The aim of this study was to investigate the effect of condensed tannin (CTs) with differing molecular weight on their capacity to modify the fatty acid profile in milk. Twenty multiparous crossbred lactating dairy goats were assigned in a randomized complete block design (RCBD), and were subjected to receive the dietary treatments as followings; T1: control (with no CTs supplementation), T2: supplemented with mangosteen peel in a concentrate as a source of low molecular weight CTs at level of 3.0 %DM of CTs equivalent, T3: supplemented with the same diet with T2 but added with polyethylene glycol (PEG, as tannin inactivator) as the control of T2, and T4: supplemented with quebracho CT extract (UNITAN ATO, Buenos Aires, Argentina; 75-77 % tannins) in a concentrate as a source of high molecular weight CTs at level of 3.0 %DM of CTs equivalent, and T5) supplemented with the same diet with T4 but added with PEG as the control of T4. No significant change was detected for feed intake and nutrient digestibility indicate that CTs at level of 3.0 %DM of diet did not showed the detrimental effect to feed intake and nutrient digestibility, however, ruminal fermentation parameters and milk yield and milk compositions did not affected by different source of CT inclusion.

With the rapid spread of carbon trading in the global economy, the interactions of prices between carbon (or clean/renewable energy) and traditional fossil energies such as coal and oil have raised growing attention, but little research have discussed their dynamic volatility spillover and time-varying correlation. The purpose of this study is to investigate these issues, for the weekly data of EUA futures, Biofuel and Brent oil prices from 25 October 2009 to 5 July 2020. We employ the VAR-GARCH model with the BEKK specification. Our results are summarized as follows. At first, we identified the sudden changes and the volatility persistence in the three markets, and also confirmed that the volatility of the markets has changed significantly over time. Secondly, we find that there are a weak volatility spillover effect among the three markets, while a strong spillover effect between the EUA and Brent oil markets. Lastly, in financial markets, the EUA can be used as a hedging portfolio for the Biofuel and Brent oil markets. These results can help investors to well compose their portfolios and manage their investment risks, and help potential pollutant emission sources to join in carbon market in a cost-effective way.

Dietary approach is essential to obesity control, but the effectiveness of changes in meal frequency (MF) as strategies for loss and maintenance of body mass remain unclear. This study aimed to evaluate the influence of MF on a hypocaloric diet on weight loss, active ghrelin levels and metabolic indicators of women with obesity. This is a randomized, parallel clinical trial, including forty women, randomized in two groups, both following a hypocaloric diet, according to MF (G1 – six meals/day; G2 – three meals/day). Dietary, laboratory, anthropometric and body composition indicators were assessed, as well as energy expenditure (EE), before and after the 90 days of intervention. After intervention, both groups decreased body weight, body mass index (BMI), waist circumference, fat mass (FM), insulin and HOMA-IR. G1 increased insulin sensitivity and G2 reduced triglyceride and FM and increased fat-free mass (FFM). MF increased ghrelin levels. There were no differences in EE variables. Hypocaloric diet with different MF promoted a reduction in total weight, BMI, WC and FM and an improvement in glycidic metabolism. However, the accomplishment of the three meals/day increased the FFM and active ghrelin and reduced triglyceride, while six meals/day was more beneficial in increasing insulin sensitivity.

We do fuzzification the concept of domination in crisp graph by using membership values of nodes, $\alpha$-strong arcs and arcs. In this paper, we introduce a new variation on the domination theme which we call vertex domination. We determine the vertex domination number $\gamma_v$ for several classes of fuzzy graphs, specially complete fuzzy graph and complete bipartite fuzzy graphs. The bounds is obtained for the vertex domination number of fuzzy graphs. Also the relationship between $M$-strong arcs and $\alpha$-strong is obtained. In fuzzy graphs, monotone decreasing property and monotone increasing property is introduced. We prove the vizing's conjecture is monotone decreasing fuzzy graph property for vertex domination. we prove also the Grarier-Khelladi's conjecture is monotone decreasing fuzzy graph property for it. We obtain Nordhaus-Gaddum (NG) type results for these parameters. The relationship between several classes of operations on fuzzy graphs with the vertex domination number of them is studied.

