Background: we aim to investigate attitudes toward vaccination, by analyzing empirical factors associated with vaccine acceptance in the Lazio region mpox vaccination (MpoxVax) campaign in Italy. Methods: all subjects who accessed to MpoxVax and signed the informed consent were prospectively enrolled in the MPOX-VAC Study and were asked to fill out an anonymous survey. Two endpoints were selected: ‘delayed acceptance’ and ‘early acceptance’, defined as access for vaccination >60 and ≤30 days from the vaccination campaign starting (VCS), respectively. Results: over the study period 1717 individuals underwent vaccination: 129 (7%) >60 [1588 (92.5%) ≤60] and 676 (60%) ≤30 days from VCS. A bisexual orientation, a lower education level and a worse perceived physical and mental health were associated with delayed access to vaccination. Being Pre-Exposure Prophylaxis (PrEP) users and, marginally, HIV positive, having a high perceived risk for mpox infection and reporting high-risk behaviors like the use of recreational drugs/chems, sex under the influence of drugs and/or alcohol and higher number of principal sexual partners, were associated with early access to vaccination. Conclusions: according to our data, risk awareness was a major determinant of early mpox vaccination acceptance. Conversely, worse perceived health status and a low educational level were critical factors associated with delayed vaccination.

Objetives: Adequate donor-recipient matching is necessary to achieve the best renal function after transplantation. The nephron load received from the donor, which can be reflected in variables such as age, sex and body mass index, may influence the evolution of the graft. Our objetive was develop a combined score according to the donor-recipient pairing in age, sex and body mass index, and assess its influence on the evolution of the renal graft. Materials and methods: Transplant patients between 2013 and 2020 who had at least 1 year of post-transplant follow-up. A ranking of 0 to 2 points was awarded according to the match between donor and recipient for sex, age and body mass index individually, with higher rank to greater mismatch. Subsequently, a Score with value of 0 to 6 points was created with the combined ranking of the indivudual variables, analyzing its influence on the evolution of the graft by multivariate linear regression. Results: 280 patients followed for 4.3 years of median. Worse renal function was observed at the end of follow-up as the range of each variable increased separately, and the Score created, with a worsening of renal function as the combined Score increased in the multivariate analysis: Coefficient B= -2.4 ml/min, p=0.018. Conclusions: An adequate match between donor and recipient in age, sex and body mass index using this combined Score can help achieve better kidney function after transplantation.

Jealousy and mate retention have received attention in the research over the last decades. Despite this, most of the research examined male jealousy and male mate retention, emphasizing cost-inflicting behavior due to its role in relationship and domestic violence. The aim of this study was to investigate the relationship between jealousy and all mate retention strategies in romantic relationship among women during the COVID-19 pandemic. The sample consisted of 772 Croatian women aged 19 to 40 who were in a heterosexual relationship at the time. The study was conducted online, and the participants completed the Multidimensional jealousy scale and Mate Retention Inventory. The results showed that cognitive, emotional, and behavioral jealousy are positively correlated with all mate retention strategies which indicate that a stronger experience of jealousy can be expected to result in more frequent use of all partner retention strategies. We also found that all three dimensions of jealousy and relationship length positively predicted both cost-inflicting and benefit-provisioning mate retention behavior, whereas age was a negative predictor of benefit-provisioning behavior only. Findings of this study suggest that although jealousy can substantially explain interpersonally risky and damaging behavior in relationships, it can also explain affectionate and attentive behavior to some extent.

Biological, environmental, behavioral, and social factors can influence sleep and lead to sleep disorders or diseases. Sleep disorders are common, numerous and heterogeneous in terms of their etiology, pathogenesis, and symptomatology. Management of sleep-wake circadian disorders (SWCD) includes education to sleep hygiene, behavioral strategies, psychotherapy (cognitive behavioral therapy (CBT), particularly), instrument-based treatments (i.e. positive airway pressure therapy, hypoglossal nerve stimulation), and pharmacotherapy. Depending on the disease, therapy varies and is executed sequentially, or can be a combination of several forms of therapy. Drugs used for SWCD include traditional sleep or wake-promoting agents, chronotherapeutic agents. Recently, novel medications, which are more precisely acting on specific neurochemical systems (i.e. orexin system) important for sleep and wake, are also increasingly being used. In this review, the pharmacotherapy of common sleep disorders (insomnia, sleep-related breathing disorder, central disorders of hypersomnolence, circadian rhythm sleep wake disorders, parasomnias, and sleep-related movement disorders) embedded in the overall therapeutic concept of each disorder is presented. There is also an outlook on possible future pharmacotherapies.

The A. japonicus industry has expanded significantly, but no research has focused on how to de-termine the age of A. japonicus during farming. Correctly estimating the age of A. japonicus can provide a decision-making basis for the breeding process, and data for the protection of A. japonicus aquatic germplasm resources. DNA methylation levels in the body wall of Apostichopus japonicus at 4 months, 1 year, 2 years, and 3 years old were determined by MethylRAD-Seq, and differentially methylated genes related to age were screened. The results of the study found that 441 and 966 differentially methylated genes were detected at CCGG and CCWGG sites, respectively. As-partate aminotransferase, succinate semialdehyde dehydrogenase, isocitrate dehydrogenase, the histone H2AX, heat shock protein Hsp90, aminopeptidase N, cell division cycle CDC6, Ras GTPase activating protein (RasGAP), slit guidance ligand slit 1, integrin linked kinase ILK, mechanistic target of rapamycin kinase Mtor, protein kinase A Pka, and autophagy-related 3 atg3 these genes may play key roles in the growth and aging process of A. japonicus. This study provided data for identifying the age of A. japonicus.

BACKGROUND: Cervical cancer is the second most frequent cancer among women worldwide between 14 and 49 years of age including Nigeria. Figures have greatly reduced in developed countries after the introduction and implementation of effective screening and vaccination programs which is greatly undeveloped and inefficient in Nigeria and other developing countries at large. OBJECTIVES: The study assessed the knowledge and attitude of reproductive age women towards cervical cancer prevention in selected tertiary institutions in Osun State. METHODOLOGY: The study was a descriptive cross-sectional study carried out among reproductive age women in selected tertiary institutions in Osun State, Nigeria. A probability based multistage sampling technique was adopted as the sampling technique for the study. Data was collected using a semi-structured, self-administered and interviewer guided questionnaire. RESULTS: Age of respondents was 25.305±8.195. 313(79.0%) of the total respondents were Christians, and 83(21.0%) of the respondents were Muslims. For the overall knowledge score, only 52.0% of the respondents had good knowledge while 48.0% of the respondents had poor knowledge. 52.0% exhibited negative attitude towards cervical cancer prevention while 48% exhibited positive attitude towards cervical cancer prevention. Only 23% of the respondents had taken part in screening and vaccination towards cervical cancer prevention while 77% of the respondents had not. CONCLUSION: The knowledge of reproductive age women towards cervical cancer prevention was above average while their attitude towards cervical cancer prevention was low. This issue could be addressed by increasing the awareness of the effects of cervical cancer among reproductive age women in the country.

Background: We aimed to determine the splenic stiffness (SS) values in healthy individuals as measured by 3 Tesla magnetic resonance elastography (3T MRE) and to investigate the possible effects of parameters such as age, sex, spleen volume, diameter, and parenchyma thickness on SS.Methods: A total of 54 healthy volunteers were included in this cross-sectional study. Participants' age and sex information were recorded, in addition to spleen craniocaudal and anteroposterior diameter, cortical thickness, spleen volume, and SS, which were measured using 3T magnetic resonance imaging and MRE. Results: Twenty-nine male and 25 female subjects with a mean age of 54.78±15.40 years were included in the study. Mean cradiocaudal diameter was 10.46±1.16 cm, anteroposterior diameter was 9.88±1.29 cm, parenchyma thickness was 4.08±0.67 cm, SS was 3721.94±709.69 Pascal (Pa), and median spleen volume was 292.54 (239.40-311.00) cm³. A significant positive correlation was observed between age and SS (r=0.779, p<0.001). The SS values were not associated with sex, craniocaudal diameter, anteroposterior diameter, parenchymal thickness, or volume.Conclusion:Age should be considered when using SS in the diagnosis and staging of relevant diseases such as portal hypertension and esophageal varices. Our results should be confirmed by future studies using 3T MRE in larger populations.

Background: We aimed to determine the splenic stiffness (SS) values in healthy individuals as measured by 3 Tesla magnetic resonance elastography (3T MRE) and to investigate the possible effects of parameters such as age, sex, spleen volume, diameter, and parenchyma thickness on SS. Methods: A total of 54 healthy volunteers were included in this cross-sectional study. Participants' age and sex information were recorded, in addition to spleen craniocaudal and anteroposterior diameter, cortical thickness, spleen volume, and SS, which were measured using 3T magnetic resonance imaging and MRE. Results: Twenty-nine male and 25 female subjects with a mean age of 54.78±15.40 years were included in the study. Mean cradiocaudal diameter was 10.46±1.16 cm, anteroposterior diameter was 9.88±1.29 cm, parenchyma thickness was 4.08±0.67 cm, SS was 3721.94±709.69 Pascal (Pa), and median spleen volume was 292.54 (239.40-311.00) cm3. A significant positive correlation was observed between age and SS (r=0.779, p<0.001). The SS values were not associated with sex, craniocaudal diameter, anteroposterior diameter, parenchymal thickness, or volume Conclusion:Age should be considered when using SS in the diagnosis and staging of relevant diseases such as portal hypertension and esophageal varices. Our results should be confirmed by future studies using 3T MRE in larger populations.

