Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

Recent years have experienced an increase in construction and demolition waste (C&DW), which is the most significant solid waste stream. C&DW is contributing to exceeding all planetary boundaries and presents a range of other issues. In order to better understand the existing research on C&DW, a global bibliographic analysis was undertaken through seven groups of keyword searches and the results visualised using VOCviewer. The results show that C&DW receives only a modest research attention compared to other areas of waste, and this is despite an exponential increase in C&DW research since 2016. The analyses also show that concrete is the most researched material in terms of C&DW, and that reuse, recycling, and circular economy are so far attracting only proportionally modest research attention. This signals a need for further acceleration of the C&DW research, and specifically for more research on reuse, recycling, and circular economy for materials other than concrete.

This review explores the application of the conservative management model for pain to sports-related concussions (SRCs), framing concussions as a distinct form of pain syndrome with a pathophysiological foundation in central sensitization. Drawing parallels with proven pain management models, we underscore the significance of a proactive approach to concussion management. Recognizing concussions as a pain syndrome allows for the tailoring of interventions in alignment with conservative principles. This review first covers the epidemiology and controversies surrounding prolonged concussion recovery and persistent post-concussion symptoms (PPCS). Next, the pathophysiology of concussions is presented within the central sensitization framework, emphasizing the need for early intervention to mitigate the neuroplastic changes that lead to heightened pain sensitivity. Five components of the central sensitization process specific to concussion injuries are highlighted as targets for conservative interventions in the acute period: peripheral sensitization, cerebral metabolic dysfunction, neuroinflammation, glymphatic system dysfunction, and pain catastrophizing. These proactive interventions are emphasized as pivotal in accelerating concussion recovery and reducing the risk of prolonged symptoms and PPCS, in line with the philosophy of conservative management.

Conflicts are frequent within the complex professional environment of the construction industry. If claims cannot be overcome amicably, they result in disputes that lead to litigation. Identification of the causes of these claims and their impact on the duration, cost, and quality of the final project is expected to facilitate the prevention of unsuccessful performance of construction contracts. The novelty of this study is that after codifying the most common causes of construction contract claims derived from the extant literature, they are further investigated in terms of their probability of occurrence and the perceived impact they have on the project completion time, its total cost, and quality. Based on calculated relative importance indices from expert opinion, this paper proposes probability and severity of impact values for 39 common causes of claims in the construction industry. These can be applied to calculate their risk values for stakeholders in public construction contracts to plan mitigation measures of contractual claims. The findings show that the top five riskiest causes of contractual claims in the Greek construction industry are changes in quantities, work, or scope, design quality deficiencies or errors, payment delays, delays in work progress, and the financial failure of the contractor.

Earth is a complex material with a mechanical and physical behavior that differs from modern building materials. The conservation of rammed earth (RE) constructions presents specific difficulties that are challenging to overcome. The lack of knowledge about RE due to its abandonment for decades and attempts to adopt materials and repair methodologies designed for new building products has led to inadequate interventions. In the case of historic defensive constructions, the doubts and technical difficulties are even greater due to the nature of the so called military RE (with physical and mechanical characteristics significantly different from those of civil, more common, RE) and, not least, due to the historical and cultural heritage value of these constructions. Some important interventions have been carried out recently and others are underway or in the planning stage, and there is a constant lack of information and technical data on the best ways to intervene. To fill this gap, the state of conservation of the RE defensive structures and the results of interventions carried out throughout history in the southwest of the Iberian Peninsula are being assessed. This article sets out the framework of the subject, identifies the material and construction techniques, and recognizes the main causes of its deterioration and decay. With special focus on the most frequent damages detected in historic military defensive structures built with RE, it analyses and discuss the most common techniques that have been used for the repair and conservation of these particular structures.

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

In hepatocellular carcinoma (HCC), recurrence usually occurs after curative surgical resection. Currently, no approved adjuvant therapy has been shown to reduce recurrence rates. In this report, the in vivo mouse effect of sequential combination treatment with recombinant mouse interferon-alpha (rmIFN-α) and an anti-mouse-PD1 antibody on hepatitis B virus (HBV) clearance was evaluated. A phase I clinical trial was then conducted to assess the safety, tolerability, and inhibitory activity of sequential therapy with ropeginterferon alfa-2b and nivolumab in HCC recurrence in patients who have undergone curative surgery for HBV-related HCC. In animal modeling, HBV suppression was significantly greater with rmIFN-α and anti-PD1 sequential combination treatment than with their treatment alone. In the Phase I study, eleven patients completed the sequential therapy with ropeginterferon alfa-2b every two weeks at the dose of 450 µg for six doses, followed by three doses of nivolumab every two weeks up to 0.75 mg/kg. A notable decrease or clearance of HBV surface antigen was observed in two patients. Dose-limiting toxicity of grade 3 alanine transaminase and aspartate aminotransferase increases was observed in one patient. The maximum tolerated dose was determined. Currently no HCC recurrence has been observed. The treatment modality was well tolerated. The data support further clinical development of sequential combination therapy as a post-surgery prophylactic measure against the recurrence of HBV-related HCC.

This research delves into the integration of green roofs with Building Information Modeling (BIM), a pivotal advancement in sustainable urban construction. Aligning with the United Nations Sustainable Development Goals, particularly Goal 11, the study explores how this integration can address global challenges like climate change and resource depletion. Using the Dynamo Visual Programming Language within Autodesk Revit, the research develops a computational modeling approach for green roofs, focusing on their thermal and structural characteristics under varied environmental conditions. Key findings demonstrate the significant influence of substrate and drainage material combinations on green roofs’ thermal performance, highlighting the need for tailored designs based on climatic conditions. The study also emphasizes the importance of considering structural performance in both dry and saturated conditions for overall building integrity. The research identifies gaps in current practices, such as limited focus on specific green roof materials and reliance on certain software tools, suggesting the need for broader material selection and software adaptability. Future research directions include expanding material selections, exploring diverse environmental conditions, and integrating green roofs with various BIM software platforms. The study's implications extend to stakeholders in the construction industry, offering a framework for architects, urban planners, and policymakers to design and implement green roofs aligned with environmental goals. This work contributes to the field by proposing a novel approach to sustainable construction, integrating ecological design with digital technology, and setting a new benchmark in the integration of green roofs with BIM. By addressing these aspects, the research paves the way for future developments in sustainable urban construction, enhancing the efficiency, sustainability, and resilience of urban communities in line with global sustainability objectives.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The present state of the natural environment is significantly influenced by the construction sector. Due to the large amounts of consumed natural resources and materials as well as the high volume of emitted pollutants, the building industry is considered to have a key influence in achieving a global sustainable development. A considerable part of the ecological impact of the built environment is influenced by the energy consumed for creating appropriate indoor conditions as well as by the greenhouse gases that are emitted during the operation stage of a building’s life cycle. Therefore, the energy performances of existing buildings must be significantly improved in the near future. This paper analyzes the influence of the thermal insulation thickness of walls on the linear thermal transmittances and the heating demand of an existing building. The resulted values show that while increasing the insulation of the walls leads to a serious heat demand reduction, a deep renovation of the building cannot be achieved solely by using this solution.

Aging is a major risk factor for the higher incidence and prevalence of chronic conditions, such as cancer, cardiovascular and metabolic diseases, and neurodegenerative diseases. Closely linked with the onset of all these age-related diseases is immunosenescence, a condition defined as progressive reconfiguration of the immune functions leading to an increased susceptibility to infectious diseases, poorer response to vaccination, increased prevalence of cancer, rheumatoid arthritis, and other chronic diseases characterized by a pro-inflammatory state named inflammaging. Given that immunosenescence frames age-related diseases, it is natural to ask how these illnesses are related under the context of innate and adaptative components of the immune system. Knowledge processing by Formal Concept Analysis (FCA) of age-related diseases framed in an immunosenescence multivalued context shows that a hierarchy among these diseases emerges with a subconcept-superconcept nested structure, with two clusters, first made of metabolic diseases, cancer, and cardiovascular diseases. Second metabolic and neurodegenerative diseases and rheumatoid arthritis. Metabolic diseases seem to be a pivot illness and they must be a primary target given their global incidence and prevalence and their cost-effective treatments like regular physical activity, weight loss, healthy diet, stopping smoking, and reducing or managing stress. Another implication of the ontological analysis of age-related diseases is about the nature of immunosenescence, suggesting that initial symptoms of age-related diseases are mainly related to innate immune mechanisms, and developing of severe symptoms of age-related diseases like cancer, cardiovascular or neurodegenerative diseases depends on the activation of acquired immunity processes.

