and global remodeling of the chromatin structure and alternations in transcriptional patterns are closely associated with the pathogenesis of neurodegenerative diseases. Unlike DNA mutations, epigenetic alterations are reversible, and therefore raise the possibilities for therapeutic intervention including dietary modifications. Additionally, reactive oxygen species may contribute to the pathogenesis of Alzheimer’s disease and Parkinson’s disease. Given that the antioxidant properties of plant-derived phytochemicals are likely to exhibit pleiotropic effects against ROS-mediated epigenetic alternation, dietary intervention may be promising for the management of neurodegeneration in these diseases. In this review, the state-of-the-art applications using single-cell multi-modal omics approaches including genetics, and epigenetics, and dietary approaches for the identification of novel biomarkers and therapeutic approaches for the treatment of neurodegenerative diseases are discussed.

Acanthamoeba keratitis (AK) is a blinding corneal infection caused by the protozoan Acanthamoeba. The long-term course of AK suggests the host immunity could not kill Acanthamoeba rapidly. The immune status is still unclear in the late stage of AK. The comparative transcriptome analysis was made based on the bulk RNA sequencing of cornea tissues from AK patients and donors. Differentially expressed genes and enriched signaling pathways were calculated. CIBERSORT algorithm was used for Immune infiltration analysis of cornea tissue between AK and normal controls. A total of 2668 differentially expressed genes, including 1477 upregulated genes and 1191 downregulated genes, were detected. Gene Ontology analysis revealed that the pathways were significantly enriched in leukocyte migration, regulation of T cell activation, the external side of plasma membrane, collagen-containing extracellular matrix, immune receptor activity and cytokine binding. KEGG pathway analysis showed that the pathways were significantly enriched in the cytokine-cytokine receptor interaction, hematopoietic cell lineage and Staphylococcus aureus infection pathway. The immune infiltration profiles varied little between AK and normal controls. Compared with normal tissue, cornea tissue of AK contained a higher proportion of M0 macrophages and CD8 T cells, while resting memory CD4 T cells contributed to a relatively lower portion (P &lt; 0.05). Finally, the expression levels of cell markers and SLAMF7/STAT6 pathway were confirmed by histopathology examinations, RT-qPCR and western blot.

Pre-implantation horse conceptuses require nutrients and signals from histotroph, the composition of which is regulated by luteal progesterone and conceptus-secreted factors. To distinguish progesterone and conceptus effects we shortened the period of endometrial progesterone-priming by asynchronous embryo transfer. Day 8 embryos were transferred to synchronous (day 8) or asynchronous (day 3) recipients, and RNA sequencing was performed on endometrium and conceptuses recovered 6 and 11 days later (embryo days 14 and 19). Asynchrony resulted in many more differentially expressed genes (DEGs) in conceptus membranes (3473) than endometrium (715). Gene ontology analysis identified upregulation in biological processes related to organogenesis and preventing apoptosis in synchronous conceptuses on day 14, and in cell adhesion and migration on day 19. Asynchrony also resulted in large numbers of DEGs related to ‘extracellular exosome’. In endometrium, genes involved in immunity, the inflammatory response, and apoptosis regulation were upregulated during synchronous pregnancy and, again, many genes related to extracellular exosome were differentially expressed. Interestingly, only 14 genes were differentially expressed in endometrium recovered 6 days after synchronous versus 11 days after asynchronous transfer (day 14 recipient in both). Among these, KNG1 and IGFBP3 were consistently up-regulated in synchronous endometrium. Furthermore bradykinin, an active peptide cleaved from KNG1, stimulated prostaglandin release by cultured trophectoderm cells. The horse conceptus thus responds to a negatively asynchronous uterus by extensively adjusting its transcriptome, whereas the endometrial transcriptome is modified only subtly by a more advanced conceptus.

Viroids are smallest pathogen that consist of non-capsidated, single-stranded non-coding RNA replicons and exploits host factors for their replication and propagation. The severe stunting disease caused by Citrus bark cracking viroid (CBCVd) is a serious threat, which spread rapidly within hop gardens. In this study, we employed comprehensive transcriptome analyses to dissect host-viroid interactions and identify gene expression changes associated with disease development in hop. Our analysis revealed that CBCVd-infection resulted in the massive modulation of activity of over 2000 genes. Expression of genes associated with plant immune responses (protein kinase and mitogen-activated protein kinase), hypersensitive responses, phytohormone signaling pathways, photosynthesis, pigment metabolism, protein metabolism, sugar metabolism and modification and others were altered, which could be attributed to systemic symptom development upon CBCVd-infection in hop. In addition, genes encoding RNA-dependent RNA polymerase, pathogenesis-related protein, chitinase as well as those related to basal defense responses were up-regulated. The expression levels of several genes identified from RNA sequencing analysis were confirmed by qRT-PCR. Our systematic comprehensive CBCVd-responsive transcriptome analysis provides a better understanding and insights into complex viroid-hop plant interaction. This information will assist further in the development of future measures for the prevention of CBCVd spread in hop fields.

A high intake of carbohydrates, associated with obesity, is one of the major causes of fatty liver disease in humans. This study investigated how high carbohydrate intake induces fatty liver disease in Blunt snout bream (Megalobrama amblycephala). Blunt snout bream were fed a high-carbohydrate diet (HCBD) for 60 days. Their growth indices were evaluated, and the transcriptomes, metabolites, biochemistry, and histology of their blood and livers were analyzed. The final weight, weight gain, specific growth rate, and feed conversion ratio were all higher in the HCBD group than in the control group, but not significantly so (P > 0.05). The hepatosomatic index (HSI) differed significantly in the two groups (P < 0.05), and the metabolomics results showed that a high carbohydrate intake induced significant increases in plasma α/β-glucose, succinate, and tyrosine, which could increase hepatic glycogen and triglyceride. Low levels of betaine were also found in the livers of the HCBD group. The histology and blood biochemistry results suggested abnormal liver, with excessive lipid accumulation and liver damage. A transcriptome analysis and quantitative reverse transcription–PCR (RT–qPCR) indicated that the expression of the factors INSR, IRS, PI3K, PDK, AKT, ACC, IL6, AP1, ChREBP-MLX, PEPCK, and FBP in the insulin signaling pathway was significantly upregulated and that of SOCS3, GSK3β, and AMPK significantly downregulated in the HCBD. This pattern is associated with the nonalcoholic fatty liver disease (NAFLD) pathway. This study extends our understanding of how high carbohydrate causes increased fat deposition in the liver, enhanced glycolysis (α/β-glucose) in the plasma, and reduced betaine in the liver. This leads to activation of hepatocyte insulin resistance and lipogenesis by regulating the expression of genes related to fatty liver disease.

Traditional methods for discovery and development of new drugs can be a very time-consuming and expensive process because it includes several stages such as compound identification, pre-clinical and clinical trials before the drug is approved by the US Food and Drug Administration (FDA). Therefore, drug repurposing, namely using currently FDA-approved drugs as therapeutics for other diseases than what they are originally prescribed for, is emerging to be a faster and more cost-effective alternative to current drug discovery methods. In this paper, we have described a three-step in silico protocol for analyzing transcriptomics data using online databases and bioinformatics tools for identifying potentially repurposable drugs. The efficacy of this protocol was evaluated by comparing its predictions with the findings of two case studies of recently reported repurposed drugs: HIV treating drug Zidovudine for the treatment of Dry Age-Related Macular Degeneration and the antidepressant Imipramine for Small-Cell Lung Carcinoma. The proposed protocol successfully identified the published findings, thus demonstrating the efficacy of this method. In addition, it also yielded several novel predictions that have not yet been published, including the finding that Imipramine could potentially treat Severe Acute Respiratory Syndrome (SARS), a disease that currently does not have any treatment or vaccine. Since this in-silico protocol is simple to use and does not require advanced computer skills, we believe any motivated participant with access to these databases and tools would be able to apply it to large datasets to identify other potentially repurposable drugs in the future.

Gallium oxide (Ga2O3) is an emerging wide bandgap semiconductor promising a wide range of important applications. However, mass production of high-quality crystalline Ga2O3 still suffers from limitations associated with poor reproducibility and low efficiency. Low-temperature grown amorphous Ga2O3 demonstrates comparable performance with its crystalline counterparts. Lanthanide Er3+-doped Ga2O3 (Ga2O3: Er) possesses great potential for developing light-emitting devices, photodetectors and optical waveguides. The host circumstance can exert a crystal field around the lanthanide dopants and strongly influence their photoluminescence properties. Here we present a systematical study of the impact of amorphous-to-crystalline transition on the upconversion photoluminescence in Ga2O3: Er thin films. Through controlling the growth temperature of Ga2O3: Er films, the upconversion luminescence of as-grown thin films are strongly enhanced over 100 times. Moreover, the variation of photoluminescence reflects the amorphous-to-crystalline transformation of the Ga2O3: Er thin films. These results will aid further design of favorable optoelectronic devices integrated with lanthanide-doped Ga2O3 thin films.