Migraine is a neurovascular disorder that can be debilitating for individuals and society. Current research focuses on finding effective analgesics and management strategies for migraines by targeting specific receptors and neuropeptides. Nevertheless, the responder rates of recently approved calcitonin gene-related peptide (CGRP) monoclonal antibodies (mAbs) and receptor inhibitors remain around 50 percent. To address the need for novel therapeutic targets, researchers are exploring the potential of another secretin family peptide, pituitary adenylate cyclase-activating polypeptide (PACAP), as a ground-breaking treatment avenue for migraine. Preclinical models have revealed how PACAP affects the trigeminal system, which is implicated in headache disorders. Clinical studies have demonstrated the significance of PACAP in migraine pathophysiology; however, a few clinical trials remain inconclusive: the pituitary adenylate cyclase-activating peptide 1 receptor mAb, AMG 301 showed no benefit for migraine prevention, while the PACAP ligand mAb, Lu AG09222 significantly reduced the number of monthly migraine days over placebo in a phase 2 clinical trial. Meanwhile, another secretin family peptide vasoactive intestinal peptide (VIP) is gaining interest as a potential new target. In light of recent advances in PACAP research, we emphasize the potential of PACAP as a promising target for migraine treatment, highlighting the significance of exploring PACAP as a member of the antimigraine armamentarium, especially for patients who do not respond to or contraindicated to anti-CGRP therapies. By updating our knowledge on PACAP and its unique contribution to migraine pathophysiology, we can pave the way for reinforcing PACAP and other secretin peptides, including VIP, as a novel treatment option for migraines.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Age-related macular degeneration (AMD) is a leading cause of blindness worldwide. In late-stage AMD, geographic atrophy (GA) of dry AMD or choroidal neovascularization (CNV) of neovascular AMD results in macular atrophy (MA), leading to significant visual loss. Despite the development of innovative therapies, there are currently no established effective treatments for MA. As a result, early detection of MA is critical in identifying later central macular involvement throughout time. Accurate and early diagnosis is achieved through a combination of clinical examination and imaging techniques. Our review of the literature depicted advances in retinal imaging to identify biomarkers of progression and risk factors for late AMD. Imaging methods like fundus autofluorescence (FAF), near-infrared reflectance (NIR), widefield imaging, optical coherence tomography (OCT), multicolor confocal scanning laser ophthalmoscopy (cSLO), and optical coherence tomography angiography (OCTA) can be used to detect and monitor the progression of retinal atrophy. Multifocal electroretinogram (ERG) and microperimetry are methods for quantifying visual function to map disease progression. The evolving diverse imaging modalities optimize detection of pathology anatomy and measurement of visual function; they may also contribute to the understanding of the underlying mechanistic pathways, particularly the underlying MA changes in late AMD.

The Global Burden of Disease Study (GBD) 2019 reveals an increasing prevalence of Type 2 Diabetes Mellitus (T2DM) from 1990 to 2019. This study delves into the role of dietary risk factors across different demographic and socioeconomic groups. Utilizing data from the GBD 2019, it analyzes age-adjusted T2DM metrics—death counts, Disability-Adjusted Life Years (DALYs), and Age-Standardized Rates (ASR)—stratified by age, sex, and region. The study employed Estimated Annual Percentage Changes (EAPCs) to track trends over time. Results show that in 2019, 26.07% of T2DM mortality and 27.08% of T2DM DALYs were attributable to poor diets, particularly those low in fruits and high in red and processed meats. Geographic variations in T2DM trends were significant, with regions like Southern Sub-Saharan Africa and Central Asia experiencing the most substantial increases in Age-Standardized Mortality Rate (ASMR) and Age-Standardized DALY Rate (ASDR). A positive correlation was noted between Socio-Demographic Index (SDI) and T2DM burden due to dietary risk factors. The study concludes that targeted public health initiatives promoting dietary changes could substantially reduce the global T2DM burden.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Hemilauxania parvula sp. nov., a new fossil species of the family Lauxaniidae (Diptera: Acalyptratae), is described and illustrated from Oise amber, France (Eocene, lower Ypresian, ca 53 Ma) and its relationship is discussed. Inasmuch as this first finding of a member of Schizophora in Oise amber probably represents the oldest known record of this group of Diptera, the age of Schizophora, based on the known fossil records, is discussed.

A recent study has suggested that the age profiles for deaths due to COVID-19 variants differs between variants and shows male/female specificity. This study demonstrates the age and sex dependency is common among human pathogens. The often-reported higher susceptibility to infections among the young and elderly is true in general but does not apply to individual pathogens. Even among different types of pneumonia there are subtle differences in the age profile. The gender ratio between pathogens likewise shows wide variation from as low as 10% female admissions for leptospirosis to around 90% for gonococcal admissions. The observed age/sex variation observed for mortality due to COVID-19 variants is an expression of a far wider phenomenon with implications to the age/sex response to vaccines. We propose that such differences are likely to be controlled by small noncoding RNAs which act as potent regulators of gene expression leading to altered cell morphology, metabolism, immune function, and response to vaccines.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

In contemporary sociological discourse, social trust emerges as a fundamental determinant in catalyzing positive socio-economic interactions. The nexus between social relationships and the inherent trust within them is quintessential for the holistic well-being of individuals. The current research undertook a rigorous examination of the variations in generalized trust levels across distinct age cohorts. For this empirical investigation, a dataset comprising 2,232 observations, exclusively from the United States, was meticulously sourced from the World Value Survey.The empirical findings elucidated a significant disparity in generalized trust levels across age cohorts. Notably, the geriatric demographic manifested elevated levels of generalized trust in juxtaposition to their younger counterparts. Such an observation posits the hypothesis that the construct of trust may indeed possess an age-related dimensionality. Furthermore, a robust statistical analysis accentuated the significance of these observed disparities. The divergences in trust levels across age cohorts retained their statistical significance even post the incorporation of confounding variables such as gender, socio-economic status, educational attainment, ethnic lineage, and religious affiliations. This seminal finding underscores the imperative for further academic explorations into the intricate dynamics of trust within the socio-cultural fabric of our society.

The aim of the study is to evaluate the predictive factors of response to induction chemotherapy in patients with resectable NSCLC, treated at the unit of Thoracic Surgery of Siena University Hospital with radical surgery. From January 1, 2013 to December 31, 2020, 78 patients were recruited. We analyzed the outcomes in terms of 5-years OS based on the Estimated Regression Rate, N2 downstaging and age; two patients’ subgroups were created by age (Group A: age &lt;66 years-old; Group B: age &gt;66 years-old). No 5-year OS difference was observed based on age, while it was observed in patients with N2 downstaging (p=0.031). Bewtween patients with N2 downstaging, only patients in Group A had a significantly increased 5-year OS (p=0.019), while this was not observed in Group B (p=0-321); the same result was observed with the Estimated Regression Rate &gt; 50% (Group A p=0.005; Group B p=0.391). The percentage of disease regression and the N2 down-staging after induction chemotherapy have great value on the survival, although this advantage seems to be observed mostly in younger patients. A multidisciplinary oncologic discussion of clinical cases could provide support in the careful selection of the ideal patients to undergo neoadjuvant treatment before radical surgery.

Zn is an essential element for children related to optimal growth, development and nutritional metabolism. We measured Zn bioaccesibility (Zn-BA) levels of foods by Inductively coupled plasma mass spectrometry (ICP-MS) after in vitro digestion-fermentation method from children with gluten related disorders (GRD-CH), obesity (OB-CH) and allergy/intolerance to cow’s milk proteins (AICM-CH). Zn-BA levels in sick children (34.7 ± 28.8, 29.6 ± 30.1 and 26.7 ± 30.4%, respectively) were significantly lower (p &lt; 0.05) than in healthy norm-weight children (HE-CH). For AICM-CH, Zn-BA in animal foods was significantly lower than in plant foods, and in both plant and animal foods from sick and healthy children (p &lt; 0.05). In foods of animal origin in sick and healthy children, Zn-BA in foods heated in liquid media (frying and boiling) was significantly higher than in foods heated by hot air (roasting and grilling). In conclusion, in children the studied diseases diminished the Zn-BA, probably by the alteration of the gut microbiota which could negatively affect their appropriate long-term development. In AICM-CH, the allergy to cow's milk proteins could induce intestinal dysbiosis and inflammatory processes, leading to allergies to other animal food proteins, and to a more pronounced decrease of Zn-BA.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

