We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Abstract: Arterial hypertension is the main preventable risk factor for premature death and stroke worldwide and anxiety is a real public health problem. Stress is the common denominator for both cases. In the last 3 years, the aggressive exposure of the population to negative emotions (fear of disease in a pandemic, fear of war, financial instability) was the trigger factor. The psycho-neuro-endocrine mechanisms include the hypothalamic-pituitary-adrenal axis and induce sympathetic-parasympathetic imbalance, hypercortisolemia, endothelial dysfunction, oxidative stress, inflammation, cytokine growth, and atherosclerosis. The individual’s vulnerability to stress depends on many factors, but the key role in the perception of stress belongs to immunogenic personality traits. Among them, self-efficacy is a protective factor against stress. Our research aimed to evaluate the connections between psycho-emotional factors and hypertension, using psychometric tests, to identify vulnerability to stress, perceived stress level, anxiety, self-efficacy, and psychobehavioral type, for 215 patients, 104 hypertensive and 111 non-hypertensive patients. The results of the study confirmed that there is a statistically significant difference, which requires psychological screening measures to identify patients vulnerable to stress, as well as medical education courses for doctors in the field of psychology.

Background: A personalized approach to occupational medicine allows specialists to 1 prevent professional hazards such as stress-related depression and anxiety in extreme work environments. Objective: we aim to detect genetic markers of low resilience to stress. Methods: The study cohort included 97 elite athletes and 167 special forces personnel. The research team collected buccal mucosa samples and examined psychological status with the Hospital Anxiety and Depression Scale (HADS). We assessed 35 variants within selected genes that are most often associated with low resilience to stress, anxiety, and depression. Fisher’s Exact test was used to determine nonrandom associations between scores in the HADS scale and the genetic variants. We also trained machine learning models to predict score values from genotyping findings and ranked genetic biomarkers according to their predictive power. Results: High-risk depression profiles included C/T genotype of MTHFR C677T and A/C variant of MTHFR A1298C. Susceptibility to anxiety was associated with several polymorphisms regulating neuroactive substances, immune response, and coagulation. The ML models accurately detect depression or anxiety levels with MAE/ROV of 17.69±1.35 and 17.86±2.09% respectively. Conclusions: The study findings justify a polymorphic nature of anxiety and confirm the immune system's involvement in regulating stress response.

Background: Patients’ effective hand hygiene helps to reduce healthcare-associated infections, prevents the spread of nosocomial infections and communicable diseases, such as COVID-19. This study aimed to describe effective hand hygiene decisions based on the Health Action Process Ap-proach (HAPA) and whether this pattern is invariant for mental health. Methods: Data were collected cross-sectionally from patients who had previously been admitted to a hospital (N=279; study 1) and longitudinally from psychosomatic rehabilitation patients (N=1,073; study 2). The fit of the HAPA framework and changes in hand hygiene decisions regarding com-pliance, as well as social-cognitive variables of the HAPA, and mental health status were examined. Results: The trimmed HAPA framework fitted the data well (χ2=27.1, df=12, p<.01, CMIN/df=2.26, CFI=.97, RMSEA=.08). According to multi-group structural equation modeling, the HAPA model with hand hygiene behavior were found to be invariant with regard to mental health. Conclusion: The trimmed HAPA framework revealed to be a generic framework in explaining so-cial-cognitive processes relating to hand hygiene decisions. Helping individuals to perform hand hygiene recommendation requires intention formation and bridging the intention-behavior gap. This can be done by promoting planning and self-efficacy. All processes appear generic to partic-ipants with and without mental health challenges.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Healthcare workers' stress, burnout, and job dissatisfaction were exacerbated by the Covid-19 pandemic, whose mid-term negative effects are still present. The aim of this study was to investigate in healthcare workers the effect of the dimensions of burnout (Psychophysical exhaustion, Relational deterioration, and Professional inefficacy) on Career satisfaction. These relationships were evaluated by considering the direct and mediated effects of Disillusion. For these purposes, the Link Burnout Questionnaire (LBQ) and the Career Satisfaction Scale (Occupational Stress Indicator - OSI) were administered to 295 healthcare professionals working at three Italian public hospitals in Cagliari, Italy. The analyses were conducted using the Partial Least Square Structural Equation Model (PLS-SEM) method. Findings highlight that healthcare workers were in a condition of work distress, high risk of burnout, and career dissatisfaction. Also recognized was the direct negative effect of burnout dimensions on career satisfaction. Finally, the mediated negative effect of Disillusion in the relationship between burnout and career satisfaction was identified. This study emphasizes the relevance of the dimension of Disillusion, and its “bright side” Fulfilment, in healthcare workers, specifically referring to the disregarded relationship between burnout and career satisfaction.

Background: Patients with infectious complications related to the presence of cardiac implantable electronic devices (CIED) constitute a heterogeneous group, including local pocket infection (PI) and lead related infectious endocarditis (LRIE). The diagnosis of CIED-related infection is often difficult and requires complex imaging and microbiological tests. The aim of the current study was to evaluate the usefulness of new simple hematological parameters in detecting infectious complications in patients with CIED and assessing their extent. Methods: The retrospective analysis of clinical data of 2909 patients (36.37% with CIED-related infections), undergoing transvenous lead extraction (TLE) procedures in three high-volume centres in the years 2006-2020, was conducted. The sensitivity and specificity of new hematological markers were evaluated: the neutrophil to lymphocyte ratio (NLR), neutrophil to platelet ratio (NPR), and lymphocyte to platelet ratio (LPR) in the diagnosis of infectious complications, assessment of the spread of the infectious process and differentiation of additional structures related to the presence of leads. Results: In patients with CIED infections, compared to the non-infectious group, high inflammatory parameters were confirmed, and the highest specificity of the new markers in detecting the infectious process was demonstrated. (79.47% for NPR and 72.82% for NLR). Analysis of laboratory parameters in infectious and non-infectious patients with the presence of additional lead-related masses showed the highest specificity of NPR (82,78%) in predicting the diagnosis of vegetation. Comparison of laboratory parameters in patients with LRIE and PI showed higher NLR % (4.24 vs 2.56; p<0.001, area under curve (AUC) in a receiver operating characteristic (ROC) curve: 0.67 and 0.78 respectively) and higher NPR (0.03 vs 0.02; p<0.001; AUC: 0,51 and 0,55) in patients with LRIE. The highest sensitivity in the detection of coexistence LRIE with PI has been demonstrated for NLR (87.33%). Conclusions: Novel hematological markers may be helpful in the recognition of the inflammatory process in patients with CIED, differentiation of vegetation and vegetation-like masses, and the extent of infection in patients with PI.

: Healthcare workers are affected by mental health issues, burnout and turnover, and this burden is even greater during epidemics and pandemics, such as COVID-19. The purpose of this research is to provide an overview of the measures introduced or supported in the institutions of Quebec’s health and social services network during the COVID-19 pandemic with the aim of protecting healthcare workers’ mental health. An online questionnaire survey was administered in 2021 among human resources department personnel in health and social services network institutions involved in workplace mental health in Quebec. A total of 223 key informants representing 31 of the 34 public health and social services institutions in the province of Quebec in Canada responded to the questionnaire. Measures that focus on the needs of staff, involve all levels of authority and the ones that provide flexibility, support and recognition at work were more successful, according to the advisors surveyed. Future research into whether the same measures are considered effective or ineffective outside of a pandemic context is needed.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Akebia trifoliata is an economically important self-incompatible fruit tree in the family Lardiza-balaceae. Asexual propagation is the main strategy used to maintain excellent agronomic traits. However, the generation of adventitious roots during asexual propagation is very difficult. To study the important role of the WUSCHEL-related homeobox (WOX) transcription factor in fruit and adventitious root growth and development, we characterized this transcription factor family in the whole genome of A. trifoliata. A total of 10 AktWOXs were identified, with the fol-lowing characteristics: length (657~11328 bp), exon number (2~5), isoelectric point (5.65~9.03), amino acid number (176~361 AA), and molecular weight (20.500~40.173 kDa). 10 AktWOXs were classified into modern (6), intermediate (2), and ancient clades (2) and that all AktWOXs had undergone strong purifying selection during evolution. The expression profile of AktWOXs dur-ing A. trifoliata fruit development and adventitious root formation indicated that AktWOXs are widely involved in the development of the three fruit tissues, flesh, seeds and rind, and play an important role in the regulation of adventitious root development. Overall, this is the first study to identify and characterize the WOX family in A. trifoliata and will be helpful for further re-search on A. trifoliata fruit development and adventitious root formation.

The main objective of this paper is to assess pro-environmental behavior, climate change perception, anxiety, hope and despair in different political orientations. Specific aims included to validate all the instruments; to assess whether the factor structure of the scales were valid across political orientations; to evaluate their reliability; to assess differences concerning age, gender and political orientation; to know the variables that explain pro-environment behavior; and to evaluate the moderating role of climate change perception, despair and hope in the relationship between climate change anxiety and pro-environmental behavior. Confirmatory factor analysis (CFAs), multi-group CFAs (to measurement invariance), multiple linear regressions and moderations were performed. Results showed that pro-environment behavior and climate change hope achieved the four levels of invariance across different political orientations; climate change anxiety achieved the three first levels of invariance; climate change perception and climate change despair achieved configural invariance. Climate change anxiety personal experience, climate change perception total, reality and consequences present higher values in left political orientation that in right or center. Climate change anxiety variables contribute most to explaining pro-environmental behaviors. Hope, despair and climate change perception consequences moderate de relationship between climate change anxiety and pro-environment behavior. These results open up new avenues of investigation, namely, to understand why high levels of anxiety lead to more pro-environment al behaviors.