The small satellite market continues to grow year after year. A compound annual growth rate of 17% is estimated during the period between 2020 and 2025. Low-cost satellites can send a vast amount of images to be post-processed at the ground to improve the quality and extract detailed information. In this domain lies the resolution enhancement task, where a low-resolution image is converted to a higher resolution automatically. Deep learning approaches to Super-Resolution (SR) reached the state-of-the-art in multiple benchmarks; however, most of them were studied in a single-frame fashion. With satellite imagery, multi-frame images can be obtained at different conditions giving the possibility to add more information per image and improve the final analysis. In this context, we developed and applied to the PROBA-V dataset of multi-frame satellite images a model that recently topped the European Space Agency’s Multi-frame Super Resolution (MFSR) competition. The model is based on proven methods that worked on 2D images tweaked to work on 3D: the Wide Activation Super Resolution (WDSR) family. We show that with a simple 3D CNN residual architecture with WDSR blocks and a frame permutation technique as data augmentation better scores can be achieved than with more complex models. Moreover, the model requires few hardware resources, both for training and evaluation, so it can be applied directly from a personal laptop.

Species of the genus Drosophila have served as favorite models in speciation studies; however, genetic factors of interspecific reproductive incompatibility are underinvestigated. Here we performed the analysis of hybrid female sterility by crossing Drosophila melanogaster females and Drosophila simulans males. Using transcriptomic data analysis, molecular, cellular, and genetic approaches, we analyzed differential gene expression, transposable element (TE) activity, piRNA biogenesis, and functional defects of oogenesis in hybrids. Premature germline stem cell loss was the most prominent defect of oogenesis in hybrid ovaries. Due to the differential expression of genes encoding piRNA pathway components, rhino and deadlock, the functional RDCmel complex in hybrid ovaries was not assembled. However, the activity of the RDCsim complex was maintained in hybrids, independent of the genomic origin of piRNA clusters. Despite the identification of a cohort of overexpressed TEs in hybrid ovaries, we found no evidence that their activity can be considered the main cause of hybrid sterility. We revealed a complicated pattern of Vasa protein expression in the hybrid germline, including partial AT-chX piRNA targeting of the vasasim allele and a significant zygotic delay in vasamel expression. We arrived at the conclusion that the hybrid sterility phenotype was caused by intricate multi-locus differences between the species.

Innovative strategies to control malaria are urgently needed. Exploring the interplay between the Plasmodium sp. parasites and host red blood cells (RBC) offers opportunities for novel antimalarial interventions. Pyruvate kinase deficiency (PKD), characterized by heightened 2,3-diphosphoglycerate (2,3-DPG) concentration, has been associated with protection against malaria. Elevated 2,3-DPG levels, a specific mammalian metabolite, may hinder glycolysis, prompting us to hypothesize its potential contribution to PKD-mediated protection. We investigated the impact of the extracellular supplementation of 2,3-DPG on the Plasmodium falciparum intraerythrocytic developmental cycle in vitro. Results showed an inhibition of parasite growth, resulting from significantly less progeny from 2,3-DPG-treated parasites. We analyzed differential gene expression and the transcriptomic profile of P. falciparum trophozoites, from in vitro cultures submitted or not submitted to the action of 2,3-DPG, using Nanopore Sequencing Technology. The presence of 2,3-DPG in the culture medium was associated to a significant differential expression of 71 genes, mostly associated to GO terms nucleic acid binding, transcription, or monoatomic anion channel. Further, several genes related to the cell cycle control were downregulated in treated parasites. These findings suggest that the presence of this RBC-specific glycolytic metabolite impact the expression of genes transcribed during the parasite trophozoite stage and the number of merozoites released from individual schizonts, which supports the potential role of 2,3-DPG in the mechanism of protection against malaria by PKD.

In recent years, frequent occurrences of low temperature disasters due to global climate change have significantly impacted the normal growth of crops. Research has indicated that inorganic selenium (which is more toxic) can not only enhance the effects of low temperature stress but also increase selenium content on plants; however, there is a scarcity of studies investigating the impacts of organic selenium and nano-selenium on crops. In order to investigate whether organic selenium and nano-selenium can enhance low-temperature tolerance and increase selenium content in pak choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), different concentrations (0, 5, 10, 20 mg L-1) of exogenous selenium were applied in this experiment to assess their effects on plant growth, nutritional quality and antioxidant properties. RNA-Seq technology was used to sequence the transcriptome of the leaves. Based on the transcriptome data, a Weighted Gene Co-expression Network Analysis (WGCNA) was employed to construct a network that associates with physiological traits related to stress resistance. Two highly correlated gene co-expression modules were identified, and within them, nine hub genes associated with endocytosis, antioxidant stress, absorption, transport, and metabolism of selenium were discovered. The results indicated that the beneficial effects on yield and total selenium content under low temperature were attributed to (1) protection of photosynthetic pigments for enhancing photosynthetic capacity by the up-regulation of LHca2, LHcb1, LHca1, LHcb4 in KEGG pathway: photosynthesis-antenna proteins; (2) activation of antioxidant system for efficient ROS homeostasis such as SOD, POD and CAT by the genes such as Superoxide dismutase, Monodehydroascorbate and (3) selenium absorption by endocytosis, seleninum transportation by ABC transporter gene family and selenium metabolism related genes such as Cysteine synthase, Glutaredoxin. These findings provide a foundation for further investigation into the molecular mechanisms underlying the effects of organic selenium and nano-selenium on cyanochloride production at low temperatures.

Cancer researchers are fascinated by the chemistry of diverse natural products which show exciting potential as anticancer agents. In this study, we aimed to investigate the anticancer properties of watermelon rind extract (WRE) by examining its effects on cell proliferation, apoptosis, senescence, and global gene expression in human renal cell adenocarcinoma cells (HRAC-769-P) in vitro. Our metabolome data analysis of WRE exhibited untargeted phyto-constituents and targeted citrulline (22.29 µg/mg). HRAC-769-P cells were cultured in RPMI-1640 media and treated with 22.4, 44.8, 67.2, 88.6, 112, 134.4, and 156.8 mg mL-1 for 24, 48, and 72 hrs. At 24 hrs after treatment, (88.6 mg ml-1 of WRE) cell proliferation significantly reduced, more than 34% compared to the control. Cell viability decreased 48 and 72 hours after treatment to 45% and 37%, respectively. We also examined poly caspase, SA-beta-galactosidase (SA-beta-gal), and wound healing activities using WRE. All treatments induced an early poly caspase response and a significant reduction in cell migration. Further, we analyzed the transcript profile of the cells grown at 44.8 mg ml-1 of WRE after 6 hours using RNA sequencing (RNAseq) analysis. We identified 186 differentially expressed genes (DEGs), including 149 upregulated genes and 37 downregulated genes, in cells treated with WRE compared to the control. The differentially expressed genes were associated with NF-Kappa B signaling and TNF pathways. Crucial apoptosis-related genes such as BMF, NPTX1, NFKBIA, NFKBIE, and NFKBID might induce intrinsic and extrinsic apoptosis. Another possible mechanism is a high quantity of citrulline may lead to induction of apoptosis by the production of increased nitric oxide. Hence, our study suggests the potential anticancer properties of WRE and provides insights into its effects on cellular processes and gene expression in HRAC-769-P cells.

Bromodomain (BRD)-containing proteins are involved in many biological processes, most notably epigenetic regulation of transcription, and BRD protein dysfunction has been linked to many diseases, including tumorigenesis. However, the role of BRD proteins in the pathogenesis of uterine fibroids (UFs) is entirely unknown. The present study aimed to determine the expression pattern of BRD9 protein in UFs and matching myometrium and further assess the impact of BRD9 inhibitors on UF phenotype and epigenetic/epitranscriptomic changes. Our studies demonstrated that the levels of BRD9 were significantly upregulated in UFs compared to matched myometrium, suggesting that the aberrant BRD protein expression may contribute to the pathogenesis of UFs. We then evaluated the potential roles of BRD9 using its specific inhibitor I-BRD9. Targeted inhibition of BRD9 suppressed the UF tumorigenesis with increased apoptosis and cell cycle arrest, decreased cell proliferation, and extracellular matrix deposition in UF cells. The latter is the key hallmark of UFs. Unbiased transcriptomic profiling coupled with downstream bioinformatics analysis further and extensively demonstrated that targeted inhibition of BRD9 impacted the cell cycle- and ECM-related biological pathways, reprogrammed the UF cell epigenome and epitranscriptome, and altered miRNA-mediated gene regulation in UFs. Taken together, our data support the critical role of BRD9 in UF cells and the strong interconnection between BRD9 and other pathways controlling the UF progression. Targeted inhibition of BRD proteins might provide a non-hormonal treatment option for this most common benign tumor in women of reproductive age.