Fetal weight estimation before delivery is important in obstetrics, which assists doctors diagnose abnormal or diseased cases. Linear regression based on ultrasound measures such as bi-parietal diameter (bpd), head circumference (hc), abdominal circumference (ac), and fetal length (fl) is common statistical method for weight estimation but the regression model requires that time points of collecting such measures must not be too far from last ultrasound scans. Therefore this research proposes a method of early weight estimation based on expectation maximization (EM) algorithm so that ultrasound measures can be taken at any time points in gestational period. In other words, gestational sample can lack some or many fetus weights, which gives facilities to practitioners because practitioners need not concern fetus weights when taking ultrasound examinations. The proposed method is called dual regression expectation maximization (DREM) algorithm. Experimental results indicate that accuracy of DREM decreases insignificantly when completion of ultrasound sample decreases significantly. So it is proved that DREM withstands missing values in incomplete sample or sparse sample.

Although migraine belongs to the main causes of disability worldwide the mechanisms of its pathogenesis are poorly known, which is among the reasons that this disease is underdiagnosed and undertreated. As migraine diagnosis is based on the subjective assessment of symptoms, there is a need to establish objective markers of its occurrence and severity. Tryptophan (TRP) metabolism has been associated with the pathogenesis of neurological and psychiatric disorders. In the present work, we investigated an association between migraine and the urine concentration of TRP and its metabolites 5-hydroxyindoleacetic acid (5-HIAA), kynurenine (KYN), kynurenic acid (KYNA) and quinolinic acid (QA) in 21 low-frequency episodic migraine patients and 32 controls. Migraine patients displayed lower urinary levels of 5-HIAA and KYNA, but KYN and QA were enhanced as compared with the controls. Consequently, the patients were characterized by different values of the 5-HIAA/TRP, KYN/TRP, KYNA/KYN, and KYNA/QA ratios. Furthermore, urinary concentration of 5-HIAA was negatively correlated with Migraine Disability Assessment score, monthly migraine, and monthly headache days. A negative correlation between Patient Health Questionnaire 9 scores assessing depression. In conclusion, the urinary 5-HIAA level may be an easy-to-determine marker of migraine occurrence and severity and may contribute to the identification of migraine patients with depression.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

Exposure to extreme heat is a known risk factor that is associated with increased heat-related illness (HRI) outcomes. The relevance of heat wave definitions could change across the health conditions and geographies due to the heterogenous climate profile. This study compared the sensitivity of 28 heat wave definitions associated with HRI emergency department visits over five summer seasons (2011-2016), stratified by two physiographic regions (Coastal and Piedmont) in North Carolina. The HRI rate ratios associated with heat waves were estimated using the generalized linear regression framework assuming a negative binomial distribution. We compared the Akaike Information Criterion (AIC) values across the heat wave definitions to identify an optimal heat wave definition. In the Coastal region, heat wave definition based on daily maximum temperature with a threshold >90^th percentile for two or more consecutive days had the optimal model fit. In the Piedmont region, heat wave definition based on the daily minimum temperature with a threshold value >90^th percentile for two or more consecutive days was optimal. Additionally, we observed that the optimal heat wave definitions from this study captured moderate and frequent heat episodes than the national weather service (NWS) heat products that worked best for extreme heat episodes. This study compared the HRI morbidity risk associated with epidemiologic-based heat wave definitions and with NWS heat products. Our findings could be used for public health education and suggest recalibrating NWS heat products.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Innovations in drug delivery systems are crucial for enhancing therapeutic efficiency. Our research presents a novel approach based on Electro-fluid dynamic atomization (EFDA) to fabricate core-shell monophasic particles (CSMp) from sodium alginate blends of varying molecular weights. This study explores the morphological characteristics of these particles in relation to material properties and process conditions, highlighting their potential in drug delivery applications. A key aspect of our work is the development of a mathematical model that simulates the release kinetics of small molecules, specifically sodium diclofenac. By assessing the diffusion properties of different molecules and gel formulations through transport and rheological models, we have created a predictive tool for evaluating the efficiency of these particles in drug delivery. Our findings underscore two critical independent parameters for optimizing drug release: the external shell thickness and the diffusivity ratios within the dual layers. This allows for precise control over the timing and intensity of the release profile. The study advances our understanding of EFDA in the fabrication of CSMp and offers promising avenues for enhancing drug delivery systems by tailoring release profiles through particle characteristic manipulation.