The unsafe behavior of frontline workers at construction sites is the most important cause of construction accidents. This study proposed a comprehensive model of frontline workers' unsafe behaviors based on a systems perspective and used structural equation modeling (SEM) to explore the influence mechanisms between Objective Conditions (e.g., work environment, work climate, task complexity), Safety Management (e.g., safety education and training, safety reward and punishment regulations, safety inspection, safety technology disclosure, safety warning signs), Group Influence (propagation of unsafe behaviors among workers), Personal Perception (subjective judgment of operators on their safety knowledge and skills), and Unsafe Behaviors. Data from 460 frontline workers were collected through questionnaires and the correlation hypotheses were tested using SPSS 26.0 and Amos 26.0 software. The following conclusions were obtained: (1) Objective Conditions directly positively influence Safety Management, Group Influence, and Personal Perception, but indirectly negatively influence Unsafe Behavior; (2) Safety Management not only directly positively affects Personal Perception but also directly negatively affects Unsafe Behavior. However, the direct effect of Safety Management on Group Influence is not significant; (3) Group Influence has a direct positive effect on Unsafe Behavior, but the direct effect on Personal Perception is not significant; (4) The direct effect of Personal Perception on Unsafe Behavior is insignificant. These findings can be used as preliminary data to guide decision-makers or managers in construction companies to develop reasonable management plans to curb unsafe behaviors of frontline workers.

This paper presents a new method to model the nonlinear behaviour of masonry double curvature structures, possibly reinforced by composite materials, by means of conventional elasto-plastic analyses. It is meant to be used in professional design, especially for assessment and retrofitting purposes, therefore based on the exploitation of the simplest nonlinear Finite Elements available in a commercial software, namely trusses with elasto-fragile and elasto-ductile behaviour (Cutoff Bars). The numerical static nonlinear analyses are carried out by considering elastic hexahedral elements for bricks and lumping nonlinearities on joints. These have been assumed in turn elastic-brittle and elastic-plastic by using 1D elements, respectively Point Contacts, under No-Tension Material hypothesis, and Cutoff Bars, assigning small tensile resistance to the material. The reinforcement, realised with FRP hooping strips, has been successfully modelled in a similar fashion, i.e. by applying perfectly bonded elastic-plastic Cutoff Bars at the extrados of the dome, where the debonding is accounted for in a conventional way limiting the tensile strength according to Italian Standards indications. The procedure is validated against benchmark models with the same geometry, using experimental data and more refined structural model results for comparison.

Prediabetes, a pivotal phase in glucose metabolism between normalcy and diabetes, exerts a profound influence on the aging process and the risk of age-related diseases. This comprehensive review delves into the intricate web of blood-based biomarkers that collectively expedite senescence, marking the transition from a state of health to age-related complications. Key findings underscore the significance of diverse biomarkers, such as telomere length, p16INK4a, senescence-associated secretory phenotype (SASP) factors, DNA methylation clocks, advanced glycation end products (AGEs), inflammatory and oxidative stress markers, circulating hormones, and additional factors like folate, B12, osteocalcin, and more. Not only do these biomarkers serve as indicators of senescence, but they actively fuel chronic inflammation, oxidative stress, and metabolic dysregulation, all of which contribute to accelerated aging. The implications of this understanding are profound, as prediabetes emerges as a critical period in an individual's life, influencing various physiological systems, including the vascular and neural systems, metabolic functions, hormonal regulation, and bone health. Recognizing the profound influence of prediabetes on senescence provides a foundation for personalized intervention strategies to mitigate age-related complications and promote healthy aging. Future research directions call for a more diverse array of biomarkers, in-depth exploration of their roles, and the development of tailored precision medicine strategies to ensure a holistic understanding and effective management of prediabetes-induced senescence and its implications for aging. This knowledge has far-reaching implications for public health and clinical practice, emphasizing the need for early detection and intervention in prediabetic individuals to enhance the quality of life in an aging population with diverse needs.

Construction safety is especially important because the construction industry is so important to a country's development. Significant research and practice have been conducted to mitigate potential risks during construction and improve worker efficiency. With the rapid advancement of cognitive neuroscience and the incorporation of medical technology in recent years, various wearable monitoring devices have been widely used in the construction field for real-time monitoring of workers' physical and mental status. Among these, the use of EEG (Electroencephalogram) in construction environment research allows researchers to gain insight into the physical and mental states of construction workers while performing construction tasks. This review introduces EEG technology and portable EEG devices, followed by an overview of their use in both monitoring workers' adverse reactions and identifying hazards on construction sites, providing an effective guide for EEG research in the construction field and on-site safety management.

We report the first correction by Prime editing of a mutation in the RYR1 gene, paving the way to gene therapies for RYR1-related myopathies. The RYR1 gene codes for a calcium channel named Ryanodine receptor 1, which is expressed in skeletal muscle fibers. The failure of this channel causes muscle weakness in patients, which degenerates into motor disabilities. Currently, there are no effective treatments for these diseases, which are mainly caused by point mutations. Prime editing allows the modification of precise nucleotides in the DNA. Our results showed a 59% correction rate of the T4709M mutation in the RYR1 gene in human myoblasts by RNA delivery of the Prime editing components. It is to be noted that the T4709M is recessive, and thus, persons having a heterozygous mutation are healthy. These results are the first demonstration that it is possible to correct mutations in the RYR1 gene.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Aging induces numerous physiological alterations, with immunosenescence emerging as a pivotal factor. This phenomenon has attracted both researchers and clinicians, prompting pro-found questions about its implications for health and disease. Among the contributing factors, one intriguing actor in this complex interplay is human cytomegalovirus (CMV), a member of the herpesvirus family. Latent CMV infection exerts a profound influence on the aging immune system, potentially contributing to age-related diseases. This review delves into the intricate relationship between immunosenescence and CMV, revealing how chronic viral infection im-pacts the aging immune landscape. We explore the mechanisms through which CMV can im-pact both the composition and functionality of immune cell populations and induce shifts in in-flammatory profiles with aging. Moreover, we examine potential role of CMV in such pathol-ogies as cardiovascular diseases, cancer, neurodegenerative disorders, COVID-19, and Long COVID. This review underlines the importance of understanding the complex interplay be-tween immunosenescence and CMV. It offers insights into the pathophysiology of aging and age-associated diseases, as well as COVID-19 outcomes among the elderly. By unraveling the connections between immunosenescence and CMV, we gain a deeper understanding of aging's remarkable journey and the profound role that viral infections play in transforming the human immune system.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

Background: As long-lived organisms, urban trees often encounter development and redevelopment activities in close proximity during their lifespans. These activities can damage tree roots, often through methods like root severing during trenching or excavation. Methods: In 2017, we simulated trenching damage on mature Quercus virginiana Mill. trees at three different distances from the base (3x, 6x, and 12x the stem diameter). After five years, we revisited these trees to assess root regrowth based on the cut root's cross-sectional area (CSA) and distance from the base. Results: We observed regrowth in all but 38 (6.7%) of the 557 cut roots revisited. The lack of regrowth in some roots was not associated with our original treatments, the CSA of the roots at the time of trenching, or distance between the cut root end and the trunk (minimum P-value = 0.841). On average, the observed CSA of the regrowth was 22.2% of the original root's CSA. Only our original trenching treatments significantly predicted the level of regrowth observed five years after pruning (P-value = 0.024). Discoloration due to root pruning was minimal. Conclusion: In summary, our findings indicate that root systems require many years to recover from trenching damage. Increasing the distance between trenching activities and trees may have a minor effect on root regrowth but primarily helps reduce initial stress on the tree.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

In this paper, based on the symmetrical reliability theory, a research method for the safety factor of overall overturning stability of continuous beam bridge under carbon fiber reinforced polymers (CFRP) during cantilever and horizontal rotation construction is proposed. Under the premise that the given target reliability index is known, the method solves the overall overturning stability safety factor of continuous beam bridge under carbon fiber reinforced polymers during cantilever and horizontal rotation construction by using the symmetrical reliability analysis theory and considering the randomness of structural parameters. This method is used to calculate the safety factor and the design reinforcement aera of CRFP of overturning stability and the design reinforcement aera of CRFP of a continuous beam bridge, and the parameters are analyzed. The calculation results show that the randomness of parameters will have a great impact on the overall safety factor and the CRFP aera of overturning stability of cantilever and horizontal rotation construction of continuous beam bridge, and ignoring the influence of randomness of parameters will lead to overestimation of the overall safety factor and underestimation of the CRFP aera of overturning stability of cantilever and horizontal rotation construction of continuous beam bridge.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Healthcare workers' stress, burnout, and job dissatisfaction were exacerbated by the Covid-19 pandemic, whose mid-term negative effects are still present. The aim of this study was to investigate in healthcare workers the effect of the dimensions of burnout (Psychophysical exhaustion, Relational deterioration, and Professional inefficacy) on Career satisfaction. These relationships were evaluated by considering the direct and mediated effects of Disillusion. For these purposes, the Link Burnout Questionnaire (LBQ) and the Career Satisfaction Scale (Occupational Stress Indicator - OSI) were administered to 295 healthcare professionals working at three Italian public hospitals in Cagliari, Italy. The analyses were conducted using the Partial Least Square Structural Equation Model (PLS-SEM) method. Findings highlight that healthcare workers were in a condition of work distress, high risk of burnout, and career dissatisfaction. Also recognized was the direct negative effect of burnout dimensions on career satisfaction. Finally, the mediated negative effect of Disillusion in the relationship between burnout and career satisfaction was identified. This study emphasizes the relevance of the dimension of Disillusion, and its “bright side” Fulfilment, in healthcare workers, specifically referring to the disregarded relationship between burnout and career satisfaction.

