This paper uses probability method to evaluate the fire safety performance of prestressed steel-concrete beam bridges based on simulation experimental research. Firstly, fire simulation experimental sample analysis was conducted on actual small box girder bridges to obtain the structural response of prestressed steel-concrete structures under fire, which is in line with engineering practice. Next, construct a reliability analysis model for the fire resistance performance of prestressed steel-concrete beam bridges; Combining reliability theory with finite element method, establish a reliability analysis method for the fire resistance performance of prestressed steel-concrete beam bridges. Subsequently, a safety factor evaluation model for the fire resistance performance of prestressed steel-concrete beam bridges was proposed, and a safety factor evaluation method for the fire resistance performance of prestressed steel-concrete beam bridges based on reliability back analysis was established. Finally, based on the analysis of the structural response after a fire in a specific case of a simply supported to continuous prestressed steel-concrete continuous beam bridge project, a structural resistance sample of the prestressed steel-concrete beam bridge is generated through uniform design method, and statistical analysis is conducted. Subsequently, probability methods are used to evaluate the safety of the prestressed steel-concrete beam bridge after a fire. Through analysis, it can be concluded that the time of fire has a significant impact on the structural performance of prestressed steel-concrete beam bridges, and the randomness of parameters has a significant impact on the safety reserve of prestressed steel-concrete beam bridges after fire. It is necessary to pay attention to it in specific engineering practice and strengthen the monitoring and statistics of structural random characteristics.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

Fire outbreaks continue to cause damage despite the improvements in fire-detection tools and algorithms. It is still challenging to implement a well performing and optimized approach, which is sufficiently accurate, and has tractable complexity and low false alarming rate. Small amount of fire and identification of fire from a long distance is also a challenge in previously proposed techniques. In this study, we propose a novel hybrid model based on Convolutional Neural Networks (CNN) to detect and analyze fire intensity. 21 convolutional layers, 24 Rectified Linear Unit (ReLU) layers, 6 pooling layers, 3 fully connected layers, 2 dropout layers, and a softmax layer are included in the proposed 57-layer CNN model. Our proposed model performs instance segmentation in order to distinguish between fire and non-fire events. To reduce the intricacy of the proposed model, we also propose a key-frame extraction algorithm. The proposed model uses Internet of Things (IoT) devices to alert the relevant person by calculating the severity of fire. Our proposed model is tested on a publicly available dataset having fire and normal videos. The achievement of 95.25 % classification accuracy, 0.09% False Positive Rate (FPR), 0.65 percent False Negative Rate (FNR), and a prediction time of 0.08 seconds validates the proposed system.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

This research examines the fire resistance of geopolymer composites (GCs), formulated using alka-li-activated metakaolin and aluminum powder. The production method involves spray-coating carbon steel plates with fresh GCs, followed by a 28-day curing period at room temperature. Sub-sequently, fire performance and aging tests are conducted to evaluate fire resistance. The study investigates GC properties, including apparent density, bending strength, compression strength, thermal conductivity, porosity, and production cost. Morphological changes before and after fire and aging tests are analyzed using scanning electron microscopy (SEM). Results demonstrate GC foams' outstanding thermal insulation, providing up to 75 minutes of fire resistance with a 6 mm coating, reducing temperatures by 300 °C compared to uncoated steel. GCs exhibit a density of 670 kg/m³, thermal conductivity of 0.166 W/m·K, 68% porosity, and cost efficiency at 250 dollars per cubic meter. This study underscores the potential of foamed geopolymer coatings for effective and economical surface protection.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p < 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p < 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Tropical forest and savanna biomes are pivotal in the functioning of the Earth system. Tropical forests are one of the largest terrestrial biosphere carbon pools, whereas savannas exchange carbon between the biosphere and atmosphere via frequent and extensive landscape fires. Both are biodiverse and under increasing threat due to land clearing and anthropogenic climate change. Reliable mapping of tropical forest and savanna is essential to provide understanding of how anthropogenic impacts are affecting the extent of these biomes. Using Google Maps satellite imagery, we manually classified 24,239 random points as forest, savanna, or anthropogenic landscapes within the tropics. Because fire and climate are correlated, we developed separate geospatial models to rank the importance of climate, topography, and human influence on vegetation present. This modelling confirmed that those areas with more fires had lower probabilities of tropical forest, that forest was most likely in areas with high mean annual rainfall with little seasonal variation in precipitation, and that anthropogenic factors disrupt this environmental predictability. We found there were environments where tropical forest and savanna were equally probable are geographically restricted. These relationships suggest that future drier climates projected under anthropogenic climate change, combined with clearing and burning that have reduced tropical forest extent to a subset of its theoretical distribution, will lead to irreversible loss of tropical forests. Our modelling provides global mapping that can be used track further changes to distribution of rainforests.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Ensuring fire safety is an important condition for the successful operation of industrial enterprises. It is necessary to detect the threat of fire before ignition. An indicator of danger is the appearance of gas, which occurs as a result of unauthorized heating of equipment. Gas sensors make it possible to detect the appearance of gases characteristic of the decomposition of materials at the stage of smouldering and pyrolysis, which cause a change in the composition of the atmosphere. This paper presents a mathematical method for the rational placement of gas analyzers for premises of potentially hazardous industries. It is the rational placement of gas sensors, which ensures safety, taking into account economic feasibility that determines the effectiveness of their use. For the first time, the analysis of gas accumulation during the movement of the flow from the source to the ceil-ing, then propagation to the location of the sensors, is used for the first time to select the placement of gas sensors. Depending on the permissible values of the gas volume, the placement and number of gas sensors are selected. The calculation of the conditions for the rational placement of gas sen-sors for the most common indicators, such as carbon monoxide and hydrogen at different sizes and heights of rooms, is carried out. The method of calculating the location of gas analyzers makes it possible to diagnose and predict fire hazard at technological facilities on the basis of gas control, and compare the obtained values with the maximum permissible values. This method provides cal-culation of the coordinates of the gas source from the coordinates of the triggered sensors. Knowing the coordinates of all sensors, the coordinates of the sensors that gave the alarm, and the formula for determining the volume of the gas cloud under these sensors, it is possible to assess the localization of the source of dangerous gas in the protected room. This increases the efficiency of the fire safety system. The method makes it possible to control the layout of sensors depending on the volume of protected premises, types of production, the creation of new sensors, changes in the composition of hazardous gas in different technological conditions.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Climate and land-use changes have been contributing to increase the occurrence of extreme wild-fires, shifting fire regimes and driving desertification, particularly in Mediterranean-climate regions. However, few studies have researched the effects of land-use change on fire regimes and carbon storage at the broad national scale. To address this gap, we used spatially explicit data from annual burned areas in mainland Portugal to build a typology of fire regimes based on the accumulated burned area and its temporal concentration (Gini index) between 1984 and 2019, which was combined with 2018 carbon stock data (above- and below-ground), and a landscape typology re-sulting from cluster analysis over land-use composition, diversity and configuration, to explore relationships between landscape types and the two major ecosystem services at stake: wildfire reduction and carbon stock. Cross tabulations, logistic and linear regressions were performed on these data and results revealed a strong relationship between landscapes dominated by maritime pine and eucalypt forest plantations and high-hazardous fire regime but hold the highest carbon stock. Shrubland-mixed landscapes were associated with lower carbon stocks but less hazardous fire regimes. Specialized agricultural landscapes, as well as mixed native forests and mixed agro-forestry landscapes, were the least associated with wildfires. In the case of agricultural landscapes however, this good wildfire performance is achieved at the cost of the poorest carbon stock, de-noting land degradation, whereas native forests and agroforestry landscapes strike the best trade-off between carbon stock and fire regime. Our findings support how nature-based solutions promoting wildfire mitigation and carbon stock ecosystem services may prevent and revert land degradation harming Mediterranean regions.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast < colon < pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

Although the vegetation of the Cerrado biome is prone to fire, plant species composition can be altered according to its severity and frequency. Furthermore, many Cerrado plant species are resistant and can adapt to frequent fires. Little is known about how plant species of Cerrado environments respond to fire and the extent to which fire is beneficial for their conservation. The present study analyzed the responses of plant species of areas of campo sujo to fire and changes in floristics and vegetation structure at different post-fire intervals. Areas with frequent fires had a greater diversity of species, while the area with 10 years without burning had lower diversity and greater DBH. The distribution of species differed among the four the studied areas. We conclude that fire was beneficial for species diversity in the studied areas of Cerrado since it was able to promote the insertion and removal of species during intervals between fires.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