The study examines the return performance and resilience to market volatility of the recently introduced Environment, Social/Sustainable, and Governance (ESG) weight-tilted Hang Seng Index (HSIESG) compared to its parent, the Hang Seng Index (HSI). The ESG-infused index has a higher mean return and lower return volatility than the parent index, although the differences are statistically and economically insignificant, a result consistent with the high correlation between the two index returns. Most important, the ESG weighted-tilted index is more resilient to volatility spikes than the parent index and therefore has lower downside risks. The overall results show that stocks with high ESG ratings are less susceptible to trading pressures triggered by volatility-induced turnovers. The paper contributes to the literature by providing significant incremental information on the emerging market for ESG-related equity products in Hong Kong.

Chicken collagen is a promising raw material source to produce gelatins and hydrolysates. Gelatins and hydrolysates can be prepared biotechnologically using proteolytic enzymes produced by submerged fermentation of genetically modified microorganisms. By choosing the appropriate process conditions, such changes can be achieved at the molecular level of collagen, making it possible to prepare products with targeted properties for advanced cosmetic, pharmaceutical, medical or food applications. The research aims to investigate: i) antioxidant activity (DPPH and ABTS) in model samples of chicken collagen products (gelatin and hydrolysates); ii) distribution of molecular weights by the GPC-RID analysis method; iii) functional groups and configuration of polypeptide chains related to molecular level properties using FTIR; iv) the microbiological properties on SDA, PCA, TSA and VRBL microbial populations using MALDI method. Antioxidant activity towards ABTS radicals of more than 80% was found for all samples. The molecular weights of all gelatin samples showed typical α- and β-chains. FTIR analysis confirmed that the samples showed all typical vibrational regions for collagen cleavage products, Amide A and B, Amide I, II, and III at characteristic values. Microbiological analysis of the prepared samples showed no undesirable bacteria that would limit advanced applications of the prepared products. Gelatins and hydrolysates from chicken stomachs represent a promising alternative to products made from standard collagen tissues of terrestrial animals.

Effects and interactions of incubation time and chick preplacement holding time on mortality at placement, utilization of yolk sac, crop filling rate, early feeding–drinking behavior and broiler live performance were investigated. Ross 308 broiler hatching eggs from a 39-week-old flock were set in two identical setters in a commercial hatchery,with setting time 12 hours earlier in one machine. At the end of incubation, chicks were removed from the hatchers at the same time. Thus, incubation times were either 504 h (normal incubation time (NIT) treatment) or 516 h (longer incubation time (LIT) treatment). After pull time, chicks from each incubation time group were subjected to either 6, 24, 48, 60 or 72 h preplacement holding times. At placement, chicks were given access to feed and water. In total, 19,200 chicks were randomly assigned to a total of 10 subtreatment groups (2 incubation times × 5 preplacement holding times). Therefore, a total of 1,920 chicks were used in each subtreatment group for the grow-out period in a commercial broiler house. An interaction was found between incubation time and preplacement holding time for residual yolk sac (RYS) weight (g, %) (p &lt; 0.001). RYS weight was greater at pull time and at 6 and 24 h of preplacement holding time in the NIT treatment compared to the LIT treatment, while differences were no longer evident at 48–72 h. The lowest percentage of chicks with full crops and eating activity was observed in the shortest preplacement holding time (6 h) group at 3 h after placement. As expected, the initial BW at placement clearly decreased with increasing duration after the pull time (p &lt; 0.05) with the highest and lowest weights were found in the 6 and 72 h holding time treatments respectively. This BW difference was still evident at 35 d after placement and chicks held for the longest period after the pull time (72 h) showed the lowest BW (p &lt; 0.001). However, there was no significant difference between the 6 and 60 h preplacement holding times. Mortality during the first 7 d after placement increased only when the preplacement holding time was extended to 72 h (p = 0.031). Similar to the 7 d results, chicks held for 72 h exhibited higher 0-35 day mortality compared to those held for 6 or 24 h (p = 0.028). Neither BW nor mortality was affected by incubation time treatment at 35 d after placement (p &gt; 0.05). It can be concluded that there were no significant differences in average BW and mortality, up to and including a 60-h holding time under thermal comfort conditions, but a 72-h preplacement holding time resulted in final BW and mortality being negatively affected. In addition, LIT tended to have a beneficial effect on BW and mortality compared to NIT when the preplacement holding time was shorter (6–24 h) but had a negative effect for extended holding times (48–72 h).

