Chronic myelogenous leukemia (CML) was the first malignancy for which clinical outcome was drastically improved by kinase inhibitor therapy. Kinase inhibitors targeting other well-known oncogenes have been introduced into clinical practice, but none have shown the same magnitude of clinical benefit as ABL1 inhibition in CML. We argue that early detection is an underappreciated, but critically important factor in success of ABL1 inhibitors in treatment of CML. We show that CML provides a window into how many types of cancer may look and behave at an early stage, prior to diagnosis and the development of additional genomic alterations. The remarkable clinical benefits of ABL1 inhibition is likely due to early detection of CML at a stage in which the tumor is driven by single oncogenic alteration which can be successfully controlled by the inhibitor. Thinking of CML as a prototype for effective systemic treatment based on early cancer detection may help to develop strategies for improving treatment for other types of cancer.

Breast cancer stands as a predominant health concern for women globally. As mammography is the primary screening tool for breast cancer detection, improving the detection of breast cancer at screening could save more lives. This mammography re-view paper provides a systematic review of computer-aided techniques during a specific time frame for the segmentation and classification of microcalcification, evaluating image processing, machine learning, and deep learning techniques. The systematic review is meticulously carried out, adhering closely to the preferred reporting items for Systematic Reviews and Meta-Analysis (PRISMA) guidelines. This article focuses on mammographic breast cancer detection approaches based on automated systems, discussed chronologically from 1970 through 2023. This article encompasses the breadth of artificial intelligence-based methods from the most primitive to the most sophisticated models. Image processing and machine learning-based methods are compre-hensively reviewed. The evaluation of a deep learning architecture based on self-extracted features for classification tasks demonstrated outclass performance. Large-scale datasets required for a broader and in-depth analysis of novel methods for breast cancer detection are also discussed in this article. This research work is aligned with the United Nations' sustainability de-velopment goals.

PIK3CA is a gene usually mutated in breast cancer and has an important role in tumor progression and treatment. Therefore, there is required a technique to detect low-rate PIK3CA mutations improving the clinical conduct. This study aimed to compare chip-based dPCR and Sanger sequencing to detect PIK3CA mutations in breast cancer patients. Fifty-seven tumor samples from breast cancer patients were collected and analyzed by Sanger sequencing and dPCR for PIK3CA mutations (E545K, H1047R, and H1047L). Digital PCR sensitivity, specificity, and overall performance were estimated by contingency tables, receptor operator characteristic (ROC), and area under the curve (AUC). Sanger sequencing identified PIK3CA mutations in six patients (10.5%), two with H1047R, and four with E545K. Digital PCR confirmed those mutations and identified 19 additional patients with at least one mutation. Comparison between dPCR and Sanger sequencing showed a sensitivity of 100% (95% CI 53-100%), and a specificity of 84.2% (95% CI 83 - 84.2%). Besides, H1047R mutation showed a significant association with breast cancer phenotype (p =0.019) and lymphatic node infiltration (p =0.046). Digital PCR showed a high sensitivity to detect mutations in tumor samples and it might be capable to detect low-rate mutations and tumor subpopulations not detected by Sanger sequencing.

Computer-aided image diagnostics (CAD) have been used in many fields of diagnostic medicine. It relies heavily on classical computer vision and artificial intelligence. Quantum neural network (QNN) has been introduced by many researchers around the world and presented recently by research corporations such as Microsoft, Google, and IBM. In this paper, the investigation of the validity of using the QNN algorithm for machine-based breast cancer detection was performed. To validate the learnability of the QNN, a series of learnability tests were performed alongside with classical convolutional neural network (CCNN). QNN is built using the Cirq library to perform the assimilation of quantum computation on classical computers. Series of investigations were performed to study the learnability characteristics of QNN and CCNN under the same computational conditions. The comparison was performed for real Mammogram data sets. The investigations showed success in terms of recognizing the data and training. Our work shows better performance of QNN in terms of successfully training and producing a valid model for smaller data set compared to CCNN.

Cranberries are rich in bioactive constituents reported to influence a variety of health benefits, ranging from improved immune function and decreased infections to reduced cardiovascular disease and more recently cancer inhibition. A review of cranberry research targeting cancer revealed positive effects of cranberries or cranberry derived constituents against 17 different cancers utilizing a variety of in vitro techniques; whereas, in vivo studies supported the inhibitory action of cranberries toward cancers of the esophagus, stomach, colon, bladder, prostate, glioblastoma and lymphoma. Mechanisms of cranberry-linked cancer inhibition include cellular death induction via apoptosis, necrosis and autophagy; reduction of cellular proliferation; alterations in reactive oxygen species; and modification of cytokine and signal transduction pathways. Given the emerging positive preclinical effects of cranberries, future clinical directions targeting cancer or premalignancy will be considered

Beyond factors such as smoking and obesity, the risk of getting gastrointestinal cancer is passed down from parents to offspring, inherited by a gene mutation, predisposing them to develop cancer in their lifetime. Here we describe the clinical history of family members affected by gastrointestinal pathologies often leading to cancer. In the epidemiological study, the cohort of members of this family shared a high risk of developing gastrointestinal diseases. The subjects were monitored from May 2006 to December 2017 by collecting periodically clinical and endoscopic data, and determining both auto-modification of lymphocyte Poly(ADP-ribose)Polymerase as early signal of DNA damage, and erythrocyte membrane lipid composition (Fat Profile). Both biomarkers were demonstrated to be non invasive and easy tools, to monitor over time family members, first the oldest members (nine siblings), and thereafter their offspring, whose cell status evolved from physiological even to cancerous one. All subjects developed gastrointestinal pathologies of different kind and seriousness. Some diseases evolved to cancer, sometimes as a sudden and lethal event. The results of the two molecular approaches, agreed and even predicted the clinical and imaging paths. This cohort study supported the hypothesis that both noninvasive molecular analyses can predict altered cell states and support clinical and imaging tests.

Lung cancer remains the main cause of global cancer-related deaths. Currently low-dose computed tomography (LD-CT) shows a 20% reduction of mortality. However, its clinical suitability is hindered by cost, radiation, and some false positives. Thus, the discovery non-invasive and less-expensive biomarker is urgent needed. In this scenario, proteins released in biological fluids could be considered interesting biomarkers for their role in cancer development. We conducted a pioneering case-control pilot study aimed at assessing the usefulness of Raf Kinase Inhibitory Protein (RKIP) and its phosphorylated form (pRKIP) as potential early-stage lung cancer biomarkers. Urine and Blood samples of two consecutive and independent cohorts of lung cancer patients and healthy controls were screened by means of a novel experimental ELISA assay designed to evaluate both forms of the biomarker. Although urinary levels of RKIP were not statistically different between the lung cancer group and high-risk healthy group, serum ones instead increased significantly in early stage LC patients and permitted to discriminate LC patients from both low-risk (HS) and high-risk healthy subjects (HR-HS) with an overall 93% accuracy (AUC 0.93) when LC was compared to HS and 74% (AUC 0.73) when it was compared to high-risk group. Of note, the analysis of RKIP/pRKIP ratio also showed a high accuracy (90% - AUC 0.95) in discriminating LC patients from HS and more importantly, it allowed to identify LC patients compared to HR-HS, with a higher accuracy (79% - AUC 0.79) than RKIP alone. We hypothesize that serum RKIP levels may be correlated to the activation of the immune systems against the tumor during the first phases of its development. Our study identified a preliminary, non-invasive, RKIP and pRKIP profile able to discriminate with high specificity and sensitivity the early-stage lung cancer patients from high-risk Healthy Subjects. These results, although preliminary, suggest the utility of measuring RKIP/pRKIP as potential new screening test for lung cancer and provide the basis for future validation studies.

The implementation of sentinel lymph node (SLN) biopsy is changing the scenario in the surgical treatment of early-stage cervical cancer and the oncologic safety of replacing bilateral pelvic lymphadenectomy with SLN biopsy is currently under investigation. One of the undisputed values of SLN biopsy is its diagnostic accuracy in detecting low-volume metastases (LVM) via pathologic ultrastaging. In early-stage cervical cancer, the reported incidence of LVM ranges from 4 to 20%. The prognostic impact and the role of adjuvant treatment in patients with LVM is still unclear. Some non-prespecified analyses in prospective studies showed no impact on the oncologic outcomes compared to node-negative disease. However, the heterogeneity of the studies, the differences in the disease stage and the use of adjuvant treatment, and the concomitant pelvic lymphadenectomy (PLND) make any conclusion on this topic hard. Current guidelines suggest considering micrometastasis (MIC) as a node-positive disease, while isolated tumor cells (ITC) as a node-negative disease, with a low level of evidence. This review aims to highlight the unanswered questions about the definition, identification, prognostic and therapeutic role of LVM and underline the present and future challenges we are facing. We hope this review will guide further research, giving robust evidence on LVM and their impact on clinical practice.

Background: Assessing the impact of bone health clinical management in breast cancer (BC) patients receiving adjuvant endocrine therapy and designing a personalized clinical pathway to reduce bone loss, in an Italian research hospital. Methods: The primary endpoint was to assess (through the process improvement organizational method) the clinical pathway that post-surgical BC patients prescribed with endocrine therapy undergo to prevent bone loss. The secondary endpoint was to design a personalized clinical pathway for a prompt implementation of guidelines, to assess and possibly prescribe antiresorptive therapy. Results: During the first year of the new diagnostic therapeutic assistance pathway execution, an 60% increase in Dual-Energy X-ray Absorptiometry evaluations within 30 days and a 39.5% increase in antiresorptive therapy prescription within 90 days (since prescription of endocrine therapy) were shown, thus increasing patients’ compliance. Conclusion: Case managers and bone health specialists in this context can improve patients’ adherence to therapies and bone health, helping physicians to expand their collaboration.

LC-SPIK is a liver cancer-specific isoform of Serine Protease Inhibitor Kazal and has been proposed as a new biomarker for the detection of HCC given its unique 3-D structure which differs from normal pancreatic SPIK. An ELISA technology based on its unique structure was developed to use LC-SPIK as an effective biomarker for the clinical diagnosis of HCC. AFP, the most widely used biomarker for HCC surveillance currently, suffers from poor clinical performance, especially in the detection of early-stage HCC. In one case-control study, which included 164 HCC patients and 324 controls, LC-SPIK had an AUC of 0.87 compared to only 0.70 for AFP in distinguishing HCC from liver disease controls (cirrhosis, HBV/HCV). LC-SPIK also performed significantly better than AFP for the 81 patients with early-stage HCC (BCLC stage 0 and A), with an AUC of 0.85 compared to only 0.61 for AFP. Cirrhosis is the major risk factor for HCC, about 80% of patients with newly diagnosed HCC have preexisting cirrhosis. LC-SPIK’s clinical performance was also studied in HCC patients with viral and non-viral cirrhosis including cirrhosis caused by nonalcoholic fatty liver disease (NAFLD) and alcoholic liver disease (ALD). In a total of 163 viral cirrhosis patients with 93 HCC patients (50 early-stage), LC-SPIK had an AUC of 0.85, while AFP had an AUC of 0.70. For patients with early-stage HCC, LC-SPIK had a similar AUC of 0.83, while AFP had an AUC of only 0.60. For 120 patients with nonviral cirrhosis, including 62 HCC (23 early-stage) patients, LC-SPIK had an AUC of 0.84 while AFP had an AUC of only 0.72. For the 23 patients with early-stage HCC, LC-SPIK had a similar AUC of 0.83, while the AUC for AFP decreased to 0.65. All these results suggest that LC-SPIK has significantly better performance in the detection of HCC than AFP in all etiologies of liver diseases. In addition, LC-SPIK accurately detected the presence of HCC in 71%-91% of HCC patients with false-negative AFP test results in viral associated HCC and non-viral associated HCC.

This review explores the transformative impact of sensor technologies in early disease detection. It highlights recent advancements in nanotechnology-based sensors, particularly focusing on their applications in identifying disease biomarkers at early stages. The integration of these sensors with artificial intelligence for predictive analytics in healthcare is also discussed. Applications in cancer, infectious diseases, and chronic disease management underscore their diverse utility. Challenges in sensor technology adoption and future directions, including multiplexed sensors and wearable devices, are examined. This review underscores sensors' potential in enhancing disease management and patient outcomes.

This article presents a comparative analysis of three Machine Learning models, namely Logistic Regression, Decision Tree Classifier, and Random Forest Classifier, for prostate cancer detection. The models were trained and evaluated using clinical data, and their performance was assessed using various evaluation metrics. The results show that Logistic Regression achieved the highest accuracy (90%) among the three models, followed by Random Forest Classifier (76.67%) and Decision Tree Classifier (73.33%). Similarly, Logistic Regression demonstrated superior precision (95.65%) and F1 Score (93.62%), indicating its effectiveness in identifying true positive cases. However, the Decision Tree Classifier exhibited higher recall for the negative class (83.33%) compared to the positive class (70.83%), while Random Forest Classifier showed balanced recall for both classes (66.67% for negative and 79.17% for positive). These findings suggest that Logistic Regression outperforms the other models in terms of accuracy and precision, while the Decision Tree Classifier and Random Forest Classifier provide better recall for certain classes. The results highlight the potential of Machine Learning in prostate cancer detection and provide insights for further research and improvement of the models.

This study focused on the precise detection and concordant analysis of circulating tumor cells (CTCs) to verify the usefulness of CTCs as promising clinical markers. CTCs are traditionally achieved using immune-fluorescence and morphological techniques. By combining two prostate cancer-specific genes (PSA and PSMA) and two epithelial-specific genes (EpCAM and KRT19), the CTC detection efficiency can be enhanced. The detection rates of localized prostate cancer (LPC), locally advanced prostate cancer (LAPC), metastatic hormone-sensitive prostate cancer (mHSPC), and metastatic castration-resistive prostate cancer (mCRPC) were 63.04 % (29/46), 70.59% (34/51), 94.34% (50/53), and 90% (126/140), respectively. Subsequent correlation analysis between the four genes, baseline PSA, and CTC count revealed that only the CTC count correlated with baseline PSA in the localized stages of prostate cancer, whereas all four genes were correlated with baseline PSA and CTC count in the metastatic stages of prostate cancer. The precise detection of CTCs using both numerical and transcriptomic analyses can improve the accuracy of biomarker investigations. This study provides valuable insights into the limitations of serum PSA testing and offers a promising alternative to diagnose and manage prostate cancer via the CTC number and specific genes for prostate cancer.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Growing evidence has revealed the implication of germline variation in cancer predisposition and prognostication. Here, we describe an analysis of putatively disruptive rare variants across the genomes of 726 patients with B-cell lymphoid neoplasms. We discovered a significant enrichment of 26 genes in germline protein truncating variants (PTVs), affecting cell signaling (MET, JAK2, ANGPT2), energy metabolism (ACO1) and nucleic acid metabolism and repair pathways (NT5E, DCK). Interestingly, some of these variants were restricted to either chronic lymphocytic leukemia (CLL) (i.e., ANGPT2 and AKR1C3) or B-cell lymphoma cases (PNMT, TPT1 and IGHMBP2). Additionally, we detected 1,675 likely disrupting variants in genes associated with cancer, of which 44.75% were novel events and 7.88% were PTVs. Among these, the most frequently affected genes were ATM, BIRC6, CLTCL1A and TSC2. Homozygous or compound heterozygous variants were detected in 28 cases; and coexisting somatic events were observed in 17 patients, some of which affected key lymphoma drivers such as ATM, KMT2D and MYC. Finally, we observed that variants in the helicase gene WRN were independently associated with shorter survival in CLL. Our study results support an important role for rare germline variation in the pathogenesis, clinical presentation and disease outcome of B-cell lymphoid neoplasms.

