Accurately estimating a person's age is crucial for identity verification at all critical checkpoints, including airports, land borders, and seaports. Human gait may be used as a biometric identifier and indicator of age, among other things. This study aims to develop methods for estimating a person's age by observing their walk. In this paper, a novel technique for preprocessing the proposed gait dataset has been used by utilizing a combination of the gait energy image (GEI), the accumulated frame difference energy image (AFDEI), and the invariant moment of the image. The proposed technique outperformed state-of-the-art methods in terms of accuracy. The proposed method was tested and evaluated using a convolutional neural network (CNN), and it achieved an average accuracy of 90.35% across 14 different view angles within 5 K-Fold, the proposed method resulted in 94.68% and 94.54% in 30º and 75º view degree respectively. concluding that the approach is effective and promising for estimating age using human gait.

(1) Background: Breast cancer is the second leading cause of cancer death among women. The accurate prediction of survival intervals will help physicians make informed decisions on treatment strategies or the use of palliative care for patients; (2) Methods: The gene expression is predictive and correlates to patient prognosis. To establish a reliable prediction tool, we collected the RNA-seq data of breast cancer patients, a total of 1187 RNA-seq data (median age 58 years), in FPKM format from the TCGA database. Among them, 144 RNA-seq data with date of death information was selected to establish the SaBrcada-AD dataset. We first normalized the SaBrcada-AD dataset to transcripts per million (TPM) to build survival prediction model SaBrcada. After normalization and dimension raising, the differential gene expression data were used for testing eight different deep learning architectures. Among them, GoogLeNet performed the best. Considering the effect of age on prognosis, we examined all ages between the lower and upper quartiles of patient age for a stratified random sampling test; (3) Results: Stratifying by age based on a cut-off of 61 years of age improved the accuracy of SaBrcada compared to previous findings, resulting in an accuracy of 0.798. We also built a free website tool to provide 5 kinds of predicted survival period information for clinician reference; (4) Conclusions: We established a breast cancer survival analysis prediction model, SaBrcada, and a website tool with the same name. Through this highly reliable survival analysis model and website tool, information on survival intervals will be provided for clinicians as part of precision medicine.

In this paper, using the discrete time model, we consider the average age of all files for a cached-files-updating system where a server generates N files and transmits them to a local cache. In order that the cached files are fresh, in each time slot the server updates files with certain probabilities. The age of one file or its age of information (AoI) is defined as the time the file stays in cache since it was last time sent to cache. Assume that each file in cache has corresponding request popularity. In this paper, we obtain the distribution function of the popularity-weighted average age over all files, which gives a complete description of this average age. For the random age of single file, both the mean and its distribution have been derived before by establishing a simple Markov chain. Using the same idea, we show that an N dimensional stochastic process can be constituted to characterize the changes of N file ages simultaneously. By solving the steady-state of the resulting process, we obtain the explicit expression of stationary probability for an arbitrary state-vector. Then, the distribution function of the popularity-weighted average age can be derived by mergering a proper set of stationary probabilities. For the possible applications, the distribution function can be utilized to calculate the probability that the average age violates certain statistical guarantee.

Purpose: Perceptual learning and production practice are basic mechanisms that children depend on to acquire adult levels of speech accuracy. In this study, we examined perceptual learning and production practice as they contributed to changes in speech accuracy in three- and four-year-old children. Our primary focus was manipulating the order of perceptual learning and baseline production practice to better understand when and how these learning mechanisms interact. Method: Sixty-five typically-developing children between the ages of three and four were included in the study. Children were asked to produce CVCCVC nonwords like /bozjəm/ and /tʌvtʃəp/ that were described as the names of make-believe animals. All children completed two separate experimental blocks: a baseline block in which participants heard each nonword once and repeated it, and a test block in which the perceptual input frequency of each nonword varied between 1 and 10. Half of the participants completed a baseline-test order; half completed a test-baseline order. Results: Greater accuracy was observed for nonwords produced in the second experimental block, reflecting a production practice effect. Perceptual learning resulted in greater accuracy during the test for nonwords that participants heard 3 or more times. However, perceptual learning did not carry over to baseline productions in the test-baseline design, suggesting that it reflects a kind of temporary priming. Finally, a post hoc analysis suggested that the size of the production practice effect depended on the age of acquisition of the consonants that comprised the nonwords. Conclusions: The study provides new details about how perceptual learning and production practice interact with each other and with phonological aspects of the nonwords, resulting in complex effects on speech accuracy and learning of form-referent pairs. These findings may ultimately help speech-language pathologists maximize their clients’ improvement in therapy.

The incidence of cancer in organ transplant patients is higher than in the non-transplanted population. The incidence increases with increasing age. The use of Fludeoxyglucose positron emission tomography/CT (PET/CT) is sensitive and specific to detect PTLD LD compared with conventional CT imaging. We analyzed the medical data of 127 patients aged over 60 years, who underwent heart transplantation in the above period, who have been practicing early CT-PET for diagnostic purposes between February 2007 and October 2018. Of 127 consecutive patients who underwent CT-PET, SUVs up than 4, were found in 84 patients of which 20 were affected by PTLDs, seven patients were affected by chronic non neoplastic inflammatory diseases, the remainder were affected by other neoplasms. The favorable effect of physical activity programs on cardiorespiratory and psychomotor function occur in all patients. In conclusion, CT-PET at the first doubts about the possibility of the development of neoplasms has allowed a diagnosis and then a treatment more quickly. Education in behavioral norms that improve the patient's quality of life is necessary.

Pomegranate peel is a natural source of phenolics, claimed to possess healing properties, among which antioxidant and antidiabetic. In line with this evidence, the ethyl acetate PGE extract, obtained by Soxhlet from the peel of Dente di cavallo DC2 variety and characterized by a 4% amount of ellagic acid, has been studied for its hypoglycemic, antiglycation and antioxidative cytoprotective properties, in order to support a possible further nutraceutical interest. The α-amylase and α-glucosidase enzyme inhibition, interference with advanced glycation end-products (AGE) formation and metal chelating abilities were evaluated as hypoglycemic mechanisms. Also, considering that oxidative stress is associated with hyperglycemia complications, PGE antioxidant cytoprotective properties under hyperglycemic conditions were assayed. Phenolic profile was characterized by integrated chromatographic and spectrophotometric methods. Under our experimental conditions, PGE strongly inhibited the tested enzymes, especially α-glucosidase, and exerted chelating and antiglycation properties. Also, it reduced both ROS and GSH levels under hyperglycemic conditions, thus suggesting its ability to support cell functions by counteracting intracellular oxidative stress. Along with ellagic acid, rutin was the major identified flavonoid (about 4 %) of PGE. Present results suggest PGE to be a possible remedy for hyperglycemia management and encourage further studies to exploit its promising properties.

In some cases, the human impact on ancient landscapes has been so profound that local soils still remain significantly affected even after hundreds and thousands of years after ending impact. We studied the Late Bronze Age Muradymovo settlement located in Urals, Russia, aiming to estimate the consequences of the ancient people activity for environment. Despite the present humid climate, the modern soils inside the cultural layer of the study site contain more than 27% of gypsum at a depth of just 10 cm from the surface, and a microrelief of the study site is typical of a gypsum desert. The nearby background Chernozems are gypsum-free to a depth of 2 meters. According to the archaeological data, the ancient people belonged to the ‘Srubno-Alakul’ archaeological culture (1750–1350 yrs BC cal) and had a tradition of building their houses from gypsum rocks. At the present time, this area is still unsuitable for human settlement. The properties of modern soils inside the cultural layer of the study site are directly affected by the Late Bronze Age human activities. It has been identified on soil morphology, micromorphology and chemical properties of soils developed inside the cultural layer of the settlement.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] > 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p < 0.05) in scores by health/bonding groups. Convergent validity was supported (r > 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Gold occurrence Maljavr, located in amphibolite metamorphosed rocks in the Uragubsky greenstone belt, is the first gold prospect connected with conglomerates of Archean age, found in the Fennoscandian Shield. Gold mineralization is controlled by a series of lenses of altered rocks in biotite gneiss-metaconglomerate. The age of zircon from biotite gneiss in the zone of alteration is 2665±22 Ma, this is considered as the time of alteration processes. Biotite gneiss and altered rocks were later intruded by tourmaline granite pegmatite at 2508±7Ga, the pegmatite caused recrystallization of sulfide minerals in the altered rocks. Visible gold in association with bismuth minerals native bismuth, ehrigite (the second finding in the world), maldonite, bismuthinite, joseite-B, hedleyite was found exceptionally in polymineral inclusions in recrystallized arsenopyrite and löllingite. The age of pegmatite 2508±7Ma we regard as the time of formation of gold-bismuth mineralization. Geological position of the Maljavr occurrence, the linkage of gold mineralization with pegmatite, geochemical association Au-As-Se-Te-Bi in the mineralized rocks – all these characteristics correspond to intrusion-related gold deposits. Biotite gneiss-metaconglomerate, hosting the mineralized altered rocks, was the probable primary source of arsenic and gold for mineralization.