Background and Objectives: The current study aimed to determine the impact of fasciotomy on mortality and morbidity in children and adults with crush-related AKI following the 2023 Kahramanmaraş earthquakes. Materials and Methods: The study included individuals who had suffered crush injuries after the 2023 Kahramanmaraş earthquakes and were identified as having acute kidney injury (AKI). Patients with AKI were divided into two groups based on age: those under 18 years and those over 18 years. A comparative analysis was conducted between the mortality and morbidity rates of patients who underwent fasciotomy and those who did not. Disseminated intravascular coagulopathy (DIC), sepsis, and adult respiratory distress syndrome (ARDS) have all been identified as contributors to morbidity. Results: The study was conducted with a total of 40 patients (21 males and 19 females) aged between four and 83 years. A total of 21 patients underwent fasciotomy and the patients underwent varying numbers of fasciotomy, ranging from zero to 11. The mortality rate was 12.5%, corresponding to five adult patients. No instances of mortality were reported in the paediatric cohort. The application of fasciotomy in instances of crush-induced AKI did not result in elevated levels of mortality in either the paediatric or adult demographic. Within the adult population, a substantial difference in the duration of dialysis was observed between individuals who underwent fasciotomy and those who did not. A statistically significant increase in the number of fasciotomy incisions was observed in patients diagnosed with sepsis compared with those without sepsis. The study found a significant positive correlation between the number of fasciotomy incisions and dialysis days. Conclusions: Neither adult nor paediatric patients with crush-induced AKI showed an increased risk of death after fasciotomy. The number of fasciotomy incisions significantly correlated with the development of sepsis. Despite experiencing delays in hospital admission for paediatric patients, the incidence of both crush syndrome and mortality rates among children remained relatively low.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Repeated fires cause peatlands to degrade. Fire management has been carried out, but fires continue to occur, especially during the dry season. Through social capital that applies in the community based on the local wisdom of the Banjar people in environmental management, it is hoped that peatland fires can be overcome in this area. This research aims to analyze the social capital of the Banjar people in mitigating land fires based on local wisdom and the environment. The sample in this study was 250 people who live in an area prone to fires on peatlands in Banjarbaru, South Kalimantan, Indonesia. There are three variables in this study, namely Trust (T), Network (N) and Norm (N). There are 33 Likert scale questions (1-4, strongly agree-strongly disagree). We also conducted interviews with 20 members of the Fire Care Community (MPA) to obtain information about the social capital of the Banjar community in mitigating land fires. The analysis used is Structural Equation Modeling (SEM). The study results show norms have the greatest influence on disaster mitigation of peatland fires compared to trust and social networks. Norms in the community in the form of values from peatlands, rules, norms and sanctions regulate the community more to deal with the problem of peatland fires than trust and social networks

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

As a follow-up to previously published research, this paper examines the responses of a group (n=185) of professional and volunteer firefighters directly involved in fighting extreme wildfire events of the 2017 summer season in Portugal. The data used in this research stem from two open-ended questions in response to a web-based survey: i) lessons learned and ii) proposals for improving the Civil Protection service. The replies were qualitatively examined. Participants exhibit incomplete awareness of extreme wildfires, and their only answers are i) the improvement of both the current organization and the technical and human resources of the suppression model (question 1), and ii) the increase in human and material resources, the single command, the in-dependence from Civil Protection and the valorization of experience, as the main aspects for the improvement of Civil Protection (question 2). Little attention is given to prevention and to the concept of control capacity, respectively. The answers to both questions showcase scarce knowledge of the paradigm shift in reference to the prevention model. The ratios of missing re-plies to both questions were 32.43% and 47.57%, respectively. The work stands out for its novelty and originality, as to our knowledge there is a total lack of similar works in all European Union literature.

Findings primarily drawn from literature review and interviews with professional resource persons suggest that although the RMG industry of Bangladesh has made substantial progress in correcting structural risks within factory buildings, fire still remains an unresolved issue posing unceasing threat to safety. These findings are significant for all stakeholders within the global supply chain network of Bangladesh, concerned with improving sustainability of the RMG industry and seeking to outline the responsibilities for each group of actors towards preventing building disasters. Both Tazreen Fashion fire incident and the Rana Plaza building collapse served as ‘critical junctures’ in rapid transfer of physical technology to enhance structural safety and streamline production planning within the RMG manufacturing factories within Bangladesh. However, the transfer of social technology within the supply chain network of a developing nation in areas such as development of organisational safety culture or promoting workplace ethics, requires long-term planning and prolonged practices. The paper thus concludes that in developing countries, transfer of physical technology is more readily achievable than the adoption of social technology.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Shrubland and forestland covers are highly prone to fire. The Normalized Difference Vegetation Index (NDVI) has been widely used for biomass quantitative assessment. This study aims were the following: (1) to compute the NDVI annual curve for two types of land cover eucalypts and shrubland areas; (2) to collect field data in these two types of land cover to estimate aboveground biomass (AGB); and (3) to produce AGB maps for eucalypts and shrubland areas by modelling AGB with NDVI and validate them with other data sources. A study area in the central inland Portugal was considered. The Sentinel-2 MSI imagery for the year of 2022 and 2023 were used to compute the NDVI. The NDVI annual curve for 2022 showed a minimum observed between July and August, in accordance with the climatological data, and allowed differentiating eucalypts from shrubland areas. Spectral signatures also confirmed this differentiation. The fitted linear models for AGB prediction using the NDVI imagery showed good fitting performances (R2 of 0.76 and 0.69). The AGB maps provide a relevant decision support tool for forest management and for fire hazard and fire severity mitigation. Further research is needed using more robust data sets for models’ independent validation.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Fire is a common disturbance in the Brazilian savanna (Cerrado), wherein high-frequency fires drive the vegetation structure, composition, function, and dynamics of savanna ecosystems. Under climate change pressure, further understanding of fire-vegetation relationships and interactions can provide new approaches for establishing strategies for integrated fire management and promote savanna vegetation recovery post-fire. To understand how 15 years of yearly manipulated burning affects the vertical and horizontal structure of the vegetation, the species composition and diversity metrics (species richness, Shannon's diversity, and Pielou's evenness), and the aboveground carbon stocks, we surveyed all woody plant species with a diameter greater than three centimeters in 15 plots of a typical Brazilian savanna (cerrado stricto sensu) at an experimental research station in central Brazil (Cerrado biome). Fifteen plots (five per treatment) were differently affected by fire events over a decade, comprising three treatments: (i) annual fire, (ii) legacy fire (> 11 years since the last fire event), and control (not burned in the past 30 years). Non-metric multidimensional scaling (NMDS) analysis indicated a significant effect of fire on the species composition among treatments and that some species benefited from fire, such as Erythroxylum suberosum, whereas others propagated better without fire, such as Camisala montana and Dalbergia miscolobium. Over a decade of annual fire events led to decreases in Shannon's diversity, species richness, and stem density, which were significantly lower in the annual fire treatment than in the control and legacy fire treatments. Stem density by diameter and height size class (except for the 1-2 m class and above 8 m) was higher in the control than in the annual fire treatment, but the number of dead trees did not differ between the control and annual fire treatments. Our results also showed that fire was a factor in changes in the evaluated parameters, such as annual fire treatment, which reduced the amount of biomass and, therefore, the carbon stock. This study suggests that, if burned yearly, typical Brazilian savannas can become less biodiverse in terms of woody plant species and negatively affect their fire resilience. Therefore, fire management practices should focus on determining the frequency with which these ecosystems may benefit the most from fire disturbances.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

High-rise building fires pose a serious threat to the lives and property safety of the people. The lack of reliable and accurate positioning means is one of the main difficulties faced by rescue. In the absence of prior knowledge of the high-rise building fire environment, the coverage deployment of mobile base stations is a challenging problem that has not received much attention in the literature. This paper studies the problem of autonomous optimal deployment of base stations in high-rise building fire environment based on UAV group. A novel problem formulation is proposed that solves the non line of sight (NLOS) positioning problem in complex unknown environment. The purpose of this paper is to realize the coverage and deployment of mobile base stations in complex and unknown fire environment. The NLOS positioning problem in the fire field environment is turned into the line of sight (LOS) positioning problem through the optimization algorithm. And there are more than three LOS base stations nearby any point in the fire field. A control law which is formulated in a mathematically precise problem statement is developed that guarantees to meet mobile base stations deployment goal and to avoid collision. Finally, positioning accuracy of our method and that of common method were compared. The simulation result showed that the positioning accuracy of simulated firefighter in the fire field environment was improved greatly.