Cholangiocellular carcinoma (CCA) is the second most common primary liver cancer, with increasing incidence worldwide and inadequate therapeutic options. Intra- and extrahepatic bile ducts have distinctly different embryonic origins and developmental behavior, and accordingly intra- and extrahepatic CCAs (ICC vs. ECC) are molecularly different. A promising strategy in oncotherapy is targeted therapy, targeting proteins that regulate cell survival and proliferation; such as the MAPK/ERK and PI3K/AKT/mTOR signaling pathways. Inhibitors of these pathways have been tested previously in CCA cell lines. However, these cell lines could not be clearly assigned to ICC or ECC, and results indicated apoptosis induction by targeted therapeutics. We tested targeted therapeutics (selumetinib, MK2206) in three defined ICC cell lines (HuH28, RBE, SSP25). We observed cooperative effects of dual inhibition of the two pathways, in accordance with inhibition of phospho-AKT and phospho-ERK1/2 expression. Proliferation was blocked more effectively with dual inhibition than with each single inhibition, but cell numbers did not drop below baseline. Accordingly, we observed G1-phase arrest, but not apoptosis (cleaved caspase-3, AIFM1 regulation, subG1-phase) or necroptosis (phospho-MLKL). We conclude that dual inhibition of MAPK/ERK and PI3K/AKT/mTOR pathways is highly effective to block proliferation of ICC cell lines, but therapy must certainly be supplemented with standard therapies.

Lung cancer is the leading cause of cancer mortality worldwide, and it is urgently necessary to diagnose it as early as possible. Usually, the diagnostic process begins with a radiological examination which, when a possible tumour is present, is followed by a biopsy to extract tissue samples from the patient's lungs. Therefore, the purpose of this study is the development of an artificial intelligence algorithm that will analyse the Whole Slide Image (WSI) generated by the digitisation of the glass slides obtained from the extracted samples and detect if there is a tumour. The developed learning algorithms as well as the tested neural networks (NNs) were trained on a dataset composed of previously annotated WSI tiles, classified as Tumour or Non-Tumour. From these, four developed convolutional neural networks stood out and were selected to be compared with each other and with the tested NNs. When the best result of each of the developed architectures was compared to the highest result of the tested NNs, it was possible to denote that version 4 of CancerDetecNN achieved an average accuracy of 89.749 \% and an average loss of 0.220. Furthermore, the results for the four selected versions are in agreement with the results reported in the literature, however, the limited size of the given dataset must be considered. Given the results obtained, the fourth version has the potential to optimise the lung cancer diagnosis process.

This review article is aimed at exploring the possibility of developing an integrated approach in the management of the different needs of endometrial cancer (EC) patients seeking to become pregnant. Life preservation of the woman, health preservation of the baby, a precocious and – as much as possible – minimally invasive characterization of the health and fertility parameters of the patient, together with the concerns regarding the obstetric, neonatal, and adult health risks of the children conceived via assisted reproduction techniques (ART) are all essential aspects of the problem to be taken into consideration, yet the possibility to harmonize such needs through a concerted integrated approach is still highly challenging. This article aims to illustrate the main features of EC and how it affects the normal physiology of pre-menopausal women. Then, we focus on the prospect for a miR-based, molecular evaluation of patient health status, including both EC early diagnosis and staging and, similarly, the receptivity of the woman, discussing the possible evaluation of both aspects using a single specific panel of circulating miR in the patient, thus allowing a relatively fast, non-invasive way to perform such testing with a significantly reduced margin of error. Finally, the ethical and legal/regulatory complexities arising from such innovative techniques require not only a risk-benefit analysis; respect for patient autonomy and equitable health care access allocation are fundamental issues as well.

A super-porous hybrid platform can offer significantly increased number of reaction sites for the analytes and thus can offer advantages in the biosensor applications. In this work, a significantly improved sensitivity and selectivity of hydrogen peroxide (H2O2) cancer sensor is demonstrated by a super-porous hybrid CuO/Pt NP platform. The super-porous hybrid platform is fabricated by a physiochemical approach combining the physical vapor deposition of Pt NPs and electrochemical deposition of super-porous CuO structures by adopting a dynamic hydrogen bubble technique. Under an optimized condition, the hybrid CuO/Pt biosensor demonstrates a very high sensitivity of 2,205 µA/mM∙cm2 and a low limit of detection (LOD) of 140 nM with a wide range of H2O2 detection. This is meaningfully improved performance as compared to the CuO-based H2O2 sensors as well as to the previously reported metal oxide based H2O2 sensors. The hybrid CuO/Pt platform exhibits excellent selectivity against other interfering molecules such as glucose, fructose, dopamine, and ascorbic acid. Due to the synergetic effect of highly porous CuO structures and underlying Pt NPs, the CuO/Pt architecture offers extremely abundant active sites for the H2O2 reduction and electron transfer pathways.

Oral cancer represents a significant global public health challenge, contributing substantially to cancer incidence and mortality. Despite established risk factors such as tobacco use and alcohol consumption, early detection remains crucial for effective treatment. This study introduces a novel approach using a transistor-based biosensor system for detecting the P90 (CIP2A) protein. We have tested the presence of CIP2A in human leukoplakia samples that can rise into oral squamous cell carcinoma. The method employs commercially available glucose test strips functionalized with P90 antibodies, providing high sensitivity and a low limit of detection, which is five orders lower than commercial ELISA kits. A specially designed printed circuit board (PCB) facilitates accurate measurements, and the device's performance is optimized through characteristic tests. Human sample testing validates the biosensor's effectiveness in distinguishing samples after cell lysis. This study contributes to advancing accurate and cost-effective diagnostic approaches for oral pre-cancer and cancer tissues.

In recent years, numerous approaches have been developed to comprehend the molecular altera-tions underlying thyroid cancer (TC) oncogenesis and explore novel therapeutic strategies for TC. It is now well established that the neurokinin-1 receptor (NK-1R) is overexpressed in cancer cells and that NK-1R is essential for viability of cancer cells. The binding of substance P (SP) to NK-1R in neoplastic cells plays a pivotal role in cancer progression by promoting neoplastic cell growth, protecting tumour cells from apoptosis, triggering invasion and metastasis through enhanced migration of cancer cells, and stimulating endothelial cell proliferation for tumour angiogenesis. Remarkably, all types of human TC (papillary, follicular, medullary, anaplastic), as well as met-astatic lesions, exhibit overexpression of SP and NK-1R compared to the normal thyroid gland. TC cells synthesize and release SP, which exerts its multiple functions through autocrine, para-crine, intracrine, and neuroendocrine processes, including the regulation of tumour burden. Con-sequently, the secretion of SP from TC results in increased SP levels in plasma, which are signifi-cantly higher in TC patients compared to controls. Additionally, NK-1R antagonists have demonstrated a dose-dependent antitumour action. They impair cancer cell proliferation on one side and induce apoptosis of tumour cells on the other side. Furthermore, it has been demonstrat-ed that NK-1R antagonists inhibit neoplastic cell migration, thereby impairing both invasiveness and metastatic abilities, as well as angiogenesis. Given the consistent overexpression of NK-1R in all types of TC, targeting this receptor represents a promising therapeutic approach for TC. Therefore, NK-1R antagonists, such as the drug aprepitant, may represent novel drugs for TC treatment.

Accurate assessment of the breast cancer deterioration degree plays a crucial role in making medical plan, and the important basis for degree assessment is the number of mitoses in a given area of the pathological image. We utilized deep multi-scale fused fully convolutional neural network (MFF-CNN) combing with conditional random felid (CRF) to detect mitoses in hematoxylin and eosin stained histology image. Analyze the characteristics of mitotic detection ----scale invariance and sparsity, as well as the difficulties ---- small amount of data , inconsistent image staining and sample class unbalanced. Based on this, mitotic detection model is designed. In this paper, a tissue-based staining equalization method is used, and to establish an effective training sample set, we select training samples by using CNN. A mitotic detection model fusing multi-level and multi-scale features and context information was designed, and the corresponding training strategy was made to reduce over-fitting. As preliminarily validated on the public 2014 ICPR MITOSIS data, our method achieves a better performance in term of detection accuracy than ever recorded for this dataset.

The purpose of this longitudinal study was to determine the effects of a rowing training program on physical fitness and body composition in female breast cancer survivors (56.78 ± 6.38 years). Over six months, the participants (n=40) performed two training sessions per week for an average of 75 minutes, combining resistance and muscle strength exercises with rowing. To evaluate the impact of the program, physical fitness tests and anthropometric measurements were carried out before and after the training protocol. The results show statistically significant improvements in measures such as weight (-1.84 kg), BMI (-0.7 kg/m2), hip (-3.24 cm) and waist circumference (-2.45 cm). In addition, variables associated with physical fitness also improved including leg strength (3.04 cm), dominant handgrip strength (4.24 kgf), non-dominant handgrip strength (3.49 kgf), aerobic endurance (78.35 m) and muscle flexibility (3.96 cm). We can therefore conclude that a rowing-based exercise program is an effective strategy to improve physical fitness in this type of population, yielding improvements in both anthropometric measurements and basic physical capacity variables, essential factors for better health and quality of life.

Microarray gene expression-based detection and classification of medical conditions have been prominent in research studies over the past few decades. However, extracting relevant data from the high-volume microarray gene expression with inherent nonlinearity and inseparable noise components raises significant challenges during data classification and disease detection. So, this paper proposes a two-level strategy involving feature extraction and selection methods before the classification step. The feature extraction step utilizes Short Term Fourier Transform (STFT), and the feature selection step employs Particle Swarm Optimization (PSO) and Harmonic Search (HS) metaheuristic methods. The classifiers employed are Non-Linear Regression, Gaussian Mixture Model, Softmax Discriminant, Naive Bayes, SVM (Linear), SVM (Polynomial), and SVM (RBF). The two-level extracted relevant features are compared with raw data classification results, including Convolutional Neural Network (CNN) Methodology. Among the methods, STFT with PSO feature selection and SVM (RBF) classifier produced the highest accuracy of 94.47%.

Background: this interventional pilot study aimed to evaluate the short-term (3 years) efficacy of focal laser ablation (FLA) in treating the index lesion of low-intermediate risk prostate cancer, along with assessing the safety of the procedure (ClinicalTrials.gov ID NCT04045756). Methods: forty patients aged between 46 and 86 with histologically proven organ-confined prostate cancer and low to intermediate progression risk were included. FLA was performed under percutaneous fusion magnetic resonance/ultrasound guidance in a Day Hospital setting under local anesthesia. Patients underwent regular clinical assessments, PSA measurements, post-procedure MRI scans, and biopsies at 36 months or if positive findings were detected earlier. Statistical analyses were conducted to assess trends in PSA levels and cavity dimensions over time. Results: forty patients were initially included, with 15 lost to follow-up. At 36 months, a mean PSA reduction of 60% was observed, and 80% of MRI scans showed no signs of in-field clinically significant residual/recurrent cancer. Biopsies at 36 months revealed no malignant findings in 20 patients. No deterioration in sexual function or urinary symptoms was recorded. Conclusions: FLA appears to be safe, feasible and effective in the index lesion treatment of low-intermediate risk prostate cancer, with a high rate of tumor eradication and preservation of quality of life.

Lung cancer is the leading cause of cancer related mortality worldwide. In order to improve its overall survival, early diagnosis is required. Since current screening methods still face some pitfalls, such as high false positive rates for low-dose computed tomography, researchers are still looking for early biomarkers to complement existing screening techniques in order to provide a safe, faster and more accurate diagnosis. Biomarkers are biological molecules found in body fluids, such as plasma, that can be used to diagnose a condition or disease. Metabolomics has already shown to be a powerful tool in the search for cancer biomarkers since cancer cells are characterised by impaired metabolism, resulting in an adapted plasma metabolite profile. The metabolite profile can be determined using nuclear magnetic resonance, or NMR. Although metabolomics and NMR metabolite profiling of blood plasma are still under investigation, there is already evidence for its potential for early-stage lung cancer diagnosis, therapy response, and follow-up monitoring. This review highlights some key breakthroughs in this research field, where the most significant biomarkers will be discussed in relation with their metabolic pathways and in light of the altered cancer metabolism.

Circulating tumor cells (CTC) have shown to be prognostic in advanced colorectal cancer (advCRC), but their value for predicting response to treatment or as a source of molecular data is debated. We compared CellSearch® (Janssen Diagnostics, LLC) and IsoFlux^TM (Fluxion Biosciences Inc, South San Francisco, CA) systems for the enumeration of CTC in patients with newly diagnosed advCRC (group 1; n=34). Using castPCR^TM we studied KRAS status in CTC isolated with IsoFlux^TM and compared it with that of the primary tumor in patients from group 1 and in KRAS wild-type (KRAS^WT) patients with progressive disease (group 2; n=22). Median number of CTC detected with CellSearch® (groups 1 and 2) was 1 (range: 0-78) and with IsoFlux^TM (group 1) was 8 (range: 0-419), showing a modest correlation (r=0.345, P=0.036), which improved if lung metastases (r=0.805, P=0.016) or if lung and liver metastases were present (r=0.812, P=0.05). A Bland-Altman plot showed that the higher the number of CTC detected the larger the difference between both methods in favor of IsoFlux^TM. After a median follow-up since CTC collection of 16 months (range: 1-30) CellSearch® ≥ 3 CTC (HR 2.77, 95% CI 0.77-9.95) and IsoFlux^TM ≥ 11 CTC (HR 4.14, 95% CI 1.05-16.19) were established as the best cutoff points for predicting survival. Using castPCR^TM we found KRAS mutations in CTC in 4 out of 8 patients from group 1 and in 2 out of 3 patients from group 2. None of these mutations were found in the primary tumor using standard methods, possibly reflecting intratumor heterogeneity or treatment selection pressure. We conclude that IsoFlux^TM is more efficient than CellSearch® in the isolation of CTC in patients with advCRC, achieving, in a majority of cases, the established minimum of CTC for castPCR^TM-based genetic analyses.