Keywords: Demographics, Diversity, Gender, Race, Age, Professionals, Built Environment, Construction Industry, South Africa

This in-depth review navigates the intricate relationship between gender, hormonal influences, and the progression of autosomal dominant polycystic kidney disease (ADPKD), highlighting the limited literature on this crucial topic. The study explores the impact of female sex hormones on liver and renal manifestations, uncovering gender-specific differences in disease progression. Actually hormonal therapy in women with ADPKD remains a challenging issue and is a source of concern regarding its potential impact on disease outcomes, particularly at the hepatic level. Notably, women with ADPKD exhibit a slower renal disease progression compared to men, attributed to hormonal dynamics. The review sheds light on the role of estrogen in regulating pathways of the renin-angiotensin-aldosterone system, revealing its complex interplay and implications for cardiovascular and renal health. Therapeutic considerations for fertile women with ADPKD, including contraception options, are discussed, emphasizing the necessity for personalized approaches. In the postmenopausal phase, the review evaluates the role of hormonal replacement therapy, considering its potential benefits and risks in the context of ADPKD. The review concludes by underscoring the imperative need for tailored treatment approaches for ADPKD patients, considering individual risks and benefits. The scarcity of literature underlines the call for further research to enhance our understanding of optimal hormonal therapies in the context of ADPKD, ultimately paving the way for innovative and personalized therapeutic interventions.

This trial was carried out to find out the effects of the parent flocks and the hatching time of broiler chickens on the production traits and bacteriota development of animals. Two times 730 hatching eggs were collected from two different parent flocks with age of 22-23 and 65-66 weeks. In the hatchery both groups were divided into two subgroups, when the day-old chickens were separated according to their hatching time. A feeding trial was carried out afterwards, using the 4 treatments in 6 replicate floor pens, feeding commercial starter, grower, and finisher diets, that contained all the nutrients according to the breeder’s recommendations. The day-old chickens of the parent older flock and those hatched later were heavier and this advantage of the birds remained until end of the production period. The different age and origin of parent flocks failed to modify the microbiological parameters of the chicken’s ceca. However, the hatching time significantly influenced the different bacteriota diversity indices. The late hatched chickens showed higher Bacteroidetes and Actinobacteria and lower Firmicutes abundances at day 11. These treatments resulted differences in the main families, Ruminococcaceae, Lactobacillaceae, Bacteroidaceae. These differences could not be found at day 39.

The coombs (in Catalan comes) form an integral part of the landscape. These are small valleys, with the deepest and flattest part cultivated for agriculture. They are predominantly found in the most arid regions of Catalonia, particularly around the cities of Tarragona and Lleida. They are generally dry land areas. We propose that these coombs gained significance in the early centuries of the Middle Ages, a period marked by intense erosion. It is important to identify their locations and establish connections with medieval written documents, the settlements that thrived throughout the Middle Ages, archaeological sites such as necropolises, and the valuable data derived from to-ponymy studies. We think that understanding these coombs can greatly contribute to under-standing how the territory was organized in the Middle Ages, the extent of cultivated lands that were established, and the distribution of many settlements. Ultimately, this knowledge can aid in acquiring better understanding of the current landscape.

Background: Current European guidelines support transcatheter aortic valve implantation (TA-VI) in intermediate to low-risk patients ≥75 years-old but its prognostic relevance is unknown. Methods: Intermediate-to-low-risk (Society of Thoracic Surgeon score <8%) patients enrolled in the HORSE registry were included. We compared the population with less versus more than 75 years old. The primary endpoint was all-cause mortality. Results: A total of 2685 patients were included, 280 (8.6%) <75 and 2405 ≥75 years. Through a mean follow-up of 437 ± 381 days, 198 (8.2%) and 23 (8.2%) patients died in the two arms, without statistically significant differences (log-rank p=0.925). At Cox regression analysis, age did not predict the occurrence of all-cause death, neither as a continuous variable (HR 1.01, 95% CI 0.99-1.04, p=0.294) nor dichotomizing according to the prespecified cutoff of 75 years (HR 0.97, 95% CI 0.63-1.51p=0.924). Time-to-event ROC curves showed low accuracy of age to predict all-cause mortality (area under the curve of 0.54 for both 1-year and 2-year outcomes). Conclusions: TAVI has comparable benefits across age strata in intermediate-to-low risk patients. The age cut-off suggested by current guidelines is not predictive of the risk of adverse events during hospital stay, neither of all-cause mortality through a mid-term follow-up.

Delve into the ebb and flow of human ingenuity as the researcher traces the evolution of writing from papyrus to pixels. Discover how humble instruments like quill pens and typewriters have propelled human into the digital frontier, forever reshaping the art of expression in the modern age. This article examines the evolution of writing tools from traditional pen and paper to digital writing in the modern age. It explores the development of writing materials such as papyrus, parchment, and paper, as well as the invention of writing tools including quill pens, fountain pens, and typewriters. The rise of digital writing tools, including word processing software and smartphones, is also discussed, along with their benefits such as increased efficiency and productivity, enhanced collaboration and sharing capabilities, and greater accessibility and flexibility. However, the article also highlights the challenges of writing in the digital age, including the impact of digital distractions on writing focus and quality, the issue of online plagiarism and copyright infringement, and the potential loss of traditional writing skills. The article concludes with recommendations for educators, school administrators, students, and researchers to strike a balance between digital and traditional writing practices, to embrace digital writing tools while preserving traditional writing skills, and to understand the importance of the evolution of writing. The theoretical frameworks of Social Construction of Technology (SCOT) Theory, Media Ecology Theory, and Activity Theory are also discussed in relation to the evolution of writing tools. Overall, this article provides valuable insights into the history, benefits, and challenges of writing in the digital age, as well as suggestions for navigating the future of writing and its tools.

Colorectal cancer remains one of the most commonly diagnosed cancers. Advanced rectal cancer patients receive neoadjuvant radiochemotherapy as well as surgery and suffer under reduced health-related quality of life due to various side effects. We were interested in the role of the COVID-19 pandemic and how it affected those patients’ quality of life. A total of 489 advanced rectal cancer patients from the University Hospital Erlangen in Germany were surveyed between May 2010 and March 2022 and asked to fill out the EORTC QLQ-C30 and QLQ-CR38 questionnaire over eight different time points: in the beginning, during and after radiochemotherapy, right before surgery and in yearly intervals after surgery for up to four years. Answers were converted to scores to compare the COVID-19 period to the time before March 2020 focusing on the follow-ups, the developments over time – including by sex and age - and the influence of the TNM cT-stage. Overall, a trend of impaired functional and symptom scores was found across all surveys with few significances (body image -10.6 percentage points (pp) after one year; defecation problems +13.5 pp, insomnia +10.2 pp and weight loss +9.8 pp after three years; defecation problems +11.3 pp after four years). cT4-stage patients lost significantly more weight than their cT1-3-stage counterparts (+10.7 to 13.7 pp). Further studies should be conducted to find possible causes and develop countermeasures for future major infectious diseases.

This paper discusses the preliminary results of archaeological surveys conducted in the Juuku Region of north-central Kyrgyzstan on the south side of Lake Issyk kul. Our goal was to document ancient and contemporary agropastoral systems over a four millenia time period. During the surveys about 350 loci were identified as settlements, burial mounds, graves, single artifact finds, and artifact scatters (ceramic). The areas of Juuku Valley survey included two discrete polygons: Polygon 1, Lower Juuku at 1750 to 1950 m asl in elevation and Polygon 2, Chak Juuku or Upper Eastern Branch Juuku Valley at 2060 to 2100 m asl in elevation. Three radiometric dates and preliminary archaeobotanical studies were conducted at three exposed profile cuts. The methods included here are: (1) pedestrian surveys; (2) use of digital maps (Google Earth, Encarta); (3) placing archaeological loci within known chronological time periods; (4) AMS dating of charcoal samples collected from profile deposits; and (5) preliminary identification of plant remains found from archaeobotanical samples. The results of our research represent the first step toward inventorying and interpreting archaeological data in the Juuku Valley derived from field studies.