The current classification of acute myeloid leukemia (AML) relies largely on genomic alterations. AML with mutated Nucleophosmin1 (NPM1-mut) is the largest of the genetically defined groups, involving about 30% of adult AMLs and is currently recognized as a distinct entity in the actual AML classifications. NPM1-mut AML usually occurs in de novo AML and is associated predominantly with a normal karyotype and relatively favorable prognosis. However, NPM1-mut AMLs are genetically, transcriptionally, and phenotypically heterogeneous. Furthermore, NPM1-mut is a clinically heterogenous group. Recent studies have in part clarified the consistent heterogeneities of these AMLs and have strongly supported the need for an additional stratification aiming to improve the therapeutic response of the different subgroups of NPM1-mut AML patients.

Following the central dogma of molecular biology, gene expression heterogeneity can aid in predicting and explaining the wide variety of protein products, functions, and, ultimately, heterogeneity in phenotypes. There is currently overlapping terminology used to describe the types of diversity in gene expression profiles, and overlooking these nuances can misrepresent important biological information. Here, we describe transcriptome diversity as a measure of the heterogeneity in 1) the expression of all genes within a sample or a single gene across samples in a population (gene-level diversity) or 2) the isoform-specific expression of a given gene (isoform-level diversity). We first overview modulators and quantification of transcriptome diversity at the gene level. Then, we discuss the role alternative splicing plays in driving transcript isoform-level diversity and how it can be quantified. Additionally, we overview computational resources for calculating gene-level and isoform-level diversity for high-throughput sequencing data. Finally, we discuss future applications of transcriptome diversity. This review provides a comprehensive overview of how gene expression diversity arises, and how measuring it determines a more complete picture of heterogeneity across proteins, cells, tissues, organisms, and species.

A recent paradigm shift in diagnostics of medulloblastoma allows the distinction of four major groups defined by genetic data rather than histology. This new molecular classification correlates better with prognosis and will allow better clinical management for therapies targeting druggable mutations, but also offers a new combination of monitoring tumor development in real-time and treatment response by sequential liquid biopsy. This review highlights recent developments after a century of milestones in neurosurgery, radio- and chemotherapy, but also controversial theories on the cell of origin, animal models and the use of liquid biopsy.

Crustacean hyaluronidases are 1 poorly understood both in terms of their enzymatic properties and in terms of their structural features. In this work, we have shown that the hepatopancreas homogenate of the red king crab has a hyaluronidase activity that is an order of magnitude higher than its commercial counterpart. Zymography revealed the hyaluronidase activity of the protein roughly from40 to 50 kDa relative to the molecular marker used in electrophoresis. Analysis of the hepatopancreas transcriptome revealed a hyaluronidase sequence with an expected molecular weight of 42.5 kDa. It turned out that the reaction of cleavage of hyaluronate in the presence of a homogenate proceeds by the mechanism of b-elimination, which is well known for bacterial hyaluronidases. Thus, a new hyaluronidase of higher eukaryotes was found and described, which is not integrated into the modern classification of hyaluronidases.

The Pashmina and Barbari are two famous goat breeds found in the wide areas of the Indo-Pak region. Pashmina is famous for its long hair-fiber (Cashmere) production while Barbari is not-selected for this trait. So, the mRNA expression profiling in the skin samples of both breeds would be an attractive and judicious approach for detecting putative genes involved in this valued trait. Here, we performed differential gene expression analysis on publicly available RNA-Seq data from both breeds. Out of 44,617,994 filtered reads of Pashmina and 55,995,999 of Barbari which are 76.48% and 73.69% mapped to the ARS1 reference transcriptome assembly respectively. A pairwise comparison of both breeds resulted in 47,159 normalized expressed transcripts while 8,414 transcripts are differentially expressed above the significant threshold. Among these, 4,788 are upregulated in Pashmina while 3,626 transcripts are upregulated in Barbari. Fifty-nine transcripts harbor 57 genes including 32 LOC genes and 24 are annotated genes which were selected on the basis of TMM counts > 500. Genes with ectopic expressions other than uncharacterized and LOC symbol genes are Keratins (KRT) and Keratin Associated Proteins (KRTAPs), CystatinA&6, TCHH, SPRR4, PPIA, SLC25A4, S100A11, DMKN, LOR, ANXA2, PRR9 and SFN. All of these genes are likely to be involved in keratinocyte differentiation, sulfur matrix proteins, dermal papilla cells, hair follicles proliferation, hair curvature, wool fiber diameter, hair transition, hair shaft differentiation and its keratinization. These differentially expressed reported genes are critically valuable for enhancing the quality and quantity of the pashmina fiber and overall breed improvement. This study will also provide important information on hair follicle differentiation for further enrichment analyses and introducing this valued trait to other goat breeds as well.

With the vast amount of goods being shipped around the world, there is a need to track and manage various types of assets, particularly shipping containers. Logistics industries dealing with small facilities, shipments, equipment, and vehicles must be tracked. There are many applied asset tracking systems such as Radio-Frequency Identification (RFID), Bluetooth Low Energy (BLE) Beacon, and Long-Range Radio (LoRa). This paper presents these systems and focuses on locating assets using LoRaWAN technology, which has a positive impact on the responsive and sustainable cities in Egypt. IoT-based Long Range (LoRa) is a low-power, wide-area communication technology that uses radio frequencies to transmit data over long distances. The extended range, low power consumption, low maintenance, and the ability to store location data when the end node that needs to connect to the asset is out of the gateway's coverage make LoRa a good choice for developing asset-tracking applications. This paper introduces a real-time tracking experiment as a result of a project implementation, whose goals are aligned with industry, innovation, and infrastructure and Sustainable Cities and Communities, the Sustainable Development Goals (SDGs) No. 9 and 11.

Based on the topology of wide area protection system (WAPS), after studying the reliability of hardware system and information flow in the WAPS and establishing the reliability assessment model, the multi-service reliability analysis method with multi monitoring and protection tasks in WAPS was proposed. In the model, the impact of network quality of service (QoS) such as information flow loss and delay, is studied. On the base of the model, the multi-service reliability evaluation method is employed to analyze the reliability of a WAPS of IEEE14 node power system, and the key nodes of the WAPS is given, which provides a basis for improving the reliability of the WAPS.

Recent studies have elucidated the diversity of genes encoding venom in sea anemones. However, most of those genes are yet to be explored in an evolutionary context. Insulin is a common peptide across metazoans and has been coopted into a predatory venom in many venomous lineages. In this study, we focus on the diversity of insulin-derived venoms in sea anemones and on elucidating their evolutionary history. We sourced data for 34 species of sea anemones and found sequences belonging to two venom families that have Insulin PFAM annotations (Cono-Insulin, VP302). Our findings show that both families have undergone duplication events. Members of each of the independently evolving clades have consistent predicted protein structures and distinct dN/dS values. Our work also shows that VP302 is part of a multidomain venom contig and has experienced a secondary gain into the venom system of cuticulate sea anemones.

Poa crymophila is a perennial, cold-tolerant, native grass species, widely distributed to the Qing-hai-Tibet Plateau. However, the molecular mechanism behind the cold stress tolerance and role of key regulatory genes and pathways of P. crymophila are poorly understood yet. Therefore, the present study investigated the physiological and transcriptome responses of P. crymophila’s roots, stems, and leaves under cold stress to explore the molecular mechanism of cold tolerance. Results of the present study suggested that cold stress significantly changed the physiologic characteristics of roots, stems, and leaves of P. crymophila. In addition, the transcriptome results showed that 4434, 8793, and 14942 differentially expressed genes (DEGs) were identified in roots, stems, and leaves, respectively; however, 464 DEGs were commonly identified in these three tissues. The Gene On-tology (GO) results showed that a large numbers of DEGs were significantly enriched in the pho-tosynthetic related categories in leaves. In addition, the “response to stimulus” category was sig-nificantly enriched in roots and stems. The Kyoto Encyclopedia of Genes and Genomes (KEGG) results showed that DEGs involved in “phenylpropanoid biosynthesis” were significantly enriched in roots, “photosynthesis” and “circadian rhythm-plant” pathways significantly enriched in stems and leaves, starch and sucrose metabolism, and galactose metabolism were pathways significantly enriched in three tissues. Weighted gene coexpression network analysis (WGCNA) identified Hub genes involved in P. crymophila cold response. This study provides new insights into the molecular mechanisms underlying the cold tolerance of P. crymophila belowground and aboveground tissues. In addition, specific genes involved in Ca2+ signaling, ROS scavenging system, hormones, circadian clock, photosynthesis, and transcription factors (TFs) were identified in P. crymophila. The identi-fication of key genes may provide valuable resources for further functional genomic and breeding studies.