Premenstrual syndrome (PMS) continues to impact the health outcomes and emotional well-being of reproductive-age women, globally. Several studies have provided conflicting evidence concerning the role of dietary approaches in improving PMS symptoms. Accordingly, this study aimed to evaluate the possible influence of a healthy diet and motivational strategies on PMS symptoms and health-related quality of life among Omani adolescents. This open-label, randomized, prospective controlled trial was conducted in two randomly selected secondary schools, in Al Seeb Willayah, in Muscat region. Adolescents with PMS symptoms, who were at grade 10 or 11, aged 16 years or above, had regular menstrual cycles and not known to have psychiatric disorder, were included in this study. Participants in the intervention group received an individual face-to-face dietary consultation and motivational phone consultation. The health outcomes, including the PMS symptoms in both groups, and quality of life, were recorded via a daily record of severity of problems questionnaire (DRSP) and the 14-item Self-Reporting-Based Perceived Stress Scale tools, respectively. The primary outcome was the differences in the mean premenstrual symptom scores between the two groups. Secondary outcomes included the quality of life and stress levels of participants. The study period was from 1 February and ended 30 June 2021. SPSS was used to analyze the data and intention-to-treat analysis was utilized.A total of 72 adolescents with PMS were randomized to the intervention and control groups (n=36 each). Both groups were similar at baseline (P-value&gt;0.05). No significant association was found between healthy-diet and PMS symptoms (P-value&gt;0.05). In addition, no significant association was found between healthy-diet and quality of life at follow-up (P-value=0.216). The outcomes of this study refuted any possible relationships between healthy diet and PMS symptoms. Accordingly, dietary consultations may not facilitate the clinical management of PMS symptoms in adolescent females.

Background and Objectives: Chemokines have various biological functions and potential roles in the development or progression of neuroinflammatory diseases. However, the specific pathogenic roles of chemokines in age-related macular degeneration (AMD), the leading cause of blindness in older individuals, remain elusive. Chemokines interact with their receptors expressed in the endothelium and on leukocytes. The sulfation of tyrosine residues in chemokine receptors increases the strength of ligand–receptor interaction and modulates signaling. Therefore, in the present study, we aimed to construct a human recombinant sulfated CXCR3 peptide trap (hCXCR3-S2) and mouse recombinant sulfated CXCR3 peptide trap (mCXCR3-S2) to demonstrate in vivo effects in preventing choroidal neovascularization and chemotaxis. Materials and Methods: First, the effect of hCXCR3-S was validated in vitro. Interestingly, hCXCR3-S2 inhibited the migration and invasion of two human cancer cell lines. Subsequently, the in vivo efficacy of mCXCR3-S2 was investigated using a mouse model of neovascular AMD. Results: Intravitreal injection of mCXCR3-S2 attenuated choroidal neovascularization and macrophage recruitment in neovascular lesions. These in vitro and in vivo effects were significantly stronger with CXCR3-S2 than with wild-type CXCR3 peptides. Conclusion: These findings demonstrate that the sulfated form of the CXCR3 peptide trap is a valuable tool that could be supplemented with antivascular endothelial growth factors in AMD treatment.

Pure silver as well as silver compounds have been used as antiseptics for centuries. Nowadays, the most frequently applied form of silver is a nanoparticle form. Several studies demonstrate the ability of silver nanoparticles and silver salts to accumulate in the brain of laboratory ani-mals as well as the ability of silver nanoparticles to influence behavioral and cognitive functions of laboratory mammals. For the first time, the influence of a silver salt, in particular, silver citrate on the change dynamics of behavioral and cognitive functions of laboratory mice at the daily oral exposure during 30, 60, 120 and 180 days is investigated in the present research. We observed the anxiety increase after 30 days of the exposure as well as the ability of mice to adapt to the prolonged oral exposure of silver citrate manifested in the anxiety decrease, increase of locomotor activity and the tendency of long-term contextual memory improvement. Increase of locomotor activity and memory improvement might be associated with the sensitivity increase and regarded as compensatory mechanism to anxiety increase. The observed phenomenon is classified as a hormetic effect. A comparison with the analogous study implemented polyvi-nylpyrrolidone coated silver nanoparticles is carried out. It was concluded that the nanoform is more neurotoxic.

Assessment of renal function is critical to diagnose and manage renal age-related decline, disease (KD), and failure, which are prevalent in the elderly population. Glomerular filtration rate (GFR) is widely used as an indicator of kidney function, but its direct measurement is challenging, as are its age and gender caveats. This makes difficult the differential diagnosis, between age-related physiological decline and KD and/or failure. Currently, the inflammation-based modified Glasgow prognostic score (mGPS) is emerging as promising biomarker of several inflammatory acute/chronic diseases. In this study, the large variability of eGFR with age and gender was evaluated, as the association of eGFR values with mGPS levels. A population of 57449 adult participants (age ≥18 years) was enrolled. Appropriate circulating biomarkers were measured to detect eGFR and mGPS values. The data obtained demonstrated a significant decrease of eGFR in men vs. women across the four selected age classes (18-40, 40-60, 60-80, 80-100 years), eGFR classes were significantly associated with mGPS (p<0.001), as age-classes and gender with mGPS categories. Accordingly, the percentage of people having a mGPS score= 2 significantly increased across the eGFR classes: with a 11% in the G1/eGFR class to achieve the 44% in G5/eGFR. Thus, the combination of mGPS with eGFR could represent the best benchmark risk model for differentiating age-related renal decline from a very KD, and for a better identification of different degrees of KD severity.

Background: we aim to investigate attitudes toward vaccination, by analyzing empirical factors associated with vaccine acceptance in the Lazio region mpox vaccination (MpoxVax) campaign in Italy. Methods: all subjects who accessed to MpoxVax and signed the informed consent were prospectively enrolled in the MPOX-VAC Study and were asked to fill out an anonymous survey. Two endpoints were selected: ‘delayed acceptance’ and ‘early acceptance’, defined as access for vaccination &gt;60 and ≤30 days from the vaccination campaign starting (VCS), respectively. Results: over the study period 1717 individuals underwent vaccination: 129 (7%) &gt;60 [1588 (92.5%) ≤60] and 676 (60%) ≤30 days from VCS. A bisexual orientation, a lower education level and a worse perceived physical and mental health were associated with delayed access to vaccination. Being Pre-Exposure Prophylaxis (PrEP) users and, marginally, HIV positive, having a high perceived risk for mpox infection and reporting high-risk behaviors like the use of recreational drugs/chems, sex under the influence of drugs and/or alcohol and higher number of principal sexual partners, were associated with early access to vaccination. Conclusions: according to our data, risk awareness was a major determinant of early mpox vaccination acceptance. Conversely, worse perceived health status and a low educational level were critical factors associated with delayed vaccination.

Biological, environmental, behavioral, and social factors can influence sleep and lead to sleep disorders or diseases. Sleep disorders are common, numerous and heterogeneous in terms of their etiology, pathogenesis, and symptomatology. Management of sleep-wake circadian disorders (SWCD) includes education to sleep hygiene, behavioral strategies, psychotherapy (cognitive behavioral therapy (CBT), particularly), instrument-based treatments (i.e. positive airway pressure therapy, hypoglossal nerve stimulation), and pharmacotherapy. Depending on the disease, therapy varies and is executed sequentially, or can be a combination of several forms of therapy. Drugs used for SWCD include traditional sleep or wake-promoting agents, chronotherapeutic agents. Recently, novel medications, which are more precisely acting on specific neurochemical systems (i.e. orexin system) important for sleep and wake, are also increasingly being used. In this review, the pharmacotherapy of common sleep disorders (insomnia, sleep-related breathing disorder, central disorders of hypersomnolence, circadian rhythm sleep wake disorders, parasomnias, and sleep-related movement disorders) embedded in the overall therapeutic concept of each disorder is presented. There is also an outlook on possible future pharmacotherapies.

(1) Background: Some evidence suggests that cannabidiol (CBD) has potential to help alleviate HIV symptoms due to its antioxidant and anti-inflammatory properties. Here we examined acute CBD effects on various behaviors and the endocannabinoid system in HIV Tat transgenic mice. (2) Methods: Tat transgenic mice (female/male) were injected with CBD (3,10,30 mg/kg) and assessed for antinociception, activity, coordination, anxiety, and recognition memory. Brains were taken to quantify endocannabinoids and related lipids. Additionally, CBD and metabolite 7-hydroxy-CBD were quantified in the plasma and cortex. (3) Results: Tat decreased striatal-related nociception and locomotion, with some sex-dependent effects on coordination. CBD had no effect on nociception and coordination, but increased locomotor activity. For anxiety, differential CBD effects were noted for sex, with decreasing anxiety-like behavior in males only. In the striatum and spinal cord, male sex was associated with lower 2-arachidonoylglycerol and with elevated concentrations of its proinflammatory metabolite arachidonic acid. CBD metabolism was altered by sex and Tat. (4) Conclusion: Findings indicate that acute CBD effects are not altered by HIV Tat, and CBD has minimal effects on behavior and the endocannabinoid system. Interestingly, sex-dependent alterations were noted for endocannabinoids and related lipids, which may be of relevance in view of potential CBD-based treatment options for people living with HIV.