Abstract: The aim of the present study was to identify the age and sex-related associations between marital status with PA and TV time. We used data from Vigitel, an annual telephone survey started in 2006 in Brazil. We applied a complex sample logistic regression model to estimate the odds for PA and TV time comparing marital statuses according to age and sex subgroups, independent of obesity, hypertension, diabetes, self-assessed poor health, and smoking. Our sample included 561,837 individuals with a TV time &gt; 3 h/day (prevalence = 25.2%) and PA &gt; 150 min/week (prevalence = 35%). Compared to single individuals, married men and women were less likely to watch TV more than 3 h/day in participants &gt; 30 years old. When compared to single, married participants were less likely to do more than 150 min of PA/week at younger age groups. Married women older than 40 years were more likely to do more than 150 min of PA/week than the single ones, while there were no differences among married men by age group. In conclusion, married individuals are less likely to spend more than 3 hours a day watching TV than single individuals. Single men and women were more likely to do more than 150 min of PA/week at younger age groups and married women older than 40 years were more likely to do 150 min of PA/week than single women.

Understanding the processes that govern the transformation of the landscape through time is essential for exploring the evolution of a coastal area. Coastal landscapes are dynamic sites, with their evolution strongly linked with waves and sea-level variations. Geomorphological features in the coastal area, such as beachrock formations and dune fields, can function as indicators of the coastal landscape evolution through time. However, our knowledge of the chronological framework of coastal deposits on the Aegean coasts is limited. Optically stimulated luminescence dating techniques are deemed to be very promising indirect dating of the coastal sediments, especially when they are linked with archaeological evidence. The dating of the sediments from different sediment core depths, as they are determined by the method of luminosity, allows us to calculate the rate of sediment deposition over time. Additionally, the coastal evolution and stability were studied from 1945 until today, with the use of aerial photographs and satellite images. This paper presents the 6000 ka years evolution of a coastal landscape based on geomorphological, archaeological, and radio-chronological data. Based on the results, the early stages of the Ammoudara beach dune field appear to be formed ~9.0 – 9.6 ka BP, while the OSL ages from 6 m depth represented the timing of its stabilization (OSL ages ~5–6 ka). This indicates that the dune field appears to already have been formed long before the Bronze Age (5-10 ka BP) and became stabilized with only localized episodes of dune reactivation occurring, while high coastal erosion rates are found in modern times.

Wrist-worn fitness trackers and smartwatches are proliferating with an incessant attention towards health tracking. Given the growing popularity of wrist-worn devices across all age groups, a rigorous evaluation for recognizing hallmark measures of physical activities and estimating energy expenditure is needed to compare their accuracy across the lifespan. The goal of the study was to build machine learning models to recognize physical activity type (sedentary, locomotion, and lifestyle) and intensity (low, light, and moderate), identify individual physical activities, and estimate energy expenditure. The primary aim of this study was to build and compare models for different age groups: young [20-50 years], middle (50-70 years], and old (70-89 years]. Participants (n = 253, 62% women, aged 20-89 years old) performed a battery of 33 daily activities in a standardized laboratory setting while wearing a portable metabolic unit to measure energy expenditure that was used to gauge metabolic intensity. Tri-axial accelerometer collected data at 80-100 Hz from the right wrist that was processed for 49 features. Results from random forests algorithm were quite accurate in recognizing physical activity type, the F1-Score range across age groups was: sedentary [0.955 – 0.973], locomotion [0.942 – 0.964], and lifestyle [0.913 – 0.949]. Recognizing physical activity intensity resulted in lower performance, the F1-Score range across age groups was: sedentary [0.919 – 0.947], light [0.813 – 0.828], and moderate [0.846 – 0.875]. The root mean square error range was [0.835 – 1.009] for the estimation of energy expenditure. The F1-Score range for recognizing individual physical activities was [0.263 – 0.784]. Performances were relatively similar and the accelerometer data features were ranked similarly between age groups. In conclusion, data features derived from wrist worn accelerometers lead to high-moderate accuracy estimating physical activity type, intensity and energy expenditure and are robust to potential age-differences.

Increasing numbers of researchers are interested in the importance of dietary fiber for the gut microbiota, microbiotal metabolite SCFA, energy metabolism and gut health of the host. However, studies have demonstrated that long-term and longitudinal observation may be needed to evaluate the effect of dietary fiber better, and few such works have been made in chickens. Therefore, we successively fed low-fiber, high--fiber and low-fiber diets to two breeds of chickens during different growth periods (1—8, 9—20 and 21—50 weeks), aiming to longitudinally observe the long-term effect of altered dietary fiber on the gut microbiota, SCFA and development of cecum of chickens with age. The results showed that the composition and function of the gut microbiota, SCFA and the development of the cecum were different during different periods, which was largly affected by dietary fiber. However, the causes of some effects were different during the different periods. For example, compared with that in low-fiber chickens at 8 weeks, dominant fiber-degradation bacteria such as Bacteroidetes, Alloprevotella and SCFA-producing bacteria such as Faecalibacterium increased due to a high-fiber diet at 20 weeks, while due to a high feed intake in 50 weeks. Moreover, the concentration of SCFA in 20 weeks was significantly higher than in 8 weeks and 50 weeks, but the causes of this difference were also distinct. It was proposed that a long-term observation was needed to evaluate the effect of dietary fiber better on chickens. The metabolite pathways of ATP-binding cassette (ABC) transporters encoded by Firmicutes were enriched in 8 weeks, while a two-component system and β–glucosidase encoded by Bacteroidetes were enriched in 20 and 50 weeks. The trend was the same in two breeds of chickens except for Alloprevotella. In addition, the total content of SCFA in the contents of cecum was also affected by the size of the cecum. Surprisingly, the length of the cecum shortened from 20—50 weeks, maybe due to reduced dietary fiber.

Biophoton emission has been experimented for decades. The photo-genic origin of biophoton has also been attributed to the oxidative stress or free radical production. However, there are considerable gaps in quantitative understanding of biophoton emission. In this work, I propose an analytical hypothesis for interpreting a few patterns of steady-state biophoton emission of human, including the dependency on age, the diurnal variation, and the geometric asymmetry associated with serious asymmetrical pathological conditions. The hypothesis is based on an alternative form of energy state, termed vivo-nergy, which is associated with only metabolically active organisms that are also under neuronal control. The hypothesis projects a decrease of the vivo-nergy in human during growth beyond puberty. The hypothesis also proposes a modification of the vivo-nergy by the phases of systematic or homeostatic physiology. The hypothesis further postulates that the deviation of the physiology-modified vivo-nergy from the pre-puberty level is deteriorated by acquired organ-specific pathological conditions. A temporal differential change of vivo-nergy is hypothesized to proportionally modulate oxidative stress that functions as the physical source of biophoton emission. The resulted steady-state diffusion of the photon emitted from a photo-genic source in a human geometry simplified as a homogeneous spherical domain is modeled by photon diffusion principles incorporating an extrapolated zero-boundary condition. The age and systematic physiology combined determines the intensity of the centered physiological steady-state photo-genic source. An acquired pathology sets both the intensity and the off-center position of the pathological steady-state photo-genic source. When the age-commemorated, physiology-commanded, and pathology-controlled modifications of the steady-state photo-genetic sources are implemented in the photon diffusion model, the photon fluence rate at the surface of the human-representing spherical domain reveals the patterns on age, the temporal variation corresponding to systematic physiology, and the geometric asymmetry associated with significant asymmetric pathological condition as reported for spontaneous biophoton emission. The hypothesis, as it provides conveniences for quantitative estimation of biophoton emission patterns, will be extended in future works towards interpreting the temporal characteristics of biophoton emission under stimulation.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

(1) Background: Among the chronic complications of type 2 diabetes mellitus, cancer became the leading cause of death in several countries. Our objective was the determination of whether prevalent type 2 diabetes mellitus is associated with a higher incidence of cancer. (2) Methods: This study is a nationwide analysis performed in Hungary. Study population was divided into a group with type 2 diabetes mellitus and into a non-diabetic group. The primary outcome was the risk related to overall cancer incidence. A key secondary outcome was the overall incidence of cancer in distinct study years. Further outcomes were the annual percent changes. (3) Results: The odds ratio related to the overall incidence of cancer was 2.50 (95% confidence interval: 2.46-2.55, P&lt;0.0001) in patients with diabetes as related to controls. The odds ratio was higher in males than in females. The highest risk was found in the 18-39-year-old subgroup. The annual cancer incidence rate declined in controls, but not in patients with diabetes. Several types of cancer showed a decreasing tendency in non-diabetic controls.; (4) Conclusions: type 2 diabetes is associated with a higher risk of cancer. High risk in young patients with type 2 diabetes suggests that these young individuals should be considered as a risk group.