Background: Pancreatic neuroendocrine tumors (pNETs) represents a rare subset of pancreatic cancer. Functional tumors caused hormonal changes and clinical syndromes, while non-functional ones are often diagnosed late. Surgical management need a multidisciplinary planning, involving enucleation, distal pancreatectomy with or without spleen preserving, cen-tral pancreatectomy, pancreaticoduodectomy or total pancreatectomy. Minimally invasive ap-proach increased in the last decade compared to the open technique. The aim of this study is to analyze current diagnostic and surgical trends for pNETs, to identify better interventions and their outcomes. Methods: The study adhered to PRISMA guidelines, conducting a systematic review of literature from May 2008 to March 2022 across multiple databases. Several combinations of keywords was used ("NET", "pancreatic", "surgery", "laparoscopic", "minimally invasive", "robotic”, “enuclea-tion”,“parenchima sparing”) and relevant article references was manually checked. Manuscript quality was evaluated. Results: The study screened 3867 manuscripts, twelve studies were selected, primarily from Ita-ly, the United States, and China. A total of 7767 surgical treated patients was collected from 160 included centers. The mean age was 56,3 y.o. Enucleations (EN) and distal pancreatectomy (DP) was the most common performed surgery and represents 43.4% and 38.6% of the total interven-tions, respectively. Pancreatic fistula, post operative bleeding, re-operation and follow up was recorded and analyzed. Conclusions: Enucleation show better postoperative outcomes and lower mortality rates com-pared to pancreaticoduodenectomy (PD) or distal pancreatectomy (DP), despite similar risks of postoperative pancreatic fistula (POPF). DP was preferred over enucleation for pancreas body-tail, while laparoscopic enucleation is better for head pNETs.

In recent years, computer-aided analysis techniques have emerged as valuable tools in assisting dermatologists by providing objective and efficient analysis of skin cancer images. This paper utilizes the combination of the Contourlet Transform (CT) and Local Binary Pattern (LBP) techniques for accurately recognizing borders, contrast changes, and shapes of skin cancer images. These results often contain many features, leading to high computational costs and potential over-fitting issues. Hence, we applied Particle Swarm Optimization (PSO) to select the most informative and discriminating features, reducing the dimensionality while retaining important information for accurate classification. After reducing the feature set with PSO, we applied these sets to Machine learning classification algorithms: Support Vector Machine (SVM), Random Forest (RF), and Neural Networks (NN). The results show that SVM has the lowest time complexity of 0.0458 seconds, followed by the Neural Network at 0.08730 seconds, and the Random Forest model has the highest time complexity of 0.1622 seconds. The SVM and Neural Network models are faster to train than the Random Forest model, making them more suitable for real-time or latency-sensitive applications. We also compared our proposed model with the state-of-the-art models and obtained the accuracy of 86.9%, which is the highest among the models.

Lysophosphatidic acid (LPA) is a promising biomarker candidate to screen for ovarian cancer (OC) and potentially stratify and treat patients according to disease stage. LPA is known to target actin-binding protein gelsolin that is a key regulator of actin filament assembly. Previous studies have shown that the phosphate headgroup of LPA alone is inadequate to bind to the short chain of amino acids in gelsolin known as the PIP2-binding domain. Thus, the molecular-level detail of the mechanism of LPA binding is poorly understood. Here, we model LPA binding to the PIP2-binding domain of gelsolin in the gelsolin-actin complex through extensive ten microsecond atomistic molecular dynamics (MD) simulations. We predict that LPA binding causes a local conformational rearrangement due to LPA interactions with both gelsolin and actin residues. These conformational changes are a result of the amphipathic nature of LPA, where the anionic phosphate, polar glycerol and ester groups, and lipophilic aliphatic tail mediate LPA binding via charged electrostatic, hydrogen bonding, and van der Waals interactions. The negatively-charged LPA headgroup binds to the PIP2-binding domain of gelsolin-actin while its hydrophobic tail is inserted into actin, creating a strong LPA-insertion pocket that weakens the gelsolin–actin interface. The computed structure, dynamics, and energetics of the ternary gelsolin–LPA–actin complex confirms that a quantitative OC assay is possible based on LPA-triggered actin release from the gelsolin-actin complex.

The concept and policies of multiple early cancer detection (MCED) have gained significant attention from governments worldwide in recent years. In the era of burgeoning artificial intelligence (AI) technology, the integration of MCED with AI has become a prevailing trend, giving rise to a plethora of MCED AI products. However, due to the heterogeneity of both the detection targets and the AI technologies, the overall diversity of MCED AI products remains considerable. The types of detection targets encompass protein biomarkers, cell-free DNA, or combinations of these biomarkers. In the development of AI models, different model training approaches are employed, including datasets of case-control researches or real-world cancer screening datasets. Various validation techniques, such as cross-validation, location-wise validation, and time-wise validation are used. All of the factors show significant impacts on the predictive efficacy of MCED AIs. After the completion of AI model development, deploying the MCED AIs in clinical practice presents numerous challenges, including presenting the predictive reports, identifying the potential locations and types of tumor, and addressing cancer-related information such as clinical follow-up and treatment. This study reviews several mature MCED AI products currently available in the market, detecting their composing factors from serum biomarkers detection, MCED AIs training/validation, and the clinical application. The review illuminates the challenges encountered by existing MCED AI products across these stages, offering insights into the continued development and obstacles within the field of MCED AI.

Lung cancer (LC) stands as the foremost cause of cancer-related fatality rates worldwide. Early diagnosis significantly enhances patient survival rate. Nowadays, low dose computed tomography (LDCT) is widely employed on chest as a tool for large-scale lung cancer screening. Nonetheless, a large amount of chest radiographs causes an onerous burden on radiologists. Some computer-aided diagnostic (CAD) tools can provide insights to medical images for diagnosis and augmenting diagnostic speed. However, due to variation in parameter settings across different patients, substantial discrepancies in image voxels persist. We find different voxel-size causing a compromise between model generalization and diagnostic efficacy. This study investigates the performance disparities of diagnostic models trained on original images and LDCT images reconstructed to different voxel-sizes but isotropic. The application is to differentiate a nodule to be benign or malignant. Using 11 features, a support vector machine (SVM) is trained on LDCT images with an isotropic voxel having side-length of 1.5 mm for 225 patients in house. The result yields a favorable model performance with an accuracy of 0.9596 and an area under the receiver operating characteristic curve (ROC/AUC) of 0.9855. In addition to furnish CAD tools for clinical applications, future research is encouraged to include LDCT images from multi-centers.

A heterogeneous disease like cancer is activated through multiple pathways and different perturbations. Depending upon the activated pathway(s), patients’ survival vary significantly and show different efficacy to various drugs. Therefore, cancer subtype detection using genomics level data is a significant research problem. Subtype detection is often a complex problem, and in most cases, needs multi-omics data fusion to achieve accurate subtyping. Different data fusion and subtyping approaches have been proposed, such as kernel-based fusion, matrix factorization, and deep learning autoencoders. In this paper, we compared the performance of different deep learning autoencoders for cancer subtype detection. We performed cancer subtype detection on four different cancer types from The Cancer Genome Atlas (TCGA) datasets using four autoencoder implementations. We also predicted the optimal number of subtypes in a cancer type using the silhouette score. We observed that the detected subtypes exhibit significant differences in survival profiles. Furthermore, we also compared the effect of feature selection and similarity measures for subtype detection. To evaluate the results obtained, we selected the Glioblastoma multiforme (GBM) dataset and identified the differentially expressed genes in each of the subtypes identified by the autoencoders; the obtained results coincide well with other genomic studies and can be corroborated with the involved pathways and biological functions. Thus, it shows that the results from the autoencoders, obtained through the interaction of different datatypes of cancer, can be used for the prediction and characterization of patient subgroups and survival profiles.

(1) Background: Sentinel lymph node (SLN) mapping represents an accurate and feasible technique for the surgical staging of endometrial and cervical cancer. This is commonly performed by conventional laparoscopy or robotic-assisted laparoscopy, but in recent years, a new retroperitoneal transvaginal natural orifice transluminal endoscopic surgery (vNOTES) approach has been described. This technique provides easy visualization of lymphatic afferent vessels and pelvic lymph nodes, early SLNs assessment, and a coherent mapping methodology following the lymphatic flow from caudal to cranial. However, only a few publications have reported it. Following the IDEAL (Idea Development Exploration Assessment Long-term follow-up) framework, research concerning this technique is at stage 2a, with only small case series as evidence of its feasibility. Its standardized description appears necessary to provide the surgical homogeneity required to move further. (2) Methods: description of a standardized approach for retroperitoneal pelvic SLN mapping by vNOTES. (3) Results: we described a 10-step approach to successfully perform retroperitoneal vNOTES SLN mapping, including pre-, intra-, and postoperative management. (4) Conclusions: This IDEAL stage 2a study could help other surgeons approach this new technique, and it proposes a common methodology necessary to evolve through future IDEAL stage 2b (multi-center studies) and stage 3 (randomized controlled trials) studies.

Background and Objectives: The purpose of the study was to analyze the relationships between several clinical and biological factors, but also the tumor topography and surgical strategies used in patients with colorectal cancer. Materials and Methods: We designed an analytical, observational, retrospective study that included patients admitted to our emergency surgical department and diagnosed with colorectal cancer. The study group inclusion criteria were: patients admitted during 2020-2022; patients diagnosed with colorectal cancer (including the ileocecal valve); patients who benefited from a surgical procedure, either in emergency or elective. Results: In our study group, consisting of 153 patients, we accounted for 56.9% male patients and 43.1% female patients. The most common clinical manifestations were pain (73.2% of the study group), followed by abdominal distension (69.3% of the study group) and absence of intestinal transit (38.6% of the study group). A number of 69 patients were operated in emergency (45.1%), while 84 patients (54.9%) benefited from elective surgery. The most frequent topography of the tumor was the sigmoid colon, with 19.60% of the patients, followed by the colorectal junction, with 15.68% of the patients and superior rectum and inferior rectum, with 11.11% of the patients in each subcategory. The most frequent type of procedure was right hemicolectomy (21.6% of the study group), followed by rectosigmoid resection (20.9% of the study group). The surgical procedure was finished by performing an anastomosis in 49% of the patients, an ostomy in 43.1% of the patients, while for 7.8% of the patients, a tumoral biopsy was performed. Conclusions: Colorectal cancer remains one of the most frequent cancers in the world, with a heavy burden that involves high mortality, alterations in the quality of life of the patients and their families, and also the financial costs of the medical systems.

The current management of colorectal cancer liver metastasis (CRCLM) patients involves a multidisciplinary approach with surgical resection remaining the primary curative option. The advances in liver surgery have improved outcomes, enabling more patients to undergo surgery successfully. In addition, the development of imaging software has improved the preoperative planning and patient selection for surgery and other interventions. Systemic therapies, such as targeted therapies and immunotherapies have enhanced the chances of complete resection. Targeted agents in combination with chemotherapy, have shown efficacy in downstaging tumors and increasing resectability.

Cervical cancer is one of the ailments that endangers the health of women all over the world and causes infertility. Fortunately, this disease can be avoided. Both the results and participation rates of the current preventative strategy remain poor. Hence, preventative or early detection methods remain challenging and open. In gynecology and computer science fields, few studies on identifying cervical cancer are based on behavior risk factor and machine learning. Moreover, various social and behavioral aspects might often make it more difficult to detect cervical cancer especially in low‑ and middle‑income countries (LMICs). Accordingly, focus on predicting the presence of cervical cancer through behavioral risk factors is the basic structure of this research. We proposed an approach to classify cervical cancer from a social-behavioral perspective using logistic regression to predict cervical cancer. We got significantly improved outcomes than the existing methods. Moreover, we used feature engineering to formulate less dimensionality as a pre-processing step and optimized parameters to be prepared for classification phase. The results proved that using the logistic regression with regularization type L1 had a promising performance. The accuracy of Logistic Regression (LR) L1 was 97.2%. Such results support the proposed work as a reliable classification predictive tool.

Circulating tumor cells (CTCs) are cells released from the primary tumor and intravasate into the blood or lymphatic vessels, where they are transported to distant sites and act as seeds that initiate cancer metastases. Recent advances in CTC research have shown their relevance as prognostic markers for early and metastatic disease detection, predictive biomarkers for relapse, and response to medical intervention or therapy. The rapidly evolving landscape of CTC biology has opened new avenues for understanding cancer progression, metastasis, and treatment response. Additionally, translating these findings into clinical applications holds promise for improving cancer diagnostics, prognosis, and personalized therapeutic strategies. This review discusses the significance of CTCs in cancer research and their associated challenges. We explore recent developments in the detection and characterization of CTCs and their implications in cancer research and clinical practice.

Analyzed the literature devoted to the changes in the expression of the RAS proteins of cancer cells. A brief review of protein expression dynamics PAC in malignant tumors and the possible role of epigenetic mechanisms in these processes. Through research epigenetic mechanisms state for cancer have been developed principally new techniques for their correction, based on the use of selective regulators systems covalent modification-histone proteins (for example, deacetylase inhibitor) and microRNA synthesis technologies. Literature data show promising pharmacological correction epigenetic modification of chromatin in the treatment of cancer.

In patients with presumed pancreatic ductal adenocarcinoma (PDAC), biomarkers that may open for personalised, risk-adapted treatment are lacking. The study analysed the impact of circulating tumour cells (CTCs) on the patterns of recurrence and survival in 98 patients resected for PDAC with 5-10 years of follow-up. Preoperative samples were analysed by the CellSearch® system for EpCAM+/DAPI+/CK+/CD45- CTCs. CTCs were detected in 7 of the 98 patients. CTCs predicted a significantly shorter median DFS of 3.3 vs. 9.2 months and a median CSS of 6.3 vs. 18.5 months. Relapse status was confirmed by imaging for 87 patients. Of these, 58 developed distant metastases (DM) and 29 cases isolated local recurrence (ILR) as first event. All patients with CTCs experienced DM. pN-status and histological grade >2 were other independent risk factors for DM, but only CTCs predicted significantly shorter cancer-specific, disease-free and post-recurrence survival. We conclude that CTC presence in resected PDAC patients predicted early distant metastasis and impaired survival. The impact of CTCs was comparable to that of histopathological risk factors and exceeded the effect size of other preoperative parameters. Thus, preoperative CTCs alone or in combination with histopathological factors may guide initial treatment decisions in patients with resectable PDAC in the future.