Background: Urinary tract infection (UTI) is one of the commonest bacterial infections among reproductive age females. Untreated UTI in reproductive age female is associated with sexual dysfunction, cystitis, pyelonephritis and Pelvic inflammatory disease. At present, the antimicrobial resistance emergency has quadrupled worldwide and poses a serious threat to the treatment of patients. Thus, this study aimed to determine bacterial profile, antibiotic susceptibility pattern and associated risk factors of urinary tract infection among reproductive age females attending the Logbaba District Hospital Methods: A hospital-based cross-sectional study was conducted from January – July, 2023. Convenient sampling was employed to recruit 259 reproductive age females. Sociodemographic and risk factors information were obtained using a well-structured questionnaire. Mid-stream urine was collected and inoculated on cystine lactose electrolyte deficient media. Isolates were identified using API 20. Antibiotic sensitivity testing was performed using modified kirby-bauer susceptibility testing technique. Multivariate logistic regression model was used to assessed risk factors. A p-value < 0.05 was considered as statistically significant. Results: The overall prevalence of UTI among reproductive age females was 82/259 (31.66%). Symptomatic and asymptomatic patients reported a prevalence of 50/121(41.32%) and 32/138 (23.19%), respectively. Ages ranging from 21-30 years (AOR: 2.53 ,95% CI 1.32 – 4.43, p=0.006) and 31 – 40 years (AOR: 0.19 , 95% CI: 0.14- 0.54; p <0.0001), student (AOR: 1.8, 95% CI: 1.21 - 2.75; p = 0.010), history of UTI (5.34, 95% CI = 1.86 - 18.15; p = 0.03), symptomatic (AOR = 2.86, 95% CI1.78 - 4.67, p <0.0001) and secondary education (AOR: 0.13, 95% CI 0.08 - 0.32; p<0.0001) were predictors to UTI. Klebsiella Pneumoniae was the most frequent species 27 (32.9%), follow by E coli 22(26.8%), Staphylococcus aureus 16 (19.5%), CONS 8 (9.8%), Proteus mirabilis 6 (7.3 %) and Pseudomonas aeruginosa 3(3.7%). Majority of the isolates were sensitive to cefotaxime (87.80%), imipenem (85.7%), vancomycin (79.27%), Ofloxacillin (76.83%), Ceftriaxone (75.61%), Ciprofloxacin (74.39%), Gentamicin (71.95%) and Doxycycline (69.51%), and resistant to Amoxicillin (51.22%), cotrimoxazole (47.56%) and Azithromycin (31.71%) , All the isolates were multidrug drug resistant (100%) and Klebsiella Pneumoniae and E coli were the most multidrug drug resistant species Conclusion: In the present study, the prevalence of urinary tract infection among reproductive age females was high and considerably a high proportion of multidrug resistance was observed. This result will have a significant impact on the selection of appropriate antimicrobial agents for the treatment of urinary tract infection in the study area.

In recent years, the interaction between adiponectin (APN), a versatile fat-associated adipokines, and eye disorders has become a captivating focus of interest. Unveiling the intricate relationship between APN and its receptors (AdipoRs) with aging eye disorders has emerged as a fascinating frontier in medical research. This review article delves into this captivating connection, illuminating the hidden influence of adipocytokine, APN on retinal health. This comprehensive review critically examines the latest findings and breakthroughs that underscore the pivotal roles of APN/AdipoRs signaling in maintaining ocular homeostasis and protecting against eye ailments. Here, we meticulously explore the intriguing mechanisms by which APN protein influences retinal function, lens clarity, and overall visual acuity. Drawing from an extensive array of cutting-edge studies, the article highlights APN's multifaceted functions, ranging from anti-inflammatory properties and oxidative stress reduction to angiogenic regulation within retinal and macula tissues. The involvement of APN/AdipoRs in mediating these effects opens up novel avenues for potential therapeutic interventions targeting prevalent aging eye conditions. Moreover, this review unravels the interplay between APN signaling pathways and age-related macular degeneration (AMD). The single-cell RNA seq results validate the expression of both the receptor isoform (AdipoR1/R2) in retinal cells. The transcriptomic analysis showed lower expression of AdipoR1/2 in dry AMD pathogenesis compared to healthy subjects. The inhibitory peptide (APN1) demonstrated over 75% suppression of CNV, whereas the control peptide did not exert any inhibitory effect on CNV. The elucidation of these relationships fosters a deeper under-standing of adipose tissue's profound influence on ocular health, presenting new prospects for personalized treatments and preventative measures. In conclusion, "Obesity Hormone's Role in Aging Eyes: Linking Adiponectin/AdipoRs to AMD" provides a captivating journey into the enthralling world of APN intertwining the realms of adipose biology and aged ophthalmology.

Background: Lipid disorders are one of risk factors for cardiovascular diseases. The aim of the study was to determine the lipid profile in early childhood in the group of Polish children born small for gestational age (SGA). Materials and Methods: The study included 140 children (93 SGA and 47 controls) aged 5 to 11 years. All children underwent a physical examination and blood tests for the glucose and lipid profile. SGA group was divided in subgroups: symmetrical and asymmetric intrauterine growth restriction (IUGR). Results: Blood sample analysis revealed higher levels of total cholesterol levels (SGA group 190.61 +/- 24.66 mg/dl vs control 143.23 +/- 23.90; p&lt;0.001). The analysis of particular fractions of cholesterol showed significantly higher mean values of triglycerides, LDL-cholesterol as well as lower mean values of HDL-cholesterol in children born as SGA. Children in both groups did not differ significantly according to weight and body mass index. A statistically significantly higher glucose concentration was obtained in the group of children with IUGR with symmetrical type of IUGR. Conclusions: Children born SGA even in their early childhood, without overweight or obesity, have abnormal lipid profile, which may be a risk factor of cardiovascular diseases in adulthood.

Background: Myocardial infarction (MI) is a major cause of mortality worldwide. Its presentation as ST-segment elevation MI (STEMI) and non-ST-segment elevation MI (NSTEMI) is influence by atherosclerosis risk factors. Aim: To assess the patterns of presentation and predicting risk factors of acute MI in Kosovo. Methods: This is a cross sectional study from the Clinic of Cardiology of the University Clinical Center of Kosovo, which included all patients hospitalized with acute MI over a period of 7 years (January 1st, 2014 to December 31st, 2020). Data was collected using a structured questionnaire and epidemiological patterns and risk factors were analyzed. Results: Among 7353 patients admitted with acute MI (age 63 ± 12 years, 29% female), 4366 (59.4%) patients had STEMI, and 2987 (40.6%) NSTEMI. Patients age was not different between the two groups (p=0.077). NSTEMI patients smoked less (48.3% vs. 54%, p<0.001), but were more diabetics (37.8% vs. 33.6%, p<0.001), more hypertensives (69.6% vs. 63%, p<0.001), frequently had family history for coronary artery disease (CAD) (40% vs 38%, p=0.009), and included more females compared to STEMI patients (32% vs 27%, p<0.001). The two groups of patients, did not differ in the prevalence of significant CAD on angiography (66.8% vs. 67.8%, p = 0.396), but NSTEMI patients underwent less primary percutaneous interventions compared with STEMI patients (43.6% vs. 55.2%, p < 0.001). Conclusion: In Kosovo, STEMI is commoner than NSTEMI, who were mostly males, more likely to have diabetes, hypertension and family history for CAD compared to those with NSTEMI. Smoking and arterial hypertension proved the strongest predictors of acute MI, in Kosovo, thus highlighting the urgent need for better atherosclerosis risk control and education strategy.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Introduction: Determination of radiological bone age (BA) is a diagnostic method that consists of estimating chronological age (CA) from the bone maturation of children. Although environmental and hormonal factors can interfere with bone ossification, the process is essentially dependent on ancestral inheritance. These ethnic backgrounds are not usually considered, which can lead to biased interpretations and inadequate decision-making by pediatricians or forensic experts. The objective of this study was to determine the precision and accuracy of these radiological procedures among different ethnic groups. Methods: A qualitative systematic review carried out following MOOSE statement and previously registered in the International Prospective Registry of Systematic Reviews PROSPERO (CRD42023449512). Search was performed in MEDLINE (PubMed) (n=561), Cochrane Library (n=261), CINAHL (n=103), Web of Science (WOS) (n=181) and public institutional repositories (n=37) from inception to 31st December 2022 using Mesh as “Diagnostic Techniques and Procedures”, “Diagnostic imaging”, “Radiography”, “Age Determination by Skeleton” and free terms combining with booleans “AND” and “OR”. PEDro scale, and Risk of Bias in non-randomized Studies of Exposure (ROBINS-E) were used to assess methodological quality and risk of bias of included studies respectively. Results: 51 articles (n=19,531) were included according to the inclusion criteria previously established. There was a good to moderate methodological quality and a high to very high risk of bias. Skeletal methods for determining BA were precised in terms of intra-observer and inter-observer reliability in all ethnic groups. Regarding to accuracy of Skeletal methods in Caucasians and Hispanic children, GPA was accurate at all ages, but in youths, TW3 RUS could be a consistent alternative. In Asian and Arab, GPA and TW3 overestimated BA in adolescents near adulthood. In African youths, GPA overestimated BA while TW3 was more accurate in estimating CA. Dental and Cervical radiographic methods are equally precise but lesser accurate than Skeletal BA determination. Conclusion: Skeletal radiographic methods GPA and TW3 are both precise for BA determination among all ethnical groups, but their accuracy in estimating CA can be altered by racial bias.

Intergenerational integration has given rise to a novel aging paradigm known as all-age communities, which is garnering international attention. In China, the aging population and the implementation of the three-child policy have resulted in increased demand for retirement and childcare services among residents in older neighborhoods. Consequently, there is a pressing need to retrofit these older neighborhoods to accommodate all-age living arrangements given the high demand they generate. Therefore, this study undertakes research interviews with residents and constructs an exploratory theoretical model rooted in established theory. To assess the significance of our model, we employ Smart PLS 3.0 based on 297 empirical data points. Our findings indicate that anxiety has a significant negative effect on payment behavior; objective perception, willingness to pay, and government assistance exert significant positive effects on payment behavior. By comprehensively analyzing the mechanisms underlying residents’ payment behavior, this study provides valuable insights to the government for promoting the aging process within communities and formulating effective transformation policies.