Wheat yield plays an important role in the global economy. Changing climate conditions and increased drought negatively affect grain yield. Currently, breeding programs are aimed at improving wheat productivity. To accelerate the selection process of hybrids and parental forms for crosses, it is essential to pay attention to plants' phenotypic and genetic potential. We studied the genes of the "green revolution" group Rht and coarse-grained TaGW and TaGS to increase yields by selecting optimal parameters for wheat. We focused on short-stemmed and coarse-grained characteristics in a dry climate and conducted a correlation analysis between the genetic potential of wheat varieties and hybrids and their phenotypic manifestation in drought conditions. Rht-D1b significantly reduced the height of plants by 51.67% and reduced the coleoptile length by 30.45%. At the same time, TaGW8-B1a increased the grain width by 13.37%. However, in the presence of Rht-D1b and Rht-B1b in the genome, the 1000-kernal weight was 35.06 g (p<0.05), the Rht-B1b gene enhanced it by 9% (p<0.05), while both Rht-D1a and Rht-B1a alleles gave a 1000-kernal weight of 37.96 g (p<0.05). The Rht-D1b and Rht-B1b alleles gave 18.5 seeds per ear, while the Rht-D1a and Rht-B1a alleles gave the value of grains per ear -24.1 pcs. The data obtained indicated the relationship of phenotypic and genetic parameters in wheat between the coarse-grained and short-stemmed genes, which makes it possible to select based on the genetic parameters of varieties and hybrids, thereby speeding up the selection process.

This work presents patient radiation dose data for pediatric interventional cardiology procedures in a large hospital in Colombia. The data collection period was from April 2020 to July 2022. The local DRLs were calculated as the 3rd quartile of patient dose data distributions for kerma area-product (Pka) values. The sample of collected clinical procedures (255) was divided into diagnostic and therapeutic procedures and grouped into five weight and five age bands. The Pka differences found between diagnostic and therapeutic procedures were statistically in all weight and age bands, except the group between 1-5 years. The local DRLs were 69 Gy/cm2 (< 5 kg), 3.44 Gy/cm2 (5-<15 kg), 8.87 Gy/cm2 (15-<30 kg), 10.51 Gy/cm2 (30-<50 kg) y 22.61 Gy/cm2 (50-<80 kg), respectively. In conclusion, from comparing our results with other existing DRL values, we are similar to other centers and scope to continue optimizing the radiation dose values. This will contribute to setting national diagnostic reference levels (DRLs) for Colombia in the near future.

In this paper, a Markov random field model is proposed to determine a site’s light pollution risk level. The specific data of 12 indicators of five typical cities in China is first collected to establish a hierarchical indicator system using an R-type clustering algorithm. Then, the entropy weight method is used to filter, determine 10-factor indicators, three potential impact indicators, and a light pollution risk index, and establish an undirected probability map model. A light pollution measurement based on Markov random field is obtained, and a location-based light pollution risk assessment index (LBLPRAI) is proposed. LBLPRAI of different types of sites is analyzed, and three possible intervention strategies are proposed to solve the light pollution problem: road lighting system planning, increasing vegetation coverage, and building system planning. Finally, the simulated annealing algorithm is used to determine the best intervention strategy, and it is concluded that the use of strategy 1 in the urban community 2 is the most effective measure, which can reduce the risk level of light pollution by 17.2%.