Breast cancer is the most common malignancies in women and the second leading cause of cancer death in women. Triple negative breast cancer (TNBC) subtype is a breast cancer subset without ER, PR and HER2 expression, limiting treatment options and presenting a poorer survival rate. Thus, we investigated whether HDACi would be used as potential anti-cancer therapy on breast cancer cells. In this study, we found TNBC and HER2-enrich breast cancers are extremely sensitive to Panobinostat, Belinostat of HDACi via experiments of cell viability assay, apoptotic marker identification and flow cytometry measurement. On the other hand, we developed a bioluminescence based live cell non-invasive apoptosis detection sensor (IADS) detection system to evaluate the quantitative and kinetic analyses of apoptotic cell death by HDAC treatment on breast cancer cells. In addition, the use of HDACi may also be accompanied with chemotherapeutic agent such as doxorubicin to synergic drug sensitivity on TNBC cell (MDA-MB-231), but not in breast normal epithelia cells (MCF-10A), providing therapeutic benefits against breast tumor in clinic.

Early detection of breast cancer, one of the most common cancers in women worldwide, raises survival rates and lowers the cost of treatment. Although breast cancer detection and classification (CAD) tools have improved, some issues and restrictions still require further research. The creation of breast cancer CAD systems, particularly with deep learning models, was significantly impacted by recent advancements in machine learning and image processing techniques. The current deep learning-based CAD system to identify and categorize masses in mammography is presented in a structured manner in this survey. The survey provides the most popular breast cancer CAD system evaluation metrics, publicly available mammographic datasets, and current image modalities. The survey examines the available literature, emphasizing its strengths and limitations. The survey also emphasizes the difficulties and drawbacks of the current methods for classifying and detecting breast cancer. We point out research gaps and make suggestions for further study. This systematic review may be beneficial for clinicians using CAD systems to diagnose breast cancer early on and for researchers looking for knowledge gaps and making more contributions to the field.

Background: Circulating rare cells participate in breast cancer evolution as systemic components of the disease and thus, are a source of theranostic information. Exploration of cancer-associated rare cells is in its infancy. We determined the validity of a rare-cell detection platform and demonstrated the usefulness of a certain rare cell subset as a novel approach to characterize the breast cancer system. Methods: Linearity of the Rarmax® platform was established using a spike-in approach. The platform includes red blood cell lysis, leukocyte depletion and high-resolution fluorescence image recording. Rare cell analysis was conducted on 28 samples (before and after surgery) from 14 patients with breast cancer, 20 healthy volunteers and 9 non-cancer control volunteers. In-depth identification of rare cells, including circulating tumor cells, endothelial-like cells, erythroblasts and inflammation-associated cells, was performed using a phenotype and morphology-based classification system. Results: The platform performed linearly over a range of 5-950 spiked cells, with an average recovery of 84.6%. Circulating epithelial and endothelial-like cell subsets have been demonstrated to be associated with or independent of cancer with tumor presence. Furthermore, certain cell patterns may be associated with treatment-related adverse effects. The sensitivity in detecting tumor-presence and cancer-associated abnormality before surgery was 50% and 85.7%, respectively and the specificity was 100% and 96.6%, respectively. Conclusion: The present study supports the idea of a cancer-associated rare cell abnormality to represent tumor entities as well as systemic cancer. The latter is independent of the apparent clinical cancer.

High-throughput screening technologies continues to produce large amounts of multiomics data from different populations and cell types for various diseases, such as cancer. However, analysis of such data encounters difficulties due to cancer heterogeneity, further exacerbated by human biological complexity and genomic variability. There is a need to redefine the drug discovery development pipeline, bringing an Artificial Intelligence (AI)-powered informational view that integrates relevant biological information and explores new ways to develop effective anticancer approaches. Here, we show SynPred, an interdisciplinary approach that leverages specifically designed ensembles of AI-algorithms, links omics and biophysical traits to predict synergistic anticancer drug synergy. SynPred exhibits state-of-the-art performance metrics: accuracy – 0.85, precision – 0.77, recall – 0.75, AUROC – 0.82, and F1-score - 0.76 in an independent test set. Moreover, data interpretability was achieved by deploying the most current and robust feature importance approaches. A simple web-based application available online at http://www.moreiralab.com/resources/synpred/ was constructed to predict synergistic anticancer drug combinations requiring only the upload of the two drug SMILES to be tested, allowing easy access by non-expert researchers.

Radiolabelled tracers targeting the prostate-specific membrane antigen (PSMA) have become important radiopharmaceuticals for the PET-imaging of prostate cancer. In this connection we recently developed the fluorine-18 labelled PSMA-ligand [¹⁸F]PSMA-1007 as next generation radiofluorinated Glu-ureido PSMA inhibitor after [¹⁸F]DCFPyL and [¹⁸F]DCFBC. Since radiosynthesis so far was suffering for rather poor yields novel procedures for the automated radiosyntheses of [¹⁸F]PSMA-1007 have been developed. We herein report on both the two-step and the novel one-step procedures, which have been performed on different commonly used radiosynthesisers. Using the novel one-step procedure the [¹⁸F]PSMA-1007 was produced in good radiochemical yields ranging from 30-70 % and synthesis times less than 55 minutes. Furthermore, upscaling to product activities up to 50 GBq per batch was successfully conducted. All batches passed quality control according to European Pharmacopoeia standards. Therefore, we were able to disclose a new, simple and at the same time high yielding production pathway for the next generation PSMA radioligand [¹⁸F]PSMA-1007. Actually it turned out that the radiosynthesis is as easily realised as the well-known [¹⁸F]FDG synthesis and thus transferable onto all currently available radiosynthesisers. Using the new procedures, clinical daily routine can be sustainably supported in-house even in larger hospitals by a single production batch.

Background: Qazvin province has suffered a lot of natural disasters (earthquakes) for a long time. so, the establishment of the first industrial city in Iran, has always been a source of concern. One of these problems is the possibility of chlorine gas leaking from the chlorination system of drinking water and treatment plant the existing ones are on the health of the inhabitants of this region.Material and method: This analytical study was carried out in Novorossiysk district of Alborz in December 2012. Initially, chlorine gas leakage scenarios from these facilities were simulated by ALOHA and WISER software, and then using the Emergency Level System, according to the CCPS Consultative Center's Chemical Process Safety Advice, the Emergency Response Program was presented. Results: ALOHA software, in comparison with WISER software, has more precision to identify and address the consequences of chlorine gas leakage hazards and according to the simulation of this software in the event of a leak from the well and water resources unit at 8240 m from the area and at night 7520 meters will be affected. Due to the speed of delivering results through the WISER software, this software can be used at times when the operating speed is considered (incident time).Conclusion: According to the CCPS model, the emergency conditions were classified at levels 3 and 4, therefore, the relevant crisis management agencies (Qazvin Crisis Management Committee, Alborz City Health Center, Red Crescent and Firefighting Authority) should provide training maneuvers At Alborz city level, and informing people of cities and industrial companies, many efforts have been made to reduce human and environmental damage in case of possible leakage.

Sentinel lymph node dissection (sLND) using a magnetometer and superparamagnetic iron oxide nanoparticles (SPIONs) as a tracer was successfully applied in prostate cancer (PCa). Radioisotope-guided sLND combined with extended pelvic LND (ePLND) achieved better node removal, increasing the number of affected nodes or the detection of sentinel lymph nodes outside the established ePLND template. We determined the diagnostic value of additional magnetometer-guided sLND after intraprostatic SPION-injection in high-risk PCa. This retrospective study included 104 high-risk PCa patients (PSA >20 ng/ml and/or Gleason score ≥8 and/or cT2c) from a prospective cohort who underwent radical prostatectomy with magnetometer-guided sLND and ePLND. The diagnostic accuracy of sLND was assessed using ePLND as a reference standard. Lymph node metastases were found in 61 of 104 patients (58.7%). sLND had a 100% diagnostic rate, 96.6% sensitivity, 95.6% specificity, 96.6% positive predictive value, 95.6% negative predictive value, 3.4% false negative rate, and 4.4% false positive rate (detecting lymph node metastases outside the ePLND template). These findings demonstrate the high sensitivity and additional diagnostic value of magnetometer-guided sLND, exceeding that of ePLND through the individualized extension of PLND or the detection of sentinel lymph nodes / lymph node metastases outside the established node template in high-risk PCa.

: Carcinoma-associated fibroblasts (CAFs) are highly accumulated in the tumor surrounding stroma of primary epithelial ovarian cancer (OC). CAFs exert important functions for the vascularization, growth and progression of ovarian tumor cells. However, no attention has been shown to their origin so far. It has been mainly assumed that CAFs in primary OC arise from the activation of resident fibroblasts. Here, we compare CAFs with ovarian location to CAFs found in peritoneal implants from patients with advanced OC. Our findings show that CAFs from primary tumors and peritoneal metastases share the expression of mesothelial-related markers. Therefore, as in peritoneal carcinomatosis, CAFs in primary ovarian carcinomas could be originated via a mesothelia-to-mesenchymal transition (MMT) process. The detection of mesothelial-derived CAFs in tumors confined to the ovary and associated biomarkers could be the key to early detection of peritoneal spread in affected patients.

Patients with glioblastoma (GB), a highly aggressive brain tumor, have a median survival of 14.6 months following neurosurgical resection with adjuvant chemoradiotherapy. Quiescent GB cancer stem cells (CSCs) invariably cause local recurrence. These GB CSCs that can be identified by embryonic stem cell markers express components of the renin-angiotensin system and are associated with circulating CSCs. Despite the presence of circulating CSCs, GB rarely develops distant metastasis outside the central nervous system. This paper reviews the current literature on GB growth inhibition in relation to CSCs, circulating CSCs, the RAS and the novel therapeutic approach by repurposing drugs that target the renin-angiotensin system to improve overall symptom-free survival and maintain quality of life.

This study presents a platform for ex-vivo detection of cancer nodules, addressing automation of medical diagnoses in surgery and associated histological analyses. The proposed approach takes advantage of the property of cancer to alter the mechanical and acoustical properties of tissues, because of changes in stiffness and density. A force sensor and an ultrasound probe were combined to detect such alterations during force-regulated indentations. To explore the specimens, regardless of their orientation and shape, a scanned area of the test sample was defined using shape recognition applying optical background subtraction to the images captured by a camera. The motorized platform was validated using seven phantom tissues, simulating the mechanical and acoustical properties of ex-vivo diseased tissues, including stiffer nodules that can be encountered in pathological conditions during histological analyses. Results demonstrated the platform’s ability to automatically explore and identify the inclusions in the phantom. Overall, the system was able to correctly identify up to 90.3% of the inclusions by means of stiffness in combination with ultrasound measurements, paving pathway towards robotic palpation during intraoperative examinations.

Patients with pT1 high-grade (HG) bladder cancer (BC) and a very high risk of progression might benefit from immediate radical cystectomy (RC), but this option remains controversial. Validation of a standardized method to evaluate the extent of lamina propria (LP) invasion (with recognized prognostic value) in transurethral resections (TURBT) specimens is still needed. The Rete Oncologica Lombarda (ROL) system showed a high predictive value for progression after TURBT in recent retrospective studies. Our aim was to validate ROL system on a large mono-institutional prospective series of primary urothelial carcinomas. From 2016 to 2020, we adopted ROL for all patients with pT1 HG BC on TURBT. We employed a 1.0-mm threshold to stratify tumors in ROL1 and ROL2. A total of 222 pT1HGBC were analyzed. Median age was 74 years, with male predominance (73.8%). ROL was feasible in all cases: 91 cases were ROL1 (41%) and 131 ROL2 (59%). At a median follow up of 26.9 months (IQR 13.8-40.6), we registered 80 recurrences and 40 progressions. ROL was a significant predictor of tumor progression at both univariable (HR 3.53; CI 95% 1.56 – 7.99; p<0.01) and multivariable (HR 2.90; CI 95% 1.25 – 6.75; p=0.01) Cox regression analyses. At Kaplan-Meier estimates, ROL showed correlation with both PFS (p=0.0012) and RFS (p=0.0167). Our results confirmed the strong predictive value of ROL for progression on a large prospective series. We encourage the application of ROL for reporting the extent of LP invasion, substaging T1 HG BC, and improving risk tables for urological decision making.

Malignancy is a fatal disease with an increasing incidence with each passing year, and the early diagnosis of malignancy can significantly improve the cure rate of patients, which has profound implications for saving patients' lives. The changes of miRNA are closely related to the occurrence of malignant tumors. The expression of miRNA in many malignant tumors is obviously different and unique from that in normal tissues. In this study, a strategy for amplifying microRNA (miRNA) signal was designed using duplex specific nuclease (DSN), which was then combined with Peptide nucleic acid (PNA) probe hybridization technology to prepare a sensitive and efficient paper-based lateral flow biosensor (LFB) for the detection of pancreatic cancer (PC) associated microRNA-10b. The performance evaluation results of the LFB showed that the detection limit of miR-NA-10b is 5 nM/mL, and carries demonstrated well specificity, stability, reproducibility. The biosensor prepared in this paper can provide accurate and rapid detection of miRNA-10b. The detection results play a guiding role in the early diagnosis of PC. Meeting the clinical need for largescale screening of individuals at high risk of PC. Providing new avenues to achieve early mass screening in individuals at high risk of PC.

Tumor to stroma ratio is a highly debated prognostic factor in the management of several solid tumors and there is no universal agreement on its practicality. In our study we proposed to confirm or dismiss the hypothesis that a simple measurement of stroma quantity is an easy-to-use and strong prognostic tool. We have included 74 consecutive patients with colorectal cancer who underwent primary curative abdominal surgery. The tumors have been grouped into stroma-poor (stroma <10%), medium-stroma (between 10 and 50%) and stroma-rich (over 50%). The proportion of tumor stroma ranged from 5% to 70% with a median of 25%. Very few, only 6.8% of patients had stroma-rich tumors, 4% stroma-poor tumors and 89.2%tumors with a medium quantity of stroma. The proportion of stroma, at any cut-off, had no statistically significant influence on the disease specific survival. This can be explained by the low proportion of stroma-rich tumors in our patient group and the inverse correlation of stroma proportion with tumor grade. The real-life proportion of stroma-rich tumors and the complex nature of the stroma-tumor interaction has to be further elucidated.