Atrial fibrillation (AF) is a form of sustained cardiac arrhythmia and microRNAs (miRs) play crucial roles in pathophysiology of AF. To identify novel miR-mRNA pairs, we performed RNAseq from atrial biopsies of AF and non-AF patients. Differentially expressed miRs (11-down and 9-up) and mRNAs (95-up and 82-down) were identified and hierarchically clustered in a heat-map. Subsequently, GO, KEGG, and GSEA analyses were run to identify deregulated pathways. Then, miR targets were predicted in miRDB database, and a regulatory network of negatively correlated miR-mRNA pairs was constructed using Cytoscape. To select potential candidate genes from GSEA analysis, top-50 enriched genes in GSEA were overlaid with predicted targets of differentially deregulated miRs. Besides, protein-protein-interaction (PPI) network of enriched genes in GSEA was constructed, and subsequently GO and canonical pathway analyses were run for genes in PPI network. Our analyses showed that TNF-α, p53, EMT, and SYDECAN1 signaling were among the highly affected pathways in AF samples. SDC-1 (syndecan-1) was the top-enriched gene in p53, EMT, and SYDECAN1 signaling. Consistently, SDC-1 mRNA and protein levels were significantly higher in atrial samples of AF patients. Among negatively correlated miRs, miR-302b-3p was experimentally validated to suppress SDC-1 transcript levels. Overall, our results suggested that miR-302b-3p/SDC-1 axis may involve in pathogenesis of AF.

The reflection and transmission spectra of a metamaterial formed by omega-shaped elements with pre-calculated optimal parameters on a silicon substrate have been recorded in the terahertz range at oblique incidence for the s- and p- polarizations of the incident wave. The spectra were interpreted within the dipole radiation theory of electromagnetic waves. Both measurement results and analysis provide evidence sup-porting the presence of a pronounced polarization anisotropy impact in the reflection and transmission of the metamaterial. The potential of these materials to be utilized in the development of devices that control the polarization properties of THz radiation across a wide spectral range is examined.

In recent, Chae found that, at weak gravitational acceleration g_N≲10⁻⁹ms⁻², the observed orbit of the wide binary stars is not accordant with current theory of binary star. Here, we present, this finding should be an observational evidence for that Newtonian theory of orbit perturbation is still valid in galactic scale.

The aim of this study was to identify the differentially expressed genes (DEG) from the skeletal muscle and liver samples of animal model for metabolic diseases in human. To perform the study, the fatty acid (FA) profile and RNA sequencing (RNA-Seq) data of 35 samples of liver tissue (SOY1.5, n=17 and SOY3.0, n=18) and 36 samples of skeletal muscle (SOY1.5, n=18 and SOY3.0, n=18) of Large White pigs were analyzed. The FA profile of the tissues was modified by the diet, mainly those related to monounsaturated (MUFA) and polyunsaturated (PUFA) FA. The skeletal muscle transcriptome analysis revealed 45 DEG (FDR 10%), and the functional enrichment analysis identified network maps related to inflammation, immune process, and pathways associated with the oxidative stress, type 2 diabetes and metabolic dysfunction. For the liver tissue, the transcriptome profile analysis revealed 281 DEG, which participate in network maps related to neurodegenerative diseases. With this nutrigenomics study, we verified that different levels of soybean oil in the pig diet, an animal model for metabolic diseases in humans, affected the transcriptome profile of skeletal muscle and liver tissue. These findings may help to better understand the biological mechanisms that can be modulated by the diet.

The main aim of this work is to present a step-by-step procedure to model and analyze the power loss distribution of three-level Gallium Nitride (GaN) inverters. It has been applied to three distinct three-phase three-levels voltage source inverters utilized in electric traction drives: Active Neutral Point Clamped, Neutral Point Clamped and T-Type Neutral Point Clamped. The proposed analytical power loss modelling, combined to an equivalent representation of the electrical machine demonstrated to be a viable solution to achieve a time-saving and low computational burden simulation platform, leading to satisfying accuracy results. This has been confirmed by comparing the results carried out from the simulations of a 110kW permanent magnet synchronous motor drive and those determined by considering a simplified circuital representation based on the proposed analytical power loss modelling.

Maternal obesity and gestational diabetes mellitus (GDM) are linked with impaired placental function and early onset of non-communicable cardiometabolic diseases in offspring. Previous studies have highlighted that the dietary non-esterified fatty acids (NEFAs), palmitate (PA) and oleate (OA), key dietary metabolites associated with maternal obesity and GDM, are potential modulators of placental lipid processing. Using the BeWo cell line model, the current study integrated transcriptomic (mRNA microarray), metabolomic, and lipidomic readouts to characterize the underlying impacts of exogenous PA and OA on placental villous trophoblast cell metabolism. Targeted gas chromatography and thin layer chromatography highlighted that saturated and monounsaturated NEFAs differentially impact BeWo cell lipid profiles. Furthermore, cellular lipid profiles differed when exposed to single and multiple NEFA species. Additional multi-omic analyses suggested that PA exposure is associated with enrichment in β-oxidation pathways, while OA exposure is associated with enrichment in anti-inflammatory and antioxidant pathways. Overall, this study further demonstrated that dietary PA and OA are important regulators of placental lipid metabolism. Encouraging appropriate dietary advise and implementing dietary interventions that maintain appropriate placental function by limiting excessive exposure to saturated NEFAs such as PA, will continue to be crucial in the clinical management of at-risk obese and GDM pregnancies.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with septic cardiomyopathy being a common and severe complication. Despite its significant clinical impact, the molecular mechanisms underlying sepsis-induced cardiomyopathy (SICM) remain incompletely understood. In this study, we performed a comparative analysis of whole transcriptome profiles in two widely used mouse models of septic cardiomyopathy, the cecal ligation and puncture (CLP) model and the lipopolysaccharide (LPS) model. Our aim was to identify key genes and pathways involved in the development of septic cardiomyopathy and to evaluate the similarities and differences between the two models. Our findings suggested that 1) both methods can induce septic heart dysfunction within 24 hours; 2) distinct whole transcriptome expression profiles are revealed; 3) potentially different pathways are involved in causing heart failure in sepsis. The comprehensive comparison provides valuable insights into the molecular basis of septic cardiomyopathy and contributes to the ongoing search for effective treatment strategies, triggered by different factors for SICM.

Potato is among one of the most important food crops, yet maintaining plant productivity in this drought-sensitive crop has become a challenge. Competition for scarce water resources and the continued effects of global warming exacerbate current constraints on crop production. While plants’ response to drought in above-ground tissues has been well documented, the regulatory cascades in developing tubers have been largely unexplored. Using the commercial Canadian cultivar ‘Vigor’, plants were subjected to a drought treatment under high-tunnels causing a 4 ℃ increase in canopy temperature when compared to the well-watered control. Tubers were sampled for RNAseq and metabolite analysis. Approximately 2600 genes and 3898 transcripts were differentially expressed by at least four-fold in drought-stressed potato tubers, with 75 % and 69 % being down-regulated respectively. A further 229 small RNAs were implicated in gene regulation during drought. The comparison of protein homologues between Solanum tuberosum L. and Arabidopsis thaliana L. indicates that downregulated genes are associated with phenylpropanoid, carotenoid, and patatin biosynthesis. This suggests that there may be nutritive implications to drought stress occurring during the potato tuber bulking phase in sensitive cultivars.

The New Zealand brushtail possum (Trichosurus vulpecula), introduced from Australia in the 1850s, is an invasive species that is widespread throughout New Zealand and forms the largest self-sustained reservoir of bovine tuberculosis (Mycobacterium bovis) in the wild. Conservation and agricultural authorities regularly apply a series of population control measures to suppress brushtail possum populations. The evolutionary consequence of more than half a century of intensive population control operations on the species genomic diversity and population structure is hindered by a paucity of available genomic resources for the species. This study is the first to characterise the functional content and diversity of brushtail possum liver and brain cerebral cortex transcriptomes. Raw sequences from hepatic cells and cerebral cortex were assembled into 58,001 and 64,735 transcripts in hepatic cells and cerebral cortex, respectively. Functional annotation and polymorphism assignment of the assembled transcripts demonstrated a considerable level of variation in the core metabolic pathways that represent potential targets for selection pressure exerted by chemical toxicants. This study suggests that the brushtail possum population in New Zealand harbours considerable levels of variation in metabolic pathways that could potentially promote the development of tolerance against chemical toxicants.

The new unique technology for granulation of metals and nonmetallic melts is presented in the paper. It was created on the newly developed controlled film flow disintegration with rapid cooling of the droplets and solidified granules in amorphous state. Three new phenomena discovered by us created the base for 3 different methods for granulation of metals and nonmetallic melts in a wide range of granules’ sizes. Electromagnetic resonance method allows producing granules of metals in the range of 1 mm and over. The soliton-like vibrational regime is available for production of any granulation material in the range 0.1-1 mm. Moreover, the shockwave regime is applicable for producing particles from 10 micrometers by size. All methods produce particles of the stated size with a narrow distribution by size: deviation from the average size no more than 50%. The other known methods do not produce granules with such high cooling rate, which can realize the amorphous state and cannot regulate size of particles in such bright but narrow range from 10 micrometers to 1-2 mm.