The present study was conducted the status of sea bass from Kokko and Kyuntone of The Gulf of Motttama Wetland (GoMW) area in Thanatpin Township in Bago Region Myanmar from September 2019 to August 2020. Fifty specimens were monthly collected, measured and weighed. Invoices of sea bass were collected for the depot and fish sellers by monthly. In Kokko, mean value of standard length and body weight were highest in March (32.70±1.58, 660.7±112.23). The mean value of standard length was peak in January (31.39±7.16) but peak of body weight was in March (963.24±280.86) in Kyuntone villages. The lowest mean value of standard length and body weight were found in June at both study areas. According to the invoice data revealed that monthly catch weight of sea bass is most abundance in October (829.92) kg in Kokko, (339.12) kg in Kyuntone. Based on price of relations to size group, small size C &lt; 300g (41%) was mostly abundance in Kokko and in Kyuntone small size C &lt; 300g (35%) was second abundance. Specimens were not landed in April and May. In June, young specimens were very rarely seen in both study sites. The important roles of wetland fishes, the economic valuation of GOMW in Myanmar and samples of fishing gear and value chain of sea bass in Myanmar was expressed in this study.

High temperature (HT) significantly affects the crop physiological traits and reduces the 12 productivity in plants. To increase yields as well as survival of crops under HT, developing heat13 tolerant plants is one of the main targets in crop breeding programs. The present study attempted 14 to investigate the linkage of the heat tolerance between the seedling and the reproductive growth 15 stages of tomato cultivars ’Dafnis‘ and ’Minichal’. This research was undertaken to evaluate heat 16 tolerance under two experimental designs such as screening at seedling stage and screening from 17 reproductive traits in greenhouses. Survival rate and physiological responses in seedlings of 18 tomatoes with 4-5 true leaf were estimated under HT (40 °C, RH 70%, day/night, respectively) and 19 under two control and HT greenhouse conditions (day time 28 °C and 40 °C, respectively). Heat 20 stress significantly affected physiological-chemical (photosynthesis, electrolyte conductivity, 21 proline) and vegetative parameters (plant height, shoot fresh weight, root fresh weight) in all 22 tomatoes seedlings. The finding revealed that regardless of tomato cultivars the photosynthesis, 23 chlorophyll, total proline and electrical conductivity parameters were varied in seedlings during the 24 heat stress period. The heat tolerance rate of tomatoes in the seedling stage might not be associated 25 always with reproductive parameters. HT reduced the fruit parameters likeas fruit weight (31.9%), 26 fruit length (14.1%), fruit diameter (19.1%) and fruit hardness (9.1%) in compared to NT under HT 27 in heat susceptible tomato cultivar ‘Dafnis’, while in heat tolerant cultivar ‘Minichal’ fruit length 28 (7.1%) and fruit diameter (12.1%) was decreased by the affect of HT but on the contrary fruit weight 29 (3.6%) and fruit hardness (8.3%) were increased. In conclusion, screening and selection for tomatoes 30 should be evaluated at the vegetative and reproductive stages with consideration of reproductive 31 parameters.

The synthesis of additives for thinning mineral suspensions based on sodium polyacrylate was carried out. The effect of molecular weight regulators on the molecular weight characteristics of the polymer and the effect of such polymers on the rheological properties of suspensions was studied. Sodium acrylate polymers are synthesized by free radical polymerization in aqueous solution using molecular weight regulators. The molecular weight characteristics of the polymeric samples were estimated by viscometry using Mark-Houwink-Kuhn-Sakurada (MHKS) equation. Synthesized polymers were used as thinners ceramic slurries, prepared according to the recipe of the enterprises producing ceramic products. The thinning ability of polymer samples with different molecular weights was estimated using an Engler viscometer from the time of the ceramic slurry flow. The influence of the type and amount molecular weight regulator on polyacryates was revealed. It was found that molecular weight synthesized samples was in the range of 21000 - 91000. It was determined that samples with a molecular weight of 28000 - 35000 synthesized using mercaptoethanol (at a dosage of 0.5-1.5% by weight of the monomer) provide optimal fluidity to the ceramic slurry.