Fire safety is a critical concern in various industries necessitating the development of sustainable and effective fire-resistant materials. Sustainable fire-resistant polysaccharide-based composite aerogels are regarded as innovative solutions in fire safety applications, and as such, research in this field has increased consistently over the past few years. Despite the plethora of literature on this important subject, only a few studies have attempted to map the global research of sustainable fire-resistant polysaccharide-based composite aerogels to identify the geospatial collaborative network and trend of research. This study utilizes a scientometric review of global trends in sustainable fire-resistant polysaccharide-based composite aerogels research between 2003–2023 by VOSviewer and biblioshiny to analyze co-author, co-word, co-citation, clusters, and geospatial map. A total of 234 bibliographic records from the Scopus database were analyzed to generate the study's research power networks and geospatial map. The most significant contributions in sustainable fire-resistant polysaccharide-based composite aerogels comes from China, the United States, Australia, Canada, and India with records of 194, 20, 11, 9, and 8 respectively. The top five sources for articles in this area of research include ACS Applied Materials and Interfaces, Chemical Engineering Journal, Composite Engineering, ACS Sustainable Chemistry and Engineering, and Carbohydrate Polymers. The application of sustainable fire-resistant polysaccharide-based composite aerogels spans the engineering and construction fields. The versatility in the fabrication and customization allows for seamless integration into diverse applications. The article concludes by emphasizing the significance of sustainable fire-resistant polysaccharide-based composite aerogels as a promising advancement in fire safety technology, combining sustainability, fire resistance, versatility, and mechanical strength to address critical challenges in the field. This study provides readers with an extensive understanding of the salient research themes, trends, and patterns of sustainable fire-resistant polysaccharide-based composite aerogel research worldwide.

Mountain fire can become more complex than fires at lower elevation due to the complex interaction of fire, topography, and weather. The Gell River Fire in Tasmania, Australia occurred in rugged terrain where there are abundant fire sensitive vegetation communities, as well as the presence of infrastructure including high-voltage transmission lines. The fire began at the end of December 2018 and lasted a few months, with a final burnt area of approximately 350km² despite significant fire suppression effort. The fire was investigated by employing wind vector maps, numerical weather model vertical sounding charts (NWMVS) and Prototype 2, which is an integrated fire simulator and can detect lateral fire channeling (LFC). Our analysis of the fire found its spread was likely to be introduced into a valley by forced channeling (FC), which is modified synoptic wind, and showed rapid spread in the valley. The simulated fire also showed wider spread than the observed data in the valley, with the simulated fire impacting highly sensitive vegetation communities on the fringes of the valley. This alludes to some potential conclusions: (1) The loss of fire sensitive vegetation would have increased if fire suppression activity had not been conducted. (2) Spotting fires could be produced by LFC because these spotting fire would allow spreading fire in a shorter period. (3) Heterogeneity of vegetation, such as combination of buttongrass and forest, could help carry fire rapidly in the valley with LFC. Fire can propagate faster in buttongrass than in forests while the forests allow the spotting fire.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

In the overall context of national eco-conservation civilization development and considering the hills in the Beijing-Tianjin-Hebei-Shanxi region, the local forest coverage rate is gradually on the rise, and so is the risk of forest fire. Every year, satellites can monitor and detect hundreds of fire spots on average. In recent years, serious fire took place for several times, leading to loss of life and personal injury. Then the fire-fighting work consumed huge amount of labor and material resources, exerting negative social impacts in many ways. Thus, the analysis of fire climate background in this region and the forecast based on fire weather indexes constitute an important part in the forest fire risk management. Located in the tropical monsoon climate zone, four provinces and municipalities of Beijing, Tianjin, Hebei and Shanxi are similar in terms of climate characteristics. This study tries to analyze the characteristics about fire spots under satellite monitoring, fire climate and fire weather index. The probability distribution analysis of weather index about fire spots in history and key meteorological observation stations as well as the weather index analysis in the early stage of typical fire indicate that the Fine Fuel Moisture Content (FFMC) and the Initial Spread Index (ISI) in the Fire Weather Index (FWI) system is applicable to the fire risk analysis in the Beijing-Tianjin-Hebei-Shanxi region, which can also effectively indicate the fuel moisture and spread conditions. As regards to the average level in Beijing-Tianjin-Hebei-Shanxi, when the FFMC is smaller than 93.5 and the ISI is also smaller than 5.0, there is a low risk of fire; when the FFMC is above 94 and the ISI is larger than 10.0, there is a high risk of fire; and the fire risk will be extremely high if the FFMC is over 96 and the ISI is above 13.0. In the practical fire-fighting management, the fire danger class can be released in reference to the ISI classes and threshold values of key meteorological observation stations under analysis provided by this study.

Background: We studied Riveaux Road Fire, which was ignited by multiple lightning strikes in January 2019 and burnt more than 637.19 km² in southern Tasmania, Australia. Aims: We focused on fire weather, such as identification of dynamic wind and vegetation type, in a valley of the study area. Methods: We employed two methods: numerical weather model vertical sounding (NWMVS) and the use of a fire simulator, to quantify and examine the contribution of dynamic winds to fire behaviour. The NWMVSs allow rapid diagnosis of changes in wind, temperature, dew point temperature and cloud coverage. Prototype 2 is a fire simulator based on the specification of Australian Fire Danger Rating System (AFDRS). Key results: We found fires to be guided by terrain-forced channelling primarily and by downslope wind conditionally in the valleys. In addition, the fire intensity periodically changed with the magnitude of surface wind, in buttongrass moorland, in which the fire often smoulders, during the fire period according to the satellite image. Conclusions and Implications: Therefore, there should be caution for not only terrain and dynamic wind but also vegetation type during fire spread in rugged terrain.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

We previously showed that mice with knockout in the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) gene encoding the PGC-1a protein and nuclear factor erythroid 2 like 2 (NFE2L2) gene, showed some features of the age-related macular degeneration (AMD) phenotype. To further explore the mechanism behind the involvement of PGC-1a in AMD pathogenesis we used young (3-month) and old (12-month) mice with knockout in the PPARGC1A gene and age-matched wild-type (WT) animals. An immunohistochemical analysis showed age-dependent different expression of markers of oxidative stress defense, senescence and autophagy in the retinal pigment epithelium of KO animals as compared with their WT counterparts. Multivariate inference testing showed that senescence and autophagy proteins had the greatest impact on the discrimination between KO and WT 3-month animals, but proteins of antioxidant defense also contributed to that discrimination. A bioinformatic analysis showed that PGC-1a might coordinate the interplay between genes encoding proteins involved in antioxidant defense, senescence and autophagy in the aging retina. These data support importance of PGC-1a in AMD pathogenesis and confirm the utility of mice with PGC-1a knockout as an animal model to study AMD pathogenesis.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