Background: Immunoglobulin A nephropathy (IgAN) is a complex autoimmune disease, and the exact pathogenesis remains to be elucidated. Methods: We conducted summary data-based Mendelian randomization (SMR) analysis and performed functional mapping and annotation using FUMA to explore genetic loci that are po-tentially involved in the pathogenies of IgAN. Both analyses used summarized data of a recent genome-wide association study (GWAS) on IgANs, which included 477,784 Europeans (15,587 cases and 462,197 controls) and 175,359 East Asians (71 cases and 175,288 controls). We performed separate SMR analysis using CAGE and GTEx eQTL data. Results: Using the CAGE eQTL data, our SMR analysis identified 32 probes tagging 25 unique genes that were pleiotropically/potentially causally associated with IgAN, with the top three probes being ILMN_2150787 (tagging HLA-C, PSMR=2.10×10-18), ILMN_1682717 (tagging IER3, PSMR=1.07×10-16) and ILMN_1661439 (tagging FLOT1, PSMR=1.16×10-14). Using GTEx eQTL data, our SMR analysis identified 24 probes tagging 24 unique genes, with the top three probes being ENSG00000271581.1 (tagging XXbac-BPG248L24.12, PSMR=1.44×10-10), ENSG00000186470.9 (tagging BTN3A2, PSMR=2.28×10-10), and ENSG00000224389.4 (tagging C4B, PSMR=1.23×10-9). FUMA analysis identified 3 independent, significant and lead SNPs, 2 genomic risk loci and 39 genes. Conclusion: We identified many genetic variants/loci that are potentially involved in the patho-genesis of IgAN.

An innovative wireless sensor network (WSN) based on Ultra-Wide Band (UWB) technology for 3D accurate superficial monitoring of ground deformations, as landslides and subsidence, is proposed. The system has been designed and developed as part of an European Life+ project, called Wi-GIM (Wireless Sensor Network for Ground Instability Monitoring). The details of the architecture, the localization via wireless technology and data processing protocols are described. The flexibility and accuracy achieved by the UWB two-way ranging technique is analysed and compared with the traditional systems, such as robotic total stations (RTSs), Ground-based Interferometric Synthetic Aperture Radar (GB-InSAR), highlighting the pros and cons of the UWB solution to detect the surface movements. An extensive field trial campaign allows the validation of the system and the analysis of its sensitivity to different factors (e.g., sensor nodes inter-visibility, effects of the temperature, etc.). The Wi-GIM system represents a promising solution for landslide monitoring and it can be adopted in conjunction with traditional systems or as an alternative in areas where the available resources are inadequate. The versatility, easy/fast deployment and cost-effectiveness, together with the good accuracy, make the Wi-GIM system a possible solution for municipalities that cannot afford expensive/complex systems to monitor potential landslides in their territory.

Prebiotic oligosaccharides are widely used as human and animal feed additives for their beneficial effects on the gut microbiota. However, there are limited data to assess the direct effect of such functional foods on the transcriptome of intestinal epithelial cells. The purpose of this study is to describe the differential transcriptomes and cellular pathways of colonic cells directly exposed to galacto-oligosaccharides (GOS) and fructo-oligosaccharides (FOS). We have examined the differential gene expression of polarized Caco-2 cells treated with GOS or FOS and their respective mock-treated cells using mRNA sequencing (RNA-seq). A total of 89 significant differentially expressed genes were identified between GOS and mock-treated groups. For FOS treatment, a reduced number of 12 significant genes were observed to be differentially expressed relative to the control group. KEGG and Gene Ontology functional analysis revealed that genes up-regulated in the presence of GOS were involved in digestion and absorption processes, fatty acids and steroids metabolism, potential antimicrobial proteins, energy-dependent and -independent transmembrane trafficking of solutes and amino acids. Using our data, we have established complementary non-prebiotic modes of action for these frequently used dietary fibers.

Combined awareness about the power and limitations of bioinformatics and molecular biology enables advanced research based on high-throughput data. Despite an increasing demand for scientists with a combined background in both fields, the education in dry lab and wet lab is often separated. This work describes an example of integrated education with focus on genomics and transcriptomics. Participants learn computational and molecular biology methods in the same practical course. Peer-review is applied as a teaching method to foster cooperative learning of students with heterogeneous backgrounds. Evaluation results indicate acceptance and appreciation of this approach.

Smart farm is a technology that greatly helps improve the productivity and quality of crops and is being actively introduced into indoor environments such as green houses. However, it has not yet been distributed to field-grown crops. The main reason is that, unlike indoor environments, it is very difficult to collect sensor data for monitoring the growth environment of crops in open fields where weather conditions change significantly and power supply is difficult. Additionally, because various sensors are used, the data formats of the devices are different, making it difficult to process. This paper presents a field crop growth environment monitoring and big data analysis system. The proposed system first solves power supply and data communication problems using solar power generation and LPWA technology. Additionally, based on the oneM2M architecture, data from various sensors is transmitted to the server using standardized technology. The transmitted data is stored and managed on the server as big data, and can be used to predict the production and quality of field-grown crops and take appropriate measures. The proposed system is expected to create an environment optimized for the growth of field crops and help prevent and manage diseases.

Hispanics are disproportionately affected by low rates of physical activity and high rates of chronic diseases. Hispanics generally and Mexican Americans specifically are underrepresented in research on physical activity and its impact on mental well-being. Some community-based interventions have been effective in increasing physical activity among Hispanics. This study examined data from a sample of low-income Hispanic participants in free community exercise classes to characterize the association between self-reported frequency of exercise class attendance, intensity of physical activity, and participant well-being. As part of two cross-sectional samples recruited from a stratified random sample of community exercise classes, 302 participants completed a questionnaire consisting of a modified version of the Godin-Shephard Leisure-Time Exercise Questionnaire (LTEQ) and the Mental Health Continuum Short Form (MHC-SF). Adjusted binary logistic regression analyses indicated that those who achieve moderate and strenuous self-reported physical activity have 130% higher odds (p = 0.0422) of positive mental well-being after adjustment for age, attendance, and self-reported health. This study provides evidence that physical activity intensity and time are associated with flourishing mental health among Hispanics. The study provides insight into the planning and development of community-based physical activity programming tailored to low-income populations.

The PLM concept implies the use of heterogeneous information resources at different stages of the product life cycle, the joint work of which allows you to effectively solve the problems of product quality and various costs. According to the principle of isomorphism of regularities of complex systems, an effective PLM system must have these regularities. Unfortunately, this principle is not often fundamental when designing PLM systems. The purpose of the work is to show, using a simple example, the principles of development, operation and use of an educational multi-agent PLM system, the main purpose of which is to study and research these regularities in the life cycle of a special threaded connection. The multi-agent approach to the development of a PLM system provides the necessary prerequisites for the emergence of system-wide regularities in it. The parallel work of agents is implemented using the actor model and the Ray Python-package. Agents for the logical inference of knowledge base facts, CAD/FEA/CAM/SCADA agents, agents for optimization by various methods, and other agents have been developed. Open source software was used to develop the system. Each agent has relatively simple behavior, implemented by its rule function, and can interact with other agents. The system can work in interactive mode with the user or in automatic mode according to a simple algorithm: the rule functions of all agents are executed until at least one of them returns a value other than None. Examples of the operation of the system are given and such system-wide regularities as emergence, historicity and self-organization are demonstrated in it.

The endometrium, the inner mucosal lining of the uterus, undergoes complex molecular and cellular changes across the menstrual cycle in preparation for embryo implantation. Transcrip-tome-wide analyses have mainly been utilized to study the endometrial receptivity, the prerequisite for successful implantation, with most of the studies, so far, comparing the endometrial transcriptomes between (i) secretory versus proliferative endometrium or (ii) mid-secretory versus early-secretory endometrium. In the current study, we provide the complete transcriptome description of the endometrium across the entire menstrual cycle and, for the first time, comprehensively characterize the proliferative phase of the endometrium. Our temporal transcriptome analysis includes five time points: mid-proliferative, late-proliferative (peri-ovulatory phase), early-secretory, mid-secretory, and late-secretory phases. Thus, we exhaustively unveil the transitions between the consecutive proliferative and secretory phases, highlighting their unique gene expression profiles and possible distinct biological functions. Transcriptome analysis reveals many differentially expressed genes (DEGs) across the menstrual cycle, most of which are phase-specific. As an example of the coordinated gene activity, the expression profile of his-tone-encoding genes within the HIST cluster on chromosome 6 showed an increase in cluster activity during the late-proliferative and a decline during the mid-secretory phase. Moreover, numerous DEGs are shared among all phases. In conclusion, in the current study, we delineate the endometrial proliferative phase-centered view of transcriptome dynamics across the menstrual cycle. Data analysis highlights significant transcriptomic and functional changes occurring during the late-proliferative phase – an essential transition point from the proliferative to the secretory phase. Future studies should explore how the biology of the late-proliferative phase endometrium impacts the achievement of mid-secretory endometrial receptivity or contributes to molecular aberrations leading to embryo implantation failure.