.With the increasing use of carbon fiber reinforced plastics in various area, carbon fiber composites based on prepregs have attracted attention in industries and academia research. However, prepreg manufacturing processes are costly, and the strength of structures varies depending on the orientation and defects (pores and delamination). For non-contact evaluation of internal defects, we proposed lock-in infrared thermography to investigate orientation angles after a compression test. We also conducted a drop-weight impact test to study the behaviour of the composites after impact according the fibers orientation for composite fabricated using unidirectional carbon fiber prepregs. Using CAI tests, we determined the residual compressive strength and confirmed the damage modes using a thermal camera. The results of the drop weight impact tests show that the specimen laminated at 0° suffered the largest damage because of susceptibility of the resin to impact. In contrast, the specimens oriented in of 0°/90° and +45°/–45° directions transferred more than 90% of the impact energy back to the impactor because of the lamination of fibers in the orthogonal directions. Furthermore, the specimens that underwent complete damage in the impact tests were subjected to the lock-in method and showed internal delamination and cut fibers. With the finite elements analysis, the damage of each ply could be observed. Moreover, the temperature differences in the residual compression tests were not significant.

There is accumulating evidence that prenatal exposure to air pollution disturbs fetal growth and development, but little is known about these effects in cold climates or their season-specific or joint effects. Our objective was to assess independent and joint effects of prenatal exposure to specific air pollutants on the risk of low birth weight (LBW). We utilized the 2568 children of the Espoo Cohort Study, born between 1984 and 1990, and living in the City of Espoo. We conducted stratified analyses for births during warm and cold seasons separately. We analyzed the effect estimates using multi-pollutant Poisson regression models with risk ratio (RR) as the measure of effect. The risk of LBW was related to exposure to CO and (adjusted RR 1.44, 95% CI: 1.04-2.00) and exposure to O3 in the spring-summer season (1.82, 1.11-2.96). There was also evidence of synergistic effects between CO and O3 (relative risk due to interaction, RERI, all year 1.08, 95% CI: 0.27-4.94, spring-summer 3.97, 2.17-25.85) and PM2.5 and O3 (all year 0.72, -0.07-3.60, spring-summer 2.80, 1.36-19.88). We present new evidence of both independent and joint effects of prenatal exposure in a cold climate on the risk of LBW at low levels of air pollution.

By combing continuum topology optimization (TO) method and lattice structure technique, a sandwich aircraft spoiler with a high stiffness-to-weight is designed. TO method is served to produce the shell of the aircraft spoiler and the lattice structure, used as cores, is employed to support the shell. TO problem is established as maximizing the stiffness of the structure with limited material volume. Density-based method is utilized to achieve a 0/1 solution. We then empirically replace the core of the aircraft spoiler by using 3D kagome lattice structure. Two different materials, i.e., aluminum alloy and titanium alloy, are synthetically applied to further reduce the weight and simultaneously improve the strength of the aircraft spoiler. Numerical simulations are conducted to show that the designed aircraft spoiler can meet the service environment with a reduction of its weight by approximately 80% when compared with that of the initial design model. Finally, we have fabricated the designed model with photosensitive resin by using 3D printing technique.

The domestication and subsequent genetic improvement of wheat led to the development of large-seeded cultivated wheat species relative to their smaller-seeded wild progenitors. While increased grain weight (GW) continues to be an important goal of many wheat breeding programs, few genes underlying this trait have been identified despite an abundance of studies reporting quantitative trait loci (QTLs) for GW. Here we perform a QTL analysis for GW using a population of recombinant inbred lines (RILs) derived from the cross between wild emmer wheat accession ‘Zavitan’ and durum wheat variety ‘Svevo’. Identified QTLs in this population were anchored to the recent Zavitan reference genome, along with previously published QTLs for GW in tetraploid wheat. This genome-based, meta-QTL analysis enabled the identification of a locus on chromosome 6A whose introgression from wild wheat positively affects GW. The locus was validated using an introgression line carrying the 6A GW QTL region from Zavitan in a Svevo background, resulting in >8% increase in GW compared to Svevo. Using the reference sequence for the 6A QTL region, we identified a wheat ortholog to OsGRF4, a rice gene previously associated with GW. The coding sequence of this gene (TtGRF4-A) contains four SNPs between Zavitan and Svevo, one of which reveals the Zavitan allele to be rare in a core collection of wild emmer and completely absent from the domesticated emmer genepool. Similarly, another wild emmer accession (G18-16) was found to carry a rare allele of TtGRF4-A that also positively affects GW and is characterized by a unique SNP absent from the entire core collection. These results exemplify the rich genetic diversity of wild wheat, posit TtGRF4-A as a candidate gene underlying the 6A GW QTL, and suggest that the natural Zavitan and G18-16 alleles of TtGRF4-A have potential to increase wheat yields in breeding programs.