Background: Patients with infectious complications related to the presence of cardiac implantable electronic devices (CIED) constitute a heterogeneous group, including local pocket infection (PI) and lead related infectious endocarditis (LRIE). The diagnosis of CIED-related infection is often difficult and requires complex imaging and microbiological tests. The aim of the current study was to evaluate the usefulness of new simple hematological parameters in detecting infectious complications in patients with CIED and assessing their extent. Methods: The retrospective analysis of clinical data of 2909 patients (36.37% with CIED-related infections), undergoing transvenous lead extraction (TLE) procedures in three high-volume centres in the years 2006-2020, was conducted. The sensitivity and specificity of new hematological markers were evaluated: the neutrophil to lymphocyte ratio (NLR), neutrophil to platelet ratio (NPR), and lymphocyte to platelet ratio (LPR) in the diagnosis of infectious complications, assessment of the spread of the infectious process and differentiation of additional structures related to the presence of leads. Results: In patients with CIED infections, compared to the non-infectious group, high inflammatory parameters were confirmed, and the highest specificity of the new markers in detecting the infectious process was demonstrated. (79.47% for NPR and 72.82% for NLR). Analysis of laboratory parameters in infectious and non-infectious patients with the presence of additional lead-related masses showed the highest specificity of NPR (82,78%) in predicting the diagnosis of vegetation. Comparison of laboratory parameters in patients with LRIE and PI showed higher NLR % (4.24 vs 2.56; p<0.001, area under curve (AUC) in a receiver operating characteristic (ROC) curve: 0.67 and 0.78 respectively) and higher NPR (0.03 vs 0.02; p<0.001; AUC: 0,51 and 0,55) in patients with LRIE. The highest sensitivity in the detection of coexistence LRIE with PI has been demonstrated for NLR (87.33%). Conclusions: Novel hematological markers may be helpful in the recognition of the inflammatory process in patients with CIED, differentiation of vegetation and vegetation-like masses, and the extent of infection in patients with PI.

: Healthcare workers are affected by mental health issues, burnout and turnover, and this burden is even greater during epidemics and pandemics, such as COVID-19. The purpose of this research is to provide an overview of the measures introduced or supported in the institutions of Quebec’s health and social services network during the COVID-19 pandemic with the aim of protecting healthcare workers’ mental health. An online questionnaire survey was administered in 2021 among human resources department personnel in health and social services network institutions involved in workplace mental health in Quebec. A total of 223 key informants representing 31 of the 34 public health and social services institutions in the province of Quebec in Canada responded to the questionnaire. Measures that focus on the needs of staff, involve all levels of authority and the ones that provide flexibility, support and recognition at work were more successful, according to the advisors surveyed. Future research into whether the same measures are considered effective or ineffective outside of a pandemic context is needed.

Construction 4.0 is witnessing exponential growth in Digital Twin (DT) technology developments and applications, revolutionizing the adoption of Building Information Modelling (BIM) and other emerging technologies used throughout the lifecycle of the built environment. BIM provides technologies, procedures, and data schemas representing building components and systems. At the same time, DT enhances this with real-time data for cyber-physical integration, enabling live asset monitoring and better decision-making. Despite being in the early stages of development, DT applications have rapidly progressed in the AEC sector, resulting in a diverse literature landscape due to the various technologies and parameters involved in fully developing the DT technology. The intricate complexities inherent in digital twin advancements have confused professionals and researchers. This confusion arises from the nuanced distinctions between the two technologies, i.e., BIM and DT, causing a convergence that hinders realizing their potential. To address this confusion and lead to a swift development of DT technology, this study presents a holistic review of the existing research focusing on the critical components responsible for developing DT applications in the construction industry. The study identifies five crucial elements: technologies, maturity levels, data layers, enablers, and functionalities. Additionally, it identifies research gaps and proposes future avenues for streamlined DT developments and applications in the AEC sector. Future researchers and practitioners can target data integrity, integration and transmission, bi-directional interoperability, nontechnical factors, and data security to achieve mature digital twin applications for AEC practices. This study highlights the growing significance of DTs in construction and provides a foundation for further advancements in this field to harness its potential to transform built environment practices.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Akebia trifoliata is an economically important self-incompatible fruit tree in the family Lardiza-balaceae. Asexual propagation is the main strategy used to maintain excellent agronomic traits. However, the generation of adventitious roots during asexual propagation is very difficult. To study the important role of the WUSCHEL-related homeobox (WOX) transcription factor in fruit and adventitious root growth and development, we characterized this transcription factor family in the whole genome of A. trifoliata. A total of 10 AktWOXs were identified, with the fol-lowing characteristics: length (657~11328 bp), exon number (2~5), isoelectric point (5.65~9.03), amino acid number (176~361 AA), and molecular weight (20.500~40.173 kDa). 10 AktWOXs were classified into modern (6), intermediate (2), and ancient clades (2) and that all AktWOXs had undergone strong purifying selection during evolution. The expression profile of AktWOXs dur-ing A. trifoliata fruit development and adventitious root formation indicated that AktWOXs are widely involved in the development of the three fruit tissues, flesh, seeds and rind, and play an important role in the regulation of adventitious root development. Overall, this is the first study to identify and characterize the WOX family in A. trifoliata and will be helpful for further re-search on A. trifoliata fruit development and adventitious root formation.

During carbonation process, the presence of water is an important parameter to accelerate this phenomenon. The carbon dioxide (CO₂) has been used as curing process production of fiber cement boards keeping the dimensional stability of cellulose fibers in cementitious matrix and promoting the CO₂ capture of environment. In addition, magnesium oxysulfate (MOS) cement has been used as another alternative binder to reduce the amount of CO₂ in the nature. The aim of this scientific paper is analysis the effect of rehydration method on the physical-mechanical properties of CO2-cured magnesium-based fiber cement boards. These boards were produced by Hatschek process simulation. The physical-mechanical performance and microstructural characteristics of MOS boards before and after carbonation were investigated by: water absorption (WA), apparent porosity (AP), and bulk density (BD); four-point bending test; X-ray diffraction (XRD); thermogravimetric analysis (TGA) and scanning electron microscopy (SEM). According to the results, it was possible observe which the accelerated carbonation process resulted in improvements in the mechanical properties of the boards. The boards carbonated after 48 hours showed higher Modulus of Rupture values. The rehydration process of the composites before carbonation led to enhancements in the boards pre-cured for 48 and 72 hours, demonstrating that carbonation occurred more effectively after the supply of water through rehydration. The improvements in mechanical properties were associated with the formation of hydration products, which preferentially formed in the pores and voids of the fiber-cement. The presence of these carbonation products altered the physical properties of the materials, increasing the density of the boards and reducing the void volume. The decomposition of the formed carbonates was confirmed by thermogravimetric analysis, which indicated that the rehydration process favored the carbonation of the materials

Premenstrual syndrome (PMS) continues to impact the health outcomes and emotional well-being of reproductive-age women, globally. Several studies have provided conflicting evidence concerning the role of dietary approaches in improving PMS symptoms. Accordingly, this study aimed to evaluate the possible influence of a healthy diet and motivational strategies on PMS symptoms and health-related quality of life among Omani adolescents. This open-label, randomized, prospective controlled trial was conducted in two randomly selected secondary schools, in Al Seeb Willayah, in Muscat region. Adolescents with PMS symptoms, who were at grade 10 or 11, aged 16 years or above, had regular menstrual cycles and not known to have psychiatric disorder, were included in this study. Participants in the intervention group received an individual face-to-face dietary consultation and motivational phone consultation. The health outcomes, including the PMS symptoms in both groups, and quality of life, were recorded via a daily record of severity of problems questionnaire (DRSP) and the 14-item Self-Reporting-Based Perceived Stress Scale tools, respectively. The primary outcome was the differences in the mean premenstrual symptom scores between the two groups. Secondary outcomes included the quality of life and stress levels of participants. The study period was from 1 February and ended 30 June 2021. SPSS was used to analyze the data and intention-to-treat analysis was utilized.A total of 72 adolescents with PMS were randomized to the intervention and control groups (n=36 each). Both groups were similar at baseline (P-value&gt;0.05). No significant association was found between healthy-diet and PMS symptoms (P-value&gt;0.05). In addition, no significant association was found between healthy-diet and quality of life at follow-up (P-value=0.216). The outcomes of this study refuted any possible relationships between healthy diet and PMS symptoms. Accordingly, dietary consultations may not facilitate the clinical management of PMS symptoms in adolescent females.