Migraine is a neurovascular disorder that can be debilitating for individuals and society. Current research focuses on finding effective analgesics and management strategies for migraines by targeting specific receptors and neuropeptides. Nevertheless, the responder rates of recently approved calcitonin gene-related peptide (CGRP) monoclonal antibodies (mAbs) and receptor inhibitors remain around 50 percent. To address the need for novel therapeutic targets, researchers are exploring the potential of another secretin family peptide, pituitary adenylate cyclase-activating polypeptide (PACAP), as a ground-breaking treatment avenue for migraine. Preclinical models have revealed how PACAP affects the trigeminal system, which is implicated in headache disorders. Clinical studies have demonstrated the significance of PACAP in migraine pathophysiology; however, a few clinical trials remain inconclusive: the pituitary adenylate cyclase-activating peptide 1 receptor mAb, AMG 301 showed no benefit for migraine prevention, while the PACAP ligand mAb, Lu AG09222 significantly reduced the number of monthly migraine days over placebo in a phase 2 clinical trial. Meanwhile, another secretin family peptide vasoactive intestinal peptide (VIP) is gaining interest as a potential new target. In light of recent advances in PACAP research, we emphasize the potential of PACAP as a promising target for migraine treatment, highlighting the significance of exploring PACAP as a member of the antimigraine armamentarium, especially for patients who do not respond to or contraindicated to anti-CGRP therapies. By updating our knowledge on PACAP and its unique contribution to migraine pathophysiology, we can pave the way for reinforcing PACAP and other secretin peptides, including VIP, as a novel treatment option for migraines.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Revealing the underlying pathomechanisms of neurological and psychiatric disorders, searching for new biomarkers, and developing novel therapeutics all require translational research. In vivo and in vitro disease models have been instrumental in casting light on complex polygenic, multifactorial, and heterogeneous disease mechanisms. In the most recent years, advanced preclinical models have revealed the intriguing interaction of sex/gender and aging with the pathogenesis and clinical manifestations of psychiatric and neurological diseases. However, despite these advancements, there is still a great deal of work to be done to fully comprehend the underlying mechanisms of these diseases and to develop treatments that can significantly improve the lives of those who suffer from them. The current challenge in the field of neurological and psychiatric diseases is to develop disease-modifying, effective treatments for these complex and long-lasting debilitating conditions with a high burden of disease.The first edition of the research topic ‘Emerging Translational Research in Neurological and Psychiatric Diseases: From In Vitro to In Vivo Models’ reinforces translational research playing a critical role in bridging the gap between basic research and clinical applications. Also, it provides a platform for researchers to share their findings and advancements in translational research in this field. This new collection gathers 25 papers offering insights into the latest advancements in translational research and potential new avenues for treatments. These papers cover various topics, including the development of new preclinical models, the use of in vitro and in vivo methods, and the application of qualitative and quantitative research methods.

Background and Objectives: Although there has been growing interest in the association of ADHD with anxiety, depression, suicidal ideation, and self-esteem, there is a lack of consistent results and these associations remain unclear. This study investigated the differential patterns of anxiety, depression, suicidal ideation, and self-esteem with regard to the presence of ADHD. Materials and Methods: The subjects were divided into a patient group and a control group. The patient group included 49 patients diagnosed with ADHD at the department of psychiatry of one university hospital. For the control group, 3,727 students were invited to complete a questionnaire. Of the 1,717 students who responded to the questionnaire, 245 were selected for patient-controlled studies. All the subjects were instructed to complete the Beck Suicide Ideation Scale, Children's Depression Inventory, Beck’s Depression Inventory, State-Trait Anxiety Inventory, and Rosenberg Self-Esteem Scale. Results: ADHD subjects experienced more anxiety, depression, and suicidal ideation as well as lower self-esteem compared to the control group comprising participants without ADHD. Conclusions: These findings suggest that ADHD symptoms may contribute to greater suicidal ideation through experienced depression, anxiety, and low self-esteem in school-aged children. Therefore, appropriate ADHD symptom management is necessary to reduce suicidal ideation among school-aged children with ADHD symptoms.

The average working person can spend between 35-60 hours a week in the workplace, making it an influential place for mental well-being while also being a place for socio-economic contribution. Workplace incivility can diminish positive mental health outcomes and negatively impact work engagement through increased social anxiety. To investigate this, 118 working adults aged between 19 to 67 years old in Singapore were recruited for a survey comprising of demographics questions, the Workplace Incivility Scale, Brief DSM-5 Social Anxiety Disorder Severity Scale, Utrecht Work Engagement Scale-9 over the period of November 2022 to April 2023. Correlational, regression and mediation analysis showed workplace incivility scale scores to significantly pre-dict social anxiety after controlling for covariates, supporting our hypothesis that employees exposed to work-place incivility would have higher levels of social anxiety that mediated work engagement after controlling for age and gender. The findings here show workplace incivility to be a possible intervention target for social anx-iety to reduce negative impacts on work engagement in order to improve employee experience and retention for organizations.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Anxiety is a complex emotional state that can arise from the anticipation of a threatening event, and preoperative anxiety is a common experience among adult patients undergoing surgery. In adult patients, the incidence of preoperative anxiety varies widely across different surgical groups, and it can result in a variety of psychophysiological responses and problems. Despite its negative impact, preoperative anxiety often receives insufficient attention in clinical practice. To improve pain management strategies, there is a need for further research on personalized approaches that take into account various factors that contribute to an individual's pain experience. These personalized approaches could involve developing tools to identify individuals who are more likely to experience increased pain and may require additional analgesia. To address this, regular assessments of anxiety levels should be conducted during preoperative visits, and counseling should be provided to patients with high levels of anxiety. Identifying and addressing preoperative anxiety in a timely manner can help reduce its incidence and potential consequences.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background As a major virus outbreak in the 21st century, the Coronavirus disease 2019 (COVID-19) pandemic has led to unprecedented hazards to mental health globally. Health care workers, patients with COVID-19 are experiencing post-traumatic stress disorders, anxiety, depression, and insomnia. Methods: A cross-sectional study using a questionnaire consisted of four parts: sociodemographic, current and previous health status, measures in a social isolation, and the Arabic version of Depression, Anxiety and Stress Scale (DASS-21). Results: We had 110 patients who completed the data. 89 (80.9%) of patients recovered from COVID-19. They ranged from 18-84 with a mean of 37.6 years (SD = 9.8 years). We had 33.6% of patients re-ported moderate to extremely severe depression compared to 18.2% with mild reported symptoms. The anxiety severity showed that (35.4%) out of patients had moderate to extremely severe anxiety, compared to (6.4%) who had mild anxiety. While stress severity showed that (22.7%) had moderate to extremely severe stress compared to (13.6%) who had mild stress. Conclusion: COVID-19 has caused a significant increase in the prevalence of mental health illness in the general population. Large systematic reviews are required to set the general overall of impact of this pandemic on mental health.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Memory and emotion, fundamental components of our mental existence, are highly vulnerable to psychiatric disorders like post-traumatic stress disorder (PTSD). This condition has been linked to serotonin (5-HT) metabolism disruptions. Over 95% of the 5-HT precursor tryptophan (Trp) is metabolized through the Trp-kynurenine (KYN) metabolic pathway, but little is known about its role in behavior. Kynurenine aminotransferases are responsible for the production of the Trp-KYN metabolite kynurenic acid. The gene aadat codes for mitochondrial kynurenine aminotransferase isotype 2. We generated CRISPR/Cas9-induced aadat knockout (kat2−/−) mice to examine the consequence of the gene deletion on negative valence in emotion, memory, and motor function in males 8 weeks of age and compared them to their wild-type counterparts. The forced swim test showed increased depression-like behaviors in transgenic mice. Anxiety and memory tests showed no significant differences. The transgenic mice had fewer center field and corner entries, shorter ambulation distances, and fewer jumping counts in the open field test. Overall, the transgenic mice exhibit depression-like behavior in a learned helplessness model, emotional indifference, and motor deficits. Here we present the first evidence that the deletion of the aadat gene triggers depression-like behaviors, uniquely associated with despair experience rather than adverse-conditioned memory. These findings have profound implications, opening avenues for further exploration into the main causes of experience-based depression linked to despair. This investigation has the potential to advance our understanding of these complex conditions and pave the way for improved therapeutic strategies by elucidating the relationship between Trp metabolism and the pathogenesis of PTSD.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Background Posttraumatic stress disorder (PTSD) is a complex condition that represents a significant burden in terms of individual disability and societal costs. Despite decades of research investigating treatment options, PTSD remains a major cause of quality-of-life impairment. We hypothesized that patients with PTSD might benefit from peripheral somatosensory stimulation (PSS) therapy. Methods Six adult patients with clinically diagnosed PTSD were enrolled to undergo daily PSS therapy over a 4-week period. Patients completed two surveys evaluating satisfaction with treatment and overall well-being (Survey 1) and severity of PTSD symptoms (Survey 2). Survey 1 was completed weekly during the course of the study. Survey 2 was based on the 9-question National Stressful Events Survey PTSD Short Scale (NSESSS) and was completed as a baseline prior to initiation of therapy and then at the conclusion of the trial. All data were analyzed by an independent statistician. Results Six male patients were enrolled in the study; all completed the trial. All patients demonstrated a decrease in symptoms within one week of initiation of therapy. This benefit was sustained and appeared to further improve over the course of the trial. For Survey 1, the overall median scores demonstrated a significant time-dependent improvement across measurement times (p < 0.001). For Survey 2, patients had statistically significant improvements from baseline regarding feelings of being emotionally upset and being overly alert. Results from a cumulative link mixed model demonstrated that treatment yielded a 38.2-fold higher likelihood of transitioning from a higher PTSD score at baseline to a lower (improved) score at week 4. No adverse events were described by the patients. Conclusions PSS stimulation appeared to improve symptoms in all six patients with PTSD symptoms in this trial. Patients had unanimous and clinically meaningful improvement in overall PTSD symptoms with treatment. By week 4, all patients responded that they enjoyed the treatment and would like to keep their device. We suggest that further investigation into the potential usefulness of PSS therapy in patients with PTSD is warranted.