In this paper we show that the Schwarzschild radius can be extracted easily from any gravitationally-linked phenomena without having knowledge of the Newton gravitational constant or the mass size of the gravitational object. Further, the Schwarzschild radius can be used to predict any gravity phenomena accurately, again without knowledge of the Newton gravitational constant and also without knowledge of the size of the mass, although this may seem surprising at first. Hidden within the Schwarzschild radius are the mass of the gravitational object, the Planck mass (their relative mass), and the Planck length. We do not claim to have all the answers, but this seems to indicate that gravity is quantized, even at a cosmological scale, and this quantization is directly linked to the Planck units. This also supports our view that the Newton gravitational constant is a universal composite constant of the form $G=\frac{l_p^2{c}^3}{\hslash }$ , rather than relying on the Planck units as a function of G. This does not mean that Newton’s gravitational constant is not a universal constant, but that it is instead a composite universal constant that depends on the Planck length, the speed of light, and the Planck constant. Further, $\frac{G\times 1\hspace{0.17em}\mathrm{weight}\hspace{0.17em}\mathrm{unit}}{c^2}=\frac{G}{c^2}$ is the Schwarzschild radius off one weight unit. So G is only needed when we want to use gravity to find the weight of an object, such as weighing the Earth. This is, to our knowledge, the first paper that shows how a long series of major gravity predictions and measurements can be completed without any knowledge of the mass size of the object, or Newton’s gravitational constant. As a minimum we think it provides an interesting new angle for evaluating existing gravity theories, and it may even give us a small hint on how to combine quantum gravity with Newton and Einstein gravity.

The present study examined and compared the effects of high- and low-molecular weight (MW) chitosan, a nutraceutical, on intestinal and liver lipid metabolism in rats fed with high-fat diet. Both high- and low-MW chitosan decreased liver weight, elongated small intestine, improved the dysregulation of blood lipids and liver fat accumulation, and increased fecal lipid excretion in high-fat diet-fed rats. Supplementation of both high- and low-MW chitosan significantly inhibited the decreased phosphorylated AMP-activated protein kinase (AMPK)α and peroxisome proliferator-activated receptor (PPAR)α protein expressions and the increased lipogenesis/cholesterogenesis-associated protein expressions (sterol regulatory element binding protein (SREBP)1c, SREBP2, and PPARγ) and the decreased apolipoprotein (Apo)E and microsomal triglyceride transfer protein (MTTP) protein expressions in the livers of high-fat diet-fed rats. Both high and low-MW chitosan supplementation could also suppress the increased MTTP protein expression and the decreased angiopoietin-like protein (Angptl)4 protein expression in the intestines of high-fat diet-fed rats. Comparison between high and low-MW chitosan, high-MW chitosan has a higher efficiency than low-MW chitosan on the inhibition of intestinal lipid absorption and the increase of hepatic fatty acid oxidation, which can improve liver lipid biosynthesis and accumulation.

The use of pain relief during castration and dehorning of calves on commercial beef operations can be limited by constraints associated with the delivery of analgesic agents. As topical anaesthetic (TA) and buccal meloxicam (MEL) are now available in Australia, offering practical analgesic treatments for concurrent castration and dehorning of beef calves, a study was conducted to determine their efficacy in providing pain relief when applied alone or in combination. Weaner calves were randomly allocated to; (1) no castration and dehorning / positive control (CONP); (2) castration and dehorning / negative control (CONN); (3) castration and dehorning with buccal meloxicam (BM); (4) castration and dehorning with topical anaesthetic (TA); and (5) castration and dehorning with buccal meloxicam and topical anaesthetic (BMTA). Weight gain, paddock utilisation, lying activity and behaviour following treatment were measured. CONP and BMTA calves had significantly greater weight gain than CONN calves (P < 0.001). CONN calves spent less time lying compared to BMTA calves on all days (P < 0.001). All dehorned and castrated calves spent more time walking (P = 0.024) and less time eating (P < 0.001) compared to CONP calves. There was a trend for CONP calves to spend the most time standing and CONN calves to spend the least time standing (P = 0.059). There were also trends for the frequency of head turns to be lowest in CONP and BMTA calves (P = 0.098) and tail flicks to be highest in CONN and BM calves (P = 0.061). The findings of this study suggest that TA and MEL can improve welfare and production of calves following surgical castration and amputation dehorning.