Based on the teaching material of "Robotics" course, this paper studied the automatic knowledge graph construction, including knowledge points extraction and knowledge point relation extraction. We proposed a new method of extracting the first-level, second-level, and third-level knowledge points as well as their prerequisite relations of knowledge points in the textbook. For the problem of insufficient knowledge of the pre-trained language model in the specific field, methods such as incremental pre-training and optimization of cost functions are employed to integrate subject knowledge into the pre-trained language model, thus improving its effectiveness. To overcome the problem that the traditional method of relationship extraction can not be applied directly to the extraction of teaching materials, a new scheme for knowledge point relationship extraction based on keyword relationship is proposed. The experimental data from textbooks shows that the F1 score of knowledge point extraction reaches 93%, considerably improved compared to the traditional model. Consequently, the knowledge point entity extraction and relationship extraction methods based on the pre-trained model can effectively extract structured information and facilitate the automatic construction of knowledge graphs.

This study explores the perspectives and practices of architects regarding the reuse of wood in construction across five South-Central European countries: Slovenia, Serbia, North Macedonia, Bosnia and Herzegovina (BiH), and Montenegro. Based on a survey of architectural professionals, the research explores their attitudes, challenges, and motivations for using reclaimed wood, with a focus on circular construction principles. Key findings reveal unanimous agreement among re-spondents that both their profession and government entities inadequately support or promote wood reuse within the context of circular construction. While architects value reclaimed wood, there are country-specific variations. Environmental benefits, unique aesthetics, historical value, and sustainability are cited as primary motivators for reclaimed wood use. Additionally, re-spondents emphasize the ecological aspect as the most important consideration in wood product reuse, followed by economic and technological factors. Common concerns revolve around the long-term quality and maintenance of wood products. This research provides insights into the challenges and opportunities surrounding reclaimed wood use in South-Central Europe, high-lighting the need for support mechanisms and increased awareness to advance circular construc-tion practices in the region. These findings can have implications for architects and investors by identifying market opportunities, promoting eco-friendly practices, and providing valuable in-sights for future building designs with a focus on reclaimed wood elements within circular con-struction.

To solve the problem of complex sensor installation and easy damage in contact displacement measurement, a non-contact measurement method of brace displacement in bridge swivel construction based on binocular vision is proposed in this study. Combined with monitoring data in a swivel construction interchange project, binocular vision system was compared and analyzed with the traditional displacement meter and total station. Results showed that force versus displacement variation plots were obtained by binocular visual measurement in the weighing test, the inflection point can be clearly distinguished, and the position of the inflection point was the same as that of the displacement meter; monitoring data of binocular vision measurement and total station were compared and analyzed in the bridge swivel process, the average error was no more than 0.18 mm, the maximum error was no more than 0.42 mm, and the standard deviation was no more than 0.12. The method proposed in this study can be used as an alternative to displacement meter and total station measurement methods in bridge swivel construction, the problem of complex sensor installation and easy damage is solved in brace displacement measurement, equipment and labor costs can be effectively saved.

Background and Objectives: Chemokines have various biological functions and potential roles in the development or progression of neuroinflammatory diseases. However, the specific pathogenic roles of chemokines in age-related macular degeneration (AMD), the leading cause of blindness in older individuals, remain elusive. Chemokines interact with their receptors expressed in the endothelium and on leukocytes. The sulfation of tyrosine residues in chemokine receptors increases the strength of ligand–receptor interaction and modulates signaling. Therefore, in the present study, we aimed to construct a human recombinant sulfated CXCR3 peptide trap (hCXCR3-S2) and mouse recombinant sulfated CXCR3 peptide trap (mCXCR3-S2) to demonstrate in vivo effects in preventing choroidal neovascularization and chemotaxis. Materials and Methods: First, the effect of hCXCR3-S was validated in vitro. Interestingly, hCXCR3-S2 inhibited the migration and invasion of two human cancer cell lines. Subsequently, the in vivo efficacy of mCXCR3-S2 was investigated using a mouse model of neovascular AMD. Results: Intravitreal injection of mCXCR3-S2 attenuated choroidal neovascularization and macrophage recruitment in neovascular lesions. These in vitro and in vivo effects were significantly stronger with CXCR3-S2 than with wild-type CXCR3 peptides. Conclusion: These findings demonstrate that the sulfated form of the CXCR3 peptide trap is a valuable tool that could be supplemented with antivascular endothelial growth factors in AMD treatment.

Assessment of renal function is critical to diagnose and manage renal age-related decline, disease (KD), and failure, which are prevalent in the elderly population. Glomerular filtration rate (GFR) is widely used as an indicator of kidney function, but its direct measurement is challenging, as are its age and gender caveats. This makes difficult the differential diagnosis, between age-related physiological decline and KD and/or failure. Currently, the inflammation-based modified Glasgow prognostic score (mGPS) is emerging as promising biomarker of several inflammatory acute/chronic diseases. In this study, the large variability of eGFR with age and gender was evaluated, as the association of eGFR values with mGPS levels. A population of 57449 adult participants (age ≥18 years) was enrolled. Appropriate circulating biomarkers were measured to detect eGFR and mGPS values. The data obtained demonstrated a significant decrease of eGFR in men vs. women across the four selected age classes (18-40, 40-60, 60-80, 80-100 years), eGFR classes were significantly associated with mGPS (p<0.001), as age-classes and gender with mGPS categories. Accordingly, the percentage of people having a mGPS score= 2 significantly increased across the eGFR classes: with a 11% in the G1/eGFR class to achieve the 44% in G5/eGFR. Thus, the combination of mGPS with eGFR could represent the best benchmark risk model for differentiating age-related renal decline from a very KD, and for a better identification of different degrees of KD severity.

1960s Europe saw a large number of residential neighborhoods built to house those migrating from the countryside. Today, more than 50 years later, these neighborhoods suffer high levels of functional, social, and technical obsolescence. In response to this, University of Seville developed the Aura Strategy as an intervention methodology to find global solutions to issues in outdated neighborhoods. To provide visibility to this aspect of the Aura strategy, the retrofit proposal presented in this article provides a solution to improve the roofing of buildings in a case study neighborhood (Polígono de San Pablo, Seville) and an analysis of the results in terms of energy and financial savings for local residents. The results show that for a population of roughly 18,000 (in 2018), net savings, including energy and retrofitting costs, ranging from nearly 6.5 to over 8.6 million can be made over the 20-year life cycle span. Likewise, the results obtained on the reduction of thermal loads indicate a 72% decrease in energy consumption, equivalent to a saving of close to 4,500 tons of greenhouse gas emissions for the district and the entire life cycle time period, with the consequent benefits on the impact on air quality and and the fight against climate change. climate change.

Background: we aim to investigate attitudes toward vaccination, by analyzing empirical factors associated with vaccine acceptance in the Lazio region mpox vaccination (MpoxVax) campaign in Italy. Methods: all subjects who accessed to MpoxVax and signed the informed consent were prospectively enrolled in the MPOX-VAC Study and were asked to fill out an anonymous survey. Two endpoints were selected: ‘delayed acceptance’ and ‘early acceptance’, defined as access for vaccination &gt;60 and ≤30 days from the vaccination campaign starting (VCS), respectively. Results: over the study period 1717 individuals underwent vaccination: 129 (7%) &gt;60 [1588 (92.5%) ≤60] and 676 (60%) ≤30 days from VCS. A bisexual orientation, a lower education level and a worse perceived physical and mental health were associated with delayed access to vaccination. Being Pre-Exposure Prophylaxis (PrEP) users and, marginally, HIV positive, having a high perceived risk for mpox infection and reporting high-risk behaviors like the use of recreational drugs/chems, sex under the influence of drugs and/or alcohol and higher number of principal sexual partners, were associated with early access to vaccination. Conclusions: according to our data, risk awareness was a major determinant of early mpox vaccination acceptance. Conversely, worse perceived health status and a low educational level were critical factors associated with delayed vaccination.