(1) Background/Objectives: Accurate determination of chronological age is crucial in legal dental identification. This study aimed to compare the effectiveness of different formulas in estimating the age of a Brazilian subpopulation by analyzing the pulp/tooth ratio of the maxillary canine and mandibular second premolar in panoramic and periapical radiographs. (2) Methods: The sample consisted of panoramic and periapical radiographs of 247 individuals. The file of each radiograph was opened in the Adobe Photoshop CS4® program to outline and obtain values in pixels for calculating the pulp/tooth ratio. Statistical analysis was conducted using the SPSS program, with a significance level set at 5%. (3) Results: The interclass correlation coefficient demonstrated excellent intra-observer agreement (0.990 – 0.999). The determination coefficients (R2) suggested that only 30-35% of the actual age results could be explained by the pulp/tooth ratio. Smallest differences were observed with Cameriere's formula for the mandibular second premolar on panoramic radiographs (+4.1 years). The greatest differences were found with the formulas for the mandibular second premolar in panoramic radiographs of the Korean (+12.5 years) and Portuguese (-12.1 years) populations. (4) Conclusions: The equations employed allowed for estimating the age of a Brazilian subpopulation and showed little agreement between the actual age and the estimated age.

Digital transformation systems generate a substantial volume of data, creating opportunities for potential innovation, particularly those driven by artificial intelligence. This study focuses on the intricate relationship between artificial intelligence and innovation as foundational elements in the digital transformation framework for sustained growth and operational excellence. This study provides a holistic perspective on the cultivation and pillars of AI-powered innovation, highlighting their pivotal role in revolutionizing industries, including healthcare, education, finance, manufacturing, transportation, and agriculture. The work emphasizes the key pillars essential for fostering AI-powered innovation, including monitoring performance measurement to use the power of the present, continuous learning and innovation, data analytics and insights, predictive analytics, and innovative product development. This study investigates how these pillars serve as the foundation for groundbreaking advancements, driving efficiency, enhancing decision-making processes, and fostering creativity within organizations. This study explores the significance of continuous learning, interdisciplinary collaboration, and industry partnerships in nurturing a thriving AI-powered innovation ecosystem. By understanding and harnessing these fundamental elements, businesses can navigate the complexities of the digital age, fostering innovation that not only optimizes processes but also enhances the overall human experience, ushering in a new era of technological excellence and societal progress.

The advent of AI in medicine has transformed various medical specialties, including orthodontics. AI has shown promising results in enhancing the accuracy of diagnoses, treatment planning, and predicting treatment outcomes. With the growing number of AI applications and commercially available tools, there is an increase in their usage in orthodontic practices worldwide. This review aims to explore the principles of artificial intelligence (AI), its applications in the diagnostic process of modern orthodontic practices, and concerns associated with the implementation of AI algorithms in clinical practice. A comprehensive review of the literature was conducted, focusing on five categories where AI has been applied in orthodontics: dental diagnostics, cephalometric evaluation, skeletal age determination, temporomandibular joint (TMJ) evaluation, and extraction decision making. AI has demonstrated high efficacy in all those fields. However, variations in performance and the necessity of manual supervision indicate that AI should be used cautiously in clinical settings. Nevertheless, the high complexity and potential unpredictability of AI algorithms call for cautious implementation and regular manual validation of results. Continuous AI learning, proper governance, and addressing privacy and ethical concerns are crucial for the successful integration of AI into orthodontic practice.

Background: Urinary tract infection (UTI) is one of the commonest bacterial infections among reproductive age females. Untreated UTI in reproductive age female is associated with sexual dysfunction, cystitis, pyelonephritis and Pelvic inflammatory disease. At present, the antimicrobial resistance emergency has quadrupled worldwide and poses a serious threat to the treatment of patients. Thus, this study aimed to determine bacterial profile, antibiotic susceptibility pattern and associated risk factors of urinary tract infection among reproductive age females attending the Logbaba District Hospital Methods: A hospital-based cross-sectional study was conducted from January – July, 2023. Convenient sampling was employed to recruit 259 reproductive age females. Sociodemographic and risk factors information were obtained using a well-structured questionnaire. Mid-stream urine was collected and inoculated on cystine lactose electrolyte deficient media. Isolates were identified using API 20. Antibiotic sensitivity testing was performed using modified kirby-bauer susceptibility testing technique. Multivariate logistic regression model was used to assessed risk factors. A p-value < 0.05 was considered as statistically significant. Results: The overall prevalence of UTI among reproductive age females was 82/259 (31.66%). Symptomatic and asymptomatic patients reported a prevalence of 50/121(41.32%) and 32/138 (23.19%), respectively. Ages ranging from 21-30 years (AOR: 2.53 ,95% CI 1.32 – 4.43, p=0.006) and 31 – 40 years (AOR: 0.19 , 95% CI: 0.14- 0.54; p <0.0001), student (AOR: 1.8, 95% CI: 1.21 - 2.75; p = 0.010), history of UTI (5.34, 95% CI = 1.86 - 18.15; p = 0.03), symptomatic (AOR = 2.86, 95% CI1.78 - 4.67, p <0.0001) and secondary education (AOR: 0.13, 95% CI 0.08 - 0.32; p<0.0001) were predictors to UTI. Klebsiella Pneumoniae was the most frequent species 27 (32.9%), follow by E coli 22(26.8%), Staphylococcus aureus 16 (19.5%), CONS 8 (9.8%), Proteus mirabilis 6 (7.3 %) and Pseudomonas aeruginosa 3(3.7%). Majority of the isolates were sensitive to cefotaxime (87.80%), imipenem (85.7%), vancomycin (79.27%), Ofloxacillin (76.83%), Ceftriaxone (75.61%), Ciprofloxacin (74.39%), Gentamicin (71.95%) and Doxycycline (69.51%), and resistant to Amoxicillin (51.22%), cotrimoxazole (47.56%) and Azithromycin (31.71%) , All the isolates were multidrug drug resistant (100%) and Klebsiella Pneumoniae and E coli were the most multidrug drug resistant species Conclusion: In the present study, the prevalence of urinary tract infection among reproductive age females was high and considerably a high proportion of multidrug resistance was observed. This result will have a significant impact on the selection of appropriate antimicrobial agents for the treatment of urinary tract infection in the study area.

Intergenerational integration has given rise to a novel aging paradigm known as all-age communities, which is garnering international attention. In China, the aging population and the implementation of the three-child policy have resulted in increased demand for retirement and childcare services among residents in older neighborhoods. Consequently, there is a pressing need to retrofit these older neighborhoods to accommodate all-age living arrangements given the high demand they generate. Therefore, this study undertakes research interviews with residents and constructs an exploratory theoretical model rooted in established theory. To assess the significance of our model, we employ Smart PLS 3.0 based on 297 empirical data points. Our findings indicate that anxiety has a significant negative effect on payment behavior; objective perception, willingness to pay, and government assistance exert significant positive effects on payment behavior. By comprehensively analyzing the mechanisms underlying residents’ payment behavior, this study provides valuable insights to the government for promoting the aging process within communities and formulating effective transformation policies.

As the global aging trend continues to intensify, there will inevitably be more complex and diverse aging problems in the future. There is no doubt that designers have the responsibility to explore the possibilities of the future and solve the problems that will be faced in the future. Based on the Future Cone, the Double Diamond Model and the IDEO Method Cards, this study proposes a new model to guide the design practice of future aging issues in the context of aging. With the aim of validating and refining the framework, an ageing designer workshop was held where participants were asked to imagine, explore and express ideas about future ageing issues. The workshop was used to refine the proposed model. More specifically, the model includes a future concept, a design guidance process based on the Double Diamond Model, and tools that can be applied at all stages of design, which can help designers generate ideas and solutions for future aging problems, and collectively lead society to a more desirable future. Moreover, this study also explores broader directions for the development of the model and provides a reference for continued research on this topic in the future.