CO2 is widely used in the prevention and control of coal spontaneous combustion. In this manuscript, three low-rank coals with different metamorphic degrees were selected as the research objects. The temperature-programmed experiments, in-situ infrared cooling experiments, simulation of competitive adsorption of CO2 and O2 in coal pores, and simulation study of CO2 inhibition of coal oxygen composite reaction were used to obtain the role and effect of CO2 in preventing oxygen adsorption in coal at low-temperature oxidation stage. It is concluded that CO2 can displace the O2 near the pore wall to physically prevent the adsorption of O2. Through the change law of heating rate and kinetic analysis, it is found that CO2 can increase its activation energy by 5.3%-108.3% during the slow heating stage of coal, and reduce its heating rate. At around 120°C, coal loses the protective effect of CO2. From the changes of functional groups, it can be seen that when coal is cooled in CO2 atmosphere, mainly pyrolysis and condensation reactions occur due to the lack of O2. In addition, CO2 can also inhibit the chain reaction of coal's chemical adsorption of oxygen. This work provides a theoretical basis for CO2 prevention and control of coal spontaneous combustion.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Visual impairment and blindness are a growing public health problem, as they reduce the quality of life of millions of people. The management and treatment of these diseases represent a scientific and therapeutic challenge, since the different cellular and molecular actors involved in the pathophysiology are still being identified. The visual system components, particularly the retinal cells, are extremely sensitive to genetic or metabolic alterations, and immune cells activated by insults contribute to biological events that culminate with vision loss and irreversible blindness. Several ocular diseases are linked to retinal cell loss, and diseases such as retinitis pigmentosa, age-related macular degeneration, glaucoma and diabetic retinopathy are characterized by pathophysiological hallmarks that represent possibilities to study and develop novel treatments for retinal cells degeneration. Here, we present a compilation of revisited information on retinal degeneration, including pathophysiologic and molecular features, biochemical hallmarks and possible directions for novel treatments, aiming to assist as a guide for innovative research. The expansion of knowledge of the mechanistic bases of the pathobiology of eye diseases, including information on the complex interactions of genetic predisposition, chronic inflammation, and environmental and aging-related factors will allow the identification of new therapeutic strategies.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Lipofuscin accumulates with age as intracellular fluorescent granules originating from incomplete lysosomal digestion of phagocytosed and autophagocytosed material. The purpose of this review is to provide an update on the current understanding of the role of oxidative stress and/or lysosomal dysfunction in lipofuscin accumulation and its consequences, particularly for retinal pigment epithelium (RPE). Next, the fluorescence of lipofuscin, spectral changes induced by oxidation, and its contribution to retinal fluorescence are discussed. This is followed by reviewing recent developments in fluorescence imaging of the retina, and the current evidence on the prognostic value of retinal fluorescence for the progression of age-related macular degeneration (AMD), the major blinding disease affecting elderly people in developed countries. The evidence of lipofuscin oxidation in vivo, and the evidence of increased oxidative damage in AMD retina ex vivo lead to the conclusion that imaging of spectral characteristics of lipofuscin fluorescence may serve as a useful biomarker of oxidative damage which can be helpful in assessing the efficacy of potential antioxidant therapies in retinal degenerations associated with accumulation of lipofuscin and increased oxidative stress. Finally, amendments to currently used fluorescence imaging instruments are suggested, to be more sensitive and specific for imaging spectral char-acteristics of lipofuscin fluorescence.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

There is only a very short reaction time for people to find the best way out of a building in a fire outbreak. Software applications can be used to assist the rapid evacuation of victims; however, this is an arduous task, which requires an understanding of advanced technologies. Since well-known pathway algorithms (such as, Dijkstra, Bellman-Ford and A*) can lead to serious problems over performance, we decided to make use of deep reinforcement learning techniques. A wide range of strategies including a random initialization of replay buffer and transfer learning were assessed in three projects involving schools of different sizes. The results showed the proposal was viable and that in most cases the performance of transfer learning was superior. In addition, the study raised challenges that had to be faced in the future.

Forests, integral to human civilization, hold immense value and play a vital role in maintaining ecological harmony. Despite India's goal of extensive forest coverage, significant progress is still needed. Uncontrolled forest fires pose a severe threat, particularly in Uttarakhand's Pauri Garhwal district. To address this challenge, a comprehensive study examined surface and subsurface hydrological factors influencing the forest fire occurrences, such as elevation, aspect, slope, vegetation, proximity to human settlements, proximity to waterbodies, Active faults and lineament density. A total of 15 such factors were integrated with advanced techniques of remote sensing and GIS and coupled with historical fire data to create a precise forest fire risk map using the support vector machine algorithm. Forest fire risk map was classified into 5 distinct risk zones, Very High Risk (47.38 Km2), High Risk (275.98 km2, Moderate Risk (985.49 km2), Low Risk (1741.17 km2) and Very Low Risk (2374.11 km2) aiding in proactive fire management. By embracing this innovative tool, decision-makers can protect forests, preserve biodiversity, and ensure a sustainable future for generations to come.

Introduction: The primary objective of researchers in the biology of ageing is to gain a comprehensive understanding of the ageing process while developing practical solutions that can enhance the quality of life for older individuals. This involves a continuous effort to bridge the gap between fundamental biological research and its real-world applications. Purpose: In this narrative review, we attempt to link research findings concerning the hormetic relationship between neurons and germ cells, and translate these findings into clinically relevant concepts. Methods: We conducted a literature search using PubMed, Embase, PLOS, Digital Commons Network, Google Scholar and Cochrane Library from 2000 to 2023, analyzing studies dealing with the relationship between hormetic, cognitive, and reproductive aspects of human ageing. Results: The process of hormesis serves as a bridge between the biology of neuron-germ cell interactions on one hand, and the clinical relevance of these interactions on the other. Details concerning these processes are discussed here, emphasizing new research which strengthens the overall concept. Conclusions: This review presents a scientifically and clinically relevant argument, claiming that maintaining a cognitively active lifestyle may decrease age-related degeneration, and improve overall health in ageing.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

The 2022-2023 Chilean summer showed increased temperatures and similar burned area, compared to the 2016-2017 season, where more than 500,000 hectares were compromised, mainly in the rural areas. After a brief review, it is revealed that the effects of forest fires on soil and hydrological properties are barely debated in Chile. Here, we showed a climatological analysis where temperature records in the 2016-2017 season were unusual, as well as another unexpected increase in the summer of 2022-2023, resulting in high-severity fires known as ‘mega-fires’ or “storm-fires”. Mega-fires affect forest plantations and native forests mainly from 33º S (Maule Region) to 39º S (Los Ríos Region) and they are expected to become frequent due to climate change, moving from the north to the south. We present an overview of the influence of wildfires on soil components in the most affected areas (inland, Coastal, and Andes ranges), their hydrological impacts, and potential erosion risk due to high winter precipitation. We propose several management practices that could help to prevent or mitigate these events, including pre-and post-fire interventions, such as afforestation and seeding, selective logging, mulching, erosion barriers, soil preparation, and dam monitoring. We argue that any effective plan in fire-prone and affected areas should include a combination of actions taken at the hillslope scale at integral ecosystem management, whose effectiveness should be monitored and verified regionally at the watershed scale.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

Crop residue burning produces a lot of polluting gases and fine particles, endangering human health, damaging soil structure, and causing fire accidents. In addition to the impact of residue burning on the local environment, pollutants can spread with the wind to more distant areas and impact the air quality of surrounding areas, especially cities. Nevertheless, a comparative analysis of the impact of two common residue burning parameters, the number of residue fire points and residue burned area, on urban air quality indicators has not been reported. In this study, the correlation between these two different residue burning parameters on air quality in Daqing City was investigated comparatively using the Visible Infrared Imaging Radiometer Suite (VIIRS) fire point product, the Moderate-resolution Imaging Spectroradiometer (MODIS) burned area product, and buffer zone analysis. The association between MODIS burned area products and air quality index (AQI) was found to be around 0.8, with a maximum of 0.816 at a buffer zone radius of 50 km. Meanwhile, it was found that the correlation between the number of residue fire points extracted from the VIIRS active fire products and air quality was above 0.6, again with a maximum of 0.745 at a buffer radius of 50 km. Within other levels of buffer zones, the correlation between residue burned area and AQI was consistently higher than that between residue fire points and AQI. By comparing the correlation between VIIRS fire points, MODIS burned area, and AQI with the concentration of each pollutant, we found that the correlation between residue burned area and AQI and the concentration of each pollutant is higher. MODIS burned area monitoring, on the other hand, detects changes in the time series of images taken by satellite at two transit moments to obtain the new burned area and cumulative burned area during this period, allowing the monitoring of fire traces caused by fire points at non-transit moments. From analyzing the correlation between residue fire points, residue burned area, and the concentration of each pollutant (PM2.5, PM10, CO, NO2, SO2, O3), we found significant correlations between residue burning and PM2.5, PM10, CO, and NO2 concentrations, with the highest correlation (R2) of 0.81 for PM2.5. Moreover, the correlation between residue burned area and PM2.5, PM10, CO, and NO2 concentrations was significantly higher than that between the number of residue fire points and their concentrations.

Global warming is increasing the frequency and intensity of compound drought-heat events (CDHEs), potentially leading to larger and more extreme fire seasons in mesic forests. Wildfire activity in subtropical China, under the influence of monsoonal rainfall, was historically limited to dry winters and rare in rainy summers. Here we seek to test that this area is on the brink of a major change in its fire regime characterized by larger fire seasons, extending into the summer, leading to increases in burned area. We analyze fire activity in Chongqing Municipality (46,890 km2), an important area in subtropical China hosting the Three Gorges Reservoir Area. We observed significant increases in summer forest fires under anomalous dry-hot summer conditions, where total burned area was 3-6 higher than the historical annual mean (largely confined to the winter season). Vapor pressure deficit, an indicator of hot and dry conditions, was a strong predictor of fire activity, with major wildfires occurring on days where VPD was higher than 3.5kPa. Results indicate that major wildfire activity may occur in the area as a result of climate change, unless strong fire prevention policies are implemented.