This study examined the eye movement patterns of 317 elementary students across reading conditions (audio-assisted reading (AR) and reading-only (R)) and text types (fiction and non-fiction), and identified eye movement parameters that predict their literal comprehension (LC) and inferential comprehension (IC). Participants, randomly assigned to either reading condition and either text type, answered questions assessing their LC and IC. Average fixation duration (AFD), total fixation duration (TFD), and scanpath length were used as eye movement parameters. There were main effects of age on all parameters and interaction effects between age and reading condition on TFD and scanpath length. Controlling for age, TFD had a positive impact on LC of both text types in the AR, while under the R, it affected negatively on IC of both text types. Longer scanpaths predicted IC of fiction in the AR, LC and IC of non-fiction under the AR, and LC of non-fiction within the R. AFD influenced negatively on IC of fiction in the AR, LC and IC of non-fiction in the AR, and LC of non-fiction under the R. These eye movement patterns and predictors indicate children employ different reading strategies based on reading modality and text type.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A recent study demonstrated that noninvasive measurements of cortical hemodynamics and metabolism in the resting human prefrontal cortex can facilitate quantitative metrics of unilateral mitochondrial-hemodynamic coupling and bilateral connectivity in infraslow oscillation (ISO) frequencies in young adults (YA). The ISO includes three distinct vasomotions with endogenic (E), neurogenic (N), and myogenic (M) frequency bands. The goal of this study was to prove the hypothesis that there are significant differences between young and older adults (OA) in the unilateral coupling (uCOP) and bilateral connectivity (bCON) in the prefrontal cortex. Accordingly, we performed measurements from 24 OA (67.2 ± 5.9 years of age) using the same 2-channel broadband near-infrared spectroscopy (bbNIRS) setup and resting-state experimental protocol as those in the recent study (Shahdadian et al, Cerebral Cortex Communications, 2022). After quantification of uCOP and bCON in three E/N/M frequencies and statistical analysis, we demonstrated that OA had significantly weaker bilateral hemodynamic connectivity but significantly stronger bilateral metabolic connectivity than YA in the M band. Furthermore, OA exhibited significantly stronger unilateral coupling on both prefrontal sides in all E/N/M bands, particularly with a very large effect size in the M band (&gt; 1.9). These age-related results clearly support our hypothesis and were well interpreted following neurophysiological principles. The key finding of this paper is that the neurophysiological metrics of uCOP and bCON are highly associated with age and may have the potential to become meaningful features for human brain health and be translatable for future clinical applications, such as early detection of Alzheimer’s disease.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

The giant panda (Ailuropoda melanoleuca) is one of the most endangered species of land mammals and has significant academic research value worldwide. The evaluation of hematological parameters in giant pandas is important for assessing the physiological status of animals. This study collected blood samples from 12 healthy giant pandas from September 2018 to August 2020 under non-anesthetic conditions. The samples were then analyzed for basic blood indices and blood rheology, and normal values for hematological parameters and blood rheology under non-anesthetic conditions in giant pandas in Beijing area were obtained. The study confirmed the influence of age and season on hematological and biochemical parameters in captive giant pandas: hematological morphology, blood rheology, and serum enzymes showed seasonal variations, while age affected the changes in serum enzymes, serum protein content, and serum metabolite content. There are significant differences in blood indicators among different age groups of giant pandas, indicating variations in the overall metabolic processes and differences among pandas of different age groups. Seasonal variations showed a regulatory effect on blood rheology parameters and a negative effect on blood viscosity. Further research should be conducted to investigate whether factors such as season and climate cause environmental stress in captive giant pandas. The results obtained in this study aim to better protect the stability of the giant panda population and provide references for the appropriate feeding and medical care of captive giant pandas.

The impact of early maternal age on several outcomes (e.g. mental health issues, delinquency, aggression, impulsivity, victimization and interpersonal difficulties) has been studied since the late 1980s. Research has demonstrated links between exposure to adverse childhood experiences (ACEs) and trauma related outcomes such as substance abuse, interpersonal and self-directed violence, and sexual risk-taking, to name a few. The current study analyzed the incidence of ACE exposure and mental health outcomes (e.g. suicidal behaviors or self-harm, psychiatric hospitalizations, and substance use) as related to early maternal age in youth known to have experienced trafficking or sexual abuse. General demographics and incidence of various experiences and clinical presentations (e.g. ACE exposure, age of mother at birth of youth and age at first birth), and history of self-harm, substance use and psychiatric hospitalization were examined in a sample of 225 youth referred for services subsequent to experiences of sex trafficking or exploitation. Relationships between ACE exposure and maternal age related to mental health outcomes was also examined. Trafficked and exploited youth reported rates of ACE exposure and poor mental health outcomes at far greater rates than the general population. Significant findings were related to early maternal age and engaging in self-harm or suicidal behaviors. Previously anticipated mediational analyses were not conducted due to the sample size and lack of correlations. Findings highlight the significant ACE exposure and high needs of exploited, trafficked and abused youth and related mental health outcomes, emphasizing the need for early and comprehensive preventive and therapeutic interventions.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

Background and Objectives: The current study aimed to determine the impact of fasciotomy on mortality and morbidity in children and adults with crush-related AKI following the 2023 Kahramanmaraş earthquakes. Materials and Methods: The study included individuals who had suffered crush injuries after the 2023 Kahramanmaraş earthquakes and were identified as having acute kidney injury (AKI). Patients with AKI were divided into two groups based on age: those under 18 years and those over 18 years. A comparative analysis was conducted between the mortality and morbidity rates of patients who underwent fasciotomy and those who did not. Disseminated intravascular coagulopathy (DIC), sepsis, and adult respiratory distress syndrome (ARDS) have all been identified as contributors to morbidity. Results: The study was conducted with a total of 40 patients (21 males and 19 females) aged between four and 83 years. A total of 21 patients underwent fasciotomy and the patients underwent varying numbers of fasciotomy, ranging from zero to 11. The mortality rate was 12.5%, corresponding to five adult patients. No instances of mortality were reported in the paediatric cohort. The application of fasciotomy in instances of crush-induced AKI did not result in elevated levels of mortality in either the paediatric or adult demographic. Within the adult population, a substantial difference in the duration of dialysis was observed between individuals who underwent fasciotomy and those who did not. A statistically significant increase in the number of fasciotomy incisions was observed in patients diagnosed with sepsis compared with those without sepsis. The study found a significant positive correlation between the number of fasciotomy incisions and dialysis days. Conclusions: Neither adult nor paediatric patients with crush-induced AKI showed an increased risk of death after fasciotomy. The number of fasciotomy incisions significantly correlated with the development of sepsis. Despite experiencing delays in hospital admission for paediatric patients, the incidence of both crush syndrome and mortality rates among children remained relatively low.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Treating clubfoot in walking age children is debated, despite studies showing that using Ponseti casting principles can correct the mid-foot effectively. We aimed to explore techniques and approaches for management of older children with clubfoot and identify areas of management consensus. A mixed-methods cross-sectional electronic survey on delayed presenting clubfoot (DPC) was sent to 88 clubfoot practitioners (response rate 56.8%). We collected data on decision-making, casting, imaging, orthotics, surgery, re-currence, rehabilitation, multidisciplinary care and contextual factors. The quantitative data were analysed using descriptive statistics and the qualitative data were analysed using conventional content analysis. Many respondents used the Pirani score and some used the PAVER score to aid deformity severity assessment and correctability [1,2]. Ponseti casting principles were consistently applied with a stepwise approach. Con-textual factors influenced the timing of the treatment, the decision to treat a bilateral deformity simultaneously, and casting intervals. Differences were seen around orthotic usage and use of tibialis anterior tendon transfer following full correction. The survey identified consensus areas in overall principles of management for delayed presenting clubfoot and implementation of Ponseti principles, indicating these principles are well recognized as a multidisciplinary approach for older children with clubfoot. Some dif-ferences in approach may reflect different economic or social contexts. The principles can be adapted well for different geographical and healthcare contexts.

As the global aging trend continues to intensify, there will inevitably be more complex and diverse aging problems in the future. There is no doubt that designers have the responsibility to explore the possibilities of the future and solve the problems that will be faced in the future. Based on the Future Cone, the Double Diamond Model and the IDEO Method Cards, this study proposes a new model to guide the design practice of future aging issues in the context of aging. With the aim of validating and refining the framework, an ageing designer workshop was held where participants were asked to imagine, explore and express ideas about future ageing issues. The workshop was used to refine the proposed model. More specifically, the model includes a future concept, a design guidance process based on the Double Diamond Model, and tools that can be applied at all stages of design, which can help designers generate ideas and solutions for future aging problems, and collectively lead society to a more desirable future. Moreover, this study also explores broader directions for the development of the model and provides a reference for continued research on this topic in the future.