Stand biomass in boreal forests has attained recognition for its crucial role in carbon cycling. In this study, we examined the effect of stand age on above- and belowground biomass allocation in downy birch (Betula pubescens Ehrh.) in three drained peatland sites in Central Finland. We used allometric equations to estimate individual-tree above-ground biomass and its various components, including stem wood, stem bark, living branches, leaves, and dead branches. The above-ground biomass ranged from 10.5 t ha-1 to 276.0 t ha-1 and foliage biomass from 0.009 t ha-1 to 0.6 t ha-1. We found that stand age had a strong correlation with above-ground biomass, but foliage biomass appeared to peak at the middle-aged (50 years) stand compared to the young (10 years) or mature (80 years) stands. We observed coarse root biomass production of 45, 250, and 110 g m-2 in the 0–50 cm peat layer for young, middle-aged, and mature stands, respectively. Most coarse root biomass occurred in the top 20-cm layer (77%). These findings improve our understanding of how biomass allocation patterns – specifically those in foliar biomass– change over time, and the impact on litter inputs into the soil.

Purpose: Cardiovascular disease (CVD) is a major risk factor for mortality in patients with osteoarthritis, and comorbidities increase postoperative complications after total knee arthroplasty (TKA). Arteriosclerosis plays a major role in hemodynamic dysfunction and CVD; however, arteriosclerosis has not been preoperatively evaluated before TKA using the cardio–ankle vascular index (CAVI). In this study, we evaluated the degree of preoperative arteriosclerosis using the CAVI in patients undergoing TKA, as well as its correlations with several preoperative patient factors. Methods: Arteriosclerosis was evaluated in 209 consecutive patients (251 knees) with osteoarthritis who underwent TKA at our institution between May 2011 and June 2022. The CAVI was measured in the supine position 1 day before TKA, and the correlations between the CAVI and several clinical factors were analyzed. A p value of <0.05 was considered statistically significant. Results: The CAVI was normal in 62 knees (25%), borderline in 71 knees (28%), and abnormal in 118 knees (47%). Univariate analysis revealed a moderate positive correlation between preoperative CAVI and age (r = 0.451, p < 0.001) and a weak negative correlation between preoperative CAVI and body weight (r = −0.306, p < 0.001) and body mass index (BMI) (r = −0.319, p < 0.001). Multivariate analysis showed that age (β = 0.349, p < 0.001) and BMI (β = −0.235, p < 0.001) were significantly correlated with preoperative CAVI. Conclusion: Arteriosclerosis should be carefully managed intraoperatively and postoperatively in patients with osteoarthritis undergoing TKA, particularly in older patients and patients with a low BMI.

For a long time, there has been interest in the relationship between personality traits and life satisfaction. However, many previous studies suffer from small sample sizes or selective sampling, sometimes leading to biased or imprecise results. The current study, which focuses on the trait of extraversion, attempts to overcome these limitations by using a large-scale German survey of more than 40,000 individuals aged 10 to 72. As the descriptive and regression results clearly show, there is a statistically significant relationship between extraversion and several dimensions of current life satisfaction. Depending on the type of satisfaction, the unstandardized regression coefficients range from 0.18 to 0.33. To gain further insight, age is added as an explanatory variable to test whether these associations change as a person ages. The results show that the effect sizes sometimes differ by age but remain robust and statistically significant. In conclusion, the study adds to the literature by providing convincing evidence that extraversion and life satisfaction are positively associated, at least in Western and industrialized countries, and that there are interaction effects with age.

The Huayangchuan uranium deposit, located in the west of the Xiaoqinling belt on the southern margin of the North China Craton, is a polymetallic deposit dominated by U, Nb, Pb, and rare earth elements. The Huayangchuan uranium deposit, discovered in the 1950s, has long been known as a carbonatite-type uranium deposit. Recently, new geological work has found uranium mineralisation in many granitic pegmatite veins in the Huayangchuan deposit and adjacent areas. Here, we report a systematic investigation of the petrography, whole-rock geochemistry, zircon U-Pb ages, and in situ Lu-Hf isotopic characteristics of newly discovered U-rich granitic pegmatite veins in the west of Huayangchuan deposit. The petrological results showed that the lithology of the samples is equivalent to that of granite. The U-Pb ages of zircon were 1826.3 ± 7.9 and 1829 ± 11 Ma. Microscopically, the symbiotic characteristics of zircon, betafite, and uraninite exist in the intergranular fissures of K-feldspar and quartz, reflecting metallogenic phenomena in the rock formation process. Almost all whole-rock samples were rich in SiO2 (64.37–70.69 wt.%), total alkalis (K2O+Na2O = 8.50–10.30 wt.%), and Al2O3 (12.20–14.41 wt.%), but poor in Ti2O (0.23–0.73 wt.%), MgO (0.38–0.90 wt.%), P2O5 (0.14–0.83 wt.%), MnO (0.04–0.57 wt.%). Additionally, they showed enrichment of LILEs (such as Rb, Ba, Th, U, and K), depletion of HFSEs (such as Ta, Nb, P, Ti, and Hf), no alkaline dark minerals, and the characteristics are typical of intraplate A1-type granite. The A1-type granite displayed low zircon εHf(t) values (-19.42– -15.02) with zircon two-stage Hf model aged 3.10–2.76 Ga, indicating that the U-rich granitic pegmatite was derived predominantly from partial melting of the ancient continental crust (such as the early Taihua group formed in Archean-Neoarchean). Combined with the above results and regional geological data, the U-rich granitic pegmatite discovered in the Huayangchuan deposit was related to granite magma activity that formed in a post-collisional regime after the Luliang movement in the late Palaeoproterozoic. This study suggests that future uranium prospecting work in this area should focus on late Palaeoproterozoic U-rich granitic pegmatites.

Abstract. Babies born to severe acute respiratory syndrome corona virus-2 (SARS-CoV-2) infected mothers are at greater risk for perinatal morbidity and more likely to receive a neurodevelopmental diagnosis in the first year of life. However, the effect of maternal infection on placental function and neonatal outcomes varies depending upon the patient population. We set out to test our hypothesis that maternal SARS-CoV-2 infection in our underserved, socioeconomically disadvantaged, predominantly African American and Latina population in the Bronx, NY would have effects evident at birth. Fifty-five SARS-CoV-2 positive and 61 negative third trimester patients were randomly selected from Montefiore Medical Center (MMC), Bronx, NY. In addition, two positive cases from Yale New Haven Hospital, CT were included as controls. All 55 placentas delivered by SARS-CoV-2 positive mothers were uninfected by the virus, based on immunohistochemistry, in-situ hybridization, and qPCR analysis. However, placental villous infarcts, mild preeclampsia, shortened gestational periods and lower Apgar scores were observed in the infected cases. These findings suggest that even without entering the placenta, SARS-CoV-2 can affect various systemic pathways culminating in altered placental development and function, which may adversely affect the fetus, especially in a high-risk patient population such as ours. These results underline the importance of vaccination among pregnant women, particularly in low resource areas.

The evolution of digital media in adolescents has changed the patterns and motives of use and the impact on their communication choices in their social and family networks. The objectives of this study are to understand how peers communicate adopting a social network (SN) or by voice and their social desirability. After the informant consent signature, the adolescents completed a series of self-report questionnaires on the use of SN, on communication preferences, and on social desirability through online. Most of the adolescents belonged to the 17-19 age group (83.6%) and were female (68.9%). Adolescents spent more than 3 hours/day on Whatsapp and more than 2 hours/day on Instagram, while the use of Facebook was on average only 35 minutes/day. Females used digital media for longer than males. Adolescents aged 17-19 years choose more Facebook and voice modes compared to adolescents aged 14 and 16 years. The alternative modes of Whatsapp and voice were chosen more than the social networks in their communication strategies, especially for negative topics. Motives for use were, in addition to boredom, related to maintaining one's social sphere with peers. Some educative considerations were made based on these results.

Objectives: This study aimed to analyze the awareness of local residents regarding healthcare projects and to suggest some ideas for the revision of local ones. Methods: To delve into the opinions of local residents, the author of this study created a questionnaire composed of eight questions on the general characteristics of the respondents, eight questions on satisfaction with health centers, 16 questions on the awareness of healthcare projects, and 22 questions on local healthcare. The survey was conducted for 409 residents who visited public centers in Gimcheon from 15 March to 14 April 2021. Results: Data analysis revealed the following: The proportion of local residents who use health centers was 39.1%, and those users visit health centers, on average, 3.92 times a year. Among healthcare projects, the project known by the highest proportion of people was vaccinations (84.5%), which was also the project that was most used (38.1%). Among healthcare projects needed in the with-COVID-19 age, respondents awarded the highest score to vaccinations (4.15 points on a five-point Likert scale) and the second highest score to infectious disease management (4.12). Conclusions: For healthcare projects, central and local governments should focus on activating vaccinations, solving the problem of medical accessibility through untact remote treatment and establishing national infectious disease-specializing hospitals and local infectious disease management based on such national hospitals.