Alcohol use disorder (AUD) is a chronic and relapsing biopsychosocial condition that leads to a wide range of medical, psychological, social, economic, and personal issues. The study investigated the predictors of quality of life (QoL) among male patients seeking treatment for AUD based on attention, cognitive instability, motor impulsiveness, perseverance, and self-control dimensions of trait impulsivity. The study also investigated the potential mediating effect of anxiety and alcohol use severity in this relationship. After an initial assessment, participants underwent comprehensive evaluations, including sociodemographic data, clinical history, and QoL domains. Evaluations also covered AUD severity, impulsivity dimensions, cognitive functions, craving intensity, depression, anxiety and self-efficacy. Multiple linear regressions were employed to identify associations between independent variables and QoL. Attention dimension of impulsivity and anxiety symptoms significantly predicted physical health QoL. Self-control dimension and severity of alcohol use disorder predicted psychological QoL. Indirect effect of attention dimension on physical health was significant [effect =-1.082,95% CI (-2.008, -0.3598)].The significance of impulsivity in influencing QoL for individuals with AUD has profound clinical implications. These findings underscore the importance of addressing anxiety and impulsivity in managing AUD, given their considerable impact, particularly on QoL, ultimately shaping treatment outcomes.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p &lt; 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p &lt; 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

Background and Objectives: Botulinum toxin injections are commonly used for the treatment of spasticity. However, injection procedures are associated with pain and procedural anxiety. While pharmacological approaches are commonly used to reduce these, inno-vative technology might be considered as a potential non-pharmacological alternative. Given this context, immersive virtual reality (VR) has shown effectiveness in the man-agement of procedural pain[1]. Our retrospective pilot study aimed to assess the potential added value of virtual reality in the management of pain and anxiety during intra-muscular injections of botulinum toxin. Materials and Methods: Twenty-one adult patients receiving botulinum toxin injections were included. A numerical rating scale was used to assess pain and anxiety during the injection procedure. The patient reported the pain experienced during previous injections without VR before injection and the pain expe-rienced in the current procedure with VR after the end of the procedure. Level of satis-faction of VR experience, if they agreed to reuse VR for the subsequent toxin botulinum injection, and if they would recommend VR to other patients were assessed. Results: The use of virtual reality showed a decrease of 1.8 pain-related points compared to without technology. No significant improvement in the level of anxiety was reported. Patients were very satisfied by their VR experience (7.9 out of 10) and would agree to reuse VR in their next injection procedure (88%) and to recommend the use of VR in other patients (100%). Conclusion: VR was useful for managing procedural pain related to botulinum toxin injection in adults, with a high level of satisfaction reported by the patient. VR should be considered as a valuable alternative to pharmacological approach to manage procedural pain during Botulinum toxin injection in adults.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

There are few studies of the psychological effects of language brokering (speaking on behalf of) among minors migrated to Europe, even though language brokering is becoming more current in many migrant families. As the psychological implications of language brokering remain controversial, further investigation is needed. Earlier studies have documented that language brokering is sometimes linked with emotional maladjustment and developmental drawbacks, but other studies have shown faster acquisition of social and Language skills. The present study assessed the relation of language brokering with psychological well-being in a sample of Latino migrant adolescents living in Italy; the dependent variables were depression, anxiety, and emotions. Statistically significant differences between boys and girls confirmed the sex-specificity of language brokering and the lack of statistically significant negative association between language brokering and psychological well-being.

Intergenerational integration has given rise to a novel aging paradigm known as all-age communities, which is garnering international attention. In China, the aging population and the implementation of the three-child policy have resulted in increased demand for retirement and childcare services among residents in older neighborhoods. Consequently, there is a pressing need to retrofit these older neighborhoods to accommodate all-age living arrangements given the high demand they generate. Therefore, this study undertakes research interviews with residents and constructs an exploratory theoretical model rooted in established theory. To assess the significance of our model, we employ Smart PLS 3.0 based on 297 empirical data points. Our findings indicate that anxiety has a significant negative effect on payment behavior; objective perception, willingness to pay, and government assistance exert significant positive effects on payment behavior. By comprehensively analyzing the mechanisms underlying residents’ payment behavior, this study provides valuable insights to the government for promoting the aging process within communities and formulating effective transformation policies.

Background: Mood disorders, especially depression, and emotional difficulties such as anxiety are very common problems among patients with spinal cord injury (SCI). The loss of physical training may deteriorate their mental state, which in turn has a significant impact on the improvement of functioning. The aim of the present study was to examine the influence of innovative rehabilitation approaches involving robotic assisted gait therapy (RAGT) on mood and anxiety symptoms in pa-tients with SCI. Methods: To this single-centre, single-blinded, single-arm, prospective study, 110 participants with subacute SCI were enrolled; patients were divided into experimental (robotic assisted gait therapy -RAGT) and control (conventional gait therapy with dynamic parapodium - DPT) groups. They received five training sessions per week over 7- weeks. The severity of de-pression was assessed by Depression Assessment Questionnaire (KPD) and anxiety symptoms by State - Trait Anxiety Inventory (STAI X-1) on the beginning and end of therapy. Results: SCI patients experienced significantly lower levels of anxiety and depression-related symptoms after completing the seven-week rehabilitation program (KPD: Z=6.35; p<0.001; r=0.43; STAI X-1: Z=-6.20; p<0.001; r=0.42) in both group of patients. In the RAGT group, post-rehabilitation measurements also indicated an improvement in psychological functioning, i.e., a decrease in depression and anxiety, and an increase in self-regulation. Significant results were noted for each variable (STAI X-1: Z = -4.93; KPD: Z = -5.26; SR: Z = -3.21). In the control group, there was also a decrease in the effect on the depression, anxiety-state and an increase in self-regulation ability (STAI X-1: Z=-4.01; KPD: Z=-3.65; SR: Z=-2.83). Rehabilitation modality did not appear to have a statistically significant relationship with the magnitude of improvement in KPD (including SR) and STAI scores. However, there were some significant differences when comparing the groups by extent and depth of injury and type of paralysis. The study also did not find a significant rela-tionship between improvements in physical aspects and changes in psychological factors. Conclusion: Subjects in RAGD and DPT groups experienced a decrease in anxiety and depres-sion after a 7-week rehabilitation program. However, the rehabilitation modality (DPT vs. RAGT) did not differentiate patients with SCI in terms of the magnitude of this change. Our results may suggest that individuals with severe neurological condition and complete spinal cord injury (AIS A) may experience more benefit in terms of change in psychological parameters after rehabilitation with RAGT.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Depression is considered a widespread mental health problem worldwide. Moreover, anxiety symptoms are very closely related to depression patients, and it is known that the coexistence rate of depression and anxiety diagnosed simultaneously is high. Treatment and preventive management of depression and anxiety are essential for public health. Forest healing is attracting attention as a form of low-cost preventive medicine that is safe and has no side effects. However, although the physiological and psychological effects have been scientifically proven, it is insufficient to reveal a direct relationship between forest healing and depression. This study investigated the benefits of an urban forest healing program on depression and anxiety symptoms of depressive disorders. We employed a randomized controlled trial design. Forty-seven depression patients were randomly divided into an urban forest healing program group and a control group. Measures included the Montgomery-Asberg depression rating scale (MADRS), the Hamilton Anxiety Rating Scale (HARS), and the State-Trait Anxiety Inventory (STAI) questionnaires. Our results revealed that the combination of general treatment and forest healing programs for patients with depression is more effective in improving depression and anxiety than routine treatment alone. We expect our work to serve as a starting point for more sophisticated research in discussing the availability of non-pharmacological treatments in forest healing.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Acute myocardial infarction (AMI) is a leading cause of morbidity and mortality worldwide. This study aimed to test the efficacy of a newly-developed symptom self-management program on health outcomes among inpatients post-AMI. A pilot randomised, controlled trial was utilised. A convenience sample of 90 was recruited from a tertiary hospital in Singapore. Adult inpatients with post-AMI were randomly assigned to the three groups: IManage-HSet, IManage-FF or control group. Sample size was computed using power analysis. Data were collected through self-reported questionnaires and physiological instruments. Data analyses included univariate statistics, analysis of variance and repeated measure analysis of variance. Ninety participants were recruited with 30 in each group. Participants in the IManage-HSet and IManage-FF group had significantly greater relaxation (ηp2 = 0.11), lower objective stress (ηp2 =0.14), and greater knowledge (ηp2 = 0.62) than those of the control group. The two intervention groups had lower subjective stress (ηp2 = 0.04), depression (ηp2 = 0.01), and anxiety (ηp2 = 0.03) than the control but such differences did not achieve statistical significance. Furthermore, most participants reported that they were satisfied with the programs and they provided positive comments on the contents, educational materials and relaxation practice. This pilot study supports the potential benefits and feasibility of the IManage-VR and IManage-FF interventions on stress, perceived relaxation, knowledge and patient satisfaction. Contents of the symptom management interventions could be added into current cardiac rehabilitation programs. Future RCTs with multi-centered sites and larger sample size are required to further test the intervention. This study was prospectively registered with the International Standard Randomised Controlled Trial on the 5th August 2014 with registration number ISRCTN61027816.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: The COMT gene polymorphism is associated with neurological and psychiatric disorders and pain perception. This study aimed to determine the relationship between the COMT (catechol-O-methyltransferase) gene polymorphism, pain perception in parturients with inhaled nitrous oxide during labour, and anxiety as a personality trait. Methods: A total number of 181 woman who chose vaginal birth were enrolled in this study. To present the difference in pain perception, the parturients were divided into one group (n=80) that chose labour analgesia with inhaled nitrous oxide (50% nitrous oxide and 50% oxygen) and one group without analgesia. The blood samples were taken during the pregnancy as a part of routine pregnancy controls in the hospital. The COMT gene polymorphism was detected with the PCR technique. Pain perception of labouring women was self-evaluated two times according to the VAS (Visual Analogue Scale) and anxiety as a personality trait was determined with STAI-T (State Trait Anxiety Inventory). Pain perception as well as anxiety were compared according to COMT genotypes. Results: In the 181 pregnant women there were 40 women (22%) of wild homozygotes (GG) of COMT, 95 women (53%) of mutant heterozygotes (GA), and 46 women (25%) of mutant homozygote (AA). A negative association of pain perception with the GA (mutant heterozigote) polymorphism of the COMT gene versus the wild type (GG polymorphism) was observed. The GA polymorphism of the COMT gene was associated with 0.46 units lower pain perception compared to the wild type (GG). The anxiety trait score in group AA was lower than in groups GA and AA. The difference reached statistical significance only when comparing AA versus GA (P&gt;0.042). Analgesic efficacy of nitrous oxide was noticed in 22% of labouring women who reported moderate pain (VAS score 4-7). Conclusions: The COMT gene polymorphism was associated with pain perception and anxiety among labouring women. The COMT gene polymorphism GA was associated with negative pain perception among labouring women. Nitrous oxide showed statistical significance in anxiolytic efficacy during labour in women with mild anxiety as a personality trait. Anxiolytic efficacy of nitrous oxide has shown better efficacy in labouring women with the COMT gene polymorphism AA.