In road construction, before applying an asphalt or concrete surface, the ground must be compacted and stabilized. There are two basic methods of soil stabilization: in situ and in a stationary node (ex-situ). The method of performing stabilization in place (in-situ) is the most frequently used method due to its convenience and lower price. The most popular type of binder for stabilization is a hydraulic binder (most often cement and various ashes). Such stabilization is performed at a depth of 10-50 cm, achieving the desired load-bearing parameters. In order to improve them, various chemical additives for stabilization are often used, such as ion exchange compounds, additives based on sulfuric acid, additives based on vinyl polymers or even organic additives using lignosulfonates. However, the use of such additives is associated with much greater costs and environmental burden, resulting in seeking for cheaper and equally effective alternatives. The win-win situation would be for instance recycling the problematic waste-based materials that on one hand are landfilled or impossible to recycle and on the other hand cause problems for the waste producers. Therefore, an interesting issue is the production of stabilization additives from various types of waste materials. As a result of the extensive testing of various waste-based materials blends with soil, the mechanical (compressive strength after 7 and 28 days) and hydraulic (capillary rise, water absorption, frost resistance) soil properties were measured. The optimization process led to obtaining additives compositions ensuring the best strengthening and sealing properties. These were for sandy soil: Pure foil (wax emulsion), Pure foil (wax emulsion) + waste sulphuric acid, RDF from waste tires (wax emulsion), Pure foil (wax emulsion) + “by-pass” waste ash + NaOHx2 and for clayey soil: Pure foil (wax emulsion) + NaOH, Pure foil (wax emulsion) + waste sulphuric acid, Tequant, Pure foil (wax emulsion).

Biological, environmental, behavioral, and social factors can influence sleep and lead to sleep disorders or diseases. Sleep disorders are common, numerous and heterogeneous in terms of their etiology, pathogenesis, and symptomatology. Management of sleep-wake circadian disorders (SWCD) includes education to sleep hygiene, behavioral strategies, psychotherapy (cognitive behavioral therapy (CBT), particularly), instrument-based treatments (i.e. positive airway pressure therapy, hypoglossal nerve stimulation), and pharmacotherapy. Depending on the disease, therapy varies and is executed sequentially, or can be a combination of several forms of therapy. Drugs used for SWCD include traditional sleep or wake-promoting agents, chronotherapeutic agents. Recently, novel medications, which are more precisely acting on specific neurochemical systems (i.e. orexin system) important for sleep and wake, are also increasingly being used. In this review, the pharmacotherapy of common sleep disorders (insomnia, sleep-related breathing disorder, central disorders of hypersomnolence, circadian rhythm sleep wake disorders, parasomnias, and sleep-related movement disorders) embedded in the overall therapeutic concept of each disorder is presented. There is also an outlook on possible future pharmacotherapies.

The construction industry, characterized by its intricate network of stakeholders and diverse workforce, grapples with the challenge of managing information effectively. This study delves into this issue, recognizing the universal importance of safeguarding data, particularly amid rising concerns of unauthorized access and breaches. Aiming to harness the potential of blockchain technology to address these challenges, this study used a hypothetical biographical and safety data of construction workers and securely stored on a Hyperledger Fabric blockchain. Developed within the Amazon Web Services (AWS) cloud platform, this blockchain infrastructure emerged as a robust solution for enhancing data security and privacy. Anchored in the core principles of data security, the model emerges as a potent defender against the vulnerabilities of traditional data management systems. Beyond its immediate implications, this study exemplifies the marriage of blockchain technology and the construction sector, potentially reshaping workforce management, especially in high-risk projects, optimizing risk assessment, resource allocation, and safety measures to mitigate work-related injuries. Practical validation through transaction testing using Hyperledger Explorer validates the model's feasibility and operational effectiveness, serving as a blueprint for the industry's data management. Ultimately, this research not only showcases the promise of blockchain technology in addressing construction data security challenges but also underscores its practical applicability through comprehensive testing, heralding a new era of data management that harmonizes security and efficiency for stakeholders' benefit.

Cycle times at workstations in offsite construction factories fluctuate widely due to various influencing factors. Consequently, relying on average rates, such as length per unit of time, for estimating cycle times proves to be inaccurate, often leading to significant deviations between production schedules and actual operations. To address this issue, this study proposes an estimation system that leverages machine-learning-based prediction, statistical methods, 3D simulation, and computer vision to predict cycle times at the workstation level. Testing of the system on a semi-automated wood-wall framing workstation in a panelized construction factory shows that it reduces the mean absolute error and sum of errors by approximately 36% and 68%, respectively, compared to the fixed rate method. The results also highlight the efficacy of using computer vision data for training machine-learning models for cycle time estimation, the importance of identifying and understanding the factors influencing cycle times, and the impact of random delays on the accuracy of cycle time estimation systems.

Migraine is a neurovascular disorder that can be debilitating for individuals and society. Current research focuses on finding effective analgesics and management strategies for migraines by targeting specific receptors and neuropeptides. Nevertheless, the responder rates of recently approved calcitonin gene-related peptide (CGRP) monoclonal antibodies (mAbs) and receptor inhibitors remain around 50 percent. To address the need for novel therapeutic targets, researchers are exploring the potential of another secretin family peptide, pituitary adenylate cyclase-activating polypeptide (PACAP), as a ground-breaking treatment avenue for migraine. Preclinical models have revealed how PACAP affects the trigeminal system, which is implicated in headache disorders. Clinical studies have demonstrated the significance of PACAP in migraine pathophysiology; however, a few clinical trials remain inconclusive: the pituitary adenylate cyclase-activating peptide 1 receptor mAb, AMG 301 showed no benefit for migraine prevention, while the PACAP ligand mAb, Lu AG09222 significantly reduced the number of monthly migraine days over placebo in a phase 2 clinical trial. Meanwhile, another secretin family peptide vasoactive intestinal peptide (VIP) is gaining interest as a potential new target. In light of recent advances in PACAP research, we emphasize the potential of PACAP as a promising target for migraine treatment, highlighting the significance of exploring PACAP as a member of the antimigraine armamentarium, especially for patients who do not respond to or contraindicated to anti-CGRP therapies. By updating our knowledge on PACAP and its unique contribution to migraine pathophysiology, we can pave the way for reinforcing PACAP and other secretin peptides, including VIP, as a novel treatment option for migraines.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Development and redevelopment are important drivers of tree removal and canopy loss in urban landscapes. Local ordinances are often used to curtail tree removal, but punitive regulations alone may not be enough to reduce urban tree canopy loss in land development. In Florida (US), efforts to balance trees and development have so far focused on fees and fines, but with a recent backlash against tree regulations and the fast pace of urban growth, we explored the possible role of incentives in urban tree policies. We interviewed 20 land developers across Florida to understand their perspectives on current barriers and potential incentives for tree preservation and planting. We collected data from developers, whose perspectives on tree preservation are often unknown or overlooked, despite their significant role in tree planting, removal, and retention in and around cities. Our results show that major barriers to tree preservation and planting include requirements to grade sites for stormwater management, site constraints, and monetary costs. Most developers did not know of any existing incentives beyond intrinsic motivations but said that financial incentives would be most appealing to them. Top incentive suggestions include increasing building density, reducing impact fees and tax liability, and changing tree mitigation policies. Another promising finding is that developers are willing to work with regulators to find solutions that benefit both parties. Future research should consider evaluating the level of support and viability of different incentives by gathering feedback from policymakers, land developers, and the public.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Triangles are an ever present feature in nature, which the building construction industry duly echoes. However, an exact expression intended to offer the radiant field due to any triangle in an upright or inclined position had not been identified by previous research. In this case, the author has been able to solve by direct integration, the canonical expression of radiative transfer. This result alone confers a myriad of possibilities that had been inconceivable before, for studying in detail the three-dimensional heat transfer behavior of volumes and figures in which triangles do manifest, such as fins, windows, roof-gables and louvers of various kinds. Typically, shading devices, when tilted, give rise in their extremes to rhomboidal shapes which were difficult to take into account or had to be subject to discretization and subsequent Monte Carlo methods in order to perform an approximate calculation of their emission. This implied a lengthy and inexact procedure that induced many errors and consumed computing time. We can now avoid all the former downsides due to the advances hereby presented. As the novel expression can be converted into an algorithm it will be advantageously employed for simulation. This significant finding dovetails in the intricate puzzle of radiated heat and we believe that their consequences will greatly affect the conception and design of HVAC devices, aircraft manufacturing and specifically building or lighting industries among others.