The concept of ecosystem services (ESs) provides a valuable approach to communicate societies' dependence on natural ecosystems, assisting in the evaluation of measures to protect vegetation in watersheds that promote water-related ESs. Vegetation cover and land use are important factors related to the capacity of ecosystems to provide soil loss regulation and sediment retention services, which are highly relevant for sediment management in watersheds draining into reservoirs with multiple water uses. This study aims to assess the relationship between potential changes in land use and land cover and the sediment retention service provided by riparian vegetation in a watershed draining into a hydroelectric reservoir in the Brazilian Cerrado. Sediment load was selected as a physical variable that affects different water uses in reservoirs, with these uses being dependent on the quality or quantity of stored water. Scenarios were analyzed to represent landscape reconfigurations from a baseline condition in order to account for the recovery of riparian vegetation by the agricultural sector, as foreseen in the Brazilian Forest Code. To map and quantify variations in annual sediment retention, the InVEST model was used, which allows estimating an integrated response of the drainage basin to large-scale land use changes over time and space. The results show that for the drainage basin of the Corumbá IV Hydroelectric Power Plant (HPP), the recovery of riparian areas occupied by annual crops has the potential to generate greater benefits to water use in the reservoir. In the studied catchment area, 14% of the total vegetation deficit in riparian areas is occupied by crops, while 86% is occupied by pastures. This highlights the buffering role of riparian vegetation as an effective practice for managing sediment flows originating from sheet erosion in agricultural landscapes. The methodology employed in this study allows for the quantification and mapping of the effects of soil and water conservation measures in river basins. This enables the prioritization of sectoral efforts for the restoration of native vegetation, considering the highest returns in benefits perceived by water users affected by sediment input in reservoirs. The study's results reinforce the importance of conserving vegetation in riparian areas and their surroundings for sediment retention, highlighting the role of these areas as assets in providing water-related ecosystem services.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

The Victorian Government Inquiry into wildfires that killed 173 people in 2009 has driven an Australian policy shift from self-evacuation or staying and defending a well-prepared property (‘go or stay’) to self-evacuation under catastrophic fire weather (‘leave early’). The Inquiry also led to the establishment of national ‘performance standards’ for Private Fire Shelters (PFS, that also known as bunkers). Nonetheless, incorporation of PFS into national bushfire policy remains embryonic with only Victoria having streamlined accreditation and planning approval processes. Arguments against PFS include potentially engendering complacency about preparing dwellings to survive fire and encourage risky behavior in response to a fire threat. Counteracting these arguments is research that shows that residents without PFS have low engagement with bushfire preparation and typically delay evacuation. In any case, because wildfire is unpredictable it is accepted that self-evacuation plans must have fallback positions that include sheltering ‘in place’ from the bushfire, making properly used and well maintained PFS an important element of bushfire safety. A less discussed barrier to PFS uptake outside Victoria appears to hinge on a lack of clarity about obligations for their design, certification, and consistency with planning approvals. The escalating Australian fire crisis demands much greater research and development in legal frameworks, policy and planning processes for PFS, as well as design and construction standards.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study probes the probabilistic features of major fire hazards in enclosed spaces to establish their importance to the occurrence of fires onboard ro-ro passenger ships and in turn to raise effective operational countermeasures. Distinct from the previous studies, the present research employs Bayesian Network (BN) analysis to determine the probabilities of fire hazards more effectively. The findings of the research include five critical basic events (BE) identified namely, vehicle engine fire (fuel system fault), vehicle electric fire (electrical equipment defect or short circuit), used car electrical fire, reefer units electrical fire (electrical appliances defects or short circuit), and cargo spontaneous combustion. Additionally, the risk of fire for lithium - ion battery powered vehicles is also highlighted in the process of BN analysis, which prompts the authors to propose preventive measures for mitigating the possibility of fire occurrence on this type of electric vehicles. It is hoped that these measures can be essential justifications for establishing relevant rules regarding carrying LIB vehicles in enclosed spaces on international level.

This work analyzes a new indoor laboratory data set looking at early fire indicators in controlled and realistic experiments representing different incipient fire scenarios. The experiments were performed within the confines of an indoor laboratory setting using multiple distributed sensor nodes on different room positions. Each sensor node collected data of particulate matter (PM), volatile organic compounds (VOC), CO, CO2, H2, UV, air temperature and humidity in terms of a multivariate time series. These data hold immense value for researchers within the machine learning and data science communities who are keen on exploring innovative advanced statistical and machine learning techniques. They serve as a valuable resource for the development of early fire detection systems. The analysis of the collected data was carried out in dependence of the manhattan distance between the fire source and the sensor node. We found that especially larger particles (&gt; 0.5 μm) and VOCs show a significant dependency with respect to the intensity as a function of the manhattan distance to the source. Moreover, we observed differences in the propagation behavior of VOCs, PM, and CO, which are particularly relevant in incipient fire scenarios due to the presence of strand popagation effects.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

After three years of the onset of the pandemic, there is scarce evidence about how COVID-19 disease affect the female reproductive system, and consequently, the menstrual cycle. Since the common causes of secondary amenorrhea are considered as exclusion criteria in the studies about menstrual changes following SARS-CoV-2 infection, the prevalence of this event and the influencing factors in formerly menstruating women remains unknown. A retrospective observational cross-sectional study was conducted on Spanish adult women (N= 17,512), using an online survey; a subpopulation of SARS-CoV-2-infected-formerly menstruating women was included in the present analysis (n= 72). Collected data included general characteristics, medical history, and specific information about COVID-19 disease. 38.9% of the respondents experienced menstrual-related disturbances after suffering from the COVID-19 disease, unexpected vaginal bleeding being the most common (20.8%). Other alterations related with the length – “shorter” by 12.5% − and the flow − “heavier than usual” 30.3% − of the menstrual bleeding were reported. The binary logistic regression showed that being a perimenopausal woman (AOR 4.608, CI 95%, 1.018 – 20.856, p = 0.047) and having heavy menstrual bleeding (AOR 4.857, CI 95%, 1.239 – 19.031, p=0.023) are influential factors. This evidence could help health professionals to provide scientifically up-to-date information to their patients, empowering them to actively manage their reproductive health, especially in those societies where menstrual health is still a taboo.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

As in many parts of the world, rural-urban, forest-urban interface areas surrounding urban regions expose the natural areas they interact with to a threat of fire risk that can reach various sizes. This risk has been assessed for various regions of the world using many different methods and numerical models so far. Among these, it is seen that machine learning models have successful applications in risk assessment and risk prediction studies. For the fire risk prediction of Istanbul's yet unurbanized regions, but where the city is anticipated to potentially shift, data was collected using the opportunities provided by Geographic Information Systems and Remote Sensing technologies based on fires that occurred between 2000-2021, and the region was examined. Machine learning methods' Random Forest (RF), Extreme Gradient Boosting (XGB), and Light Gradient Boosting (LGB) models were applied for the classification of factors effective in fire. The best result was given by the RF model with 0.93 accuracy, 0.062 F1 score, and 0.753 Area Under Curve (AUC) value. In the classification of factors in the RF model, the grouping between fire-initiating factors and factors effective in spreading is evident, while this distinction is partially noticeable in the other two models.

Fires pose a significant threat to human life and property. An autonomous fire detection and fighting robot has the potential to mitigate the challenges associated with firefighting. This paper presents the implementation of an autonomous fire detection and fighting robot equipped with sensors, algorithms, and actuators to detect, locate, and suppress fires autonomously. The robot's mechanical and electrical components were designed, prototyped, and tested in a controlled environment to evaluate its ability to navigate through obstacles, detect fires, and suppress them autonomously. The results show that the robot effectively detects and suppresses fires, making it a promising solution for firefighting applications. The study contributes to the development of autonomous robots for firefighting, enhancing the safety of firefighters and the effectiveness of firefighting operations.

Previous research on video game player aggression has focused on violent content, while recent studies have examined competitive factors. Few research has examined the solely impacts of competitive factors in video games without violent content on aggression, and it is still unknown what neurological processes of these effects. The present study is the first to examine the the electrophysiological characteristics of short-term competitive video game exposure and aggression. Thirty-five participants played a video game in either competitive or solo mode for 15 minutes, followed by an ERP experiment based on the Oddball paradigm and the hot sauce paradigm to measure aggressive behavior. Results showed that playing competitive game mode was associated with faster judgment to aggressive words, larger P300 amplitudes, and selection of more chili powder. The P300 amplitude partially mediated the relationship between competitive game exposure and aggressive behavior. These findings support the general aggression model.