Immunological aging type definition requires establishing reference intervals from the distribution of immunosenescence biomarkers conditional on age. For 1,605 individuals (18–97 years), we determined the comprehensive IMMmune Age indeX IMMAX from flow cytometry-based blood cell sub-populations, and identified age-specific centiles by fitting generalized additive models for location, scale and shape. The centiles were uncorrelated with age, and facilitated the categorization of individuals as immunologically slow or fast aging types. Using its 50th percentile as reference, we rescaled IMMAX to equivalent years-of-life (EYOL), and computed the immunological age gap as difference between EYOL and chronological age. Applied to preliminary baseline and follow-up measurements from 53 participants of the Dortmund Vital Study (Clinical-Trials.gov Identifier: NCT05155397), the averaged changes in IMMAX and EYOL conformed to the 5-year follow-up period, whereas no significant changes occurred concerning IMMAX centiles and age gap. This suggested that the participants immunologically adapted to aging, and kept their relative positions within the cohort. Sex was non-significant. Methodical comparisons indicated that future confirmatory analyses with the completed follow-up examinations could rely on percentile curves estimated by simple linear quantile regression, while the selection of the immunosenescence biomarker will greatly influence the outcome, with IMMAX representing the preferable choice.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

This trial was carried out to find out the effects of the parent flocks and the hatching time of broiler chickens on the production traits and bacteriota development of animals. Two times 730 hatching eggs were collected from two different parent flocks with age of 22-23 and 65-66 weeks. In the hatchery both groups were divided into two subgroups, when the day-old chickens were separated according to their hatching time. A feeding trial was carried out afterwards, using the 4 treatments in 6 replicate floor pens, feeding commercial starter, grower, and finisher diets, that contained all the nutrients according to the breeder’s recommendations. The day-old chickens of the parent older flock and those hatched later were heavier and this advantage of the birds remained until end of the production period. The different age and origin of parent flocks failed to modify the microbiological parameters of the chicken’s ceca. However, the hatching time significantly influenced the different bacteriota diversity indices. The late hatched chickens showed higher Bacteroidetes and Actinobacteria and lower Firmicutes abundances at day 11. These treatments resulted differences in the main families, Ruminococcaceae, Lactobacillaceae, Bacteroidaceae. These differences could not be found at day 39.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Abstract: Accurately predicting a fetus's gestational age (GA) is of utmost importance in prenatal care. This study aimed to develop an artificial intelligence (AI) model that can automatically predict GA using biometric measurements derived from fetal brain mag-netic resonance imaging (MRI). Additionally, we aimed to assess the significance of con-sidering different references when interpreting GA predictions. To achieve this, we obtained measurements such as Biparietal Diameter (BPD), Fron-to-occipital Diameter (FOD), and Head Circumference (HC) from a dataset comprising 52 normal fetal MRI cases with T2 Haste sequences from Rush University. Both manual and AI-based methods were utilized to acquire these measurements. We also employed three reference papers (Garel, Freq, and Bio) for comparison purposes. The results demonstrated a strong correlation between manual and AI measure-ments, indicating consistency between the two methods. The AI-based measurement of HC exhibited a higher correlation with actual values compared to BPD, FOD, and correct-ed BPD (BPDC). When comparing these measurements with GA in the Picture Archiving and Communication System (PACS), the differences varied depending on the reference used. Specifically, the differences ranged from 0.47 to 2.17 weeks for BPD, 0.46 to 2.26 weeks for FOD, and 0.75 to 1.74 weeks for HC. Furthermore, the Pearson correlation coeffi-cient analysis revealed that all correlation coefficients between PACS records and GA pre-dictions using different references were greater than 0.97. In conclusion, the AI model based on fetal brain MRI accurately predicts GA by uti-lizing BPD, FOD, and HC measurements. The AI approach, which involves combining line segments to calculate fetal head circumference, offers improved accuracy and con-venience compared to manual estimation. This study underscores the potential of AI models in accurately estimating gestational age and highlights their utility in prenatal care. By integrating AI as a valuable tool in prenatal care, we can enhance the accuracy, ef-ficiency, and decision-making involved in assessing fetal development and monitoring pregnancies using MRI measurements.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Stand biomass in boreal forests has attained recognition for its crucial role in carbon cycling. In this study, we examined the effect of stand age on above- and belowground biomass allocation in downy birch (Betula pubescens Ehrh.) in three drained peatland sites in Central Finland. We used allometric equations to estimate individual-tree above-ground biomass and its various components, including stem wood, stem bark, living branches, leaves, and dead branches. The above-ground biomass ranged from 10.5 t ha-1 to 276.0 t ha-1 and foliage biomass from 0.009 t ha-1 to 0.6 t ha-1. We found that stand age had a strong correlation with above-ground biomass, but foliage biomass appeared to peak at the middle-aged (50 years) stand compared to the young (10 years) or mature (80 years) stands. We observed coarse root biomass production of 45, 250, and 110 g m-2 in the 0–50 cm peat layer for young, middle-aged, and mature stands, respectively. Most coarse root biomass occurred in the top 20-cm layer (77%). These findings improve our understanding of how biomass allocation patterns – specifically those in foliar biomass– change over time, and the impact on litter inputs into the soil.

Age-related changes in behavior and sensory perception have been observed in a wide variety of animal species. In ants and other eusocial insects, workers often progress through an ordered sequence of olfactory-driven behavioral tasks. Notably, these behaviors are plastic, and workers adapt and rapidly switch tasks in response to changing environmental conditions. In the Florida carpenter ant, smaller minors typically perform most of the work needed to maintain the colony while the larger majors are specialized for nest defense and rarely engage in these routine tasks. Here, we investigate the effects of age and task group on olfactory responses to a series of odorant blends in minor and major worker castes. Consistent with their respective roles within the colony, we observed significant age-associated shifts in the olfactory responses of minors as they transitioned between behavioral states, whereas the responses of majors remained consistently low regardless of age. Furthermore, we identified a unitary compound, 3-methylindole, which elicited significantly higher responses and behavioral aversion in minor nurses than in similarly aged foragers suggesting that this compound may play an important role in brood care. Taken together, our results suggest that age- and task-associated shifts in olfactory physiology may play a critical role in the social organization of ant colonies.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

We previously showed that mice with knockout in the peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) gene encoding the PGC-1a protein and nuclear factor erythroid 2 like 2 (NFE2L2) gene, showed some features of the age-related macular degeneration (AMD) phenotype. To further explore the mechanism behind the involvement of PGC-1a in AMD pathogenesis we used young (3-month) and old (12-month) mice with knockout in the PPARGC1A gene and age-matched wild-type (WT) animals. An immunohistochemical analysis showed age-dependent different expression of markers of oxidative stress defense, senescence and autophagy in the retinal pigment epithelium of KO animals as compared with their WT counterparts. Multivariate inference testing showed that senescence and autophagy proteins had the greatest impact on the discrimination between KO and WT 3-month animals, but proteins of antioxidant defense also contributed to that discrimination. A bioinformatic analysis showed that PGC-1a might coordinate the interplay between genes encoding proteins involved in antioxidant defense, senescence and autophagy in the aging retina. These data support importance of PGC-1a in AMD pathogenesis and confirm the utility of mice with PGC-1a knockout as an animal model to study AMD pathogenesis.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Visual impairment and blindness are a growing public health problem, as they reduce the quality of life of millions of people. The management and treatment of these diseases represent a scientific and therapeutic challenge, since the different cellular and molecular actors involved in the pathophysiology are still being identified. The visual system components, particularly the retinal cells, are extremely sensitive to genetic or metabolic alterations, and immune cells activated by insults contribute to biological events that culminate with vision loss and irreversible blindness. Several ocular diseases are linked to retinal cell loss, and diseases such as retinitis pigmentosa, age-related macular degeneration, glaucoma and diabetic retinopathy are characterized by pathophysiological hallmarks that represent possibilities to study and develop novel treatments for retinal cells degeneration. Here, we present a compilation of revisited information on retinal degeneration, including pathophysiologic and molecular features, biochemical hallmarks and possible directions for novel treatments, aiming to assist as a guide for innovative research. The expansion of knowledge of the mechanistic bases of the pathobiology of eye diseases, including information on the complex interactions of genetic predisposition, chronic inflammation, and environmental and aging-related factors will allow the identification of new therapeutic strategies.

The coombs (in Catalan comes) form an integral part of the landscape. These are small valleys, with the deepest and flattest part cultivated for agriculture. They are predominantly found in the most arid regions of Catalonia, particularly around the cities of Tarragona and Lleida. They are generally dry land areas. We propose that these coombs gained significance in the early centuries of the Middle Ages, a period marked by intense erosion. It is important to identify their locations and establish connections with medieval written documents, the settlements that thrived throughout the Middle Ages, archaeological sites such as necropolises, and the valuable data derived from to-ponymy studies. We think that understanding these coombs can greatly contribute to under-standing how the territory was organized in the Middle Ages, the extent of cultivated lands that were established, and the distribution of many settlements. Ultimately, this knowledge can aid in acquiring better understanding of the current landscape.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Lipofuscin accumulates with age as intracellular fluorescent granules originating from incomplete lysosomal digestion of phagocytosed and autophagocytosed material. The purpose of this review is to provide an update on the current understanding of the role of oxidative stress and/or lysosomal dysfunction in lipofuscin accumulation and its consequences, particularly for retinal pigment epithelium (RPE). Next, the fluorescence of lipofuscin, spectral changes induced by oxidation, and its contribution to retinal fluorescence are discussed. This is followed by reviewing recent developments in fluorescence imaging of the retina, and the current evidence on the prognostic value of retinal fluorescence for the progression of age-related macular degeneration (AMD), the major blinding disease affecting elderly people in developed countries. The evidence of lipofuscin oxidation in vivo, and the evidence of increased oxidative damage in AMD retina ex vivo lead to the conclusion that imaging of spectral characteristics of lipofuscin fluorescence may serve as a useful biomarker of oxidative damage which can be helpful in assessing the efficacy of potential antioxidant therapies in retinal degenerations associated with accumulation of lipofuscin and increased oxidative stress. Finally, amendments to currently used fluorescence imaging instruments are suggested, to be more sensitive and specific for imaging spectral char-acteristics of lipofuscin fluorescence.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