The construction enterprise is a essential zone that contributes considerably to the worldwide financial system. but it faces numerous challenges, together with inefficiency in electric and electronics engineering tasks. This inefficiency results in delays, expanded charges, and decreased productivity. Device learning strategies have the capacity to deal with those challenges through optimizing the making plans and execution of electrical and electronics engineering tasks within the construction industry. This study paper targets to discover using machines gaining knowledge of strategies to maximise efficiency in electrical and electronics engineering projects inside the production industry. Mainly, the paper will be conscious of developing and imposing gadget mastering algorithms to optimize project scheduling, fabric procurement, and system utilization. The paper will even look at the ability of using predictive analytics to identify and mitigate dangers related to electric and electronics engineering tasks. The study could be based on a combination of literature review and empirical analysis. The literature evaluation will provide a top-level view of the demanding situations going through the development industry and the capability advantages of the usage of system getting to know strategies to deal with those challenges. The empirical evaluation will involve the improvement and testing of device mastering models on real-world information from electrical and electronics engineering initiatives inside the construction industry. The predicted results of this research are the development of a fixed of sensible recommendations for the use of machine gaining knowledge of strategies to optimize electric and electronics engineering projects within the construction industry. These suggestions will be beneficial for venture managers, engineers, and other stakeholders within the creation enterprise who're inquisitive about maximizing performance and decreasing charges of their tasks. Ordinary, this studies paper aims to contribute to the continued efforts to enhance the efficiency and productiveness of the development enterprise via exploring the ability of system studying techniques to optimize electrical and electronics engineering tasks.

This research describes a detailed analysis in the enactment of a Lean Tool, the Last Planner System during pandemic period which helps in optimizing the resources for better coordination among all stakeholders in pandemic period. LPS as it is known, focusses on minimizing the factors such as uncertainties, barriers and variability to make construction projects more flexible for better project management. These include variations and deviations, supervision, delays in approvals, change resistance, subcontractor dedication which are all related to various stakeholders in the project. Following that, a Design Science Research technique is used to evaluate the effect of applying LPS in buildings. An action strategy is being used to attain this goal, and four case studies were being documented which were concerned in the implementation of LPS in the building of the Boy's Hostel, Research Scholar Quarters, Faculty Housing, and Girls' Hostel at Chennai, Tamilnadu, India. Data was gathered by observation of site activities, interviews, documentation analysis, and a questionnaire survey and grouped into various factors. While adopting the LPS tool in the research the factors affecting the implementation were found in the covid-19 pandemic period. Further these factors were anlayzed, measured, ranked and validated for adopting in projects.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p &lt; 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p &lt; 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

Subway construction is often in a complex natural and human-machine operating environment, and that complicated setting leads to subway construction more prone to safety accidents, which can cause substantial casualties and monetary losses. Thus, it is necessary to investigate the safety risks of subway construction. The existing literature on the identification and assessment of subway construction safety risks(SCSR) is susceptible to the influence of subjective factors. Moreover, although existing studies have explored the interrelationships between different risks, these studies usually analyze the interrelationships of single risks, lack the study of risk chain transfer relationships, and fail to find out the key path of risk transfer. Therefore, this paper innovatively combines text mining, association rules and complex networks to deep mine subway construction safety incident reports and explore risk transfer process. Firstly, it uses text mining technology to identify subway construction safety risk; Then, association rules are introduced to explore the causal relationships among safety risk; Finally, the key safety risk and important transfer paths of subway construction safety accidents (SCSA) are obtained based on the complex network model. Research results show that (a) improper safety management, unimplemented safety subject responsibilities, violation of operation rules, non-perfect safety responsibilities system and insufficient safety education and training are the key safety risk in SCSA; (b) two shorter key risk transfer paths in the subway construction safety network can be obtained: insufficient safety education and training→lower safety awareness→violation of operation rules→safety accidents; insufficient safety checks or hidden trouble investigations→violation of operation rules→safety accidents; (c) in the process of risk transfer, the risk can be controlled by controlling the key nodes or cutting off the transfer path. The results of the study provide new ideas and methods for SCSR identification and influence element mining, which help safety managers propose accurate subway construction safety risk control measures.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

Failure to meet the deadlines for the implementation of investment and construction projects is a problem in all countries of the world, and leads to unstable activity of construction companies. The article studies the most important destabilizing factors affecting the main indicator of sustainable activity of construction companies-the duration of the implementation of an investment and construction projects. To determine and assess the impact of destabilizing factors on the duration of implementation of selected investment and construction projects, a survey was conducted, in which a number of customers, consultants and contractors involved in construction projects took part. Questionnaires developed on the basis of a cluster sample were sent to respondents, 48 responses were received in response to the assessment of destabilizing factors. To analyze the received and grouped information, structural equation modeling using the Smart-PLS program was used. As a result of modeling, a number of results were obtained, the most important of which are the identification of the main reasons that lead to an average (20% - 50%) increase in the duration of projects in the construction sector. The most significant were: the lack of an appropriate procurement program for materials; inefficient scheduling by contractors and instability of construction production; poor-quality processing of incoming information and untimely deci-sion-making due to changes in projects during their implementation. Destabilizing factors con-tribute to an increase in the duration of construction sector projects, which leads to time overruns, cost overruns, and an increase in the negative impact on the overall use of resources. As a result of the study, a set of recommendations was formed, the most important of which is the use of possible compensatory measures that can allow construction companies to eliminate the risks of disrupting construction deadlines for sustainable activities. These compensatory measures include: - recommendations to customers of the construction project; - recommendations to contractors; - recommendations to the consultant. Moreover, the control of destabilizing factors that can cause delays, the improvement of contracts and the precise and clearer definition of all elements of the project can help to reduce the duration of construction, and will allow companies to maintain sustainable activities in the construction industry.

In view of the complexity of the pile foundation underpinning structure system and the stringent requirements of the construction process, this paper briefly describes the necessity of introducing epoxy resin reinforcing adhesive of planting rebar in the design of pile foundation underpinning beam structure to im-prove the mechanical properties of the underpinning beam new and old concrete joint surfaces and proposes a new type of pile foundation underpinning beam system construction method by “chiseling + prestressed reinforcement + epoxy resin reinforcing adhesive”. This paper uses an actual pile foundation underpinning project of an urban overpass as a prototype, designs and creates a model structure with a similarity ratio of 1/6, and performs repeated pro-gressive static loading tests to study the load carrying capacity, displacement change, and other properties of the underpinning structure, as well as analyses and distorts the overall working performance and failure mode of them. On this basis, the prototype structure's finite element analysis model was built, and the finite element analysis results were compared with the test results to get the mechanical properties and deformation characters of the actual pile foundation under-pinning structure system corresponding to the actual underpinning beam load. This paper's study can lay the theoretical and experimental foundation for the smooth development of similar projects.

Building carbon footprint analysis is a key instrument for assessing the impact of different constructions on climate change. Several standards and methodologies are available to calculate the footprint of buildings, including standards and norms, life cycle assessment (LCA), and dedicated software tools. The use of BIM software for these calculations is both scientifically justified and very practical. This scientific publication focusses on the application of a BIM-based research methodology for the analysis of the carbon footprint of a single-family house. The research process included the following steps: (i) design of a single-family house with timber frame construction using Archicad BIM software, (ii) simulation of the building energy performance using the EcoDesigner Star plug-in, (iii) life cycle assessment (LCA) using the plug-in for Archicad, (iv) preparation of a second model with traditional masonry construction for comparison, and (v) comparative analysis of the single-family house models with timber frame and masonry construction. Analysis of the results highlights significant differences in CO2e emissions between masonry and timber buildings and the varying impact of individual elements on the total CO2e emissions of the buildings studied. These findings are relevant for future work on sustainable building design and construction, which aims to minimise negative environmental impacts. The goal of minimising the cumulative carbon footprint of buildings is critical to achieving the Sustainable Development Goals and combating climate change.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

With the continuous development of digital transformation and upgrading of Chinese construction enterprises, it is becoming increasingly important to measure their digital level, find the problems in the enterprise transformation process, and identify the key factors of enterprise digital capacity enhancement. This paper constructs a construction enterprise digital transformation maturity evaluation model from six first-level indicators and 20 second-level indicators, including digital strategy, digital business application, digital technology capability, data capability, digital organization capability, and change management. Digital maturity is divided into five levels: business management, process operation, intelligent construction, intelligent scene application, and industrial ecological collaboration. A detailed process of digital maturity evaluation based on the method of Analytic Hierarchy Process (AHP)-Decision Testing and Evaluation Laboratory (DEMATEL) is then developed. A questionnaire survey of 25 experts is used to weight the various parameters in the model, which is then demonstrated with an example construction enterprise. The model comprehensively reflects digital levels under the background of the digital economy. Its application will help understand the advantages and disadvantages enterprises face in their digital transformation to enable targeted measures to improve their digital transformation capabilities and efficiency, enhance their core competitiveness of enterprises, and promote the development of digital transformation in the construction industry.