During the pandemic, assisted reproductive treatments suffered from major disruptions in their terms due to the restrictions imposed. The objective of this study is to evaluate the level of anxiety of women whose treatments were either suspended or delayed. Methods: Descriptive cross-sectional study conducted between April and May 2020. The State-Trait Anxiety Inventory was applied in a Spanish adapted version. The research also included social, personal, and work aspects which may be involved in the challenging situation. Results: A total of 115 patients participated in the study (73.7%). Women showed a mean in trait anxiety of 17.79 (SD = 8.80) and a mean in state anxiety of 19.95 (SD = 9.08). Neither the type of treatment nor the time of infertility are predictors of trait anxiety or state anxiety. More age pressure and more worry were associated with more trait and state anxiety (p&lt;0.001). The most common emotional reactions to discontinuation of fertility treatments were sadness and anxiety. Conclusions: Discontinuation of fertility treatments due to confinement restrictions had a negative impact on the mental health of women who were following a process of assisted reproduction treatment, increasing their levels of emotional distress and anxiety.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

Background and Objectives: The current study aimed to determine the impact of fasciotomy on mortality and morbidity in children and adults with crush-related AKI following the 2023 Kahramanmaraş earthquakes. Materials and Methods: The study included individuals who had suffered crush injuries after the 2023 Kahramanmaraş earthquakes and were identified as having acute kidney injury (AKI). Patients with AKI were divided into two groups based on age: those under 18 years and those over 18 years. A comparative analysis was conducted between the mortality and morbidity rates of patients who underwent fasciotomy and those who did not. Disseminated intravascular coagulopathy (DIC), sepsis, and adult respiratory distress syndrome (ARDS) have all been identified as contributors to morbidity. Results: The study was conducted with a total of 40 patients (21 males and 19 females) aged between four and 83 years. A total of 21 patients underwent fasciotomy and the patients underwent varying numbers of fasciotomy, ranging from zero to 11. The mortality rate was 12.5%, corresponding to five adult patients. No instances of mortality were reported in the paediatric cohort. The application of fasciotomy in instances of crush-induced AKI did not result in elevated levels of mortality in either the paediatric or adult demographic. Within the adult population, a substantial difference in the duration of dialysis was observed between individuals who underwent fasciotomy and those who did not. A statistically significant increase in the number of fasciotomy incisions was observed in patients diagnosed with sepsis compared with those without sepsis. The study found a significant positive correlation between the number of fasciotomy incisions and dialysis days. Conclusions: Neither adult nor paediatric patients with crush-induced AKI showed an increased risk of death after fasciotomy. The number of fasciotomy incisions significantly correlated with the development of sepsis. Despite experiencing delays in hospital admission for paediatric patients, the incidence of both crush syndrome and mortality rates among children remained relatively low.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Many researches have identified that adverse childhood experiences (ACEs) are associated with non-suicidal self-injury (NSSI) and suicidality. However, most studies have been restricted to a few types of ACEs. This study aims to investigate associations of 13 common types of ACEs with NSSI, suicidal ideation (SI) and suicide attempt (SA), as well as the mediation of depressive and anxiety symptoms therein. A total of 1771 students aged 11-16 years who participated in the baseline survey of the Chinese Adolescent Health Growth Cohort study were included for the analysis. ACEs, SI, SA, depressive and anxiety symptoms were recorded by standard questionnaire. Of included participants, 92.0% reported one or more category of ACEs. Smoking, parent-child separation, emotional abuse, physical abuse and being bullied were positively associated with NSSI, with the adjusted odds ratio (aOR) of 2.41(95%CI, 1.01-5.75), 1.80(1.28-2.54), 1.69(1.21-2.37), 2.08(1.44-3.01) and 1.87(1.35-2.59), respectively; smoking (4.03, 1.66-9.81), parent-child separation (1.42, 1.07-1.90), emotional abuse (1.91, 1.41-2.59), physical abuse (1.80, 1.27-2.57), emotional neglect (1.78, 1.28-2.49) and being bullied (2.08, 1.54-2.81) were positively associated with SI; smoking(4.30, 1.67-11.10), emotional abuse (2.42, 1.58-3.72) and being bullied (1.75, 1.17-2.60) were positively associated with SA. The associations of ACEs with NSSI, SI and SA were each partially or completely mediated through depressive and anxiety symptoms. Children and adolescents who had experiences of smoking, physical abuse and being bullied during childhood are consistently and independently associated with NSSI and suicidality, and these associations may be largely mediated through depressive and anxiety symptoms.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