Breast cancer is among the most common and fatal diseases for women, and no permanent treatment has been discovered. Thus, early detection is a crucial step to control and cure breast cancer that can save the lives of millions of women. For example, in 2020, more than 65% of breast cancer patients were diagnosed in early-stage of cancer, from whom all survived cancer. Although early detection is the most effective approach for cancer treatment, breast cancer screening conducted by radiologists is very expensive and time-consuming. More importantly, conventional methods of analyzing breast cancer images suffer from high false detection rates. Different breast cancer imaging modalities are used to extract and analyze the key features affecting diagnosis and treatment of breast cancer. These imaging modalities can be divided into subgroups such as mammograms, ultrasound, magnetic resonance imaging, histopathological images, or any combination of them. Radiologists or pathologists analyze images produced by these methods manually that leads to increase the risk of wrong decisions for cancer detection. Thus, utilization of new automatic methods to analyze all kinds of breast screening images to assist radiologists to interpret images is required. Recently, artificial intelligence (AI) has been widely utilized to automatically improve the early detection and treatment of different types of cancer, specifically breast cancer, thereby enhancing the survival chance of patients. Advances in AI algorithms, such as deep learning, and availability of datasets obtained from various imaging modalities have opened an opportunity to surpass limitations of current breast cancer analysis methods. In this article, we first review breast cancer imaging modalities, and their strengths and limitations. Then, we explore and summarize the most recent studies that employed AI in breast cancer detection using various breast imaging modalities. In addition, we report available datasets on the breast cancer imaging modalities which are important in developing AI-based algorithms and training deep learning models. In conclusion, this review paper tries to provide a comprehensive resource to help researchers working in breast cancer imaging analysis.

Background: Cell proliferation and the cell cycle are fundamental to tumor development, with mitosis playing a crucial role in cell division. Understanding the complexities of the cell cycle and mitosis is critical for cancer research, especially in the context of developing therapeutic strategies. Objective: This review highlights mitotic poisons as potential anti-cancer pharmacotherapeutics, particularly their structural and functional group diversity presenting opportunity for semi-synthesis of new derivatives with multi-target mechanisms relevant for cancer pharmacotherapeutics. Also, the review explores naturally occurring mitotic poisons and inhibitors of microtubule-dependent molecular motors as promising cancer pharmacotherapeutics. Methods: A comprehensive review of literature from 2004 to 2023 was conducted, covering studies on cell proliferation, mechanism of cell cycle regulation, mitosis, cytokinesis, and anti-cancer drug development. The published literature was collected primarily from PubMed, Scopus, Medline, Web of Science Core Collections, Google Scholar and other relevant scientific databases using keywords including but not limited to mitotic poisons and cancer, sources of mitotic poisons, mechanism of mitotic poisons, targets of mitotic poisons and structural diversity of mitotic poisons. The efficacy and limitations of various mitotic poisons and their impact on different cancer types were examined. Recent advancements in targeted therapeutic interventions for various cancers were also explored. Results: The effectiveness and limitations of mitotic poisons, including Taxanes, Epothilones, Colchicine, Vinca alkaloids, Berberine, Laulimalide, and Pseudolaric acid B, were highlighted. Drugs targeting mitotic kinases such as CDKs, Aurora kinases, PLK1, and WEE1 inhibitors were reported. Inhibiting kinesin motor proteins such as Eg5 and KIF15 to interfere with spindle formation and cell division were discussed, along with specific genomic alterations in KIF genes and the discovery of KIFC1 as potential for future research and drug development. Conclusion: Targeting microtubules and mitotic kinases, along with inhibiting kinesin motor proteins, show promise for cancer pharmacotherapeutics. The combination of targeted therapies, patient stratification based on biomarkers (such as low alpha-1 acid glycoprotein and high p63 expression), and exploration of alternative natural sources of mitotic poisons and analogues can significantly advance cancer pharmacotherapy to improve patient outcomes.

Expression of miR-21 has been found to be altered in almost all types of cancers and it has been classified as an oncogenic microRNA. In addition, expression of tumor suppressor gene RECK is associated with miR-21 overexpression in high-grade cervical lesions. In the present study we analyze the role of miR-21 in RECK gene regulation in cervical cancer cells. To identify the downstream cellular target genes of upstream miR-21, we silenced endogenous miR-21 expression using siRNAs. We analyzed the expression of miR-21 and RECK, as well as functional effects on cell proliferation and migration. We found that in cervical cancer cells there was an inverse correlation between miR-21 expression and RECK mRNA and protein expression. SiRNAs to miR-21 increased luciferase reporter activity in construct plasmids containing the RECK-3′-UTR microRNA response elements MRE21-1, MRE21-2, and MRE21-3. The role of miR-21 in cell proliferation was also analyzed and cancer cells transfected with siRNAs exhibited a markedly reduced cell proliferation and migration. Our findings indicate that miR-21 post-transcriptionally down-regulates the expression of RECK to promote cell proliferation and cell migration inhibition in cervical cancer cell survival. Therefore, miR-21 and RECK may be potential therapeutic targets in gene therapy for cervical cancer.

An observational cohort study of patients diagnosed with endometrial cancer (EC) stage IA G1, or atypical endometrial hyperplasia (AHE), undergoing organ-preserving treatment, was conducted. Objective of the study: to determine CDO1, PITX2, and CDH13 gene methylation levels in early endometrial cancer and atypical hyperplasia specimens obtained before organ-preserving treatment in the patients with adequate response and with insufficient response to hormonal treatment. Materials and methods: 41 endometrial specimens obtained during diagnostic uterine curettage in women with EC (n=28) and AEH (n=13), willing to preserve reproductive function, were studied; 18 specimens of endometrial cancer IA stage G1 from peri- and early postmenopausal women (comparison group) were included in the study. The control group included 18 endometrial specimens from healthy women obtained by diagnostic curettage for missed abortion and/or intrauterine adhesions. Methylation levels were analyzed using the modified MS-HRM method. Results: All 13 women with AEH had complete response (CR) to medical treatment. In the group undergoing organ-preserving treatment for uterine cancer IA stage G1 (n=28), 14 patients had complete response (EC CR group) and 14 had not (non-CR). It was found that all groups had statistically significant differences in CDO1 gene methylation levels with the control group (p<0.001) except for the EC CR group (p=0.21). The p-value of difference between EC CR and EC non-CR groups was <0.001. The differences in PITX2 gene methylation levels between the control and study groups were also significantly different (p<0.001), except for AEH group (p=0.21). For the difference between EC CR and EC non-CR groups, the p-value was 0.43. For CDH13 gene methylation levels, statistically significant differences were found between the control and EC non-CR groups (p<0.001), and the control and EC comparison groups (p=0.005). When comparing the EC CR group with EC non-CR group, the p-value for this gene was <0.001. Simultaneous assessment of CDO1 and CDH13 genes methylation allowed to accurately distinguish between EC CR and EC non-CR groups (AUC=0.96). Conclusion: Assessment of CDO1 and CDH13 gene methylation in endometrial specimens from patients with endometrial cancer (IA stage G1), planned for medical treatment, can predict the treatment outcome.

Homologous recombination deficiency (HRD) has become an important prognostic and predictive biomarker for patients with high-grade serous ovarian cancer who may benefit from poly-ADP ribose polymerase inhibitors (PARPi) and platinum-based therapies. HRD testing provides relevant information to personalize patients’ treatment options, and it has been progressively incorporated in diagnostic laboratories. In this study, we evaluated the feasibility of in-house HRD testing deployable in a diagnostic clinical setting, comparing results from two commercially available next-generation sequencing (NGS)-based tumor tests (SOPHiA DDMTM HRD Solution and AmoyDx HRD Focus Panel) with the reference assay from Myriad MyChoice CDx. A total of 85 ovarian cancer samples were subjected to HRD testing. An overall strong correlation was observed across the three assays evaluated, regardless of the different underlying methods employed to assess genomic instability, with the highest pairwise correlation between Myriad and SOPHiA (R=0.87, p-value=3.39x10-19). The comparison of the assigned HRD status to the reference Myriad’s test revealed a positive predictive value (PPV) and negative predictive value (NPV) of 90.9% and 96.3% for SOPHiA’s test, while AmoyDx’s test achieved 75% PPV and 100% NPV. This is the largest HRD testing evaluation using different methodologies and provides a clear picture of the robustness of NGS-based tests currently offered in the market. Our data show that the implementation of in-house HRD testing in diagnostic laboratories is technically feasible and it can be reliably performed with commercial assays. Also, the turnaround time is compatible with clinical needs, being an ideal alternative to offer to a broader number of patients, while still maintaining high-quality standards at more accessible price tiers.

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

Abstract: Cancer cells are originated by normal cells and with those share the need to be fed. Metabolic reprogramming in cancer cells is not yet fully understood although there is a vast literature suggesting that huge amounts of both energy and substrates are require for synthesis of components of new neoplastic cells so that any macronutrient may be efficiently utilized. Recently, in vitro data show that EAA supplementation promoted colon cancer cells apoptosis by enhanced autophagy. Therefore, in this study we tested in vivo the effects of matched macronutrients standard laboratory diet (control) versus EAA rich modified diet (EAArmd) in mice injected with colon cancer cells. Results of the first set of 12 animals, 6 controls and 6 EAArmd-fed, showed that controls mice develop cancer volume cancers 5 times larger and heavier than EAArmd-fed. If confirmed, these results would open new scenarios for the cancer integrate therapies.

Histone demethylases, enzymes responsible for removing methyl groups from histone proteins, have emerged as critical players in regulating gene expression and chromatin dynamics, thereby influencing various cellular processes. LSD2 and LSD1 have attracted considerable interest among these demethylases because of their associations with cancer. However, while LSD1 has received significant attention, LSD2 has not been recognized to the same extent. In this study, we conduct a comprehensive comparison between LSD2 and LSD1, with a focus on exploring LSD2's implications. While both share structural similarities, LSD2 possesses unique features. Functionally, LSD2 shows diverse roles, particularly in cancer, with tissue-dependent roles. Additionally, LSD2 extends beyond histone demethylation, impacting DNA methylation and DNA damage repair pathways. This study underscores the distinct roles of LSD2, providing insights into their contributions to cancer and other cellular processes.

This study assesses the efficacy of a microwave colonoscopy algorithm to detect colorectal cancer precursors or polyps in an ex-vivo human colon model. The algorithm works with a device composed of a cylindrical ring-shaped switchable antenna array, which can be attached to the tip of a conventional colonoscope as an accessory. The accessory is connected to an external processing unit that generates an acoustic signal when a polyp is detected. Nowadays, 22% of polyps go undetected with conventional colonoscopy and the risk of cancer after a negative colonoscopy can be up to 7.9%. Fifteen ex-vivo freshly excised human colons with cancer (n=12) or polyps (n=3) were examined with the microwave-assisted colonoscopy system simulating a real colonoscopy exploration. Successive measurements of the colon were taken with the microwave-based colonoscopy device and processed with a microwave imaging algorithm. After the experiment, the dielectric properties of the specimens were measured with a coaxial probe and finally the samples underwent a pathology analysis. The results show that all the neoplasms were detected with a sensitivity of 100% and specificity of 87.4%.

The prompt and accurate diagnosis of breast lesions, including the distinction between cancer, non-cancer, and suspicious cancer, plays a crucial role in the prognosis of breast cancer. In this paper, we introduce a novel method based on feature extraction and reduction for detection of breast cancer in mammography images. First, we extract features from multiple pre-trained convolutional neural network (CNN) models, and then concatenate them. The most informative features are selected based on their mutual information with the target variable. Subsequently, the selected features can be classified using a machine learning algorithm. We evaluate our approach using four different machine learning algorithms, and our results demonstrate that the neural network-based classifier yields an accuracy as high as 92% for the RSNA dataset which is a new dataset that provides two views and additional features such as age. We compare our proposed algorithm with state-of-the-art methods and demonstrate its superiority, particularly in terms of accuracy and sensitivity. For the MIAS dataset, we achieve an accuracy as high as 94.5%, and for the DDSM dataset, an accuracy of 96% is attained. These results highlight the effectiveness of our method in accurately diagnosing breast lesions and surpassing existing approaches.

(1) Background: Patients with type 2 diabetes mellitus (T2DM) are at higher risk of cancer but how these two diseases associate is still debated. The goal was the assessment of the overall incidence of cancer among patients with newly diagnosed T2DM in Hungary. Summarizing, incident T2DM is associated with a significantly higher overall risk of incident cancer, with a reverse correlation of age. Newly registered T2DM patients were suggested to be screened for cancer within 6 months. (2) Methods: A nationwide, retrospective, longitudinal study was performed using a Hungarian database. The incident T2DM and diabetes free Hungarian population were included in the study. The primary endpoints were the overall and site-specific incidence and annual percentage change of the incidence of cancer in both populations. (3) Results: The overall incidence of cancer in patients amounted to 29.4/1000 and 6.6/1000 with or without T2DM, respectively, and the OR (95%CI) of cancer of the T2DM group was 4.32 (4.14-4.53), p<0.0001. The risk of having cancer was age-dependent, having the highest odd in the age group 18-39. The incidence of cancer was declining in the non-diabetic but was unchanged in T2DM population. The average lag time of diagnosing a cancer after the detection of T2DM was 3.86 months.; (4) Conclusions: Iincident T2DM is associated with a significantly higher overall risk of incident cancer, with a reverse correlation of age. Newly registered T2DM patients were suggested to be screened for cancer within 6 months.

Aim. To study the processes of lipid peroxidation and the activity of antioxidant defense enzymes depending on the chemiluminescent activity of neutrophilic granulocytes in patients with gastric cancer associated with H. pylori infection, depending on the stage. Materials and methods. 39 patients with stage I-II gastric cancer and 30 patients with stage III-IV gastric cancer were examined. The study of the chemiluminescent activity of neutrophilic granulocytes was carried out, the parameters of the lipid peroxidation system and antioxidant protection in plasma were determined using the spectrophotometric method. Statistical data processing was performed using the Statistica 7.0 software package (StatSoft, USA). Results. In patients with gastric cancer associated with H. pylori infection, regardless of stage, the proportion of neutrophilic granulocytes with normal activity does not exceed 1/3 of the total number of patients, the remaining 2/3 of patients have an altered chemiluminescent activity of neutrophilic granulocytes: in patients with gastric cancer by I -II stage of the disease, the majority revealed a reduced function of neutrophilic granulocytes, and in patients with gastric cancer stage III-IV of the disease, the majority showed increased chemiluminescent activity of neutrophilic granulocytes. In all patients with gastric cancer associated with H. pylori infection, regardless of the stage of the disease, an increase in lipid peroxidation processes with activation of antioxidant defense enzymes was detected. Conclusion. In all patients with gastric cancer associated with H. pylori infection, regardless of the stage of the disease, an increase in lipid peroxidation processes with activation of antioxidant defense enzymes was detected. At the same time, there are no statistically significant differences between the indicators of the system lipid peroxidation - antioxidant protection depending on the stage of gastric cancer and the chemiluminescent activity of neutrophilic granulocytes, which probably indicates that all reactive oxygen species produced by neutrophilic granulocytes in the respiratory burst are consumed locally, minimally affecting the development of oxidative stress in the blood plasma.