In vineyards, Botryosphaeria dieback (BD) occurs in young and old plants. In the field, the prevalence and severity of the disease increase proportionally with the age of the vineyards. Among the pathogens that cause (BD), Diplodia seriata is the most prevalent species in Chile and other countries with a Mediterranean climate. To date, no information is available on the sus-ceptibility of adult wood to infection by this pathogen since most of the pathogenicity tests have been carried out on 1- or 2-year-old shoots or detached canes. Therefore, a pathogenicity test was carried out on plants under field conditions, with inoculations in plants, on one-year-old shoots, and 2- and 10-year-old wood in grapevine cv. Cabernet Sauvignon. A pathogenicity test was carried out with two isolates of D. seriata selected in an assay in detached canes that were 2-year-old. The results on plants showed that D. seriata was significantly more aggressive on 10-year-old than on one- or two-year-old tissue. These results were compared with the lesions ob-tained from two-year-old canes. The results of this work are consistent with the damage ob-served in the field, highlight the importance of identifying each pathogenic species that causes (BD) and contribute to the knowledge of the epidemiology of this disease in Mediterranean cli-mates.

Age-related mitochondrial markers may facilitate the prognosis of artificial reproductive technology outcomes. In this report, we present our study concerning the ratio of cf-mtDNA/cf-nDNA, namely the amount of cell-free mitochondrial DNA relative to cell-free nuclear DNA, in the follicular fluid (FF) of women undergoing IVF, aiming to generate a molecular fingerprint of oocyte quality. The values of this ratio were measured and compared among three groups of women (101 in total): (A)31 women with polycystic ovary syndrome (PCOS), (B) 34 women younger than 36 years, and (C) 36 women older than 35 years of age. Real-time quantitative PCR (qPCR) was performed to quantify the ratio by using nuclear- and mitochondrial-specific primers and analyzed for potential correlation with age and pregnancy rate. Our analysis showed that the level of FF-cf-mtDNA was lower in the group of advanced-age women than in the groups of PCOS and non-PCOS women. Moreover, a significant positive correlation between FF-cf-mtDNA and the number of mature (MII) oocytes was observed. Collectively, the data show that the relative ratio of cf- mtDNA to cf-nDNA content in human FF can be an effective predictor for assessing the corresponding oocyte’s age-related performance in IVF.

Background and Objectives: The purpose of this study was to assess the bleeding that occurs during the first weeks of gestation and its implications throughout pregnancy. Secondarily, we studied the associated complications that appeared and tried to identify possible risk factors that could serve to select women at a greater risk of adverse outcomes that could benefit from an early diagnosis and improved monitoring. Materials and Methods: We selected all the women who consulted for first trimester metrorrhagia in the Emergency Department of the Hospital QuirónSalud in Malaga over the year 2015. We refer to first trimester metrorrhagia as that which occurs until week 12+6. Once the pregnant women were identified, we studied certain risk factors already present prior to the gestation and others associated with the gestation and its evolution. Results: After reviewing the visits to the obstetrics and gynecology emergency department, we selected those patients that met the inclusion criteria, resulting in a sample of 696 patients that we followed up. The average age of our patients was 34.1 years, with an average number of visits to the hospital of 1.67, most of them between the 5th and 8th weeks of pregnancy. 45.3% of these pregnancies resulted in a first trimester miscarriage, mainly between weeks 6 and 8. We tried to establish associations in order to identify possible risk factors, finding a relationship between increased maternal age and a higher risk of first trimester pregnancy loss, which rises as maternal age increases (33,37 4,316 years vs 35,01 4,740 years). This increase in risk is proportional to the increase in age. We made subgroups of women over 35 and over 40 and confirmed that increased age led to worse outcomes. We also studied several gestational complications and concluded that they appeared more frequently among older women. These complications include prematurity (33.11 vs 34.48 years), gestational diabetes (33.11 vs 36.06 years) and preeclampsia (33.25 vs 35 years). We reviewed the obstetric history of pregnant women whose gestation resulted in miscarriage and found that 50.5% of them had previously had another loss. Conclusions: Comparing the results with data from the general population, we found that the rate of first trimester miscarriage is up to 3 times higher among women who present bleeding during the first weeks of gestation compared to those who do not develop this complication. Maternal age is a risk factor for first trimester pregnancy loss and for the development of complications associated with pregnancy.

Japan has the world’s largest old population ratio, and aging is an urgent societal issue. As global trends seem to be following Japan’s social changes, there is an emphasis on municipalities becoming more age-friendly. Hence, we examine the age-friendliness of 135 Japanese municipalities, selecting 240 resident architectural designers and constructors to assess their municipalities, using the Age-Friendly Cities and Communities Questionnaire (AFCCQ). The findings indicate that Japan lacks “outdoor spaces and buildings.” Additionally, the evaluation of “housing,” “community support and health services,” and “transportation” in populated municipalities in the past five years is significantly higher than those in depopulated ones. Age-friendliness is significantly affected in the AFCCQ total score (hereafter, Score) based on “housing,” “social participation,” “community support and health services,” “transportation” and “financial situation” evaluations. High specificity (0.939) was found when the Score was treated as a marker of depopulation and, therefore, an age-friendly approach is a necessary condition to prevent depopulation. Furthermore, a lack of “communication and information” is observed in municipalities with a higher rate of single-person households aged 65 years and above. Therefore, resident architectural designers’ and constructors’ assessments, combined with the AFCCQ can be a powerful tool in evaluating the age-friendliness of municipalities.

Introduction: The primary objective of researchers in the biology of ageing is to gain a comprehensive understanding of the ageing process while developing practical solutions that can enhance the quality of life for older individuals. This involves a continuous effort to bridge the gap between fundamental biological research and its real-world applications. Purpose: In this narrative review, we attempt to link research findings concerning the hormetic relationship between neurons and germ cells, and translate these findings into clinically relevant concepts. Methods: We conducted a literature search using PubMed, Embase, PLOS, Digital Commons Network, Google Scholar and Cochrane Library from 2000 to 2023, analyzing studies dealing with the relationship between hormetic, cognitive, and reproductive aspects of human ageing. Results: The process of hormesis serves as a bridge between the biology of neuron-germ cell interactions on one hand, and the clinical relevance of these interactions on the other. Details concerning these processes are discussed here, emphasizing new research which strengthens the overall concept. Conclusions: This review presents a scientifically and clinically relevant argument, claiming that maintaining a cognitively active lifestyle may decrease age-related degeneration, and improve overall health in ageing.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

Purpose: Cardiovascular disease (CVD) is a major risk factor for mortality in patients with osteoarthritis, and comorbidities increase postoperative complications after total knee arthroplasty (TKA). Arteriosclerosis plays a major role in hemodynamic dysfunction and CVD; however, arteriosclerosis has not been preoperatively evaluated before TKA using the cardio–ankle vascular index (CAVI). In this study, we evaluated the degree of preoperative arteriosclerosis using the CAVI in patients undergoing TKA, as well as its correlations with several preoperative patient factors. Methods: Arteriosclerosis was evaluated in 209 consecutive patients (251 knees) with osteoarthritis who underwent TKA at our institution between May 2011 and June 2022. The CAVI was measured in the supine position 1 day before TKA, and the correlations between the CAVI and several clinical factors were analyzed. A p value of <0.05 was considered statistically significant. Results: The CAVI was normal in 62 knees (25%), borderline in 71 knees (28%), and abnormal in 118 knees (47%). Univariate analysis revealed a moderate positive correlation between preoperative CAVI and age (r = 0.451, p < 0.001) and a weak negative correlation between preoperative CAVI and body weight (r = −0.306, p < 0.001) and body mass index (BMI) (r = −0.319, p < 0.001). Multivariate analysis showed that age (β = 0.349, p < 0.001) and BMI (β = −0.235, p < 0.001) were significantly correlated with preoperative CAVI. Conclusion: Arteriosclerosis should be carefully managed intraoperatively and postoperatively in patients with osteoarthritis undergoing TKA, particularly in older patients and patients with a low BMI.

For a long time, there has been interest in the relationship between personality traits and life satisfaction. However, many previous studies suffer from small sample sizes or selective sampling, sometimes leading to biased or imprecise results. The current study, which focuses on the trait of extraversion, attempts to overcome these limitations by using a large-scale German survey of more than 40,000 individuals aged 10 to 72. As the descriptive and regression results clearly show, there is a statistically significant relationship between extraversion and several dimensions of current life satisfaction. Depending on the type of satisfaction, the unstandardized regression coefficients range from 0.18 to 0.33. To gain further insight, age is added as an explanatory variable to test whether these associations change as a person ages. The results show that the effect sizes sometimes differ by age but remain robust and statistically significant. In conclusion, the study adds to the literature by providing convincing evidence that extraversion and life satisfaction are positively associated, at least in Western and industrialized countries, and that there are interaction effects with age.