Coffee Coffea arabica L. depends on abundantly distributed rainfall and drought impacts their development, fruit production, bean quality, and ultimately, beverage quality. Plant Biotechnology by means of genetic manipulation and plant regeneration by the somatic embryogenic process is an alternative technology to overcome these prob-lems. In the present work we used the molecular approach of the trehalose/trehalase role in plant surviving in extreme drought/salt environments. We used a cassette containing the antisense C. arabica L. trehalase gene under the RD29 promoter from A. thaliana and the NOS terminator to genetically modified an em-bryogenic coffee C. arabica L. cv typica line under osmotic stress supplemented with mannitol (0.3M) and sorbitol (0.3M) containing medium. Drought resistant SE lines were recovered and regenerate plants. Resistant SE lines showed a higher rate of competence to induce secondary SE capacity. A transcrip-tome analysis was performed from high competent SE lines to understand the acquired molecular mechanisms to developed SE. From the up-regulated genes, a PPI network made by STRING v12.0 with high confidence (0.700) revealed the presence of the 10 modules. The cell cycle, chromatin remodeling, somatic embryogenesis, oxidative stress, generic transcription pathway, carbon metabolism, phenylpropanoid biosynthesis, trehalose biosynthesis, proline bio-synthesis and glycerolipid metabolism.

In this study, a structural profiling of equid alphaherpesvirus 1 (EHV-1) transcriptome was carried out using next-generation (Illumina) and third-generation (Oxford Nanopore Technologies) sequencing platforms. We annotated the canonical mRNA molecules and their isoforms, including transcript start and end site isoforms, and splice variants. Additionally, a number of putative 5′-truncated mRNAs containing shorter in-frame ORFs were detected. We also demonstrated that EHV-1 produces a high number of non-coding transcripts, including antisense and intergenic RNAs. One of the most remarkable features of the EHV-1 is the generation of abundant fusion transcripts some of which encoding chimeric polypeptides. We observed a higher number of splicing and transcriptional overlaps than in related viruses. Additionally, we found that many upstream genes of tandem gene clusters have their own transcript end sites (TESs) besides the co-terminal TESs, which is rare in other alphaherpesviruses. We show here that the replication origins (OriS and OriL) of the virus are co-localized with promoter sequences and overlap with specific RNA molecules. Furthermore, we discovered a novel non-coding RNA (designated as NOIR) that overlaps the 5′-ends of the longer transcript variants encoded by the two main transactivator genes ORF64 and 65 bracketing the OriL. These all suggest the existence of a central regulatory system which controls the genome-wide transcription and the replication through a mechanism based on the interference between the machineries carrying out the synthesis of DNA and RNA.

Pachychoroid neovasculopathy (PNV) is a pachychoroid-spectrum disease. As blood circulation throughout the choroid may be involved in PNV pathogenesis, analysis using ultra-wide-field (UWF) fundus imaging is crucial. We evaluated choroidal thickness after half-fluence photodynamic therapy (PDT) combined with intravitreal aflibercept injection for PNV using UWF swept-source optical coherence tomography. Seventeen eyes with PNV that underwent half-fluence PDT with adjuvant single intravitreal aflibercept injection were analyzed. To compare choroidal thicknesses in the central and peripheral choroids, we set subfields <3, <9, and 9–18 mm from the fovea. The <9- and 9–18-mm subfields were divided into four quadrants. Choroidal thickness in each subfield decreased significantly after half-fluence PDT (P<0.001); this reduction was more pronounced in the central area. We also investigated the relationship between the dominant side of the deep choroidal veins that harbor choroidal vein efflux from the macula. When choroidal thickness in the supratemporal and infratemporal 9x9-mm subfields were evaluated, the ratio of choroidal thickness reduction was not significantly different between the dominant and non-dominant sides. The dominant side was not associated with the extent of choroidal thickness reduction in PNV. In conclusion, half-fluence PDT caused thinning of the entire choroid, especially in the central area, in PNV.

Recently, smart mobility intelligent traffic services have become a critical task in Intelligent Transportation Systems (ITS). This involves not only the use of advanced sensors and controllers but also the ability to respond to real-time traffic situations at intersections, alleviate congestion, and generate policies to prevent traffic jams. DRL (Deep Reinforcement Learning) provides a natural framework for processing tasks. In DRL, each intersection can control itself and coordinate with neighbors to achieve optimal network-wide policies. However, comparing approaches remains a challenging task due to the existence of numerous possible configurations. This research performs a critical comparison of various traffic controllers found in the literature. It demonstrates that using a nonlinear approximator for coordination mechanisms and enhancing observability at each intersection are key performance drivers.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Genes that affect adaptive traits have been identified, but our knowledge of the genetic basis of adaptation in a more general sense (across multiple traits) remains limited. We combined population-genomic analyses of evolve and resequence experiments, genome-wide association mapping of performance traits, and analyses of gene expression to fill this knowledge gap, and shed light on the genomics of adaptation to a marginal host (lentil) by the seed beetle Callosobruchus maculatus. Using population-genomic approaches, we detected modest parallelism in allele frequency change across replicate lines during adaptation to lentil. Mapping populations derived from each lentil-adapted line revealed a polygenic basis for two host-specific performance traits (weight and development time), which had low to modest heritabilities. We found less evidence of parallelism in genotype-phenotype associations across these lines than in allele frequency changes during the experiments. Differential gene expression caused by differences in recent evolutionary history exceeded that caused by immediate rearing host. Together, the three genomic data sets suggest that genes affecting traits other than weight and development time are likely to be the main causes of parallel evolution, and that detoxification genes (especially cytochrome P450s and beta-glucosidase) could be especially important for colonization of lentil by C. maculatus.

DNA methylation and other epigenetic factors are important in the pathogenesis of late-onset Alzheimer’s disease (LOAD). Methylenetetrahydrofolate reductase (MTHFR) gene mutations occur in most elderly patients with memory loss. MTHFR is critical for production of S-adenosyl-L-methionine (SAM), the principal methyl donor. A common mutation (1364T/T) of the cystathionine-γ-lyase (CTH) gene affects the enzyme that converts cystathionine to cysteine in the trans-sulfuration pathway causing plasma elevation of total homocysteine (tHcy) or hyperhomocysteinemia – a strong and independent risk factor for cognitive loss and AD. Other causes of hyperhomocysteinemia include aging, nutritional factors, and deficiencies of B vitamins. We emphasize the importance of supplementing vitamin B₁₂ (methylcobalamin), vitamin B₉ (folic acid), vitamin B₆ (pyridoxine), and SAM to patients in early stages of LOAD.

Numerous dynamic and complicated processes characterize development from the oocyte to the embryo. However, given the importance of functional transcriptome profiles, long non-coding RNAs, single-nucleotide polymorphisms, and alternative splicing during embryonic development, the effect that these features have on the blastomeres of 2-, 4-, 8-, 16-cell, and morula stages of development have not been studied. Here, we conducted a scRNA-seq survey of cells from sheep from the oocyte to the blastocyst developmental stages. We then carried out experiments to identify and functionally analyze the transcriptome profiles, long non-coding RNAs, single-nucleotide polymorphisms (SNPs), and alternative splicing (AS). We founded that between the oocyte and zygote groups significantly down-regulated genes and the second-largest change in gene expression occurred between the 8- and 16-cell stages. We used various methods to construct a profile to characterize cellular and molecular features and systematically analyze the related GO and KEGG profile of cells of all stages from the oocyte to the blastocyst. This large-scale, single-cell atlas provides key cellular information and will likely assist clinical studies in improving preimplantation genetic diagnosis.

Ophelia syndrome is characterized by the coincidence of severe neuropsychiatric symptoms, classical Hodgkin lymphoma, and the presence of antibodies to the metabotropic glutamate 5 receptor (mGluR5). Little is known about the pathogenetic link between these symptoms and the role that anti-mGluR5-antibodies play. We investigated lymphoma tissue from patients with Ophelia syndrome and with isolated classical Hodgkin lymphoma by quantitative immunocytochemistry for mGluR5-expression. Further, we studied the L-1236, L-428, L-540, SUP-HD1, KM-H2, and HDLM-2 classical Hodgkin lymphoma cell lines by FACS and Western blot for mGluR5-expression, and by transcriptome analysis. mGluR5 surface expression differed significantly in terms of receptor density, distribution pattern, and percentage of positive cells. Highest expression levels were found in the L-1236 line. RNA-sequencing revealed more than 800 genes that were higher expressed in the L-1236 line in comparison to the other classical Hodgkin lymphoma cell lines. High mGluR5-expression was associated with upregulation of PI3K/AKT and MAPK pathways and of downstream targets (e.g. EGR1) known to be involved in classical Hodgkin lymphoma progression. Finally, mGluR5 expression was increased in the classical Hodgkin lymphoma-tissue of our Ophelia syndrome patient in contrast to five classical Hodgkin lymphoma-patients without autoimmune encephalitis. Given the association of encephalitis and classical Hodgkin lymphoma in Ophelia syndrome, it is possible that mGluR5-expression on classical Hodgkin lymphoma cells not only drives tumor progression but also triggers anti-mGluR5 encephalitis even before classical Hodgkin lymphoma becomes manifest.