Background: Little is known about potential confounding factors influencing the humoral response in individuals having received the BNT162b2 vaccine. Methods: Blood samples from 231 subjects were collected before and 14, 28 and 42 days following COVID-19 vaccination with BNT162b2. Anti-Spike Receptor-Binding-Domain protein (anti-Spike/RBD) immunoglobulin G (IgG) antibodies were measured at each time-point. Impact of age, sex, childbearing age status, hormonal therapy, blood group, body mass index and past-history of SARS-CoV-2 infection were assessed by multivariable analyses. Results and Conclusions: In naïve subjects, the level of anti-Spike/RBD antibodies gradually increased following administration of the first dose to reach the maximal response at day 28 and then plateauing at day 42. In vaccinated subjects with previous SARS-CoV-2 infection, the plateau was reached sooner (i.e. at day 14). In the naïve population, age had a significant negative impact on anti-Spike/RBD titers at day 14 and 28 while lower levels were observed for males at day 42, when corrected for other confounding factors. BMI as well as B and AB blood groups had a significant impact in various subgroups on the early response at day 14 but no longer after. No significant confounding factors were highlighted in the previously infected group.

Learning disorders (LD) are diagnosed in children impaired in the academic skills of reading, writing and/or mathematics. Children with LD usually show a slower resting-state electroencephalogram (EEG), with EEG patterns corresponding to a neurodevelopmental lag. LD-children also show a consistent cognitive impairment in working memory (WM), including an abnormal task-related EEG with an overall slower EEG activity of more delta and theta power, and less gamma activity in posterior sites; task-related EEG patterns considered indices of an inefficient neural resource management. Neurofeedback (NFB) treatments aimed at normalizing the resting-state EEG of LD-children have shown improvements in cognitive-behavioral indices and diminished EEG abnormalities. Given the typical findings of a WM impairment in LD-children; we aimed to explore the effects of a NFB treatment in the WM of children with LD, by analyzing the WM-related EEG power-spectrum. We recruited 18 children with LD (8-10 years old). They performed a Sternberg-type WM-task synchronized with an EEG of 19 leads (10-20 system) twice in pre-post treatment conditions. They went through either 30 sessions of a NFB treatment (NFB-group, n= 10); or through 30 sessions of a placebo-sham treatment (Sham-group, n= 8). We analyzed the before-after treatment group differences for the behavioral performance and the WM-related power-spectrum. The NFB group showed faster response times in the WM-task post-treatment. They also showed an increased gamma power at posterior sites and a decreased beta power. We explain these findings in terms of NFB improving the maintenance of memory representations coupled with a reduction of anxiety.

Background: This paper investigates the statistical relationship between bilingualism and the Onset Age (OA) of AD and MCI across a clinical sample, consisting of 580 Alzheimer's Disease (AD) subjects and 1264 Mild Cognitive Impairment (MCI) subjects, via a statistical analysis conducted on the sample retrieved from the Alzheimer's Disease Neuroimaging Initiative (ADNI) dataset. Method: To investigate whether bilingualism has any correlation with the OAs of AD or MCI subjects, our study leverages the full potential of the ADNI dataset, a dataset that covers both the OA and the bilingualism status of both the AD and MCI subjects. Prior to performing any meaningful statistical analysis, a regression model and a probabilistic model were developed in parallel to fill in the missing OA and bilingualism values. A simple least-square regression model that consists of an independent variable of registered age for Mini-Mental State Examination (MMSE) score was used to estimate the OA of the AD and MCI subjects in the ADNI dataset. After filling in the missing OA values, the number of subjects relevant for the statistical analysis increased from 816 (AD: 371, MCI: 445) to 1844 (AD: 580, MCI: 1264), which greatly enlarged the representation of the AD and MCI sample in the ADNI population. With increased sample size, a novel probabilistic classification model was introduced to infer an ADNI subject’s bilingualism when relevant demographic information and deterministic outcome were not readily available from the ADNI dataset. The weighted average OA for the bilinguals and the monolinguals was then computed, where the weights for the probabilistic labels were assigned based on the percentage of bilingualism in the general US population. Finally, a statistical analysis was performed to test whether any statistically significant correlation exists between the OA and the bilingualism of the AD and MCI subjects within the ADNI dataset. Findings: Our preliminary study demonstrates no significant statistical difference between the OA of the bilinguals and the monolinguals within the ADNI dataset. Thus, the monolingual speakers within the ADNI dataset do not statistically manifest earlier onset, as compared to the bilingual speakers, which is slightly inconsistent with some earlier statistical findings that bilingual speakers enjoy certain distinctive advantages, such as late onset of AD, as compared to monolingual counterparts.

Unification point of view, quantum cosmology must be given a priority and one should make a note that, Spin is a basic property of quantum physics and rotation is a very common experience. In this context, we have developed a quantum model of cosmology associated with Machian universe having Planck scale origin, total dark matter, light speed rotation and equality of gravitational self energy density and thermal energy density. We would like to appeal that, observed cosmic radius and age seem to be shortened by 146.3 times their actual magnitudes.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

TomoBreast hypothesized that hypofractionated 15 fractions/3 weeks image-guided radiation therapy (H-IGRT) can reduce lung-heart toxicity, as compared with normofractionated 25-33 fractions/5-7 weeks conventional radiation therapy (CRT). 123 women with stage I-II operated breast cancer were randomized to receive CRT (N=64) or H-IGRT (N=59). The primary endpoint used a four-items measure of the time to 10% alteration in any of patient self-reported measure, physician clinical evaluation, echocardiography or lung function tests, analyzed by intention-to-treat without exclusion. Results found comparable survivals, but H-IGRT significantly reduced the toxicity measured by lung diffusion capacity and alveolar volume as compared with CRT, G1 in 53% (31/59) versus 72% (44/61) patients, P=0.006; G2, 29% versus 48%, P=0.020. H-IGRT significantly reduced the risk of composite cardio-pulmonary alteration at 5 years, 10.2% versus 26.7%, P=0.024. In conclusion, TomoBreast is a proof-of-concept that image-guided radiation-therapy can improve the overall balance of lung-heart outcomes in breast cancer adjuvant therapy. Furthermore, the significance of the findings supports the efficacy of a small trial size design, which can be critical when clinical research resources are limited.

As Automated Driving Systems (ADS) technology gets assimilated into the market, the driver’s obligation will be changed to a supervisory role. A key point to consider is the driver’s engagement in the secondary task to maintain the driver/user in the control loop. The paper’s objective is to monitor driver engagement with a game and identify any impacts the task has on hazard recognition. We designed a driving simulation using Unity3D and incorporated three tasks: No-task, AR-Video, and AR-Game tasks. The driver engaged in an AR object interception game while monitoring the road for threatening road scenarios. From the results, there was less than 1 second difference between the means of gaming task (mean = 2.55s, std = 0.1002s) to no-task (mean = 2.55s, std = 0.1002s). Game scoring followed three profiles/phases: learning, saturation, and decline profile. From the profiles, it is possible to quantify/infer drivers’ engagement with the game task. The paper proposes alternative monitoring that has utility, i.e., entertaining the user. Further experiments AR-Game focusing on real-world car environment will be performed to confirm the performance following the recommendations derived from the current test.

Aging is accompanied by frontal lobe and non-dominant hemisphere recruitment that supports executive functioning, such as inhibitory control, which is crucial to all cognitive functions. Yet, the spatio-temporal sequence of processing underlying successful inhibition and how it changes with age is understudied. Thus, we assessed N200 (conflict monitoring) and P300 (response inhibition, performance evaluation) event-related potentials (ERPs) in young and healthy older adults during comparably performed successful stop-signal inhibition. We additionally interrogated the continuous spatio-temporal dynamics of N200- and P300-related activation within each group. Young adults had left hemisphere dominant N200, while older adults had overall larger amplitudes and right hemisphere dominance. N200 activation was biphasic in both groups but differed in scalp topography. P300 also differed, with larger right amplitudes in young, but bilateral amplitudes in old, with old larger than young in the left hemisphere. P300 was characterized by an early parieto-occipital peak in both groups, followed by a parietal slow wave only in older adults. A temporally similar but topographically different final wave followed in both groups that showed anterior recruitment in older adults. These findings illuminate differential age-related spatio-temporal recruitment patterns for conflict monitoring and response inhibition that are critically important for understanding age-related compensatory activation.