A number of recent discoveries suggest close links between anxiety- or probable relief-like behaviors and intracellular signaling molecules controlling morphogenesis in glial cells such as oligodendrocytes (oligodendroglial cells) in the brain, which have protective effects on neuronal cells. In the former behaviors, their intracellular signaling molecules include small GTPase members, some of which mediate cell morphological changes. Rnd2 is one such member, belonging to the Rho family of small GTPases. Despite the currently known functions of Rnd2, the precise roles of Rnd2 in cell morphogenesis and related functions in health and disease states remain to be elucidated. Herein we show that signaling through anxiety-related loss of function of the rnd2 gene is related to the regulation of oligodendroglial cell morphological differentiation in the FBD-102b cell line, which is often utilized as oligodendroglial cell differentiation model. Knockdown of Rnd2 with the clustered regularly interspaced palindromic repeats (CRISPR)/CasRx system or RNA interference has been shown to inhibit morphological differentiation. Similarly, knockdown of Prag1 and Fyn kinase, signaling molecules acting downstream of Rnd2, also blunts differentiation. Rnd2 or Prag1 knockdown also decreases Fyn phosphorylation, which is critical for its activation and for oligodendroglial cell differentiation and myelination. Of note, hesperetin, a citrus flavonoid with protective effects on oligodendroglial cells as well as neuronal ones, can recover the defective differentiation induced by the knockdown of Rnd2/Prag1/Fyn. These results suggest that signaling through Rnd2/Prag1/Fyn is directly associated with normal oligodendroglial cell morphological differentiation. Deficiency of the signaling cascade is recovered by hesperetin, presenting one potential molecular construction underlying anxiety and possible therapeutic targets.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Depression and anxiety are the most common mental health disorders worldwide. Internet-Delivered Cogni-tive Behaviour Therapy (ICBT) can reduce barriers to care for broad cross sections of the population. How-ever, People of Diverse Ethnocultural Backgrounds (PDEGs) other than White/Caucasian underutilize mental health services and are underrepresented in clinical trials of psychological interventions. To address this research gap, we adapted an evidence-based ICBT program for PDEGs. The current pilot study explores the effectiveness, satisfaction, and engagement in the adapted ICBT by PDEGs (N=41) when benchmarked against a sample of PDEGs (N=134) drawn from a previous non-adapted version of the ICBT program. Inntent-to-treat analyses showed that the adapted ICBT program is effective in reducing anxiety and de-pression symptoms among PDEGs. Large within-group pre-to-post-treatment Cohen’s effect sizes of d = 1.23, 95% CI [0.68, 1.77] and d = 1.24, 95% CI [0.69, 1.79] were found for depression and anxiety, respectively. Further, 81.8% of the PDEGs who received the adapted ICBT program reported high overall satisfaction, 90.9 % reported increased confidence in managing symptoms, and 70.7% of participants completed the ma-jority of the psychoeducational lessons in the ICBT program. No statistically significant differences in clinical outcomes, engagement, and satisfaction were found between the pilot study and benchmark sample. Future directions for ICBT research with PDEGs are described.

The launch of Open AI's chatbot, ChatGPT, has generated a lot of attention and discussion among professionals in several fields. Many concerns and challenges have been brought up by researchers from various fields, particularly in relation to the harm that using these tools for medical diagnosis and treatment recommendations can cause. Additionally, it has been debated if ChatGPT is dependable, efficient, and helpful for clinicians and medical professionals. Therefore, in this study, we assess ChatGPT's effectiveness in providing mental health support, particularly for issues related to anxiety and depression, based on the chatbot's responses and cross-questioning. The findings indicate that there are significant inconsistencies and that ChatGPT's reliability is low in this specific domain. As a result, care must be used when using ChatGPT as a complementary mental health resource.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Diabetes and mental disorders have been recognized as two significant public health concerns globally. Recent research indicates that there is a bidirectional relationship between these two conditions, with each influencing the other's course and outcomes. Nutrition plays an essential role in the prevention and treatment of both mental disorders and diabetes. A comprehensive review of existing literature was conducted to examine the impact of anxiety and depression on the development of diabetes and the influence of diabetes on the occurrence of mental health disorders such as anxiety and depression. Additionally, the effects of nutrition on the prevention and management of mental disorders, diabetes, and related complications in at risk individuals were assessed. Our findings show that mental disorders, such as depression and anxiety increase the risk of developing type 2 diabetes and are associated with poorer glycemic control, increased diabetes-related complications, and higher mortality rates. Conversely, diabetes is also linked with an increased risk of developing mental health disorders, including depression, anxiety, and cognitive decline. The biological, psychological, and social factors that contribute to the comorbidity between these two conditions are complex and multifaceted. Therefore, an integrated approach to the management of both conditions is critical for improving patient outcomes and reducing the overall burden of disease. Nutritional interventions should be utilized to reduce the risk of diabetes in patients with anxiety and depression as well as enhance mental health in patients with diabetes.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

We previously showed that mice with knockout in the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) gene encoding the PGC-1a protein and nuclear factor erythroid 2 like 2 (NFE2L2) gene, showed some features of the age-related macular degeneration (AMD) phenotype. To further explore the mechanism behind the involvement of PGC-1a in AMD pathogenesis we used young (3-month) and old (12-month) mice with knockout in the PPARGC1A gene and age-matched wild-type (WT) animals. An immunohistochemical analysis showed age-dependent different expression of markers of oxidative stress defense, senescence and autophagy in the retinal pigment epithelium of KO animals as compared with their WT counterparts. Multivariate inference testing showed that senescence and autophagy proteins had the greatest impact on the discrimination between KO and WT 3-month animals, but proteins of antioxidant defense also contributed to that discrimination. A bioinformatic analysis showed that PGC-1a might coordinate the interplay between genes encoding proteins involved in antioxidant defense, senescence and autophagy in the aging retina. These data support importance of PGC-1a in AMD pathogenesis and confirm the utility of mice with PGC-1a knockout as an animal model to study AMD pathogenesis.

Nutrition, diabetes, and mental disorders are interconnected and significantly impact an individual's overall health and well-being. This comprehensive review aims to explore the complex interplay between nutrition, diabetes, and mental disorders, highlighting the latest research findings in this field. While the influence of nutrition on the development and management of both diabetes and mental disorders is widely recognized, there remains a gap in understanding the intricate interplay between nutrition, mental health, and diabetes. Diabetes is associated with an increased risk of mental disorders, including depression, anxiety, and cognitive decline. Mental disorders can also contribute to the development of diabetes through various mechanisms including increased stress, poor self-care behaviors, and adverse effects on glucose metabolism. Thus, the mechanisms linking nutrition, diabetes, and mental disorders are complex and multi-factorial. Inflammation, oxidative stress, gut microbiota alterations, and neuroendocrine dysregulation have emerged as potential pathways that may mediate the relationship between nutrition, diabetes, and mental disorders. Additionally, deficiencies in essential nutrients such as omega-3 fatty acids, vitamin D, B vitamins, zinc, chromium, magnesium, and selenium have been implicated in the pathogenesis of both diabetes and mental disorders. Our findings indicate that the use of personalized dietary interventions and targeted nutrient supplementation can improve metabolic and mental health outcomes in patients with type 2 diabetes.

The purpose of this systematic review is to examine the various articles published in the field of neuropsychology of anxiety research in terms of publication type and volume, methodology, and subject matter. The significance of this topic derives from the clinical and functional consequences of cognitive symptoms. Generalized anxiety disorder refers to the cluster of clinical symptoms characterized by predominant anxious anticipation and difficulty controlling worry. In order for the review to be systematic and reproducible, a search of the PsycINFO, Scopus, PubMed, Elsevier databases and an analysis using the PRISMA method are suggested. After analyzing the research data, empirical studies evaluating the clinical neuropsychology of generalized anxiety disorder are discussed.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Cancer patients may experience significant distress. The “Emotion Thermometers” (ETs) are a short visual analogue scale used to screen patients for psychosocial risk. This study aimed to assess emotional distress in a large sample of cancer patients attending psychological services at an NGO, and to explore factors that may contribute to it. The ETs were answered by 899 cancer patients. They were, on average, 59.9 years old, the majority were female, had breast cancer, were under treatment or were disease-free survivors, and reported high levels of emotional distress, above the cut-off (≥5). A Generalized Linear Model was used to measure the association between the level of Distress and 33 items of the problem list. Four items - sadness, depression, sleep and breathing - were found to be significantly related to a higher level of Distress. Additionally, women and those who were in the palliative phase also had significantly higher levels of Distress. Conclusions: The results confirm the need for early emotional screening in cancer patients, as well as the relevance of attending to the characteristics of each patient. Additionally, they highlight the utility of the ETs for the clinical practice, allowing to optimize the referral to specialized psy-chosocial services.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Cumulative exposure to multiple early life stressors are expected to affect behavioral development causing increased susceptibility towards neuropsychiatric disorders. The present study was designed to mimic such conditions in rat model to study behavioral impairments during adolescence and adulthood. Female Wistar rats (n=32; 140-150 gm) were switched to low protein (LP; 8% protein) or Control (20% protein) diet, 15 days prior to conception and then diet regime was maintained throughout the experimental period. Pups born to Control and LP dams were intraperitoneally injected with deltamethrin (DLT-pyrethroid insecticide; 0.7mg/kg body weight; PND 1 to 7) or lipopolysaccharide (LPS-bacterial endotoxin; 0.3mg/kg body weight; PND 3 and 5) or DLT+LPS, on designated days forming 8 experimental groups (Control, LP, Control+LPS, LP+LPS, Control+DLT, LP+DLT, Control+DLT+LPS and LP+DLT+LPS). Neurobehavioral assessments were performed in F1 rats (1, 3, 6 months) by Open field, Elevated plus maze, Light and Dark box, and Rotarod tests. LP rats were found to be more susceptible to either singular or cumulative exposure as compared to their age matched control counterparts, showing significantly severe behavioural abnormalities, as hyperactivity, attention deficits, impulsiveness and low anxiety, the hallmark symptoms of neuropsychiatric disorders like schizophrenia and ADHD, suggesting thereby that early life multi-hit exposure may predispose individuals to developmental disorders.