With the development of bioinspired green solutions for sustainable construction over the past two decades, bio-cementation, which exploits the naturally occurring phenomenon of calcium carbonate precipitation in different environments, has drawn a lot of attention in both building construction and soil stabilization. Various types of microorganisms, along with specific enzymes derived from these microorganisms, have been utilized to harness the benefits of bio-cementation. Different application methods for incorporating this mechanism into the production process of the construction material, as well as a variety of experimental techniques for characterizing the outcomes of bio-cementation, have been developed and tested. Despite the success of bio-cementation as a sustainable method to construction has been demonstrated in a significant body of literature at the laboratory scale, the expansion of this strategy to construction sites and field application remains a pending subject. The issue may be attributed to two primary challenges. Firstly, the complexity of the bio-cementation phenomenon is influenced by a variety of factors. Secondly, the extensive body of literature examines various types of microorganisms under different conditions, leading to a wide range of outcomes. Hence, this study aims to examine the recent advancements in utilizing the most commonly employed microorganism, Sporosarcina Pasteurii, to emphasize the significance of influential factors identified in the literature, discuss the findings that have been brought to light, and outline future research directions toward scaling up the process.

In this paper, we study semiconic idempotent commutative residuated lattices. After giving some properties of such residuated lattices, we obtain a structure theorem for semiconic idempotent com- mutative residuated lattices. As an application, we make use of the structure theorem to prove that the variety of strongly semiconic idempotent commutative residuated lattices has the amalgamation property.

According to a recent estimate by UN Habitat, approximately 3 billion individuals will require suitable housing by the year 2030. This staggering demand translates to the need for around 96,000 affordable housing units to be constructed each day. However, the conventional construction methods that rely on cement-based concrete and masonry are outdated, lacking innovation, efficiency, and sustainability. In light of these challenges, cold-formed steel emerges as an appealing alternative to traditional construction materials like masonry and concrete. It offers numerous advantages, including easy fabrication, lightweight properties, energy efficiency, the ability to reuse the material at the end of its service life, and a higher level of recyclability. Cold-formed steel buildings are also recognized for their superior insulation and lower energy consumption during operation. Cold-formed steel (CFS) members are created by rolling structurally sound steel sheets into the required shapes using a forming machine, without the need for heat as in the case of hot-rolled steel. While the thickness of these members can range from 0.01 mm to 7 mm, commercial construction of load-bearing walls, roof trusses, and floor joists typically utilizes steel thicknesses of 0.7 mm to 1.2 mm. This paper tries to illustrate the materials and methods employed in the construction of cold-formed steel modular buildings in Sri Lanka[1]. It delves into the material and durability characteristics of cold-formed steel, the design philosophy behind these structures, the development of the building envelope, and the energy efficiency features of the building elements. The findings of this study demonstrate that cold-formed steel buildings can be a highly sought-after alternative for residential construction, offering faster construction timelines, cost-effectiveness, and energy-efficient practices.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

The city administration of China planned numerous metro projects and more metros can hardly avoid undercrossing a bridge. While metro shield construction when undercrossing a bridge (MSCUB) is frequently located in complicated natural and social context, which made the construction process more susceptible to safety accidents. Therefore, it is crucial to look into safety risk of MSCUB. The paper identified the safety risk factors during SSCUR by using literature review and experts’ evaluation, proposed a novel safety risk assessment model by integrating CFA and FER, and then selected a project case to test the validity of the suggested model. Research results show that (a) a safety risk factors list of MSCUB was identified, including 4 first-level safety risks and 37 second-level safety risk factors; (b) the proposed safety risk assessment model can be used to measure the risk values of the overall worksite safety risk, the first-level safety risks and the safety risk factors of MSCUB; (c) environment-type safety risk and personnel-type safety risk have higher risk values when shield construction undercrossing a bridge; (d) when compared to worker-type safety risk, manager-type safety risk is the higher risk value. The research can enrich the theoretic knowledge of MSCUB safety risk assessment and provide references to safety managers for conducting scientific and effective safety management on the construction site when subway undercrossing a river.

Background: There is a lack of literature specifically examining the workplace bullying of apprentices and trainees in traditional, male-dominated sectors such as the Australian building and construction industry. Using social identity theory (SIT), the aim of this study was to gather the attitudes, thoughts, and feelings of construction industry leaders to better understand how social identification (i.e., group membership) impacts bullying on targets and perpetrators, and the willingness to report bullying for targets and bystanders. Method: One-on-one, semi-structured interviews using a purposive sample of eight leaders from construction and blue-collar industries. Qualitative data were analysed using reflexive thematic analysis. Results: Four overarching themes were identified: difficulties for apprentices transitioning into industry, the need for continued improvement to industry culture, reluctance to report bullying, and rethinking apprenticeships to empower. Each theme provides insight into the psychosocial phenomenon of the bullying of trade apprentices and suggests that an apprentices’ level of social identification with work groups shapes how bullying is identified, interpreted, and prevented. Conclusion: Findings from this study will be important for tailoring evidence-based interventions, human resource policies and initiatives for education and awareness training. Themes also highlight systemic inadequacies impacting apprentices’ mental health and skill development, with implications for the future sustainability of apprenticeship training agreements.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

Background and Objectives: The current study aimed to determine the impact of fasciotomy on mortality and morbidity in children and adults with crush-related AKI following the 2023 Kahramanmaraş earthquakes. Materials and Methods: The study included individuals who had suffered crush injuries after the 2023 Kahramanmaraş earthquakes and were identified as having acute kidney injury (AKI). Patients with AKI were divided into two groups based on age: those under 18 years and those over 18 years. A comparative analysis was conducted between the mortality and morbidity rates of patients who underwent fasciotomy and those who did not. Disseminated intravascular coagulopathy (DIC), sepsis, and adult respiratory distress syndrome (ARDS) have all been identified as contributors to morbidity. Results: The study was conducted with a total of 40 patients (21 males and 19 females) aged between four and 83 years. A total of 21 patients underwent fasciotomy and the patients underwent varying numbers of fasciotomy, ranging from zero to 11. The mortality rate was 12.5%, corresponding to five adult patients. No instances of mortality were reported in the paediatric cohort. The application of fasciotomy in instances of crush-induced AKI did not result in elevated levels of mortality in either the paediatric or adult demographic. Within the adult population, a substantial difference in the duration of dialysis was observed between individuals who underwent fasciotomy and those who did not. A statistically significant increase in the number of fasciotomy incisions was observed in patients diagnosed with sepsis compared with those without sepsis. The study found a significant positive correlation between the number of fasciotomy incisions and dialysis days. Conclusions: Neither adult nor paediatric patients with crush-induced AKI showed an increased risk of death after fasciotomy. The number of fasciotomy incisions significantly correlated with the development of sepsis. Despite experiencing delays in hospital admission for paediatric patients, the incidence of both crush syndrome and mortality rates among children remained relatively low.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Additive manufacturing enables the realization of complex component designs that can not be achieved with conventional processes, such as the integration of lattice structures for weight reduction. To include lattice structures in component designs, an automated algorithm compatible to conventional CAD is required that is able to handle various lattice topologies as well as variable local shape parameters such as strut radii. Furthermore, smooth node transitions are desired since previous studies indicate advantages regarding reduced stress concentrations and the structural response to loadings such as fatigue performance. The surface patch-based algorithm developed in this work is able to solidify given lattice frames to smooth lattice structures without manual construction steps. The algorithm requires only a few seconds of sketching time for each node and favours paralellization. Automated special case workarounds as well as fallback mechanisms are considered for non-standard inputs. It is demonstrated on irregular lattice topologies and applied for the construction of a lattice infill of an aircraft component that was additively manufactured.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