Background: MRI-guided prostate biopsies from visible tumor-specific lesions (TBx) can be used to diagnose clinically significant carcinomas (csPCa) requiring treatment more selectively than conventional systematic biopsies (SBx). Ex vivo fluorescence confocal microscopy (FCM) is a novel technique that can be used to examine TBx prior to conventional histologic workup. Methods: TBx from 150 patients were examined with FCM on the day of collection. Preliminary findings were reported within 2 hours of collection. The results were statistically compared with the final histology. Results: 27/40 (68%) of the csPCa were already recognized in the intraday FCM in accordance with the results of conventional histology. Even non-significant carcinomas (cisPCa) of the intermediate and high-risk groups (PSA > 10 or 20 ng/ml) according to conventional risk stratifications were reliably detectable. In contrast, small foci of cisPCa were often not detected or were difficult to distinguish from reactive changes. Conclusion: The rapid reporting of preliminary FCM findings helps reduce the psychological stress on patients an can improve the clinical management of csPCa. Additional SBx can be avoided in individual cases, leading to lower rates of complications and scaring in the future surgical area. Additional staging examinations can be arranged without losing time. FCM represents a promising basis for future AI-based diagnostic algorithms.

Effective biomarkers are essential to the early diagnosis of non-small cell lung cancer (NSCLC). Herein, a retrospective study of 49 newly diagnosed and recurrent NSCLC patients, 31 patients with benign pulmonary disease and 24 healthy volunteers was conducted, to evaluate the diagnostic value of circulating rare cells for NSCLC. The expression of circulating tumor cells (CTCs) and circulating tumor-derived endothelial cells (CTECs) in peripheral blood were measured by subtraction enrichment-immunostaining-fluorescence in situ hybridization (SE-iFISH). The level of CTCs (P＜0.001) and CTECs (P＜0.001) was significantly higher in NSCLC group than that in benign pulmonary disease group. The proportion of small CTCs (P＜0.001) and CTECs (P＜0.0001) significantly increased from benign lung disease individuals to NSCLC patients. The AUC of ROC curves of total CTCs and CTECs were 0.815 (95%CI: 0.722~0.907), 0.739 (95%CI: 0.618~0.860), respectively. The cut-off values for discriminating NSCLC with benign lung disease patients were total CTCs 11.5 units/6ml and total CTECs 10.5 units/6ml, with sensitivity and specificity being 67.3% and 83.9%, 77.6% and 77.4%, respectively. When CTCs and CTECs were combined, predictive value significantly increased to 82.6% as measured by the area under the curve. Small CTCs and triploid CTCs had high positive predictive value (PPV) and positive likelihood ratio (LR+) of the diagnosis of NSCLC in early stage. CTCs and CTECs can not only be used as new biomarkers for the diagnosis of NSCLC, but can also improve diagnostic performance of the early stage NSCLC. Moreover, the combined examination of CTCs and CTECs is be superior to the single.

Exosome-based therapy has emerged as a promising strategy for addressing diverse disorders, indicating the need for further exploration of the potential therapeutic effects of the exosome cargos. This study introduces "enhanced exosomes," a novel type of exosomes developed through a novel cell culture system. These specific exosomes may become potent therapeutic agents for treating ovarian disorders. In this study, we conducted a comparative analysis of the protein and miRNA cargo compositions of enhanced exosomes and naïve exosomes. Our findings revealed distinct cargo compositions in enhanced exosomes, featuring upregulated proteins such as EFEMP1, HTRA1, PAM, RSU1, and SDF4, suggesting their potential for treating ovarian disorders. MicroRNA profiling revealed that miR-1-3p, miR-103a-3p, miR-122-5p, miR-1271-5p, miR-133a-3p, miR-184, miR-203a-3p, and miR-206 are key players in regulating ovarian cancer and chemosensitivity by affecting cell cycle progression, cell proliferation, and cell development. We examined polycystic ovary syndrome and premature ovarian insufficiency and identified altered expression of various miRNAs, such as miR-106a-5p, miR-130b-5p, and miR-130b-3p, for diagnostic insights. This study highlights the potential of enhanced exosomes as new therapeutic agents for women's reproductive health, offering a detailed understanding of the impact of their cargo on ovarian disorders.

Liquid biopsy is a rapidly emerging field which involves the minimal/non-invasive assessment of signature somatic mutations through analysis of circulating tumor DNA (ctDNA) shed by tumor cells in bodily fluids. The broad, unmet need for liquid biopsy lung cancer detection is the lack of multiplex platform that can detect a mutation panel of lung cancer genes using minimum amount of sample, especially for ultra-short ctDNA (usctDNA). Here we developed a non-PCR and non-NGS-based single droplet based multiplexing microsensor technology “Electric Field-Induced Released and Measurement (EFIRM) Liquid Biopsy” (m-eLB) for lung can-cer-associated usctDNA. The m-eLB provides multiplexable assessment of usctDNA within a single droplet of biofluid in only one well of micro-electrodes, as each electrode coated with dif-ferent probes for the ctDNA. In this m-eLB prototype, it demonstrates accuracy for 3 tyrosine ki-nase inhibitor related EGFR target sequences in synthetic nucleotides. The accuracy for the multi-plexing assay has an AUC of 0.98 for L858R, Ex19del, AUC of 0.94 for Ex19 deletion and AUC of 0.93 for T790M. By combining the 3 EGFR assay together, the AUC was 0.97 for the multiplexing assay.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

Wilms tumor (WT), the most prevalent type of renal cancer in children, exhibits overall survival rates exceeding 90%. However, chemotherapy resistance, which occurs in approximately 10% of WT cases, is a major challenge for the treatment of WT, particularly for advanced-stage patients. In this study, we aimed to discover potential mutation markers and drug targets associated with chemotherapy resistance in advanced stage WT. We performed exome sequencing to detect somatic mutations and molecular targets in 43 WT samples, comprising 26 advanced stage WTs, of which 7 cases are chemotherapy-resistant. Our analysis revealed four genes (ALPK2, C16orf96, PRKDC, and SVIL) that correlated with chemotherapy resistance and reduced disease-free survival in ad-vanced-stage WT. Additionally, we identified driver mutations in 55 genes within the chemo-therapy-resistant group, including 14 druggable cancer driver genes. Based on the mutation profile of the resistant WT samples, we propose potential therapeutic strategies involving platinum-based agents, PARP inhibitors, and antibiotic/antineoplastic agents. Our findings provide insights into the genetic landscape of WT and offer potential avenues for targeted treatment, particularly for patients with chemotherapy resistance.

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

Conventional cancer clinical trials can be time-consuming and expensive, often yielding results with limited applicability to real-world scenarios and presenting challenges for patient participation. Real-world data (RWD) studies offer a promising solution to address evidence gaps and provide essential information about the effects of cancer treatments in real-world settings. Defining RWD based on its original intent, which is the collection of data at the point of care for clinical purposes, can distinguish it from conventional clinical trial data. RWD can be generated using experimental designs that resemble those used in conventional clinical trials, but with several advantages, such as improved efficiency and a better balance between internal and external validity. RWD can support pharmacovigilance, insights into disease progression, and the development of external control groups. Prospective RWD collection enables evidence generation based on pragmatic clinical trials (PCTs) that support randomized study designs and expand clinical research to the point of care. To ensure the quality of real-world studies, it is crucial to implement auditable data abstraction methods and develop new incentives to capture clinically relevant data electronically at the point of care. The treatment landscape is constantly evolving, with the integration of front-line immune checkpoint inhibitors (ICIs), either alone or in combination with chemotherapy, affecting subsequent treatment lines. Real-world effectiveness and safety in underrepresented populations, such as the elderly, patients with poor performance status (PS), hepatitis, or human immunodeficiency virus-infected patients, are still largely unexplored. Similarly, the cost-effectiveness and sustainability of these innovative agents are important considerations in the real world.

Curcumin, found in the rhizome of turmeric, has extensive therapeutic promises via its antioxidant, anti-inflammatory, and antiproliferative properties. Preclinical in vitro and in vivo data have shown curcumin to be an effective treatment for multiple cancers. These effects are drived by curcumin's ability to induce G2/M cell cycle arrest, induction of autophagy, activation of apoptotic pathways, disruption of molecular signaling, inhibition of invasion and metastasis, and by increasing the efficacy of existing chemotherapeutics. Here we focused on the hormetic behaviour of curcumin. Frequently, low doses of toxins and other stressors not only are harmless but also activate an adaptive stress whereas high dose activates acute responses like autophagy and cell death. This phenomenon is referred to as hormesis. Many molecules that cause cell death elicite an initial autophagic step that is a cytoprotective mechanism relying on elimination of dysfunctional structures intracellular, notably by mitophagy. This phenomenon is considered as a primarily protective mechanism against stressors. At higher doses, cells undergo mitochondrial outer membrane permeabilization due to calcium release from the endoplasmic reticulum and die. Herein, we address the complex crosstalk between the induced mitochondrial biogenesis, mitochondrial destabilization accompanied by mitophagy and cell death that can also be at play.

Background: Factors that could predict which patients will benefit from Immune Checkpoint Inhibitors (ICIs) are not fully understood. This study aimed to investigate the prognostic value of KRAS biomarker in patients with advanced non-small cell lung cancer (NSCLC) in relation to clinical characteristics, treatment response and PDL1 expression. Patients and methods: The study included 100 patients with NSCLC who received immunotherapy with or without chemotherapy as 1st line treatment. In biopsy samples, the PDL1 biomarker expression rate and somatic mutations of KRAS gene were determined. Results: The mean age of the patients was 67 ± 8 years. Patients were all male and 66% were found with adenocarcinoma whereas 34% with squamous cell carcinoma. The KRAS G12C mutation was found with the highest percentage (73%). In the Kaplan-Meier survival analysis, patients with PDL1>49% in combination with a negative KRAS result had a median survival of 40 months compared to patients with a positive KRAS result (9 months, p<0.05). In addition, patients diagnosed with adenocarcinoma, PDL1<49% and negative KRAS result had a median survival of 39 months compared to patients with a positive result (28 months, p<0.05). Conclusions: Our study suggests that the presence of KRAS mutations in advanced NSCLC patients has a poor prognostic value, regardless of their PDL1 expression values, after receiving immunotherapy as first-line treatment.

Biological nanoparticles (NPs), such as extracellular vesicles (EVs), exosome-mimetic nanovesicles (EMNVs) and nanoghosts (NGs), are perspective non-viral delivery vehicles for all types of therapeutic cargo. Biological NPs are renowned for their exceptional biocompatibility and safety, alongside their ease of functionalization, but a significant challenge arises when attempting to load therapeutic payloads, such as nucleic acids (NAs). One effective strategy involves fusing biological NPs with liposomes loaded with NAs, resulting in hybrid carriers that offer the benefits of both biological NPs and the capacity for high cargo loads. Despite their unique parameters, one of the major issues of virtually any nanoformulation is the ability to escape degradation in the compartment of endosomes and lysosomes which determines the overall efficiency of nanotherapeutics. In this study, we fabricated all major types of biological and hybrid NPs and studied their response to acidic environment observed in endolysosomal compartment. In this study, we show that EMNVs display increased protonation and swelling relative to EVs and NGs in an acidic environment. Furthermore, the hybrid NPs exhibit an even greater response compared to EMNVs. Short-term incubation of EMNVs in acidic pH corresponding to late endosomes and lysosomes again induces protonation and swelling, whereas hybrid NPs are ruptured, resulting in the decline of their quantities. Our findings demonstrate that in an acidic environment, there is enhanced rupture and release of vesicular cargo observed in hybrid EMNVs that are fused with liposomes compared to EMNVs alone. This was confirmed through PAGE electrophoresis analysis of mCherry protein loaded into nanoparticles. In vitro analysis of NPs colocalization with lysosomes in HepG2 cells demonstrated that EMNVs mostly avoid endolysosomal compartment whereas hybrid NPs escape it over time. To conclude, (1) hybrid biological NPs fused with liposomes appear more efficient in the endolysosomal escape via the mechanism of proton sponge associated with scavenging of protons by NPs, influx of counterions and water, and rupture of endo/lysosomes, but (2) EMNVs are much more efficient than hybrid NPs in actually avoiding endolysosomal compartment in human cells. These results reveal biochemical differences across four major types of biological and hybrid NPs, and indicate that EMNVs are more efficient in escaping or avoiding endolysosomal compartment.

Alterations in the carnitine shuttle system may be an indication of the presence of cancer. As such, in-depth analyses of this pathway in different malignant tumors could be important for the detec-tion and treatment of this disease. The current study aims to assess the profiles of carnitine and acylcarnitines in gliomas with respect to their grade, the presence of isocitrate dehydrogenase (IDH) mutations, and 1p/19q co-deletion. Brain tumors obtained from 19 patients were sampled on-site using solid-phase microextraction (SPME) immediately following excision. Analytes were desorbed and then analyzed via liquid chromatography-high resolution mass spectrometry. The results showed that SPME enabled the extraction of carnitine and 22 acylcarnitines. An analysis of the correlation factor revealed presence of two separate clusters: short-chain and long chain car-nitine esters. Slightly higher carnitine and acylcarnitine concentrations were observed in the higher malignancy tumor samples (high vs low grade), and in those samples with worse projected clinical outcomes (without vs with IDH mutation; without vs with 1p/19q co-deletion). Thus, the proposed chemical biopsy approach offers a simple solution for on-site sampling that enables sample preservation, thus supporting comprehensive multi-method analyses.

Enzalutamide is a second-generation androgen-receptor inhibitor that increases overall survival (OS) rates in patients with metastatic castration-resistant prostate cancer (mCRPC). This study evaluates the efficacy of circulating tumor cell (CTC) status as a prognostic biomarker after enzalutamide administration. A retrospective subgroup analysis and prognostic survey of 43 patients with mCRPC and bone metastases, treated in Juntendo University-affiliated hospitals from 2015–2022, were conducted. Patients were treated with 160 mg enzalutamide daily. CTC analyses on blood samples were performed regularly before and every three months post-treatment. Relationship between the patients' clinical factors and the OS rate was analyzed using the log-rank test; the median OS was 37 months. Patients with no detected CTCs at baseline showed significantly longer OS than those with CTCs at baseline. Furthermore, patients showing negative reversion of CTCs during enzalutamide treatment had significantly longer OS than patients with CTC-positive continuation. Two biomarkers–higher hemoglobin at baseline and achieving negative-reversion of CTCs–were significantly associated with prolonged OS. This study suggests that patients achieving CTC-negative reversion during treatment for mCRPC with bone metastases exhibit improved long-term OS. Chronological measurement of CTC status might be clinically useful in treatment of mCRPC.