The concept of ecosystem services (ESs) provides a valuable approach to communicate societies' dependence on natural ecosystems, assisting in the evaluation of measures to protect vegetation in watersheds that promote water-related ESs. Vegetation cover and land use are important factors related to the capacity of ecosystems to provide soil loss regulation and sediment retention services, which are highly relevant for sediment management in watersheds draining into reservoirs with multiple water uses. This study aims to assess the relationship between potential changes in land use and land cover and the sediment retention service provided by riparian vegetation in a watershed draining into a hydroelectric reservoir in the Brazilian Cerrado. Sediment load was selected as a physical variable that affects different water uses in reservoirs, with these uses being dependent on the quality or quantity of stored water. Scenarios were analyzed to represent landscape reconfigurations from a baseline condition in order to account for the recovery of riparian vegetation by the agricultural sector, as foreseen in the Brazilian Forest Code. To map and quantify variations in annual sediment retention, the InVEST model was used, which allows estimating an integrated response of the drainage basin to large-scale land use changes over time and space. The results show that for the drainage basin of the Corumbá IV Hydroelectric Power Plant (HPP), the recovery of riparian areas occupied by annual crops has the potential to generate greater benefits to water use in the reservoir. In the studied catchment area, 14% of the total vegetation deficit in riparian areas is occupied by crops, while 86% is occupied by pastures. This highlights the buffering role of riparian vegetation as an effective practice for managing sediment flows originating from sheet erosion in agricultural landscapes. The methodology employed in this study allows for the quantification and mapping of the effects of soil and water conservation measures in river basins. This enables the prioritization of sectoral efforts for the restoration of native vegetation, considering the highest returns in benefits perceived by water users affected by sediment input in reservoirs. The study's results reinforce the importance of conserving vegetation in riparian areas and their surroundings for sediment retention, highlighting the role of these areas as assets in providing water-related ecosystem services.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

The advent of the digital age has brought about significant transformations in the entertainment industry, challenging traditional paradigms and redefining the ways in which content is created, distributed, and consumed. This research paper critically reviews the paradigm shift occurring in the entertainment industry, focusing on the implications of digital technologies, the rise of online platforms, changing consumer behavior, and the impact on various stakeholders. By analyzing relevant literature, industry reports, and case studies, this paper aims to comprehensively understand the challenges and opportunities presented by the digital age and assess its impact on the entertainment industry.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

The Huayangchuan uranium deposit, located in the west of the Xiaoqinling belt on the southern margin of the North China Craton, is a polymetallic deposit dominated by U, Nb, Pb, and rare earth elements. The Huayangchuan uranium deposit, discovered in the 1950s, has long been known as a carbonatite-type uranium deposit. Recently, new geological work has found uranium mineralisation in many granitic pegmatite veins in the Huayangchuan deposit and adjacent areas. Here, we report a systematic investigation of the petrography, whole-rock geochemistry, zircon U-Pb ages, and in situ Lu-Hf isotopic characteristics of newly discovered U-rich granitic pegmatite veins in the west of Huayangchuan deposit. The petrological results showed that the lithology of the samples is equivalent to that of granite. The U-Pb ages of zircon were 1826.3 ± 7.9 and 1829 ± 11 Ma. Microscopically, the symbiotic characteristics of zircon, betafite, and uraninite exist in the intergranular fissures of K-feldspar and quartz, reflecting metallogenic phenomena in the rock formation process. Almost all whole-rock samples were rich in SiO2 (64.37–70.69 wt.%), total alkalis (K2O+Na2O = 8.50–10.30 wt.%), and Al2O3 (12.20–14.41 wt.%), but poor in Ti2O (0.23–0.73 wt.%), MgO (0.38–0.90 wt.%), P2O5 (0.14–0.83 wt.%), MnO (0.04–0.57 wt.%). Additionally, they showed enrichment of LILEs (such as Rb, Ba, Th, U, and K), depletion of HFSEs (such as Ta, Nb, P, Ti, and Hf), no alkaline dark minerals, and the characteristics are typical of intraplate A1-type granite. The A1-type granite displayed low zircon εHf(t) values (-19.42– -15.02) with zircon two-stage Hf model aged 3.10–2.76 Ga, indicating that the U-rich granitic pegmatite was derived predominantly from partial melting of the ancient continental crust (such as the early Taihua group formed in Archean-Neoarchean). Combined with the above results and regional geological data, the U-rich granitic pegmatite discovered in the Huayangchuan deposit was related to granite magma activity that formed in a post-collisional regime after the Luliang movement in the late Palaeoproterozoic. This study suggests that future uranium prospecting work in this area should focus on late Palaeoproterozoic U-rich granitic pegmatites.

Despite the high prevalence of epilepsy in individuals with autism spectrum disorder (ASD) there is little information regarding whether seizure characteristics and treatment effectiveness change across age. Using an on-line survey, seizure characteristics, effectiveness of antiepileptic treatments, comorbidities and ASD diagnosis were collected from individuals with ASD and seizures. We previously reported overall general patterns of treatment effectiveness but did not examine the effect of seizure characteristics or age on antiepileptic treatment effectiveness. Such information would improve the personalized medicine approach to the treatment of seizures in ASD. Survey data from 570 individuals with ASD and clinical seizures were analyzed. Seizure severity (seizure/week) decreased with age of onset of seizures, plateauing in adolescence, with a greater reduction in generalized tonic clonic (GTC) seizures with age. Seizure severity was worse in those with genetic disorders, neurodevelopmental regression (NDR) and poor sleep maintenance. Carbamazepine and oxcarbazepine were reported to be more effective when seizures started in later childhood while surgery and the Atkin’s/Modified Atkin’s Diet (A/MAD) were reported to be more effective when seizures started early in life. A/MAD and the ketogenic diet were reported to be more effective in those with NDR. Interestingly, atypical Landau-Kleffner syndrome was associated with mitochondrial dysfunction and NDR, suggesting a novel syndrome. These interesting findings need to be verified in independent, prospectively collected cohorts, but none-the-less these data provide some insight into novel relationships that may assist in a better understanding of epilepsy in ASD and providing insight into personalizing epilepsy care in ASD.

The potential impact of a specific physical activity program on biomechanical gait parameters and neuromuscular strategies around the ankle joint in older adults with sarcopenic obesity (SO) remains largely unexplored. The objective of this study was to investigate the effectiveness of a 24-week Posture, Strengthening, and Motricity (PSM) program in improving neuromuscular strategies and biomechanical gait parameters in older adults with SO. 40 Participants were randomly assigned to either the trained group (TG) and the control group (CG). Only the TG received the PSM program. Standardized evaluations were performed before and after the intervention, including walking tests on an instrumented gait analysis treadmill to evaluate biomechanical gait parameters and EMG activity of ankle muscles. After the PSM program, TG exhibited an increase in comfortable walking speed (+80%, p<0.001) and step length (+38%, p<0.05). Moreover, TG demonstrated a reduction in CoP velocity (-26%, p<0.01). These gait modifications were associated with a decreased muscle activity during the different gait phases (p<0.05). The PSM program effectively improved gait, and neuromuscular capacities in older adults with SO. Notably, Results sheds light on the remarkable trainability of neuromuscular capacities in older adults with SO, despite the adverse effects of aging and obesity.

Malnutrition is the main cause of child mortality in developing nations, especially in Sub-Saharan Africa and South Asian countries. This undernutrition status is predominantly higher among primitive tribal (ST) children under 5 years of age. The nutritional status of tribal children is a serious concern in India. For this, there should be intends to examine the prevalence and determinants of primitive tribal children's nutritional status. To investigate the effect of household, child’s & maternal characteristics on biological children under 5 years of age. The study aims to find out the association between some selected determinants on scheduled tribe child’s nutritional status. The study used some selected variable of scheduled tribe mothers, household characteristics and their children anthropometric indices from DHS datasets of India, which was published by the NFHS datasets of India. In this study People datasets and Children (Under 5 years of age) of interviewed women file datasets of NFHS-IV & V is taken. The datasets of West Bengal, ST mothers, and their child into consideration as per the research interest. Then to analyze the determinants of ST children (U5 age) nutritional status, some determinant factors are taken from mothers, children and household characteristics. Children’s stunting, wasting and underweight as dependent variable and the mothers, child’s and household’s characteristics as independent variable. The statistical analysis was done by using Pearson Chi square test used to analyze the association between dependent and independent variables. The study results shows that the mother’s educational status, child’s age, birth order, size of child at birth, type of residence had significant associations with stunting. Mother's anemia status and mother age had significant associations with wasting. Mother education, currently breastfeeding, child age, sex of the child, birth order, size of child at birth, type of residence, wealth, toilet facility, and cooking fuel shows a significant association with underweight. The results found that many determinant factors had a significant role among ST children's (U5 age) nutritional status. Thus, the findings will help to achieve tentative resource allocation, and utilization through various programs and policies to improve the ST children (U5 age) nutritional status. There is a need to take a multisectoral and multidimensional approach to develop for those primitive tribal children.