In the framework of the FireStorm project, four portable weather stations were installed in the Lousã/Estrela mountain range. Given that the Portuguese Institute for Sea and Atmosphere’s sur-face network has two weather stations installed in this region, the new data allows an improved monitoring of the vertical variability of near-surface variables in this mountainous region. As most of the wildfires in mainland Portugal affect areas with complex terrain with elevations below 1200 m and major fires continue to burn overnight, it is also relevant to monitor the vertical changes of meteorological variables in the nighttime period, as these may exhibit large variability. This study provides the first assessment of the available data, with focus on the summer seasons of 2021 and 2022. The results highlight the large variability that was observed in the region and suggest that the risk of extreme fire behaviour in the nighttime period may be underestimated.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Fires are the leading cause of death, serious injury and property damage. In the past, schools, temples and government offices had more frequent fires than they should. Statistics showed that the number of fires between 2017 to 2022 amounted 13,593 cases which mostly occurred in the school, temple and government offices (40.0% of all buildings). Moreover, it causes more damage among disabled especially the blinds who has a limited vision. Therefore, this cross-sectional purpose of this study was to assess fire risk including management model in school for the blind. The fire checklists, brainstorming and Analytic Hierarchy Process (AHP) were applied to estimate the fire risk in school for the blind building. The findings revealed an inherent fire hazard factors with a risk score equal to 3.2830 and evacuation factors with a risk score equal to 3.3178 were acceptable risk except the fire control factors with a risk score equal to 1.4320 was unacceptable risk may cause an impact on life, health, property and public communities. Eventually, efforts should be made to supervise those risk factors by designing suitable activities to reduce undesirable conditions in school for the blind.

The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

In this study, we focus on the effects of fuel bed representation and fire heat and smoke distribution in a coupled fire-atmosphere simulation platform for two landscape-scale fires: the 2018 Camp Fire and the 2021 Caldor Fire. The fuel bed representation in the coupled fire-atmosphere simulation platform WRF-Fire currently includes only surface fuels. Thus, we enhance the model by adding canopy fuel characteristics and heat release, for which a method to calculate the heat generated from canopy fuel consumption is developed and implemented in WRF-Fire. Furthermore, the current WRF-Fire heat and smoke distribution in the atmosphere is replaced with a heat-conserving Truncated Gaussian (TG) function and its effects are evaluated. The simulated fire perimeters of case studies are validated against semi-continuous, high-resolution fire perimeters derived from NEXRAD radar observations. Furthermore, simulated plumes of the two fire cases are compared to NEXRAD radar reflectivity observations followed by buoyancy analysis using simulated temperature and vertical velocity fields. The results show that while the improved fuel bed and the TG heat release scheme have small effects on the simulated fire perimeters of the wind-driven Camp Fire, they affect the propagation direction of the plume-driven Caldor Fire, leading to better-matching fire perimeters with the observations. However, the improved fuel bed representation together with the TG heat smoke release scheme leads to more realistic plume structure in comparison to the observations in both fires. The buoyancy analysis also depicts more realistic fire-induced temperature anomalies and atmospheric circulation when the fuel bed is improved.

Using lightweight fire-rated board (LFRB) presents cost-effective opportunities for various passive fire protection measures. The aim of the project is to develop a LFRB with enhanced fire resistance, acoustic properties, and mechanical properties. These properties were determined using the Bunsen burner, furnace, energy dispersive X-Ray, impedance tube instrument, and Instron universal testing machine. To fabricate the LFRBs, vermiculite and perlite were blended with flame-retardant bind-ers, and four types of LFRBs were produced. A fire test was conducted to compare the fire-resistance performance of the LFRBs with a commercially available flame retardant board. The B2 prototype showed exceptional fire-resistant properties, with a temperature reduction of up to 73.0 °C as compared to the commercially available fire-rated magnesium board. Incorporating nano chicken eggshell into the specially formulated flame-retardant binder preserved the LFRBs’ structural integrity, enabling them to withstand fire for up to 120 minutes with an equilibrium temperature of 92.6 °C. This approach also provided an absorption coefficient of α = 2.0, a high flexural strength of 3.54 MPa, and effective flame retardancy properties with a low oxygen/carbon ratio of 2.60. These results make the LFRBs valuable for passive fire protection applications in the construction and building materials industry.

Forest fires are one of the world's deadliest natural disasters. Early detection of forest fires can help minimize the damage to ecosystems and forest life. In this paper, we propose an improved fire detection method YOLOv5-IFFDM for YOLOv5. Firstly, the fire and smoke detection accuracy and the network perception accuracy of small targets are improved by adding attention mechanism in the backbone network. Secondly, the loss function is improved and the SoftPool pyramid pooling structure is used to improve the regression accuracy and detection effect of the model and the robustness of the model. In addition, random Mosaic augmentation technique is used to enhance the data to increase the generalization ability of the model, and re-clustering of flame and smoke detection a priori frames are used to improve the accuracy and speed. Finally, the parameters of the convolutional and normalization layers of the trained model are homogeneously merged to further reduce the model responsibility to improve the detection speed. Experimental results on homemade forest fire and smoke datasets show that this algorithm has high detection accuracy and fast detection speed, with average accuracy of fire up to 90.5% and smoke up to 84.3%, and detection speed up to 75 FPS (frames per second transmission), which can meet the requirements of real-time and efficient fire detection.

Tightly regulated and robust mitochondrial activities are critical for normal hearing. Previously, we demonstrated that Fus1 KO mice with mitochondrial dysfunction exhibit premature hearing loss. Molecular analysis of the cochlea revealed hyperactivation of the mTOR pathway, oxidative stress, altered mitochondrial morphology and quantity, suggesting compromised energy sensing and production. Here, we investigated whether pharmacological modulation of metabolic pathways using rapamycin (RAPA) or 2-deoxy-D-glucose (2-DG) supplementation can protect against hearing loss in female Fus1 KO mice. Additionally, we aimed to identify mitochondria- and Fus1-dependent molecular pathways and processes critical for hearing. We found that inhibiting mTOR or activating alternative mitochondrial energetic pathways to glycolysis protected hearing in the mice. Comparative gene expression analysis revealed dysregulation of critical biological processes in the KO cochlea, including mitochondrial metabolism, neural and immune responses, and cochlear hypothalamic–pituitary–adrenal axis signaling system. RAPA and 2-DG mostly normalized these processes, although some genes showed a drug-specific response or no response at all. Interestingly, both drugs resulted in a pronounced upregulation of critical hearing-related genes not altered in the non-treated KO cochlea, including cytoskeletal and motor proteins, and Ca2+-linked transporters and voltage-gated channels. These findings suggest that pharmacological modulation of mitochondrial metabolism and bioenergetics may restore and activate processes critical for hearing, thereby protecting against hearing loss

The frequency of selected polymorphisms, one in each gene coding for proteins with antioxidative properties (CAT, SOD2, GPX1, NQO1) was compared between patients suffering from pain-related temporomandibular disorders (TMDp;n=85) and control subjects (CTR;n=85). According to the Oral Behaviours Checklist score participants were divided into high-frequency parafunction (HFP;n=98) and low-frequency parafunction (LFP;n=72) groups. In addition, we have investigated the association of selected polymorphisms with participants' psychological (anxiety, depression) and psychosomatic (hypervigilance, somatosensory amplification) characteristics. Polymorphisms rs1001179, rs4880, rs1050450, rs689452 were genotyped using the genomic DNA extracted from buccal mucosa swabs and real-time TaqMan genotyping assays. No differences in genotype distribution between TMDp patients and control subjects were found. Still, TMDp patients who were homozygous for minor allele A, related to the GPX1 polymorphism rs1050450 reported significantly more waking-state oral behaviours compared to GA+GG genotype carriers (score: 30 vs. 23, p=0.019). Frequency of genotype AA for rs1050450 polymorphism was higher in HFP compared to LFP participants (14.3% vs. 4.2%, p =0.030). Most important predictors of waking-state oral behaviours were depression, anxiety, AA genotype (rs1050450) and female sex. Explored genetic factors were not found to be significant risk factors for either TMDp or sleep-related oral behaviours. The association of waking-state oral behaviours with selected gene polymorphisms additionally supports previous assumptions that the daytime bruxism is more closely linked to various stress manifestations, which might also be reflected through the variability related to cellular antioxidative activity.