Leishmania major is the main causative agent of cutaneous leishmaniasis in humans. The Friedlin strain of this species (LmjF) was chosen when a multi-laboratory consortium undertook the objective of deciphering the first genome sequence for a parasite of the genus Leishmania. The objective was successfully attained in 2005, and this represented a milestone for Leishmania molecular biology studies around the world. Although the LmjF genome sequence was done following a shotgun strategy and using classical Sanger sequencing, the results were excellent and this genome assembly served as the reference for subsequent genome assemblies in other Leishmania species. Here, we present a new assembly for the genome of this strain (named LMJFC for clarity), generated by the combination of two high throughput sequencing platforms, Illumina short-read sequencing and PacBio Single Molecular Real-Time (SMRT) sequencing, which provides long-read sequences. Apart from resolving uncertain nucleotide positions, several genomic regions have been reorganized and a more precise composition of tandemly repeated gene loci was attained. Additionally, the genome annotation has been improved by adding 542 genes and more accurate coding-sequences defined for around two hundred genes, based on the transcriptome delimitation also carried out in this work. As a result, we are providing gene models (including untranslated regions and introns) for 11,238 genes. Genomic information ultimately determines the biology of every organism; therefore, our understanding of molecular mechanisms will depend on the availability of precise genome sequences and accurate gene annotations. In this regards, this work is providing an improved genome sequence and updated transcriptome annotations for the reference L. major Friedlin strain.

In this study, Silicon Carbide (SiC) nano-particle based serigraphic printing inks were formulated to fabricate highly sensitive and wide temperature range SiC printed thermistors. Initially, commercial silver ink was screen printed to fabricate inter-digitated electrodes (IDE’s) onto flexible Kapton® substrate via screen printing. Thermistor inks with different weight ratios of SiC nano- particles dispersed in polyimide resin matrix were fabricated. The SiC-polyimide temperature sensing inks were screen printed atop the IDE structures to form fully printed thermistors and encapsulated with a adhesive backed polyimide film for humidity inhibition. The high temperature tolerance of the Kapton® allowed the the sensors to be tested over a wide temperature range form 25◦C to 170◦C. The printed SiC thermistors exhibit excellent repeatability and stability over 15 hours of continuous operation. Optimal device performance was achieved with 30 wt.% SiC-polyimide ink. We report highly sensitive devices with a temperature coefficient of Resistance (TCR) of -0.556 %/◦C, a thermal coefficient of 502 K (β-index) and an activation energy of 0.08 eV which are comparable with printed thermistors previous reported. Further, the thermistor demonstrates an accuracy of ±1.35◦C which is well within the range offered by commercially available high sensitivity thermistors. SiC thermistors exhibit a small 6.5% drift due to changes in relative humidity between 10-90 %RH and a 4.2 % drift in baseline resistance after 100 cycles of aggressive bend testing at a 40°angle. The use of commercially available low cost materials, simplicity of design and fabrication techniques coupled with the chemical inertness of the Kapton® substrate and SiC nanoparticles paves the way to use all-printed SiC thermistors towards a wide range of applications where temperature monitoring is vital for optimal system performance.

In this perspective article, we ponder topographical enhancements of artificial neural networks. In our recent paper in JMLR, we proved a quasi-equivalence between the network width and depth and also discussed the power of intra-links, which can be viewed as network height. In 1982, Hopfield published a network to model human associative memory, which contains many loops for dynamic evolution toward fixed points. Based on noising-denoising loops, diffusion models are recently developed to enable Bayesian modeling and inference with big data. Furthermore, we envision development of multi-AI-agent systems through “netware” engineering as a quantum leap of software engineering for emergent behaviors and autonomous AI at individual and population levels. We believe that the novel use of links and loops in space and time via multi-scale coupling would catalyze the next-generation neural networks.

Climate change-induced temperature fluctuations pose a significant threat to crop production, particularly in the Southern Hemisphere. This study investigates the transcriptome and physiological responses of rapeseed to post-flowering temperature increases, providing valuable insights into the molecular mechanisms underlying rapeseed tolerance to heat stress. Two rapeseed genotypes, Lumen and Solar, were assessed under control and heat stress conditions in field experiments conducted in Valdivia, Chile. Results showed that seed yield and seed number were negatively affected by heat stress, with genotype-specific responses. Lumen exhibited a 9.3% average seed yield reduction, while Solar showed a 28.7% reduction. RNA-seq analysis of siliques and seeds revealed tissue-specific responses to heat stress, with siliques being more sensitive to temperature stress. Hierarchical clustering analysis identified distinct gene clusters reflecting different aspects of heat stress adaptation in siliques, with a role for protein folding in maintaining silique development and seed quality under high temperature conditions. In seeds, three distinct patterns of heat-responsive gene expression were observed, with genes involved in protein folding and response to heat showing genotype-specific expression. Gene coexpression network analysis revealed major modules for rapeseed yield and quality, as well as the trade-off between seed number and seed weight. Overall, this study contributes to understanding the molecular mechanisms underlying rapeseed tolerance to heat stress and can inform crop improvement strategies targeting yield optimization under changing environmental conditions.

The transcriptional response of human blood leukocytes to SARS-CoV-2 infection was investigated focusing on the differences between mild and severe cases and between age subgroups. Weighted gene co-expression network analysis and comparative gene expression analysis were used. Three transcriptional modules positively associated with the traits of interest and their respective high hierarchy genes were identified. Enrichment analyses showed that the yellow module, associated with severe cases and older patients, had an overrepresentation of genes involved in inflammatory and innate immune responses, and neutrophil activation. The magenta and black modules, associated with disease severity and younger patients, contained genes related to innate immunity and inflammation and genes that regulate those responses. Subnetworks for these modules were constructed using genes enriched for innate immunity, inflammation, immunoregulation and differentially expressed genes (severe vs. mild). Their analysis evidenced that immunoregulatory functions are more activated in the modules associated with younger patients, what may help to explain the better disease course and faster recovery observed in younger COVID-19 patients. Comparative gene expression analysis between severe and mild groups, followed by gene enrichment and normalized gene expression analyses, revelated a set of 23 potential biomarkers for COVID-19 severity, of which 13 are newly described.

(i) Investigations of stellar systems known as wide binaries suggest that Newton’s law of gravitation breaks down at low accelerations. This can be explained by proposing a fifth force with $U(1)$ gauge symmetry, whose corresponding gauge boson is the sought for dark matter candidate. (ii) Relativistic causality (i.e. no faster than light signalling) permits nonlocal correlations stronger than those permitted by quantum mechanics. This can be explained if our universe possesses a second 4D spacetime with a signature opposite to ours. (iii) Such a fifth force, and a second spacetime, arise naturally in a recently proposed theory of unification based on an $E_8\times E_8$ symmetry. Our spacetime arises from breaking of an $SU(2)_R\times U(1)_{YDEM}$ symmetry, and the second spacetime arises from broken electroweak symmetry.

Quantitative trait loci (QTL) are genomic regions associated with phenotype variation of quantitative traits in a population. To date, a total of 267 QTL for 29 quantitative traits have been reported in 13 studies on flax. Of these, 200 QTL from 12 studies were identified based on genetic maps, scaffold sequences, or pre-released chromosome-scale pseudomolecules. Molecular markers for QTL identification differed across studies but were mainly based on simple sequence repeat (SSR) or single nucleotide polymorphism (SNP) markers. This article provides methods with software tools and database files to uniquely map SSR and SNP markers from different references onto the recently released chromosome-scale pseudomolecules. Using these methods, 195 QTL were successfully sorted onto the 15 flax chromosomes and grouped into 133 co-located QTL clusters. Mapping of QTL from different studies to the same reference enables comparisons and facilitates genome-wide QTL analysis, candidate gene scanning, and breeding applications.

Alternative splicing (AS) is a gene regulatory mechanism modulating gene expression in multiple ways. AS is prevalent in all eukaryotes including plants. AS generates two or more mRNAs from the precursor mRNA (pre-mRNA) to regulate transcriptome complexity and proteome diversity. Advances in next-generation sequencing, omics technology and bioinformatics tools, and computational methods provide new opportunities to quantify and visualize AS-based quantitative trait variation associated with plant growth, development, reproduction, and stress tolerance. Domestication, polyploidization and environmental perturbation may evolve novel splicing variants associated with agronomically beneficial traits. To date, pre-mRNAs from many genes are spliced into multiple transcripts that cause phenotypic variation for complex traits, both in model plant Arabidopsis and field crops. Cataloguing and exploiting such variation may provide new paths to enhance climate resilience, resource-use efficiency, productivity, and nutritional quality of staple food crops. This review provides insights into AS variation alongside gene expression analysis to select for novel phenotypic diversity for use in breeding programs. AS contributes to heterosis, enhances plant symbiosis (mycorrhiza and rhizobium), and provides a mechanistic link between the core clock genes and diverse environmental clues.