Visual impairment and blindness are a growing public health problem, as they reduce the quality of life of millions of people. The management and treatment of these diseases represent a scientific and therapeutic challenge, since the different cellular and molecular actors involved in the pathophysiology are still being identified. The visual system components, particularly the retinal cells, are extremely sensitive to genetic or metabolic alterations, and immune cells activated by insults contribute to biological events that culminate with vision loss and irreversible blindness. Several ocular diseases are linked to retinal cell loss, and diseases such as retinitis pigmentosa, age-related macular degeneration, glaucoma and diabetic retinopathy are characterized by pathophysiological hallmarks that represent possibilities to study and develop novel treatments for retinal cells degeneration. Here, we present a compilation of revisited information on retinal degeneration, including pathophysiologic and molecular features, biochemical hallmarks and possible directions for novel treatments, aiming to assist as a guide for innovative research. The expansion of knowledge of the mechanistic bases of the pathobiology of eye diseases, including information on the complex interactions of genetic predisposition, chronic inflammation, and environmental and aging-related factors will allow the identification of new therapeutic strategies.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Background: Previous research studies have suggested the importance of studying the relationship between emotional regulation and sleep habits. Some investigations have especially focused on how emotional regulation could impact sleep habits in children and adolescents. Therefore, these researchers have stated there exists a two-way direction in this relationship. Objective: This study aimed to analyze the influence of emotional regulation on sleep habits in Spanish children and adolescents, and the mediating role of anxiety in this relationship. Method: Participants were 953 Spanish parents who completed the assessment protocol according to their children and adolescents’ information. Results: The results revealed moderate-strong correlations between emotional regulation problems and sleep habits disturbances (r=0.375, p&lt;0.001), trait (r=0.488, p&lt;0.001) and state (r=0.589, p&lt;0.001) anxiety. Also, emotional regulation showed a direct impact on sleep habits (β=0.011, p=0.005). Trait and state anxiety demonstrated a significant mediating role in the relationship between emotional regulation and sleep habits. Conclusions: Emotional regulation may have an impact on sleep habits during childhood and adolescence, suggesting the importance of early intervention focused on the emotions management and the prevention of sleep habits disturbances.

Aim: This study aimed to investigate the relationship between dental caries, dental anxiety, and salivary cortisol levels in children visiting pediatric dental clinics and their implications on pediatric oral health. Materials and Methods: A cross-sectional study was conducted at a dental university in the UAE. A total of 60 children, aged 4-12 years, were included. Salivary cortisol levels were measured using an Enzyme-Linked Immunosorbent Assay (ELISA) kit. Dental caries status was evaluated, and dental anxiety levels were assessed using the Modified Dental Anxiety Scale (MDAS). Statistical analyses, including Mann-Whitney U test and Pearson's correlation coefficient, were performed to determine significant differences and associations. Results: The study group showed significantly higher salivary cortisol levels compared to the control group (p<0.0001). A strong positive correlation was found between salivary cortisol levels and dental caries status (p<0.001). However, no significant difference in dental anxiety levels was observed between the study and control groups (p=0.85). A strong positive correlation was found between dental anxiety levels and dental caries status (p<0.001). Conclusion: The findings indicate a significant association between salivary cortisol levels and dental caries, suggesting that higher cortisol levels are associated with active caries. Dental anxiety levels were positively correlated with dental caries. Understanding the relationship between these variables can contribute to better oral health strategies and interventions for children, emphasizing the importance of managing dental anxiety and stress in pediatric dental care. Clinical Significance: This study highlights the potential of salivary cortisol as a biomarker for assessing stress and its impact on oral health in children. By addressing dental anxiety and stress, dental professionals can provide child-friendly dental care, enhance preventive measures, and improve oral health outcomes in pediatric patients.

Lipofuscin accumulates with age as intracellular fluorescent granules originating from incomplete lysosomal digestion of phagocytosed and autophagocytosed material. The purpose of this review is to provide an update on the current understanding of the role of oxidative stress and/or lysosomal dysfunction in lipofuscin accumulation and its consequences, particularly for retinal pigment epithelium (RPE). Next, the fluorescence of lipofuscin, spectral changes induced by oxidation, and its contribution to retinal fluorescence are discussed. This is followed by reviewing recent developments in fluorescence imaging of the retina, and the current evidence on the prognostic value of retinal fluorescence for the progression of age-related macular degeneration (AMD), the major blinding disease affecting elderly people in developed countries. The evidence of lipofuscin oxidation in vivo, and the evidence of increased oxidative damage in AMD retina ex vivo lead to the conclusion that imaging of spectral characteristics of lipofuscin fluorescence may serve as a useful biomarker of oxidative damage which can be helpful in assessing the efficacy of potential antioxidant therapies in retinal degenerations associated with accumulation of lipofuscin and increased oxidative stress. Finally, amendments to currently used fluorescence imaging instruments are suggested, to be more sensitive and specific for imaging spectral char-acteristics of lipofuscin fluorescence.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

The COVID-19 pandemic has exerted a significant impact on mental health globally. The uncertainty, fear, and stress associated with this crisis have contributed to a heightened prevalence of anxiety, depression, and various other mental health disorders. In this scenario, the present study aimed at investigating the relationship between locomotion regulatory mode, resilience, and COVID-19 anxiety. It is worth noting that previous extensive research has established a significant correlation between high levels of locomotion and diverse positive psychological conditions, such as optimism, reduced hopelessness, and positive affect. A total of 243 participants completed measures of locomotion regulatory mode, resilience, and COVID-19 anxiety. In line with our hypotheses, individuals' locomotion regulatory mode was negatively, although non significatively, associated with COVID-19 anxiety. Furthermore, resilience was found to mediate the relationship between locomotion regulatory mode and COVID-19 anxiety, indicating that individuals displaying high locomotion may be better equipped to cope with the stress and uncertainty of the COVID-19 pandemic due to their greater levels of resilience. Taken together, these findings highlight the importance of considering both locomotion and resilience in managing anxiety related to COVID-19 and suggest that interventions aimed at enhancing resilience may be beneficial particularly for individuals with low locomotion regulatory mode.

Introduction: Lack of certainty or knowledge in health professions generates uncertainty, affecting clinical practice in decision-making (diagnostic or therapeutic), intervention design and therapeutic communication. In nursing, the lack of information to predict prognosis and outcome of interventions generates uncertainty: recognizing and managing it is essential for individualized, safe, and effective care. Objective: to assess uncertainty and the perception of a debriefing within the same shift ("intrathoracic pass") as a proposal for improvement. Method: ad-hoc survey of nursing professionals and Auxiliary Nursing Care Technicians (ANC). Variables: age, work experience, PRU scale (Physisicians' Reactions to Uncertainty) and additional question on intrathoracic pass. Results: Sample: 61 nurses and 10 TCAE (90.14 % female, 9.86 % male; mean age 35.18, standard deviation SD=13.04). Mean professional experience 11.74 years (SD=12.21); 56.33% had ≤4 years of experience. Origin: 49.30% Intensive Care Units (ICU), 11.27% Hospitalization, 7.04% Emergency, 1.41% Primary Care and 30.99% Other Services. The mean level of uncertainty was 27.99 points (max. possible 75; SD=7.50), with stress (mean=25.55, max. possible: 40; SD=5.24) and anxiety (mean=15.80, max. possible: 25; SD=3.05) as major manifestations. The association uncertainty-age (r=0.339; p=0.004) and uncertainty-experience (r=0.391; p=0.001) correlated negatively (the older and more experienced, the less uncertainty), with no significant differences between degrees or services. 91.55% stated that the intra-day pass was useful to reduce uncertainty during the working day. Conclusion: Uncertainty is frequent in nursing, and implementing the intrashift pass is perceived as a competent strategy.

Introduction: The primary objective of researchers in the biology of ageing is to gain a comprehensive understanding of the ageing process while developing practical solutions that can enhance the quality of life for older individuals. This involves a continuous effort to bridge the gap between fundamental biological research and its real-world applications. Purpose: In this narrative review, we attempt to link research findings concerning the hormetic relationship between neurons and germ cells, and translate these findings into clinically relevant concepts. Methods: We conducted a literature search using PubMed, Embase, PLOS, Digital Commons Network, Google Scholar and Cochrane Library from 2000 to 2023, analyzing studies dealing with the relationship between hormetic, cognitive, and reproductive aspects of human ageing. Results: The process of hormesis serves as a bridge between the biology of neuron-germ cell interactions on one hand, and the clinical relevance of these interactions on the other. Details concerning these processes are discussed here, emphasizing new research which strengthens the overall concept. Conclusions: This review presents a scientifically and clinically relevant argument, claiming that maintaining a cognitively active lifestyle may decrease age-related degeneration, and improve overall health in ageing.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