The human polyamines spermine and spermidine are essential for cell function, and their properties have been extensively studied. However, research results of experiments conducted without understanding the properties of polyamines have been evaluated and published by reviewers who appear to have little knowledge of the properties of polyamines. It is sad that some studies repeat what was done more than half a century ago before polyamines were characterized. First, I explain the basic properties of polyamines that researchers need to know. Then, the relationship between changes in polyamine levels in the body and age- and lifestyle-related diseases is discussed. In addition, the epigenetic mechanism of action of polyamines in relation to healthy longevity and, conversely, age- and lifestyle-related diseases and the progression of senescence are discussed. Spermine, which increases with a polyamine-rich diet, acts to suppress aberrant gene methylation and proinflammatory status associated with aging. Meanwhile, chronic inflammation associated with aging induces the enzyme activity of spermine oxidase, which breaks down spermine and produces acrolein, resulting in reduced spermine levels. Acrolein, a toxic aldehyde that increases with age- and lifestyle-related diseases, is thought to accelerate these diseases.

Oxidative stress (OS) is involved in the pathogenesis of retinal neurodegenerative diseases like age-related macular degeneration (AMD) and diabetic retinopathy (DR) and an important target of therapeutic treatments. New therapeutics are tested in vivo despite limits in transferability and ethical concerns. Retina cultures using human tissue can deliver critical information and significantly reduce the number of animal experiments along with increased transferability. We cultured up to 32 retina samples derived from one eye, analyzed models’ quality, induced OS, and tested efficiency of antioxidative therapeutics. Bovine, porcine, rat, and human retinae were cultured in different experimental settings for 3-14 d. OS was induced by high-glucose or hydrogen peroxide (H2O2) and treated by Scutellarin, pigment epithelium-derived factor (PEDF), and/or granulocyte macrophage-colony stimulating factor (GM-CSF). Tissue morphology, cell viability, inflammation, and glutathione level were determined. Retina samples showed only moderate necrosis (23.83±5.05 increased to 27.00±1.66 AU PI-staining over 14 d) after 14 days in culture. OS was successfully induced (reduced ATP content of 288.3±59.9 vs. 435.7±166.8 nM ATP in controls); antioxidants reduced OS-induced apoptosis (from 124.20±51.09 to 60.80±319.66 cells/image after scutellarin-treatment). Enhanced mammalian animal and human retina cultures allow reliable, highly transferable research on OS-triggered age-related diseases and pre-clinical testing during drug development.

Age-related Macular Degeneration (AMD) is the major cause of elders’ vision loss, early screening and treatment are the most efficient way to reduce the rate of blindness. AI-based methods based on ophthalmic images play great potential for AMD diagnosis. However, low levels of accuracy, robustness, and explainability are challenges for AI approaches applied in clinics. Thus, this study proposed a multi-type of data source fusion method and a multi-model fusion approach for AMD detection. Typical unsupervised (Hierarchical Clustering and K-Means), typical supervised (SVM, VGG-16, and ResNet) methods, and proposed methods (multi-source data fusion-based method and multi-model fusion-based approach) are compared based on Optical Coherence Tomography (OCT), Fundus Autofluorescence (FAF), regular color fundus photography (CFP) and Ultra-Wide field Fundus (UWF) images. Data preprocessing and enhancements of each type of data are discussed. A feature extraction based on unsupervised ML models, feature combination and normalization, and multi-layer perception (MLP) algorithm are involved in the proposed multi-source data fusion-based method. Supervised ML and DL models and a voting mechanism are involved in the multi-model fusion-based approach. Findings show that the proposed methods present a high performance of accuracy and robustness. A real-world UWF database is involved from Shenzhen Aier Hospital. Practical and theoretical contributions are delivered. A reference value for medical diagnosis based on multiple digital images is contributed.

Number of studies claim that tobacco control (TC) regulations are associated with reductions in smoking-related hospitalisation rates, however very few have estimated the impact of TC laws (TCL) at both countrywide and regional levels, and none of them - in relation to compliance with TC regulations. This study evaluates the effects of Russian TCL on hospital admission (HA) rates for pneumonia countrywide and in 10 Russian regions and the extent of these effects in connection with the compliance to TCL. Methods: HA rates for pneumonia during 2005–2019 were analysed to compare the periods before and after the adoption of TCL in 2013. An interrupted time series design and a Poisson regression model were used to estimate the immediate and long-term effects of TCL on pneumonia annual hospitalisation rates after the TCL adoption, compared with the pre-law period. The 10 Russian regions were compared using the TCL Implementation Scale (TCIS) developed on the basis of the results of Russian TC policy evaluation survey; Spearman’s rank correlation and linear regression models were employed. Results showed a 14.3% reduction in HA rates for pneumonia (RR 0.88; p=0.01) after the adoption of TCL in Russia with significant long-term effect after 2013 (RR 0.86; p=0.006). Regions with better enforcement of TCL exhibited greater reductions in pneumonia HA rates (rsp=−0.55; p=0.04); (=−4.21; p=0.02). Conclusions: TCL resulted in a sustained reduction in pneumonia hospitalisation rates, but these effects, varying by region, may depend on the scale of the TCL enforcement.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

The dependence of longleaf pine (Pinus palustris) ecosystems on fire is well-understood, and anthropogenic alteration of fire cycles within its natural range has contributed to its decline. This is increasingly exacerbated in areas of urban interfaces, wherein use of prescribed fire can be problematic. The purpose of this study—the University of West Florida Campus Ecosystem Study—was to examine effects of fire exclusion on longleaf pine in the unique urban interface of a university campus. This was conceived as an interconnected series of investigations on the main campus and three associated natural areas that comprise remnant longleaf stands following cessation of widespread longleaf pine harvesting ~120 years ago. This period of chronic fire exclusion has allowed for a distinct shift in stand structure and composition. The open, savanna-like structure of fire-maintained longleaf stands has transitioned into closed-canopy forests with the increased prevalence of southern evergreen oaks (especially live oak—Quercus virginiana) and Magnolia spp., resulting in complete absence of longleaf regeneration. Fire exclusion has also appeared to have decreased soil fertility. Significant variation in mean age of longleaf pine stems of the main campus and natural areas suggest that the natural areas were likely under separate ownership with contrasting land-use history prior to purchase by the State of Florida for campus construction in 1963.

Amphetamine is a psychostimulant drug with a high risk of toxicity and death when misused. Abuse of amphetamines is associated with an altered organic profile, which includes omega fatty acids. Low omega fatty acid levels are linked to mental disorders. Using the Comparative Toxicogenomic Database (CTD), we investigated the chemical profile of the brain in amphetamine-related fatalities and the possibility of neurotoxicity. We classified amphetamine cases as low (0-0.5 g/ml), medium (&gt;0.5 to 1.5 g/ml), and high (&gt;1.5 g/ml) based on amphetamine levels in brain samples. All three groups shared 1-octadecene, 1-tridecene, 2,4-di-tert-butylphenol, arachidonic acid, docosahexaenoic acid (DHA), eicosane, and oleylamide. We identified chemical-disease associations using the CTD tools and predict an association between docosahexaenoic and arachidonic acids and curated conditions like autistic disorder, disorders related to cocaine, Alzheimer's disease, and cognitive dysfunction. An amphetamine challenge may cause neurotoxicity in the human brain due to a decrease in omega-3 fatty acids and an increase in oxidative products. Therefore, in cases of amphetamine toxicity, supplement therapy may necessitate preventing omega-3 fatty acid deficiency.