This paper proposes an imperfectly vaccinated SVEIR model for latent age. We calculate the equilibrium points and basic reproduction number of the model. The asymptotic smoothness, uniform persistence and the existence of the attractor of the semi-flow generated by the solutions of the system are addressed. Moreover, using LaSalle’s invariance set principle and constructing Volterra-type Lyapunov functions, we can prove the global asymptotic stability of both the disease-free equilibrium and the endemic equilibrium of the model. The conclusion is that if the basic reproduction number R0 is less than one, the disease will gradually disappear. On the other hand, if the number is greater than one, the disease will become endemic and persist. Finally, measures that can effectively control the ongoing transmission of the disease have been obtained.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

Farmers are continually looking for new reliable, objective and non-invasive methods for evaluation of ewe condition. Live weight (LW) and body condition score (BCS) are used by farmers as a basis to determine the condition of the animal. Body composition is an important aspect of monitoring animal condition. The body composition is the amount of fat, lean and bone; knowing the amount of each is important because the information can be used for better strategic management interventions. Experiments were conducted to establish the relationship between body composition and body parameters, at key life’s stages (weaning and pre-mating), using measurements automatically determined by an image processing ap-plication at Lincoln University sheep farm for 88 Coopworth ewes. Computerized Tomography technology was used to develop relationship with body parameters and a subset was used to validate the predicted model. Multivariate linear regression (MLR), artificial neural network (ANNs) and regression tree (RT) statistical analysis methods were evaluated to determine their efficacy to predict body fat, lean and bone. The results showed a correlation between fat, lean and bone determined by CT and the fat, lean, bone weight estimated by live weight and body parameters calculated using the image processing application with R2 values of 0.90 for fat, 0.72 for lean and 0.50 for bone using ANNs statistical model. From these results, farmers can utilize accurate measures of fat which will enhance nutritional and management practices.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Accurately estimating a person's age is crucial for identity verification at all critical checkpoints, including airports, land borders, and seaports. Human gait may be used as a biometric identifier and indicator of age, among other things. This study aims to develop methods for estimating a person's age by observing their walk. In this paper, a novel technique for preprocessing the proposed gait dataset has been used by utilizing a combination of the gait energy image (GEI), the accumulated frame difference energy image (AFDEI), and the invariant moment of the image. The proposed technique outperformed state-of-the-art methods in terms of accuracy. The proposed method was tested and evaluated using a convolutional neural network (CNN), and it achieved an average accuracy of 90.35% across 14 different view angles within 5 K-Fold, the proposed method resulted in 94.68% and 94.54% in 30º and 75º view degree respectively. concluding that the approach is effective and promising for estimating age using human gait.

After three years of the onset of the pandemic, there is scarce evidence about how COVID-19 disease affect the female reproductive system, and consequently, the menstrual cycle. Since the common causes of secondary amenorrhea are considered as exclusion criteria in the studies about menstrual changes following SARS-CoV-2 infection, the prevalence of this event and the influencing factors in formerly menstruating women remains unknown. A retrospective observational cross-sectional study was conducted on Spanish adult women (N= 17,512), using an online survey; a subpopulation of SARS-CoV-2-infected-formerly menstruating women was included in the present analysis (n= 72). Collected data included general characteristics, medical history, and specific information about COVID-19 disease. 38.9% of the respondents experienced menstrual-related disturbances after suffering from the COVID-19 disease, unexpected vaginal bleeding being the most common (20.8%). Other alterations related with the length – “shorter” by 12.5% − and the flow − “heavier than usual” 30.3% − of the menstrual bleeding were reported. The binary logistic regression showed that being a perimenopausal woman (AOR 4.608, CI 95%, 1.018 – 20.856, p = 0.047) and having heavy menstrual bleeding (AOR 4.857, CI 95%, 1.239 – 19.031, p=0.023) are influential factors. This evidence could help health professionals to provide scientifically up-to-date information to their patients, empowering them to actively manage their reproductive health, especially in those societies where menstrual health is still a taboo.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Models with age as a variable but actual dynamics invariant under age structure allow use of MaxEnt to predict uniform age structure. Interpretations include a major role for accepting randomness as a causal principle in ecology (in the face of ignorance, in a further interpretative stance).

It is unclear how maternal glycemic status and maternal iodine status influence birth weight in mild-to-moderate iodine deficiency (ID). We studied the association between birth weight and both maternal glucose levels and iodine intake in pregnant women with mild-to-moderate ID. Glucose values were assessed using a glucose challenge test (GCT), non-fasting glucose before delivery; iodine status was assessed using an iodine food frequency questionnaire, serum thyroglobulin (Tg) and urinary iodine concentrations (UIC). Thyroid antibodies and free thyroxine (FT4) were measured. Obstetric and an-thropometric data were also collected. Large for gestational age (LGA) was predicted using a Cox proportional hazards model with multiple confounders. Tg>13g/L was in-dependently associated with LGA (adjusted hazard ratio = 3.4, 95% CI: 1.4–10.2, p=0.001). Estimated iodine intake correlated with FT4 among participants reporting io-dine-containing supplements (ICS) after adjusting for confounders (β = 0.4 95 %CI: 0.0002-0.0008, p=0.001). Newborn weight percentiles were inversely correlated with maternal FT4 values (β=-0.2 95 %CI:-0.08 - -56.49, p=0.049). We conclude that in mild-to-moderate ID regions, maternal insufficient iodine status may increase LGA risk. Iodine status and ICS intake may modify the effect maternal dysglycemia has on offspring weight.

Background: Current European guidelines support transcatheter aortic valve implantation (TA-VI) in intermediate to low-risk patients ≥75 years-old but its prognostic relevance is unknown. Methods: Intermediate-to-low-risk (Society of Thoracic Surgeon score <8%) patients enrolled in the HORSE registry were included. We compared the population with less versus more than 75 years old. The primary endpoint was all-cause mortality. Results: A total of 2685 patients were included, 280 (8.6%) <75 and 2405 ≥75 years. Through a mean follow-up of 437 ± 381 days, 198 (8.2%) and 23 (8.2%) patients died in the two arms, without statistically significant differences (log-rank p=0.925). At Cox regression analysis, age did not predict the occurrence of all-cause death, neither as a continuous variable (HR 1.01, 95% CI 0.99-1.04, p=0.294) nor dichotomizing according to the prespecified cutoff of 75 years (HR 0.97, 95% CI 0.63-1.51p=0.924). Time-to-event ROC curves showed low accuracy of age to predict all-cause mortality (area under the curve of 0.54 for both 1-year and 2-year outcomes). Conclusions: TAVI has comparable benefits across age strata in intermediate-to-low risk patients. The age cut-off suggested by current guidelines is not predictive of the risk of adverse events during hospital stay, neither of all-cause mortality through a mid-term follow-up.

(1) Background: Breast cancer is the second leading cause of cancer death among women. The accurate prediction of survival intervals will help physicians make informed decisions on treatment strategies or the use of palliative care for patients; (2) Methods: The gene expression is predictive and correlates to patient prognosis. To establish a reliable prediction tool, we collected the RNA-seq data of breast cancer patients, a total of 1187 RNA-seq data (median age 58 years), in FPKM format from the TCGA database. Among them, 144 RNA-seq data with date of death information was selected to establish the SaBrcada-AD dataset. We first normalized the SaBrcada-AD dataset to transcripts per million (TPM) to build survival prediction model SaBrcada. After normalization and dimension raising, the differential gene expression data were used for testing eight different deep learning architectures. Among them, GoogLeNet performed the best. Considering the effect of age on prognosis, we examined all ages between the lower and upper quartiles of patient age for a stratified random sampling test; (3) Results: Stratifying by age based on a cut-off of 61 years of age improved the accuracy of SaBrcada compared to previous findings, resulting in an accuracy of 0.798. We also built a free website tool to provide 5 kinds of predicted survival period information for clinician reference; (4) Conclusions: We established a breast cancer survival analysis prediction model, SaBrcada, and a website tool with the same name. Through this highly reliable survival analysis model and website tool, information on survival intervals will be provided for clinicians as part of precision medicine.

Assessing the development of skills that ensure personal mental toughness in adolescence is important because the increasing autonomy and socialization of adolescents during adolescence inevitably creates the conditions for the emergence of an increasing number of external stressors. Paradoxically, adolescents' confidence in their ability to cope with external stressors decreases during adolescence, which may lead to poorer sport performance in adolescent athletes. The aim of this study was to determine and analyze mental toughness skills in the cadet and junior age groups of young basketball players. An additional aim is to reveal how general (total) mental toughness and age predict each of the athletic mental toughness skills. The analysis of the results of the study revealed that players in the junior age group scored statistically significantly higher on the challenge, commitment, emotional control, life control, overall control, self-confidence in one's abilities, self-confidence in interpersonal interactions, overall self-confidence, total mental toughness, determination and visualization scales. Statistically significant correlations were found between mental toughness skills and the different age groups in all scales except positive cogni-tion and self-belief. Total mental toughness was a strong predictor of the athletic mental tough-ness skills, but age did not predict determination and self-beliefs skills.

Previous research on video game player aggression has focused on violent content, while recent studies have examined competitive factors. Few research has examined the solely impacts of competitive factors in video games without violent content on aggression, and it is still unknown what neurological processes of these effects. The present study is the first to examine the the electrophysiological characteristics of short-term competitive video game exposure and aggression. Thirty-five participants played a video game in either competitive or solo mode for 15 minutes, followed by an ERP experiment based on the Oddball paradigm and the hot sauce paradigm to measure aggressive behavior. Results showed that playing competitive game mode was associated with faster judgment to aggressive words, larger P300 amplitudes, and selection of more chili powder. The P300 amplitude partially mediated the relationship between competitive game exposure and aggressive behavior. These findings support the general aggression model.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.