Adenoviruses (Ads) have been extensively manipulated for the development of cancer selective replication, leading to cancer cell death or oncolysis. Clinical studies using E1-modified oncolytic Ads have shown that this therapeutic platform was safe, but with limited efficacy, indicating the necessity of targeting other viral genes for manipulation. To improve the therapeutic efficacy of oncolytic Ads, we treated the entire Ad genome repeatedly with UV-light and have isolated AdUV which efficiently lyses cancer cells as reported previously [1]. In this report, we show that no mutations were observed in the early genes (E1 or E4) of AdUV while several mutations were observed within the Ad late genes which have structural or viral DNA packaging functions. This study also reported the increased release of AdUV from cancer cells. In this study, we found that AdUV inhibits tumor growth following intratumoral injection. These results indicate the potentially significant role of the viral late genes, in particular the DNA packaging genes, to enhance Ad oncolysis.

Breast cancer is a significant health issue across the world. Breast cancer is the most widely-diagnosed cancer in women; early-stage diagnosis of disease and therapies increase patient safety. This paper proposes a synthetic model set of features focused on the optimization of the genetic algorithm (CHFS-BOGA) to forecast breast cancer. This hybrid feature selection approach combines the advantages of three filter feature selection approaches with an optimize Genetic Algorithm (OGA) to select the best features to improve the performance of the classification process and scalability. We propose OGA by improving the initial population generating and genetic operators using the results of filter approaches as some prior information with using the C4.5 decision tree classifier as a fitness function instead of probability and random selection. The authors collected available updated data from Wisconsin UCI machine learning with a total of 569 rows and 32 columns. The dataset evaluated using an explorer set of weka data mining open-source software for the analysis purpose. The results show that the proposed hybrid feature selection approach significantly outperforms the single filter approaches and principal component analysis (PCA) for optimum feature selection. These characteristics are good indicators for the return prediction. The highest accuracy achieved with the proposed system before (CHFS-BOGA) using the support vector machine (SVM) classifiers was 97.3%. The highest accuracy after (CHFS-BOGA-SVM) was 98.25% on split 70.0% train, remainder test, and 100% on the full training set. Moreover, the receiver operating characteristic (ROC) curve was equal to 1.0. The results showed that the proposed (CHFS-BOGA-SVM) system was able to accurately classify the type of breast tumor, whether malignant or benign.

Background: Several hereditary-familial syndromes associated with various types of tumors have been identified to date, evidencing that hereditary cancers caused by germline mutations account for 5-10% of all tumors. Advances in genetic technology and the implementation of Next Generation Sequencing (NGS) have accelerated the discovery of several susceptibility cancer genes, allowing the detection of cancer-predisposing mutations in a larger number of cases. The aim of this study is to highlight how the application of an NGS-multi gene panel to a group of oncological patients subsequently leads to the improvement of healthy pathogenic variants/likely pathogenic variants (PVs/LPVs) carriers' identification and prevention of the disease in these cases. Methods: Starting from a total of 110 cancer patients carrying PVs/LPVs in genes involved in cancer susceptibility detected by a customized NGS panel of 27 cancer-associated genes, we enrolled 250 healthy collateral family members from January 2020 to July 2022. The specific PVs/LPVs identified in each proband were tested in healthy collateral family members by Sanger sequencing. Results: 131 out of the 250 cases (52%) weren’t carriers of the mutation detected in the affected relative, while 119 were carriers. Of these, 81/250 patients carried PVs/LPVs on BRCA1/2 (33%), 35/250 harbored PVs/LPVs on other genes beyond BRCA1 and BRCA2 (14%), and 3/250 (1%) were PVs/LPVs carriers both on BRCA1/2 and on another susceptibility gene. Conclusion: Our results show that the analysis of BRCA1/2 genes only would have resulted in a missed diagnosis in a number of cases and in the lack of prevention of the disease in a considerable percentage of healthy carriers with a genetic mutation (14%).

Currently, skin cancer is the most commonly diagnosed form of cancer in humans and is one of the leading causes of death in patients with cancer. Biopsy methods are an invasive research method and are not always available for primary diagnosis. Imaging methods have low accuracy and depend on the experience of the dermatologist. Artificial intelligence technologies can match and surpass visual analysis methods in accuracy, but they have the risk of a false negative response when a malignant pigmented lesion can be recognized as benign. One possible way to improve accuracy and reduce the risk of false negatives is to analyze heterogeneous data, combine different preprocessing methods, and use modified loss functions to eliminate the negative impact of unbalanced dermatological data. The paper proposes a multimodal neural network system with a modified cross-entropy loss function that is sensitive to unbalanced heterogeneous dermatological data. The accuracy of recognition in 10 diagnostically significant categories for the proposed system was 85.19%. The novelty of the proposed system lies in the use of cross-entropy loss when training the modified function with the help of weight coefficients. The introduction of weighting factors has reduced the number of false negative forecasts, as well as improved accuracy by 1.02-4.03 percentage points compared to the original multimodal systems. The introduction of the proposed multimodal system as an auxiliary diagnostic tool can reduce the consumption of financial and labor resources involved in the medical industry, as well as increase the chance of early detection of skin cancer.

Background Homologous recombination deficiency (HRD) evolved into a major diagnostic marker in high grade ovarian cancer (HGOC) predicting the response to poly (Adenosine diphosphate-ribose) polymerase inhibitors (PARPi) and also platinum-based therapy. In addition to HRD, the type of peritoneal tumor spread influences treatment response and patient survival; miliary type tumor spread has poorer predicted outcome than non-miliary type tumor spread. Methods Known methods for HRD assessment were adapted for our technical requirements and the Predictive-value Integrated Genomic Instability Score (PIGIS) for HRD assessment evolved as an outcome. PIGIS was validated in HGOC samples from 122 patients. We used PIGIS to analyze whether the type of tumor spread correlated with HRD status and whether this had an impact on survival. Results We demonstrated that PIGIS can discriminate HRD positive from HRD negative samples. Tumors with miliary tumor spread are HRD negative and have a very bad prognosis with a progression free survival (PFS) of 15.6 months and an overall survival (OS) of 3.9 years. However, HRD negative non-miliary spreading tumors in our cohort had a much better prognosis (PFS 35.4 months, OS 8.9 years), similar to HRD positive tumors (PFS 34.7 months, OS 8.9 years). Conclusions Our results indicate that in a predominantly PARPi naïve cohort the type of tumor spread might be a better predictor of response to platinum sensitivity than HRD. It remains to be determined, whether this also applies for sensitivity to PARPi.

Hereditary polyposis syndromes are rare but potentially devastating conditions which require multidisciplinary care from an early age. Societal guidelines serve as the framework for disease diagnosis, surveillance and treatment. Guidelines are based on expert opinion and ideally are evidence-based; however, recommendations may vary among different societies and can result in discordant care. This paper aims to summarize key differences in management based on societal guidelines for pediatric polyposis syndromes and identify some of the factors which may contribute to divergence in care.

Breast cancer is a leading cause of death among women. Conventional screening methods, such as mammography, and ultrasound diagnosis are expensive and have significant limitations. Digital Image Elasto Tomography (DIET) is a new noninvasive breast cancer screening system that has a potential to be a low cost and reliable breast cancer screening tool. It is based on modal analysis of the breast mass, and stereographic 3D image analysis to detect the stiffer abnormal tissues. However, camera sensor noise, especially Gaussian noise is a major source of Optical Flow (OF) error in this approach to tumor detection. This work studies the performance of different conventional filters, including the standard Gaussian filter tool to remove this noise and produce more robust screening results. A radical approach, Multiple Frame Noise Removal (MFNR) is proposed, for use in this type of medical image processing instead of a Gaussian filter or other typical image noise removal tools. Its a multiple frame noise removal method where Probability Density Function (PDF) of noise is extracted from the multiple images by characterizing the same pixel positions in multiple images. The noise becomes deterministic, and hence easily removed. The proposed algorithm was applied to a data set from 10 phantom breast tests with a prototype DIET system, and 10 in-vivo samples from healthy women. Comparisons were made to an optimal Gaussian filter form that is commonly used. Reductions in OF error using these digitally imaged data sets was used to compare performance. Refinement of the images for medical applications requires higher PSNR, which was successfully achieved by using MFNR algorithm. In this study, the algorithm was used to improve the imaging results of a DIET system. The conventional wisdom that states that noise removal and detail preservation are contrasting effects is

(1) Background: Among the chronic complications of type 2 diabetes mellitus, cancer became the leading cause of death in several countries. Our objective was the determination of whether prevalent type 2 diabetes mellitus is associated with a higher incidence of cancer. (2) Methods: This study is a nationwide analysis performed in Hungary. Study population was divided into a group with type 2 diabetes mellitus and into a non-diabetic group. The primary outcome was the risk related to overall cancer incidence. A key secondary outcome was the overall incidence of cancer in distinct study years. Further outcomes were the annual percent changes. (3) Results: The odds ratio related to the overall incidence of cancer was 2.50 (95% confidence interval: 2.46-2.55, P<0.0001) in patients with diabetes as related to controls. The odds ratio was higher in males than in females. The highest risk was found in the 18-39-year-old subgroup. The annual cancer incidence rate declined in controls, but not in patients with diabetes. Several types of cancer showed a decreasing tendency in non-diabetic controls.; (4) Conclusions: type 2 diabetes is associated with a higher risk of cancer. High risk in young patients with type 2 diabetes suggests that these young individuals should be considered as a risk group.

Nanosized drug delivery systems (DDS) have been studied as a novel strategy against cancer due to their potential to simultaneously decrease drug inactivation and systemic toxicity and increase passive and/or active drug accumulation within the tumor(s). Triterpenes are plant-derived compounds with interesting therapeutic properties. Betulinic acid (BeA) is a pentacyclic triterpene which has great cytotoxic activity against different cancer types. Herein, we developed a nanosized protein-based DDS of bovine serum albumin (BSA) as the drug carrier combining two compounds: doxorubicin (Dox) and the triterpene BeA using an oil-water-like micro-emulsion method. Spectrophotometric assays were performed to determine protein and drug concentrations in the DDS. The biophysical properties of these DDS were characterized using dynamic light scattering (DLS) and circular dichroism (CD) spectroscopy confirming nanoparticle (NP) formation and drug loading into the protein structure, respectively. The encapsulation efficiency was 77% for Dox and 18% for BeA. More than 50% of both drugs were released within 24 h, at pH 6.8, while less drug was released at pH 7.4 in this time period. Co-incubation viability assays of Dox and BeA alone for 24 h demonstrated synergistic cytotoxic activity in the low μM range against the non-small cell lung carcinoma (NSCLC) A549 cells. Viability assays of the BSA(Dox+BeA) DDS demonstrated a higher synergistic cytotoxic activity than the two drugs with no carrier. Moreover, confocal microscopy analysis confirmed cellular internalization of the DDS and nucleus accumulation of the Dox. We determined the mechanism of action of the BSA(Dox+BeA) DDS, confirming S-phase cell cycle arrest, DNA damage, caspase cascade activation, and downregulation of the epidermal growth factor receptor (EGFR) expression. This DDS has the potential to synergistically maximize the therapeutic effect of Dox and diminish chemoresistance induced by EGFR expression using a natural triterpene against NSCLC.

Epidemiological studies on micronutrient consumption have reported protective associations in the incidence and/or progression of various cancer types. Supplementation with some of these micronutrients has been analyzed, showing chemoprotection, low toxicity, antiproliferation, and the ability to modify epigenetic signatures in various cancer models. The following review inves-tigates the reported effects of micronutrient intake or supplementation in breast cancer progres-sion. A PubMed search was conducted with the keywords “micronutrients breast cancer progres-sion,” and the results were analyzed. The selected micronutrients were: Vitamins (A, C, D, and E), Folic Acid, metals (Cu, Fe, Se, and Zn), fatty acids, polyphenols, and iodine. The majority of in vitro models showed antiproliferative, cell cycle arrest, and antimetastatic effects for almost all the micronutrients analyzed, but these effects do not reflect animal or human studies. Only one clinical trial with Vitamin D and one pilot study with molecular iodine showed favorable overall survival and disease-free interval.

Gastroesophageal (GE) junction adenocarcinoma is an aggressive malignancy of growing incidence and is associated with public health issues such as obesity and GERD. Management has evolved over the last 2 decades to incorporate a multidisciplinary approach including endoscopic intervention, and neoadjuvant chemotherapy/ chemoradiation and minimally invasive or more limited surgical approaches. Surgical approaches include esophagectomy, total gastrectomy, and more recently proximal gastrectomy. This review analyzes the evidence for and applicability of these varied approaches in management as well areas of continued controversy and investigation.

The streptavidin and biotin interaction is one of the strongest non-covalent interactions in nature. As a result, this non-covalent interaction has been of great interest when it comes to biochemical assays, diagnosis of diseases, and cell-targeted drug delivery. Past research has proven that biotin-streptavidin is useful in biosensor development to improve the detection of a system when conjugated to nanoparticles. This study aims to prove that streptavidin-coated nanoparticles can be conjugated with biotinylated antibodies using the primary-secondary method to non-invasively detect adenocarcinoma in-vitro. While the use of nanoparticles is not uncommon to the diagnostics area of scientific research, the technique this research aims to investigate is a non-invasive one, utilizing the primary-secondary method. Specifically, the increased stability of fluorophores when bound to antibodies as opposed to nanoparticles directly can be indicative of the particles conjugated through the primary-secondary method’s ability to specifically bind to overexpressed transferrin receptors in the A549 cell line. In this paper, streptavidin-coated nanoparticles were conjugated with biotinylated anti-transferrin receptor antibodies and AlexaFluor-488 secondary antibodies were used to enable fluorescence-based detection. The efficiency of these particles were observed quantitatively through a plate reader and qualitatively through a fluorescence microscope. I demonstrated that these nanoparticles are able to specifically bind to the target proteins in this study. These findings contribute to the field of nanoparticle diagnostics and can be extended to different diseases caused by overexpression of proteins in the future. While this was conducted in-vitro, conjugates can be prepared to detect cancer in-vivo and can be tested with magnetic relaxometry in the future.

Colorectal cancer (CRC) is the third most commonly diagnosed cancer worldwide, and despite advances in treatment, survival rates are still low; therefore, the development of novel drugs is imperative. Acetylcorynoline (ACN) is derived from Corydalis ambigua. The effect of ACN on colon cancer is still unknown. Therefore, we investigated its potential effects. Our data showed that ACN inhibited cell viability and proliferation. Moreover, ACN induced apoptosis and cell cycle arrest by inhibiting cell growth. In the present study, we hypothesized that ACN regulates c-Myc through CNOT2 or MID1IP1. ACN reduced the protein expression of oncogenic genes, decreased c-Myc half-life, and rapidly inhibited the serum stimulation response. Moreover, knockdown of CNOT2 and MID1IP1 with ACN increased apoptosis and further reduced the expression of oncogenes. In addition, ACN exhibited a synergistic effect with low-dose of 5-fluorouracil (5-FU) and doxorubicin (Dox). Collectively, our data demonstrates that ACN inhibited c-Myc expression through CNOT2 and MID1IP1 and induced apoptosis. These findings indicate the potential of ACN as a therapeutic agent against colon cancer.