Fire regimes in mountain landscapes of southern Europe have been shifting from their baselines due to rural abandonment and fire exclusion policies. Understanding the effects of fire on biodiversity is paramount to implement adequate management. Herein, we evaluated the relative role of burn severity and heterogeneity on bird abundance in an abandoned mountain range located in the biogeographic transition between the Eurosiberian and Mediterranean region (the Natural Park ‘Baixa Limia–Serra do Xurés’). We surveyed the bird community in 206 census plots distributed across the Natural Park, both inside and outside areas affected by wildfires over the last 11 years (from 2010 to 2020). We used satellite images of Sentinel 2 and Landsat missions to quantify the burn severity and heterogeneity of each fire within each surveyed plot. We also accounted for the past land use (forestry or agropastoral use) by using a land cover information for year 2010 derived from satellite image classification. We recorded 1,735 contacts from 28 bird species. Our models, fitted by using GLMs with Poisson error distribution (pseudo-R²_-average of 0.22 ± 0.13), showed that up to 71% of the modelled species were linearly correlated with at least one attribute of the fire regime. The spatiotemporal variation in burnt area and severity were relevant factors for explaining the local abundance of our target species (39% of the species; Akaike weights > 0.75). We also found a quadratic effect of at least one fire regime attribute on bird abundance for 60% of the modeled species. The past land use, and its legacy after 10 years, was critical to understand the role of fire (Akaike weights > 0.75). Our findings confirm the importance of incorporating remotely sensed indicators of burn severity into the toolkit of decision makers to accurately anticipate the response of birds to fire management.

Migraine is a debilitating neurovascular disorder characterized by recurrent headache attacks of moderate to severe intensity. Calcitonin gene-related peptide (GGRP), which is abundantly expressed in trigeminal ganglion (TG) neurons, plays a crucial role in migraine pathogenesis. Cortical spreading depolarization (CSD), the biological correlate of migraine aura, activates the trigeminovascular system. In the present study, we investigated CGRP mRNA expression in TG neurons in a CSD-based mouse migraine model. Our in situ hybridization analysis showed that CGRP mRNA expression was observed in smaller neuronal populations. CSD did not significantly change the density of CGRP mRNA-synthesizing neurons in the ipsilateral TG. However, the cell sizes of CGRP mRNA-synthesizing TG neurons were significantly larger in the 48 h and 72 h post-CSD groups than in the control group. The proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters less than 14 μm became significantly less at several time points after CSD. In contrast, we found significantly greater proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters of 14–18 μm at 24 h, 48, and 72 h post-CSD. We deduce that the CSD-induced upward cell size shift in CGRP mRNA-synthesizing TG neurons might be causative of greater disease activity and/or less responsiveness to CGRP-based therapy.

As the world's population ages and the resulting health problems become more serious, medical and health policies in developed countries are focused on how to prevent and treat the diseases of the aging population and how to maintain their quality of life. Typical age-related diseases include deafness, cataracts, osteoarthritis, chronic obstructive pulmonary disease, diabetes mellitus, and dementia. Although the mechanisms by which these diseases develop differ, they are all caused by the accumulation of molecular and cellular damage over time. In addition, age-related diseases can cause a decline in physical and mental functions and the ability to perform activities of daily living, as well as the loss of roles in society and a sense of fulfillment in life. Therefore, there is a need for treatment and measures to accurately grasp and maintain their quality of life.

Vascular calcification (VC) is associated with increased cardiovascular risks in patients with chronic kidney disease (CKD). Sodium-glucose cotransporter 2 inhibitors, like empagliflozin, can improve cardiovascular and renal outcomes. We assessed the expression of Runt-related transcription factor 2 (Runx2), interleukin (IL)-1β, IL-6, AMP-activated protein kinase (AMPK), nuclear factor erythroid-2-related factor (Nrf2), and heme oxygenase 1 (HO-1) in inorganic phosphate–induced VC in mouse VSMCs to investigate the mechanisms underlying empagliflozin’s therapeutic effects. We evaluated biochemical parameters, mean artery pressure (MAP), pulse wave velocity (PWV), transcutaneous glomerular filtration rate (GFR), and histology in an in vivo mouse model with VC induced by an oral high-phosphorus diet following a 5/6 nephrectomy in ApoE−/− mice. Compared to the control group, empagliflozin-treated mice showed significant reductions in blood glucose, MAP, PWV, and calcification, as well as increased calcium and GFR levels. Empagliflozin inhibited osteogenic trans-differentiation by decreasing inflammatory cytokine expression and increasing AMPK, Nrf2, and HO-1 levels. Empagliflozin mitigates high phosphate–induced calcification in mouse VSMCs through the Nrf2/HO-1 anti-inflammatory pathway by activating AMPK. Animal experiments suggested that empagliflozin reduces VC in CKD ApoE−/− mice on a high-phosphate diet.

Objectives: We aimed to clarify the endoscopic and clinicopathological features of raspberry-shaped gastric lesions (RSGLs) and to establish an endoscopic diagnostic algorithm for RSGLs. Methods: We collected RSGLs from an endoscopic database at our hospital between May 2009 and August 2021. All RSGLs were histopathologically classified and compared based on their endoscopic and clinicopathological characteristics. Results: Sixty-five RSGLs in 54 patients were classified into five histopathological types: gastric adenocarcinoma of foveolar type (GA-FV, n = 43), gastric adenocarcinoma of fundic-gland type (GA-FG, n = 2), gastric adenocarcinoma of fundic-gland mucosa type (GA-FGM, n = 4), hyperplastic polyp (HP, n = 12), and proton pump inhibitor-related lesion (PPI-L, n = 4). All RSGLs exhibited polygonal or curved marginal crypt epithelium (MCE). GA-FV lesions had homogenously reddish (95%) and irregular microvascular (MV) pattern (91%). GA-FG lesions were heterogeneously reddish with a submucosal tumor shape (100%) and had a regular MV pattern (50%). GA-FGM lesions were homogenously reddish (75%) and occasionally had a submucosal tumor shape (50%) with an irregular MV pattern (75%). HP and PPI-L were homogeneously reddish (93%), with linear or dotted MCE (81%) and a regular MV pattern (100%). Conclusion: Our diagnostic algorithm for RSGLs constructed using endoscopic features might be useful for the endoscopic differential diagnosis of RSGLs.

This paper is referred to a top frontline research in life science, showing that in spite of the large variation of the physiological architecture and behavioral forms of the living systems, the fundamental structure of their informational system is basically the same, allowing the body growth/development by micro to macro-structuration processes, maintaining the same informational configuration and functions like the basic unit of life – the eukaryotic cell. Starting and based on the determination of the special/specific info-operability in living structures and the role of information in structuration and their functionality, there are discussed the informational functions of the eukaryotic/prokaryotic cells, the simplest units of life and is elaborated and presented the Informational Model of the Living Structures, showing that these structures operate on the basis of two main informational systems: one of them defined as the Programmed Informational System, composed by three components, assuring respectively the info-generation, maintenance and the proliferation/reproduction, and another one defined as the Operative Informational System, necessary for the continuous communication with the environment for adaptation, consisting in four main components referred to memory, decision, sentience and info-connection/info-selection. The revealed properties are compared with the Informational System of the Human Body, as a prototype of a living system on the top of the evolutionary scale, showing/demonstrating the compatibility of structuration and functions on the entire scale, from prokaryotic/eukaryotic unit cells to multicellular organisms – plants, animals and human, by means of a continuous adaptation process, which always follows the same line of micro to macro-structuration process based on the same Info-organization and functionality. These models are new and revolutionary in the information and life sciences

Building on the job demands-resources (JD-R) and the allostatic load (AL) models, in this study we investigated the role of smart working (SW) in the longitudinal association between workload/job autonomy (JA) and a possible biomarker of work-related stress (WRS) in the hair, namely the cortisol to dehydroepiandrosterone sulphate (DHEA(S)) ratio, during the COVID-19 pandemic. Overall, 124 workers completed a self-report questionnaire (i.e., psychological data) at Time 1 (T1) and collected a strand of hair (i.e., biological data) three months later (Time 2, T2). Results from moderated multiple regression analysis showed that smart working at T1 was negatively associated with hair cortisol/DHEA(S) ratio at T2. Additionally, the interaction between workload and SW was significant, with workload at T1 being positively associated with hair cortisol/DHEA(S) ratio at T2 among smart workers. Overall, this study indicates that SW can be conceived as a double-edged sword, with both positive and negative consequences on employee well-being. Furthermore, our findings suggest that hair cortisol/DHEA(S) ratio is a promising biomarker of WRS. Practical implications that organizations and practitioners can adopt to promote organizational well-being are discussed.

Immune checkpoint inhibition therapy (ICIT) is an emerging field in oncology especially opening new horizons to chemotherapy refractory patients. This paper provides deep insight into immune related adverse events (irAEs) posing a major challenge and drawback to ICIT, and presents right management strategies for very complex complications. Moreover, for the first time in literature, a non-linear mathematical model is introduced to measure the ICIT success rate and to decide about the optimum ICIT duration. Furthermore, a strategy is presented to overcome or to delay the progression after initial good response in a subset of patients.