Big data technologies are disruptive technologies that affect every business, including those in the construction industry. The Thai government has also been affected, and attempted to use machine learning techniques with the analytics of big data technologies to predict which construction projects have a winning price over the project budget. However, this technology was never developed, and the government did not implement it because they had data obtained via a traditional data collection process. In this study, traditional data were processed to predict behavior in Thai government construction projects using a machine learning model. The data were collected from the government procurement system in 2019. There were seven input data, including project owner department, type of construction project, bidding method, project duration, project level, winning price over estimated price, and winning price over budget. A range of classification techniques, including an artificial neural network (ANN), a decision tree (DC), and K-nearest neighbor (KNN), were used in this study (ANN). According to the results, after hyperparameter tuning, ANN had the greatest prediction accuracy with 78.9 percent. This study confirms that data from the Thai government procurement system can be investigated using machine learning techniques from big data technologies.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Bamboo is the building material of the past and future. It offers numerous properties that make it versatile for various applications, including construction. Its impressive strength-to-weight ratio enables it to bear substantial loads and stresses, while its good elasticity allows efficient energy absorption. However, its mechanical properties can vary based on factors such as species, age, locations, methods, and treatment. Treating bamboo is essential to enhance its properties and durability. The literature provides various natural and chemical treatments which enhanced some of the properties but also reported a drawbacks on higher temperature, content and duration. This paper reviewed 57 articles from Scopus database, specifically focusing on article-document type publications from the years 2003 to 2023. Additional references were also incorporated to address concerns in properties, treatment and standards to provide systematic understanding. MATLAB was utilized for data text analytics. With extensive assessment on the articles, the following gaps and concerns were observed and recommends for further study and assessment such as for bamboo properties, the development of centralized guidelines and procedures for the preparation and processing; exploration of alternative materials to reinforce bamboo without compromising its ductility; development of joint connections, and testing of mechanical properties considering seismic, wind and vibration. For treatment methods, the standardization of procedures using natural, chemical or combination. Lastly, for bamboo codes and standards, assessment of existing codes and standards for testing the mechanical properties of bamboo highlighting the potential limitations and areas, uniformity, differences with all existing similar standards. By filling these gaps, it can support the reliability and robustness of bamboo as a sustainable material, fostering its promotion and adoption in construction industry.

Sustainability is a characteristic manifested in the ability to maintain the necessary level of performance for construction companies when risk factors arise during the implementation of investment and construction projects. The risk factors that arise during the implementation of in-vestment and construction projects differ in nature, degree of influence, and other characteristics. Ignoring these factors and measures to manage them often leads to critical consequences in the form of disruptions in the timing of work. Risk is a combination of the probability and consequences of the occurrence of adverse events. The article considers the concept of risk as a potential possibility of occurrence of adverse situations and related consequences when exposed to these factors. Risk factors are characterized by surprise, discreteness of changes, the presence of threshold values, upon reaching which a transition to a different mode of operation is required. The article discusses the risk factors arising at the construction stage, their classification. A methodology has been developed that includes conducting a survey in the form of a questionnaire in order to collect information about risk factors that affect the implementation of investment and construction projects. Experts with experience in the construction sector were involved in the survey. The processing of the survey results made it possible to assess the significance of various risk factors in investment and construction projects. Thus, statistical and expert methods were used in the study. The results showed that financial, technical, legal, economic, managerial and natural factors have the greatest impact on investment and construction projects. It is recommended to pay special attention to the listed factors when developing measures aimed at preventing risks and their consequences. The methodology described in the study can be used by construction companies in strategic planning. The analysis of the stability of construction companies, depending on their use of various ways to counteract risk factors, allowed us to develop a number of practical recommendations to reduce the impact of the studied factors on achieving the goals of investment and construction projects.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Abstract: Interface risks are inherent in every construction project from start to finish. Identifying and managing these risks effectively in every project phase is crucial for actualising project objectives. This paper shows a comprehensive framework showing several relationships between project stakeholders and how the interface risks between them that influence project execution are identified and managed for the overall construction project success. Firstly, literature review on interfaces and interface risks were car-ried out and how organisations managed interface risks were discussed and secondly, the collection of quantitative data was conducted by means of structured online questionnaires. The sample consisted of 205 construction project professionals who were selected randomly. This group included individuals with various roles in the construction industry, The data was analysed using descriptive statistical methods, including factor analysis, reliability assessment, and calculations of frequencies and percentages. Finally, the results showed all the factors, work culture and organisational approaches that influence interface risk management and ways to identify and manage interface risks effectively.

For enhancing the efficiency of cantilever casting the construction in the bridge, a novel rhombus traveling track of hanging basket was developed and optimized. The civil software titled Midas was applied to analyse the mechanical properties of the hanging basket with full load and control load. The strength and distortion of the walking mechanism were within the specified range when the maximum beam unit internal force of 149.69Mpa, which was less than the allowable stress of steel 175Mpa, and the anti-overturning safety factor of the hanging basket was 2.5 to meet the requirements. Through the comparative analysis of the key components and the finite element calculation, it was found that there was about 30% redundancy in the structure performance. Therefore, further optimization of each structure was carried out, and the front elevation of the main truss of 20° was achieved. It obtained the best performance in all aspects.

Regulation (EU) No 305/2011 lays down harmonized conditions for marketing construction products in the European Union. One of its consequences has been the introduction of the product standard EN 50575 and standard EN 130501-6, concerning power, control, and communication cables permanently installed in buildings to prevent the risk of a fire and its consequences. EN 13501-6 provides the reaction to fire classifications for cables, the test methods to be performed, the requirements to meet a specific reaction to fire, and additional classifications for smoke production, flaming droplets, and acidity. EN 60754-2 is the technical standard used to assess acidity, and it defines three classes: a1, a2, and a3 (the less performant), based on pH and conductivity measurements. Due to the release of hydrogen chloride during the combustion, acidity is the weak point of PVC cables, which are not yet capable of achieving the a1 or a2 classes required in specific locations according to a fire risk assessment. EN 13501-6 does not include EN 60754-1. Both EN 60754-1 and EN 60754-2 are common standards for determining halogen gas content, acidity, and conductivity, respectively. They involve the same type of tube furnace but with different heating regimes, final temperatures, and detection methods. EN 60754-2 must be performed at temperatures between 935 – 965 °C. The paper demonstrates that, when EN 60754-2 is carried out with the thermal profile of EN 60754-1 or at 500 °C in isothermal conditions, the evolution of hydrogen chloride changes significantly if potent acid scavengers are utilized in the PVC compounds. The reason lies behind the kinetic of hydrogen chloride release during the combustion of PVC compounds: the higher the temperature or faster the heat release, the quicker hydrogen chloride evolution and the lower the probability for the acid scavenger to trap it. That further highlights the "fragility" of EN 60754-2 as a tool for assessing the risks associated with the release of hydrogen chloride in case of fire

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

We previously showed that mice with knockout in the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) gene encoding the PGC-1a protein and nuclear factor erythroid 2 like 2 (NFE2L2) gene, showed some features of the age-related macular degeneration (AMD) phenotype. To further explore the mechanism behind the involvement of PGC-1a in AMD pathogenesis we used young (3-month) and old (12-month) mice with knockout in the PPARGC1A gene and age-matched wild-type (WT) animals. An immunohistochemical analysis showed age-dependent different expression of markers of oxidative stress defense, senescence and autophagy in the retinal pigment epithelium of KO animals as compared with their WT counterparts. Multivariate inference testing showed that senescence and autophagy proteins had the greatest impact on the discrimination between KO and WT 3-month animals, but proteins of antioxidant defense also contributed to that discrimination. A bioinformatic analysis showed that PGC-1a might coordinate the interplay between genes encoding proteins involved in antioxidant defense, senescence and autophagy in the aging retina. These data support importance of PGC-1a in AMD pathogenesis and confirm the utility of mice with PGC-1a knockout as an animal model to study AMD pathogenesis.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The Onion Route Network (also called TOR) is by far the most efficient and widely used anonymity platform with millions of users daily and an expanding size and capacities. Since its public deployment in 2002, the Onion Routing network (also known as TOR) has maintained its leading position and dozens of propositions aiming to improve its performance and enhance the security (anonymity and privacy) have been made. Given the significance of this research area, this work seek to contribute into the improvement of TOR by investigating and testing revolutionary cryptographic and routing mechanism. This work is justified by the current TOR vulnerability and observed weaknesses, and set the challenging aim of covering these security flaws by proposing the relevant security and performances improvement such as the authenticated-encryption for onion construction, the lightened onion encapsulation approach and the secured circuit selection and cell routing mechanisms. The obtained results from implementing the proposed improvements and testing them into a TOR-like simulation platform permit to validate not only, the performances and security contributions brought by the improvement, but also the suitability of their potential implementation into the real TOR network.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

This paper examines some of the largely neglected areas of opportunity to utilize skeletal space structure systems in support of modular, industrialized, economical, sustainable and digital future of the construction industry. In this context, the feasibility of future use of skeletal space structures is studied for a few classes of engineering structures, namely, residential apartment buildings, and offshore platforms, along with their suitability for reconstruction, renovation, modernization and retrofit of damaged buildings and urban areas of cultural heritage significance. Finally, the particulars of lean project management of space structures are discussed with emphasis on engineering and economic factors, production management, environmental aspects, quality management, and reliability, maintainability and sustainability considerations. This article concludes that skeletal space structures can fulfil many of the essential construction requirements of modern societies, especially those facing environmental challenges, all while allowing for design flexibility and mass customization.