We report on the development of chemical vapour deposition (CVD) based graphene field effect transistor (GFET) immunosensors for the sensitive detection of Human Chorionic Gonadotropin (hCG), a glycoprotein risk biomarker of certain cancers. The GFET sensors were fabricated on Si/SiO₂ substrate using photolithography with evaporated chromium and sputtered gold contacts. GFET channels were functionalized with a linker molecule to immobile anti-hCG antibody on the surface of graphene. Binding reaction of the antibody with varying concentration levels of hCG antigen demonstrated the limit of detection of the GFET sensors to be below 1 pg/mL using four-probe electrical measurements. We also show annealing can significantly improve the carrier transport properties of GFETs and shift the Dirac point (Fermi level) with reduced p-doping in back-gated measurements. The developed GFET biosensors are generic and could find applications in a broad range of medical diagnostics in addition to cancer, such as neurodegenerative (Alzheimer’s, Parkinson’s and Lewy body) and cardiovascular disorders.

Background/Objectives: Although the role of F-18 FDG PET/CT imaging is well established in oncology, its diagnostic value in routine monitoring for recurrent colorectal cancer (CRC) is still controversial. The aim was to evaluate the diagnostic value of FDG PET/CT in detecting recurrent CRC in correlation with CEA, CA 19-9 levels, and conventional imaging modalities (CIM). Methods: Between 2009 and 2023, we retrospectively studied 134 CRC patients referred for FDG PET/CT imaging on the suspicion of recurrence based on elevated CEA and/or CA 19-9, and/or equivocal radiological findings. According to the Institutional Tumor Board CRC protocol, after initial treatment which was dependent on TNM stage (neoadjuvant therapy, primary resection or adjuvant treatment), patients underwent a standard 5-year surveillance including CEA and CA 19-9 measurements, CIM, and colonoscopy every 6 months. The statistics including univariate and multivariable analyses were conducted using the IBM SPSS 20.0 statistical software. P-values <0.05 were considered statistically significant. Results: Recurrent CRC was confirmed in 54/134 (40.3%) patients with elevated tumor markers. FDG PET/CT shows high diagnostic performance in detecting recurrent CRC with sensitivity, specificity, PPV, NPV, and accuracy of 94.4%, 82.5%, 78.5%, 95.7%, and 87.3%, respectively. The CEA shows a high sensitivity of 98.1%, but both low specificity and accuracy of 15% and 48.5%, respectively. The sensitivity, specificity, and accuracy, for CA 19-9 and CIM for the correct diagnosis in CRC patients were: 44.4%, 67.5%, 58.2%, and 51.9%, 98.8%, 79.9%, respectively. The AUC for FDG PET/CT, elevated CEA levels, CIM, and elevated CA 19-9 levels was 0.885 (95% CI: 0.824-0.946; p<0.001), 0.844 (95% CI: 0.772-0.916; p<0.001), 0.753 (95% CI: 0.612-0.844; p<0.001); and 0.547 (95% CI: 0.442-0.652; p=0.358). Univariate analysis shows that both FDG PET/CT- and CIM-positive results were highly associated with CRC recurrence (p<0.001 and p<0.001, respectively), while gender, mucinous tumor type, presence of initial lymph node metastasis (N+), and presence of initial distant metastasis (M+) have no significance (p=0.211, p=0.158, p=0.583, and p=0.201, respectively). Our multivariate analysis shows that independent predictors for CRC recurrence are: positive FDG PET/CT scans (p<0.001), positive CIM results (p=0.001) and elevated CA19-9 levels (p=0.023). Although CA 19-9 was not detected as a statistically significant predictor in the univariate analysis (p=0.358), in a multivariate analysis it was recognized as a significant predicting factor in detecting CRC recurrence (p=0.023). Conclusions: FDG PET/CT shows a high diagnostic efficacy in CRC recurrence detection, in correlation with CEA levels, CA 19-9 levels, and CIM. This imaging modality should be routinely integrated into the postoperative follow-op in patients with elevated tumor markers.

Inherited mutations in BRCA1 and BRCA2 genes increase risks for breast, ovarian, and other cancers. Both genes encode proteins for accurately repairing chromosome breaks. If mutations inactivate this function, broken chromosomes may not be restored correctly, allowing breaks to persist or rearrange chromosomes. These abnormalities are potentially catastrophic events that can originate from viral infections. I used bioinformatic analyses of publicly available breast cancer patient data to show that the distribution of chromosome breaks in hereditary breast cancers differs markedly from sporadic breast cancers. Then I tested hereditary breast cancer sequence data around chromosome breaks for DNA similarity to all known viruses. Human DNA flanking breakpoints usually had decisive matches to Epstein-Barr virus (EBV / HHV4) tumor variants HKHD40 and HKNPC60. Many breakpoints were near EBV genome anchor sites, human EBV tumor-like sequences, EBV-associated epigenetic marks, and some fragile sites. On chromosomes 2 and 12, sequences near EBV genome anchor sites accounted for 90% and 88% of breakpoints (p<0.0001), respectively. On chromosome 4, 51/52 inter-chromosomal breakpoints were close to EBV-like sequences in 19 hereditary breast cancers. In contrast, 19 sporadic breast cancers only had 12 interchromosomal breakpoint regions on chromosome 4 near EBV-like sequences. On various other chromosomes, five EBV genome anchor sites were near hereditary breast cancer breakpoints at precisely defined, disparate gene or LINE locations. Independent evidence further implicating EBV in hereditary breast cancer breakpoints is that 25 breast cancer break positions are within 1.25% of breakpoints in model EBV cancers. In addition to BRCA1 or BRCA2 mutations, all the hereditary breast cancers had mutated genes essential for immune responses. This compromise facilitates reactivation of herpes viruses which produce nucleases capable of breaking chromosomes. EBV also causes other deleterious effects: anchored EBV episomes can interfere with normal replication and obstruct DNA break repairs; even very early infection causes massive transcription changes. The results, therefore, imply proactive treatment and prevention of herpes viral infections may prevent some chromosome breaks and benefit BRCA mutation carriers.

Background: In the last years, many new treatment options have widened the therapeutic scenario of genitourinary malignancies. Immunotherapy has shown efficacy, especially in the urothelial and renal cell carcinomas, with no particular relevance in prostate cancer. However, despite the use of immune checkpoint inhibitors, there is still high morbidity and mortality among these neo-plasms. Cancer vaccines represent another way to activate the immune system. We sought to summarize the most recent advances in vaccine therapy for genitourinary malignancies with this review. Methods: We searched Pubmed, Embase and Cochrane Database for clinical trials conducted in the last ten years, focusing on cancer vaccines in the prostate, urothelial and renal cancer. Results: Various therapeutic vaccines, including DNA-based, RNA-based, peptide-based, dendritic cells, viral vectors, and modified tumor cells, have been demonstrated to induce specific immune responses in a variable percentage of patients. However, these responses rarely corresponded to significant survival improvements. Conclusions: Further pre-clinical and clinical studies will improve the knowledge about cancer vaccines in genitourinary malignancies to optimize dosage, select targets with a driver role for tumor development and growth, and finally overcome resistance mechanisms. Combination strategies represent possibly more effective and long-lasting treatments.

Berberis vulgaris L. (Berberidaceae) is a shrub that has been widely used in European folk medicine as an anti-inflammatory and antimicrobial agent. The purpose of our study was to elucidate the mechanisms of antiproliferative action of the plant’s methanolic root extract (BVR) against colon cancer cells. Cytotoxicity and pro-apoptotic activity were determined in human colon adenocarcinoma cell lines (LS180 and HT-29) and control colon epithelial CCD841 CoN cells. According to the MTT assay, after 48 h of cell exposure, the IC50 values were as follows: 4.3; 46.1 and 50.2 µg/mL for LS180, HT-29, and CCD841 CoN cells, respectively, showing the greater sensitivity of cancer cells to BVR. The Cell Death Detection ELISAPLUS kit demonstrated that BVR induced programmed cell death only against HT-29 cells. RT-qPCR with relative quantification method showed significant changes in the expression of genes related to apoptosis in both colon cancer cell lines. The genes BCL2L1 (126.84-366.66%), BCL2L2 (277.08-330.12%), CASP3 (180.36-261.36%) and CASP9 (158.08-213.46%) had significantly elevated expression, while BCL2 (23.08-52.06%) had reduced expression. Furthermore, in a panel of antioxidant tests, BVR showed positive effects (63.93±0.01, 122.92±0.01, and 220.29±0.02 mg Trolox equivalents (TE)/g in the DPPH•, ABTS•+ and ORAC assays, respectively). In the lipoxygenase (LOX) inhibition test, BVR revealed 62,60±0.87% of enzyme inhibition. The chemical composition of BVR was determined using UHPLC-UV-CAD-MS/MS analysis and confirmed the presence of several known alkaloids, including berberine, as well as other alkaloids and two derivatives of hydroxycinnamic acid (ferulic and sinapic acid hexosides). This is the first such extensive assessment of the biological activity of BVR. The results are very promising and encourage for the use of BVR as a comprehensive chemopreventive agent (anti-inflammatory, antioxidant, and pro-apoptotic) in colorectal cancer.

Epidemiological data highlight prostate cancer as a significant global health issue, with high incidence and substantial impact on patients' quality of life. The prevalence of this disease is associated with various factors, including age, heredity, and race. Recent research in prostate cancer genetics has identified several genetic variants that may be associated with an increased risk of developing the disease. However, despite the significance of these findings, genetic markers for prostate cancer are not currently utilized in clinical practice as reliable indicators of the disease. In addition to genetics, epigenetic alterations also play a crucial role in prostate cancer development. Aberrant DNA methylation, changes in chromatin structure, and microRNA (miRNA) expression are major epigenetic events that influence oncogenesis. Existing markers for prostate cancer, such as prostate-specific antigen (PSA), have limitations in terms of sensitivity and specificity. The cost of testing, follow-up procedures, and treatment for false-positive results and overdiagnosis contributes to the overall healthcare expenditure. Improving the effectiveness of prostate cancer diagnosis and prognosis requires either narrowing the risk group by identifying new genetic factors or enhancing the sensitivity and specificity of existing markers. Immunological biomarkers (both circulating and intra-tumoral), including markers of immune response and immune dysfunction, represent a potentially useful area of research for enhancing the diagnosis and prognosis of prostate cancer. Our review emphasizes the need for developing novel immunological biomarkers to improve the diagnosis, prognosis, and management of prostate cancer. We highlight the most recent achievements in the identification of biomarkers provided by circulating monocytes and tumor-associated macrophages (TAMs). We highlight that monocytes-derived and TAMs-derived biomarkers can enable to establish the missing links between genetic predisposition, hormonal metabolism and immune responses in prostate cancer.

Objective: To provide mechanistic evidence for the epidemiological link between long-term use of alcohol containing mouthwashes and oral cancer.Methods: Human epithelial keratinocytes were exposed for 30 seconds to concentrations of ethanol commonly present in mouthwashes. After a recovery period, cell viability was assessed with the MTT assay.Results: A marked cytotoxic effect was observed for ethanol concentrations of 20% and above. Conclusions: The cytotoxicity of ethanol can explain the epidemiological association between mouthwash use and oral cancer. Recent findings indicate that the risk of developing cancer in a tissue is strongly determined by the number of stem cell divisions accumulated by the tissue during a person's lifetime; cell division is a major source of mutations and other cancer-promoting errors. Since cell death activates the division of stem cells, the cytotoxicity of ethanol on the cells lining the oral mucosa will promote the division of the stem cells located in deeper layers to produce new cells to regenerate the damaged epithelium. If we regularly use mouthwashes containing cytotoxic concentrations of ethanol, we will force the stem cells of the oral cavity to divide more often than usual and our risk of developing oral cancer will probably increase.Clinical significance: Many mouthwashes contain percentages of ethanol above 20%. Because ethanol is not crucial to prevent and reduce gingivitis and plaque, members of the dental team should consider the potential risk of oral cancer associated with frequent use of alcohol containing mouthwashes when advising their patients.

Despite the recognized benefits of fecal occult blood test (FOBT) and mammography screenings, participation in breast (BC) and colorectal cancer (CRC) screening programs is still suboptimal. This study investigates municipal characteristics associated with their BC/CRC screening uptake profiles among women aged 55–69 years. Using data from 308 municipalities of Flanders from 2014 to 2017, a profile for each municipality based on its BC/CRC screening uptake compared with the median screening uptake was created. Logistic regression with generalized estimating equations was used to assess the associations between municipal characteristics and BC/CRC screening uptake profiles. The overall median uptake of cancer screening was higher for CRC (57.4%) than for BC (54.6%). The following municipal characteristics were associated with worse performance in terms of only CRC, only BC, or both CRC and BC screening uptake, respectively: foreign nationality, self-employment rate, (early) retirement rate, diabetes, disabilities; (early) retirement rate; age group 65–69, foreign nationality, self-employment rate, (early) retirement rate, wage-earners, diabetes. The following municipal characteristics were associated with better performance in terms of only CRC, only BC, or both CRC and BC screening uptake respectively: residential stability, having a partner, having children, jobseeker rate, GP visits, preventive dental visits; having children, GP visits; age group 55–59, residential stability, having a partner, having children, jobseeker rate, higher education, GP visits, preventive dental visits. This study’s results regarding the interrelation between the BC and CRC screening could be used to tailor interventions to improve the participation of the target population in both programs.

The shift towards Personalized Cancer Medicine (PCM) represents a significant transformation in cancer care, emphasizing tailored treatments based on genetic understanding of cancer at the cellular level. This review draws on recent literature to explore key factors influencing PCM implementation, highlighting the role of innovative leadership, interdisciplinary collaboration, and coordinated funding and regulatory strategies. Success in PCM relies on overcoming challenges such as integrating diverse medical disciplines, securing sustainable investment for shared infrastructures, and navigating complex regulatory landscapes. Effective leadership is crucial for fostering a culture of innovation and teamwork, essential for translating complex biological insights into personalized treatment strategies. The transition to PCM necessitates not only organizational adaptation but also the development of new professional roles and training programs, underscoring the need for a multidisciplinary approach and the importance of team science in overcoming the limitations of traditional medical paradigms. The conclusion underscores that PCM's success hinges on creating collaborative environments that support innovation, adaptability, and shared vision among all stakeholders involved in cancer care.