This study aims to develop a performance evaluation system that can facilitate performance evaluation at region, hospital, and department levels to enable better cost management for sustainable development. A multi-level system of performance evaluation informs a hierarchical assessment of cost management from regions to hospitals to departments using diagnosis-related group (DRGs). Various metrics are developed employing the variances between targets and actuals where targets are determined from two perspectives: benchmarking using external regional prices and change management using internal data. Targets for the latter are statistically based and specifically incorporate variability. The model is applied to two hospitals, twenty departments, nine DRGs and 1071 inpatients. The analyses indicate that the approach can provide a practical evaluation tool that allows for particular characteristics at multiple levels. The system provides macro-micro and external-internal perspectives in performance, enabling high-level variances to be decomposed thereby identifying sources of performance variability and financial impact.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centered on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese and to individualize the interventions, with a focus from weight change to individual's overall well-being.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centred on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese.

Telecommuting is a flexible form of work that has progressively spread over the last 40 years and which has been strongly encouraged by the measures to limit the Covid19 pandemic. There is still limited evi-dence on the effects it has on workers' health. In this survey we invited 905 workers of companies that made a limited use of telework to fill out a questionnaire to evaluate: Intrusive leadership of managers (IL), the request for work outside traditional hours (OFF-TAJD), workaholism (BWAS), effort / reward imbalance (ERI), happiness and common mental issues (CMIs), anxiety and depression, assessed by the Goldberg scale (GADS). The interaction between these variables has been studied by structural equation modeling (SEM). Intrusive leadership and working after hours were significantly associated with occu-pational stress. Workaholism is a relevant moderator of this interaction: intrusive leadership significantly increased the stress of workaholic workers. Intrusive leadership and overtime work were associated with reduced happiness, anxiety and depression. These results indicate the need to guarantee the right to disconnect, to limit the effect of the OFF-TAJD. In addition to this, companies should implement policies to prevent intrusive leadership and workaholism.

Machine Learning (ML) approaches have been fruitfully applied to several classification problems of neurophysiological activity. Considering the relevance of emotion in human cognition and behaviour, ML found an important application field in emotion identification based on neurophysiological activity. Nonetheless, the literature results present a high variability depending on the neuronal activity measurement, the signal features and the classifier type. The present work aims to provide new methodological insight on ML applied to emotion identification based on electrophysiological brain activity. For this reason, we recorded EEG activity while emotional stimuli, high and low arousal (auditory and visual) were provided to a group of healthy participants. Our target signal to classify was the pre-stimulus onset brain activity. Classification performance of three different classifiers (LDA, SVM and kNN) was compared using both spectral and temporal features. Furthermore, we also contrasted the classifiers performance with static and dynamic (time evolving) features. The results show a clear increased in classification accuracy with temporal dynamic features. In particular, the SVM classifiers with temporal features showed the best accuracy (63.8 %) in classifying high vs. low arousal auditory stimuli.

The Japanese Association for Acute Medicine Committee recently proposed a novel classification system for the severity of heat-related illnesses. The illnesses are simply classified into three stages based on symptoms and management or treatment. Stages I, II, and III broadly correspond to heat cramp and syncope, heat exhaustion, and heat stroke, respectively. Our objective was to examine whether this novel severity classification is useful in the diagnosis by healthcare professionals of patients with severe heat-related illness and organ failure. A nationwide surveillance study of heat-related illnesses was conducted between June 1 and September 30, 2012, at emergency departments in Japan. Among the 2130 patients who attended 102 emergency departments, the severity of their heat-related illness was recorded for 1799 patients, who were included in this study. In the patients with heat cramp and syncope or heat exhaustion (but not heat stroke), the blood test data (alanine aminotransferase, creatinine, blood urea nitrogen, and platelet counts) for those classified as stage III were significantly higher than those of patients classified as stage I or II. There were no deaths among the patients classified as stage I. This novel classification may avoid underestimating the severity of heat-related illness.

This study investigated the neuroprotective effects of methyl 3,4-dihydroxybenzoate (MDHB) against t-butylhydroperoxide(TBHP) induced oxidative damage in SH-SY5Y (human neuroblastoma cells) and the underlying mechanisms. SH-SY5Y were cultured in DMEM+10% FBS for 24 hours and pretreated with different concentrations of MDHB or N-acetyl-L-cysteine (NAC) for 4 hours prior to the addition of 40 μM TBHP for 24 hours. Cell viability was analyzed using the methyl thiazolyl tetrazolium (MTT) and lactate dehydrogenase (LDH) assays. An annexin V-FITC assay was used to detect cell apoptosis rate. The 2',7'-dichlorofluorescin diacetate (DCFH-DA) assay was used to determine intracellular ROS levels. The activities of antioxidative enzymes (GSH-Px and SOD) were measured using commercially available kits. The oxidative DNA damage marker 8-OHdG was detected using ELISA. Western blotting was used to determine the expression of Bcl-2, Bax, caspase 3, p-Akt and Akt proteins in treated SH-SY5Y cells. Our results showed that MDHB is an effective neuroprotective compound that can mitigate oxidative stress and inhibit apoptosis in SH-SY5Y cells

Myasthenia gravis (MG) is a disease characterized by typical clinical and immunopathogenic pe-culiarities, which correlate with age and sex/gender. Accordingly, MG patients show thymic al-terations and auto-antibodies productions, that can be the expression of a different pathogenetic mechanism related to age and gender. This determines, in relation to age at and sex/gender, a dif-ferent MG onset, prognosis, and outcome. Therefore, diverse MG forms can be identified, classi-fied, and characterized in relation to their different features, and precisely there are early onset and late-onset forms of MG. It has been hypothesized that the cause of appearance the two diverse forms of MG can be ascribed mainly to the diverse genetic and epigenetic factors. In this narrative review, we will analyze and discuss about the interplay of age- and sex-related factors (i.e. genet-ic and epigenetic factors) related to two different MG forms and how they contribute to their di-verse pathogenesis.

Smoking is a pervasive global health concern associated with a myriad of diseases, but its impact on cellular aging, particularly in relation to telomeres, is increasingly recognized. Telomeres, protective caps at the ends of chromosomes, play a crucial role in maintaining genomic integrity. This review critically examines the existing evidence on the association between smoking and telomere atrophy, exploring the molecular mechanisms involved and the implications for accelerated aging and heightened disease risk. The comprehensive analysis encompasses both cross-sectional and longitudinal studies, elucidating potential gender and age disparities. Insights into the molecular pathways linking smoking to telomere shortening are discussed, along with the broader implications for public health. The review concludes by outlining potential interventions and suggesting future research directions in this critical area.

Chronological frameworks based on artefact typologies are essential for interpreting the archaeological record, but they inadvertently treat transitions between phases as abrupt events and disregard the temporality of transformation processes within and between individual phases. This study presents an absolute chronological investigation of a dynamic material culture from Early Iron Age urnfields in Denmark. The chronological framework of Early Iron Age in Southern Scandinavia is largely unconstrained by absolute dating, primarily due to it coinciding with the so-called ‘Hallstatt calibration plateau’ (c.750 to 400 cal BC), and it is difficult to correlate it with Central European chronologies due to a lack of imported artefacts. This study applies recent methodological advances in radiocarbon dating and Bayesian chronological modelling, specifically a statistical model for wood-age offsets in cremated bone and presents the first large-scale radiocarbon investigation of regional material culture from Early Iron Age in Southern Jutland, Denmark. Dated material is primarily cremated bone from 111 cremation burials from three urnfields. The study presents absolute date ranges for 16 types of pottery and 15 types of metalwork, which include most of the recognised metalwork types from the period. This provides new insights into gradual change in material culture, when certain artefact types were in production and primary use, how quickly types were taken up and later abandoned, and distinguishing periods of faster and slower change. The study also provides the first absolute chronology for the period, enabling correlation with chronologies from other regions. Urnfields were introduced at the Bronze-Iron Age transformation, which is often assumed to have occurred c.530-500 BC. We demonstrate that this transformation took place in the 7^th century BC, however, which revives the discussion of whether the final Bronze Age period VI should be interpreted as a transitional phase to the Iron Age.