Multiple Gateways (GWs) provide network connectivity to Internet of Things (IoT) sensors in a Wide Area Network (WAN). The End Nodes (ENs) can connect to any GW by discovering and acquiring its periodic beacons. This provides GW diversity and hence improves coverage. If the GWs are within vicinity to each other, and they keep sending periodic beacons to be discovered, the result is interference and collisions. In this study, the impact of such intra-network interference is analyzed to determine the maximum number of GWs that can co-exist within a given urban neighborhood. The paper shows the relationship between beacon collisions and the resulting packet loss rates in a given urban environment. The expected collision rates are calculated for the Medium Access Control (MAC) layer. The eventual packet loss rates are calculated with the MAC and Physical (PHY) layers combined. For this purpose, a new co-channel interference model is presented. The model calculates the average Carrier to Interference ratio (C/I) averaged across all the colliding events. It takes into account the partial overlap durations and the relative power of each colliding signal. The model shows that a collision does not always cause a packet loss. Packet losses occur if there is a collision and if the C/I is below a threshold. The performance evaluation is presented using a combination of analytical and simulation methods. The analytical methods provide the theoretical foundation, and have been used to validate the simulation results. Furthermore, the system models are developed from experimental data obtained from measurements with real hardware. Numerical results are provided with a low bit rate Gaussian Frequency Shift Keying (GFSK) modulation at the PHY layer, which is derived from the IEEE 802.15.4 standard specification. This paper provides guidance on selecting the right GFSK modulation parameters for such low bit-rate and narrow bandwidth IoT applications. The analysis and simulation results show that larger beacon intervals help in reducing beacon loss rates, at the cost of larger beacon acquisition latency. On the flip side, the gateway discovery latency reduces with increasing GW density thanks to abundance of beacons.

The rapid expansion of transcriptomics from increased affordability of next-generation sequencing (NGS) technologies generates rocketing amounts of gene expression data across biology and medicine, and notably in cancer research. Concomitantly, many bioinformatics tools were developed to streamline gene expression analysis and quantification. We tested the concordance of NGS RNA sequencing (RNA-seq) analysis outcomes between the two predominant programs for reads alignment, HISAT2 and STAR, and the two most popular programs for quantifying gene expression in NGS experiments, edgeR and DESeq2, using RNA-seq data from a series of breast cancer progression specimens, which include histologically confirmed normal, early neoplasia, ductal carcinoma in situ and infiltrating ductal carcinoma samples microdissected from formalin fixed, paraffin embedded (FFPE) breast tissue blocks. We identified significant differences in aligners’ performance: HISAT2 was prone to misalign reads to retrogene genomic loci, STAR generated more precise alignments, especially for early neoplasia samples. edgeR and DESeq2 produced similar lists of differentially expressed genes in stage comparisons, with edgeR producing more conservative, though shorter, lists of genes. Albeit, Gene Ontology (GO) enrichment analysis revealed no skewness in significant GO categories identified among differentially expressed genes by edgeR vs DESeq2. As transcriptome analysis of archived FFPE samples becomes a vanguard of precision medicine, identification and fine-tuning of bioinformatics tools becomes critical for clinical research. Our results indicate that STAR and edgeR are well-suited tools for differential gene expression analysis from FFPE samples.

Camptothecin (CPT) is a potent anticancer drug, and its putative oral administration is envisioned although difficult due to physiological barriers that must be overcome. A comprehensive biophysical analysis of CPT interaction with biointerface models can be used to predict some pharmacokinetic issues after oral administration of this or other drugs. To that end, different models were used to mimic the phospholipid composition of normal, cancer, and blood-brain barrier endothelial cell membranes. The logD values obtained indicate that the drug is well distributed across membranes. CPT-membrane interaction studies also confirm the drug’s location at the membrane cooperative and interfacial regions. The drug can also permeate membranes at more ordered phases by altering phospholipid packing. The similar logD values obtained in membrane models mimicking cancer or normal cells imply that CPT has limited selectivity to its target. Furthermore, CPT binds strongly to serum albumin, leaving only 8.05% of free drug available to be distributed to the tissues. The strong interaction with plasma proteins, allied to the large distribution (VDSS=5.75 ± 0.932 L·Kg-1) and tendency to bioaccumulate in off-target tissues, were predicted to be pharmacokinetic issues of CPT, implying the need to develop drug delivery systems to improve its biodistribution.

Coccomyxa subellipsoidea KJ (C-KJ) is a green alga with unique immunoregulatory characteristics. Here, we investigated the mechanism underlying the modification of T cell function by C-KJ components. The water-soluble extract of C-KJ was fractionated into protein (P) and sugar (S) fractions [acidic (AS), basic (BS), and neutral (NS)]. These fractions were used for the treatment of peripheral blood mononuclear cells stimulated with toxic shock syndrome toxin-1. Transcriptome analysis revealed that both P and AS enhanced the expression of the genes encoding metallothionein (MT) family proteins, inflammatory factors, and T helper (Th) 17 cytokine and suppressed that of those encoding Th2 cytokines in stimulated T cells. The kinetics of MT1 and MT2A gene expression showed a transient increase in MT1 and maintenance of MT2A mRNA after T cell stimulation in the presence of AS. The kinetics of Th17-related cytokine secretion in the early period were comparable to those of MT2A mRNA. Furthermore, our findings revealed that static, a STAT-3 inhibitor, significantly suppressed MT2A gene expression. These findings suggest that the expression of MTs is involved in the immune regulatory function of C-KJ components, which is partially regulated by Th17 responses, and may help develop innovative immunoregulatory drugs or functional foods.

The increasing use of energy resources recovered from the subsurface environments and the resulting carbon imbalance in the environment has motivated the need to develop thermodynamically downhill pathways to convert and store CO₂ as water insoluble calcium or magnesium carbonates. While previous studies extensively explored aqueous routes to produce calcium and magnesium carbonates from CO₂, there has been a limited scientific understanding of the phase evolution and textural changes during the direct gas-solid conversion routes to produce calcium carbonate from calcium hydroxide, which is one of the abundant constituents of alkaline industrial residues. With increasing interest in developing integrated pathways for capturing, converting and storing CO₂ from dilute flue gases, understanding the compositions of the product phases as they evolve is essential for evaluating the efficacy of a given processing route. Therefore, in this study, we investigate the phase evolution and the corresponding textural changes as calcium hydroxide is converted to calcium carbonate under the continuous flow of CO₂ at an ambient pressure of 1 atm and on heating continuously from 30 °C to 500 °C using in-operando wide angle X-ray scattering (WAXS), small angle X-ray scattering (SAXS), and ultra-small angle X-ray scattering (USAXS) measurements.

The morphology of virgin reactor powder (RP) of high-density polyethylene HDPE with MW = 160,000 g/mol was investigated with the help of DSC, SEM, SAXS and WAXS methods. The morphological SEM analysis showed, that the main morphological units of RP are macro- and micro-shish kebab structures with significantly different geometric dimensions, as well as individual lamellae of folded chain crystals. Quantitative analysis of an asymmetric SAXS reflection made it possible to reveal the presence of several periodic morphoses in the RP with long periods from 20 nm to 60 nm and to correlate them with the observed powder morphology. According to the DSC crystallinity data, the thickness of the lamellae in each long period was estimated. Their surface energy was calculated in the framework of the Gibbs-Thompson theory. The presence of regular and irregular folds on the surface of the different shish-kebab lamellae is discussed. The percentage of identified morphoses in the RP was calculated. It has been suggested that the specific structure of HDPE RP is due to the peculiarity of polymer crystallization during suspension synthesis in a quasi-stationary regime, in which local overheating and inhomogeneous distribution of shear stresses in a chemical reactor are possible.

Low Power Wide Area Networks (LPWAN) enable a growing number of Internet-of-Things (IoT) applications with large geographical coverage, low bit-rate, and long lifetime requirements. LoRa (Long Range) is a well-known LPWAN technology that uses a proprietary Chirp Spread Spectrum (CSS) physical layer, while the upper layers are defined by an open standard - LoRaWAN. In this paper, we propose a simple yet effective method to improve the Quality-of-Service (QoS) of LoRa networks by fine-tuning specific radio parameters. Through a Mixed Integer Linear Programming (MILP) problem formulation, we find optimal settings for the Spreading Factor (SF) and Carrier Frequency (CF) radio parameters, considering the network traffic specifications as a whole, to improve the Data Extraction Rate (DER) and to reduce the packet collision rate and the energy consumption in LoRa networks. The effectiveness of the optimization procedure is demonstrated by simulations, using LoRaSim for different network scales. In relation to the traditional LoRa radio parameter assignment policies, our solution leads to an average increase of 6% in DER, and a number of collisions 13 times smaller. In comparison to networks with dynamic radio parameter assignment policies, there is an increase of 5%, 2.8%, and 2% of DER, and a number of collisions 11, 7.8 and 2.5 times smaller than equal-distribution, Tiurlikova's (SoTa), and random distribution, respectively. Regarding the network energy consumption metric, the proposed optimization obtained an average consumption similar to Tiurlikova's, and 2.8 times lower than the equal-distribution and random dynamic allocation policies. Furthermore, we approach the practical aspects of how to implement and integrate the optimization mechanism proposed in LoRa, guaranteeing backward compatibility with the standard protocol.