The concept of ecosystem services (ESs) provides a valuable approach to communicate societies' dependence on natural ecosystems, assisting in the evaluation of measures to protect vegetation in watersheds that promote water-related ESs. Vegetation cover and land use are important factors related to the capacity of ecosystems to provide soil loss regulation and sediment retention services, which are highly relevant for sediment management in watersheds draining into reservoirs with multiple water uses. This study aims to assess the relationship between potential changes in land use and land cover and the sediment retention service provided by riparian vegetation in a watershed draining into a hydroelectric reservoir in the Brazilian Cerrado. Sediment load was selected as a physical variable that affects different water uses in reservoirs, with these uses being dependent on the quality or quantity of stored water. Scenarios were analyzed to represent landscape reconfigurations from a baseline condition in order to account for the recovery of riparian vegetation by the agricultural sector, as foreseen in the Brazilian Forest Code. To map and quantify variations in annual sediment retention, the InVEST model was used, which allows estimating an integrated response of the drainage basin to large-scale land use changes over time and space. The results show that for the drainage basin of the Corumbá IV Hydroelectric Power Plant (HPP), the recovery of riparian areas occupied by annual crops has the potential to generate greater benefits to water use in the reservoir. In the studied catchment area, 14% of the total vegetation deficit in riparian areas is occupied by crops, while 86% is occupied by pastures. This highlights the buffering role of riparian vegetation as an effective practice for managing sediment flows originating from sheet erosion in agricultural landscapes. The methodology employed in this study allows for the quantification and mapping of the effects of soil and water conservation measures in river basins. This enables the prioritization of sectoral efforts for the restoration of native vegetation, considering the highest returns in benefits perceived by water users affected by sediment input in reservoirs. The study's results reinforce the importance of conserving vegetation in riparian areas and their surroundings for sediment retention, highlighting the role of these areas as assets in providing water-related ecosystem services.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

Abstract Background: Parkinson's disease (PD) is a neurodegenerative disorder featured with motor and non-motor deficits. Using 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) induced dopamine neuron degeneration has been widely used to produce reliable animal models of the PD. However, most of previous preclinical studies focused on the motor dysfunctions, few non-motor symptoms were evaluated. So far there is a lack of comprehensive investigation of the non-motor symptoms in animal models. Objectives: In this study, we aim to use a battery of behavioral methods to evaluate the non-motor symptoms in MPTP-induced non-human primate PD models. Methods: Cognitive functions, sleep and psychiatric behaviors were evaluated in MPTP-treated cynomolgus monkeys. The tests consisted of delayed matching-to-sample (DMTS), physical activity monitor (PAM), apathy feeding task (AFT), human intruder test (HIT), novel fruit test (NFT) and predator confrontation test (PCT). In addition, we tested whether the dopamine receptor agonist pramipexole (PPX) will improve these non-motor symptoms. Results: The present results show that the MPTP-treated monkeys exhibited cognitive deficits, abnormal sleep, and anxiety-like behaviors as compared to the control monkeys. These symptoms were relieved partially by PPX. Conclusions: These results suggest that MPTP-induced PD monkeys displayed non-motor symptoms that were similar to those found in PD patients. PPX treatment showed moderate therapeutic effects on these non-motor symptoms. This battery of behavioral tests may provide a valuable model for future preclinical research.

Background: Studying anxiety, stress and the selection of coping strategies in the COVID-19 pandemic is necessary to minimize the adverse changes associated with the risk of infection and the consequences of the disease. Objective: To investigate the level of anxiety, stress perception and coping strategies in relation to the presence of illness. Material and Methods: The anonymous cross-sectional online survey was conducted among 3950 university students of northeastern Poland (1822), Lithuania (232) and the Russian exclave of Kaliningrad (1896). Due to the almost identically applied anti-epidemic measures, the respondents were treated as a unified group. The State-Trait Anxiety Inventory, Perceived Stress Scale-10 and Coping Orientations to Problems Experienced questionnaires were used. Results: Among 1212 men and 2738 women, COVID-19 was diagnosed in 348 (28.7%) and 1020 (37.3%) individuals, respectively, according to the clinical protocol. The prolonged nature of the process and the longer consequences of the disease were indicated by an increase in anxiety levels. Conclusions: The risk of possible infection and coping with illness required the adoption of active anti-stress strategies, which was observed regardless of going through the disease. Convalescents differed from non-diseased individuals in having higher levels of concern about their own emotions and their more frequent turn to religion, notably among the females. The repertoire of strategies among women was broader, with elevated levels of helplessness and avoidance seen as integral strategies.

Background: Physical and mental health of corporate employees is equally important, especially in international salespeople in the in vitro diagnostic (IVD) medical device industry. The rapid growth of the IVD market is driven by the increasing prevalence of chronic and infectious diseases. This study aims to identify the association of socio-demographic, occupational, organizational, and psychosocial factors with mental health outcomes for depression, anxiety, and somatic symptoms in Chinese IVD international salespeople. Methods: The study was a cross-sectional survey of ISs in IVD companies officially registered in China. An online survey was designed to collect data through email contact with IVD companies and social media between August 2022 and March 2023. Measured factors included effort-reward imbalance (ERI), health-promoting leadership (HPL), health climate (HC), inner strength (IS), and perceived social support (PSS). Mental health outcomes assessed using the Core Symptom Index (CSI) were depression, anxiety, and somatic symptoms. Results: A total of 244 salespeople responded to the survey. CSI scores indicated that 18.4% (n = 45) and 10.2% (n = 25) of the respondents had symptoms of major depression and anxiety, respectively. ERI was positively correlated, while the IS and PSS were negatively correlated with major depression, anxiety, and somatic symptoms (p < .01). Health climate was negatively correlated with major depression (p < .05). Education background was associated with somatic symptoms (p < .05). ERI, IS, and gender were significant predictors of major depression, anxiety, and somatic symptoms (p < .05). Conclusion: The prevalence of depression and anxiety in China’s IVD international salespeople was considered low compared with prevalence in Chinese populations during COVID-19, but higher than those before the pandemic. Effort–reward imbalance, inner strength, and gender were significant factors in major depression, anxiety, and somatic symptoms among IVD international salespeople.

Purpose: To clarify the mechanism of state anxiety on intertemporal decision-making, two studies were conducted to investigate the role of trait anxiety and inhibitory control. Study 1 examined the moderating effect of trait anxiety. Study 2 continued to investigate the mediating effect of inhibition control on the basis of study 1. Methods: A total of 266 Chinese college students participated. Participants’ state anxiety, trait anxiety and intertemporal decision-making were measured by questionnaires (scales) respectively. And inhibition control was evaluated by two-choice oddball paradigm. Results: The results of Study 1 indicated that state anxiety could predict intertemporal decision-making and that the moderating effect of trait anxiety on this relationship was significant. Study 2 found that inhibitory control could completely moderate the relationship between state anxiety and intertemporal decision-making and that this indirect effect was affected by trait anxiety. Conclusion: 1)Individuals with higher trait anxiety are more inclined to make more impulsive and intertemporal decisions when they have a high level of state anxiety; 2)state anxiety allows inhibitory control ability to have a further effect on intertemporal decision-making; and 3)the higher trait anxiety in individuals, the stronger mediating effect of inhibitory control on the relationship between state anxiety and intertemporal decision-making.

Entering University is an important transition for students. Requires adaptation and can influence academic success. Psychological disorders might emerge when difficulties like anxiety occur due to insecurity about emotions in a student's life. We are currently living in post-pandemic conditions where pressure is increasing. The project "Toolbox: University Student – Web-interactive Platform", a platform for learning anxiety management, was developed to address this problem among university students. The main objective is to understand whether using the platform (based on cognitive behavioral theory) has effectively managed anxiety among students. It is a case study with a sample of 31 students from two Portuguese Universities, aged between 19 and 47 years. They were divided into two groups: intervention (n=17) and control (n=13). The results show that participants subjected to intervention with the interactive platform decreased their anxiety.

Background: The novel coronavirus (COVID-19) infection is primarily transmitted through respiratory droplets from an infected person and contact with tainted surfaces or items. Social distancing became the primary measure of preventing the spread of COVID-19, with the principal aim being to reduce the probability of contact with an already infected person. Social distancing can be distressing, as it is against the community's way of life. Saudi Arabia imposed a curfew and suspended all religious, entertainment, sporting, and mass congregations. The daily updates on COVID-19 infection and mortality are upsetting and further, aggravate depression and anxiety. With this background, this study was planned with the following objectives. To determine the sociodemographic profile of the study participants, to find the prevalence of psychological morbidity, and to measure the association between the sociodemographic details, COVID-19 associated factors, and psychological effects among Abha citizens during the COVID-19 pandemic. Methodology: A descriptive cross-sectional community-based study was conducted in the Abha city population from August 2021 to July 22. This study followed snowball sampling, the data was collected using an online Google form the link was shared in WhatsApp groups and through emails to contacts, asking friends to share it with their friends, until reaching the adequate sample size the responses were accepted. Results: A total of 530 participated, and their age ranged from 19 -70 years. Many of the participants (34.5%, n=183) belonged to 36-45 years old. Most of the responders were 69.8% married and Females (69.2%, n=367). Half of the participants had been quarantined (49.6%), and 51.5% were scared from fear of COVID-19. 64.8% of the participants had depression; 14.2%, 20.8%, 13.6%, and 16.2% had mild, moderate, severe, and extremely severe depression, respectively. Around 58.2% of participants suffered from anxiety; 5.8% experienced mild anxiety, 21.7% moderate anxiety, and 30.7% severe anxiety. The proportion of stress among the participants was 45.0%; 10.8% had mild stress, 9.4% had moderate stress, and 24.5% had severe to extremely severe stress. Conclusions: COVID-19 poses mental health problems among individuals and communities. There is a need to find the more susceptible individuals for mental health issues or other psychological disorders. Mental health and psychological problems can be resolved with health education, counseling, and appropriate interventions to curb the negative health impacts of COVID-19.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.