Pregnancy at advanced maternal age is considered a risk factor for adverse maternal, fetal, and neonatal outcomes. Here we investigated whether maternal age could be associated with differences in the blood levels of newborn screening (NBS) markers for inborn metabolic disorders on the Recommended Universal Screening Panel (RUSP). Population-level NBS data from screen-negative singleton infants were examined, which included blood metabolic markers and covariates such as gestational age, birth weight, age at blood collection, infant sex, parent-reported ethnicity, and maternal age at delivery. Marker levels were compared between maternal age groups (age range: 15-44 years) using effect size analyses, which controlled for group size differences and potential confounding from other covariates. Our results showed that 13% of the markers had maternal age-related differences including newborn metabolites with either increased (C14, C16, C18, C18:1, C3DC) or decreased (C5OH) levels at advanced maternal age group (≥35 years, absolute Cohen’s d ≥ 0.2). The increased C3DC levels in this group correlated with a higher false-positive rate in newborn screening for malonic acidemia (p-value < 0.001), while no significant difference in screening performance was seen for other markers. Maternal age at delivery is associated with inborn metabolic differences and should be considered together with other clinical variables in genetic disease screening.

(1) Background: Thrombophilia is a tendency towards hypercoagulability, and it is increased by pregnancy, and peaking around delivery.; (2) Methods: 80 Eighty thrombophilia patients admitted for delivery between 1/10/2017 and 1/12/2021 were prospectively studied, together with 80 eighty age- and para-matched control patients. Patients were admitted for delivery at term by means of cesarean section. The inflammation indexes from the complete blood count values analysis, in during both the 24 hours before and the 24 hours after labor—, extracted from the hospital’s medical records—, were calculated, and then correlated with uterine involution.; (3) Results: In pregnant patients treated for thrombophilia patients, the patients who did not manage to have close their uterine cavity closed with in the first 24-48 hours had significantly higher SII and AISI inflammation indexes SII and AISI , than the onesthose who did manage to have their uterine cavity closed their uterine cavity. In pregnant patients treated for thrombophilia patients, MLR is higher in patients without the Rh factor than in those with the Rh factor. In non-thrombophilia patients, PLR was significantly higher as compared to treated thrombophilia patients. In non-thrombophilia patients, MCVL increased with age and, before labor, while SII and AISI increased with age, postpartum. ; (4) Conclusions: There may be an underlying inflammation state that persisted despite treatment in some pregnant thrombophilia pregnant patients.

This study examined the eye movement patterns of 317 elementary students across reading conditions (audio-assisted reading (AR) and reading-only (R)) and text types (fiction and non-fiction), and identified eye movement parameters that predict their literal comprehension (LC) and inferential comprehension (IC). Participants, randomly assigned to either reading condition and either text type, answered questions assessing their LC and IC. Average fixation duration (AFD), total fixation duration (TFD), and scanpath length were used as eye movement parameters. There were main effects of age on all parameters and interaction effects between age and reading condition on TFD and scanpath length. Controlling for age, TFD had a positive impact on LC of both text types in the AR, while under the R, it affected negatively on IC of both text types. Longer scanpaths predicted IC of fiction in the AR, LC and IC of non-fiction under the AR, and LC of non-fiction within the R. AFD influenced negatively on IC of fiction in the AR, LC and IC of non-fiction in the AR, and LC of non-fiction under the R. These eye movement patterns and predictors indicate children employ different reading strategies based on reading modality and text type.

The impact of early maternal age on several outcomes (e.g. mental health issues, delinquency, aggression, impulsivity, victimization and interpersonal difficulties) has been studied since the late 1980s. Research has demonstrated links between exposure to adverse childhood experiences (ACEs) and trauma related outcomes such as substance abuse, interpersonal and self-directed violence, and sexual risk-taking, to name a few. The current study analyzed the incidence of ACE exposure and mental health outcomes (e.g. suicidal behaviors or self-harm, psychiatric hospitalizations, and substance use) as related to early maternal age in youth known to have experienced trafficking or sexual abuse. General demographics and incidence of various experiences and clinical presentations (e.g. ACE exposure, age of mother at birth of youth and age at first birth), and history of self-harm, substance use and psychiatric hospitalization were examined in a sample of 225 youth referred for services subsequent to experiences of sex trafficking or exploitation. Relationships between ACE exposure and maternal age related to mental health outcomes was also examined. Trafficked and exploited youth reported rates of ACE exposure and poor mental health outcomes at far greater rates than the general population. Significant findings were related to early maternal age and engaging in self-harm or suicidal behaviors. Previously anticipated mediational analyses were not conducted due to the sample size and lack of correlations. Findings highlight the significant ACE exposure and high needs of exploited, trafficked and abused youth and related mental health outcomes, emphasizing the need for early and comprehensive preventive and therapeutic interventions.

This paper uses preliminary studies of archaeological sites (burial mounds and settlements) from the Iron Age through Medieval periods (ca. 800 BCE to 1200 CE) in the Juuku Valley on the South side of Lake Issyk-Kul to model land-use across vertical mountain zones. To do so, we have established a radiometric chronology, conducted test excavations of an Iron Age settlement and a Turkic period burial, undertaken preliminary archaeobotanical research, and pedestrian surveys. Seed remains of wheat (Triticum aestivum), barley (Hordeum vulgare), broomcorn millet (Panicum milaceum) and foxtail millet (Setaria italica) and legumes were recovered in very small quantities from an Iron Age upland settlement at 2100 m asl and a Turkic period burial mound at 1934 m asl. These preliminary archaeobotanical results are compared to the Talgar Iron Age settlements on the north side of the Tian Shan Mountain range in Kazakhstan studied earlier by Robert Spengler. Small samples of faunal remains found at the Turkic period kurgan and from a profile at the upland Iron Age settlement indicate livestock herding of sheep/goats, cattle, and horses in Juuku Valley. The goal of this paper is to test the hypothesis that pastoral transhumance and agropastoralism were economic strategies used by ancient societies during the Iron Age through Medieval periods in mountain-river valley areas between 750 m to 2500 m asl. These economic strategies that combined the pasturing of sheep, goats, cattle and horses with the cultivation of cereals were adapted to the use of different vegetational zones along a vertical gradient. This paper based on preliminary research of upland sites of the Juuku Valley in Kyrgyzstan, initiates a long-term research study of four millennia of settlements that ranged from pastoral transhumance, pastoral nomadism, and combined mountain agriculture using survey data and test excavations.

In the vaginal ecosystem there is a symbiotic relationship between the microbiota and the host, particularly Candida spp., which are considered commensals of the vaginal mucosa. During pregnancy there is an increase in hormonal secretion that alters the vaginal microbiota and favors the development of Candida infection. Several studies have shown the increased prevalence of Candida during pregnancy, as well as its association with perinatal complications and current clinical practice guidelines recommend fluconazole as the treatment of choice during pregnancy in case of infection by Candida albicans and non-albicans Candida. However, in the Mexican population, this association has not been studied. So in this study, an intentional search for colonization by Candida spp. in pregnant women who attended the obstetric triage of the Hospital Regional de Alta Especialidad de Ixtapaluca during the period from May to October 2019, and they were followed up until the end of the pregnancy. Data on age, number of pregnancies, gestational age, body mass index, and perinatal outcomes were analyzed. Of 83 patients included in the study, yeasts corre-sponding to C. albicans (12) and C. glabrata (4) were isolated in 16. In the group of patients with Candida, the maternal age range was from 15 to 36 years old, of which 7 were adolescents and 2 with advanced maternal age, with an average of 2 gestations, the range of body mass index was from 19.3 to 42.4, of which 4 were overweight and 7 obese. Perinatal complications were observed in three patients, one presented chorioamnionitis and in two the neonates were small for gestational age. No association was found between colonization by Candida spp. and the number of preg-nancies, gestational age, body mass index or perinatal results. However, it was found that age (adolescence) may be a risk factor for the development of vulvovaginitis during pregnancy.

In 2019, the Global Burden of Disease (GBD) estimated that prostate cancer (PC) was the 16th cause of death globally in males. In Mexico, PC epidemiology has been reported for a selected number of metrics and years, although without including the most up-to-date estimates. Herein, we describe and compare the burden and trends of PC in Mexico and its 32 states from 2000 to 2019. For this, we extracted online available data from the GBD 2019 to estimate the crude and age-standardized rate (ASR per 100,000 people) of incidence, mortality, and disability-adjusted life years (DALYs). In Mexico, PC caused 27.1 thousand (95% uncertainty intervals, 20.6-36.0 thousand) incident cases, 9.2 thousand (7.7-12.7 thousand) deaths, and 161.5 thousand (122.7-219.5 thousand) DALYs in males of all ages in 2019. Among states, Sinaloa had the greatest ASR of incidence and Guerrero the highest values of deaths and DALYs. The burden of PC showed an increasing trend, although the magnitude of change differed between metrics and locations. We found both an increasing national trend and subnational variation in the burden of PC. Our results confirm the need for updated and timely estimates to design effective diagnostic and treatment campaigns in locations where the burden of PC is the highest.