Agavins consumption has lead to accelerate body weight loss in mice. We investigated the changes on cecal microbiota and short chain fatty acids (SCFA) associated to body weight loss in overweight mice. Firstly, mice were fed with standard (ST5) or high fat (HF5) diet for 5 weeks. Secondly, overweight mice were shifted to standard diet alone (HF-ST10) or supplemented with agavins (HF-ST+A10) or oligofructose (HF-ST+O10), five more weeks. Cecal contents were collected before and after supplementation to determine microbiota and SCFA concentrations. At the end of first phase, HF5 mice showed a significant increase of body weight, which was associated with reduction of cecal microbiota diversity (PD whole tree; non-parametric t-test, P < 0.05), increased Firmicutes/Bacteroidetes ratio and reduced SCFA concentrations (t-test, P < 0.05). After diet shifted, HF-ST10 normalized its microbiota, increase its diversity and SCFA levels, whereas agavins (HF-ST+A10) or oligofructose (HF-ST+O10) led to partial microbiota restoration, with normalization of the Firmicutes/Bacteroides ratio as well as higher SCFA levels (P < 0.1). Moreover, agavins noticeably enriched Klebsiella and Citrobacter (LDA > 3.0); this enrichment has not been reported previously under a prebiotic treatment. In conclusion, agavins or oligofructose modulated cecal microbiota composition, reduced extent of diversity and increased SCFA. Furthermore, identification of bacteria enriched by agavins, opens opportunities to explore new probiotics.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Some glucagon-like peptide-1 receptor agonists (GLP-1 RAs), first used in the treat-ment of type 2 diabetes mellitus (T2DM), have been approved for the treatment of obe-sity in patients with or without T2DM (liraglutide – LIR, semaglutide - SEM, and tir-zepatide - TIR). Social media had an important influence on the off-label use of GLP-1 RAs for obesity, especially for SEM. We analysed the Google queries related to SEM to assess people's interest in this drug. We also investigated the occurrence of adverse drug reactions (ADRs) by searching the EudraVigilance database (EV) for Individual Case Safety Reports (ICSRs) that reported SEM as the suspected drug and performed a descriptive and a disproportionality analysis. Data obtained for SEM were compared to other GLP-1 RAs. SEM had the highest proportions of searches on Google associated with the term “weight loss” and presented the lowest number of severe ADRs, but it also had the highest number of ICSRs reported in EV. Even though no unexpected safety issues have been reported for it until now, SEM has a high tendency for overdose reports. The most frequent off-label use was reported for SEM and TIR. In order to lower the ADRs’ risks, the off-label use should be reduced and carefully monitored.

Bigeye grunt Brachydeuterus auritus is an important economic species in the waters off Sierra Leone in West Africa, with great ecological value. Based on the survey data of bottom trawl nets from 6 voyages from 2019 to 2021, the body weight-length relationship (WLR), as well as their relative fatness, were studied in depth using the method of body length and its corresponding mean body weight. This study fitted the WLR of bigeye grunt by gender, calculated its fullness, and analyzed the influence of environmental factors. The results showed that month and gender had a significant impact on body length and weight distribution (P&lt;0.01). There was a highly significant negative correlation (P&lt;0.01) between the condition factor (a) and the allometric factor (b) in the WLR, and salinity significantly affects b (P&lt;0.05). The (lga)/b ratio was less affected by environmental factors which may be related to the body size and density of the fish. The difference in b between male and female populations was extremely significant (P&lt;0.01). The relative fatness had significant seasonal variation characteristics, with highly significant effects of sex and body length (P&lt;0.01). With increasing body length, the relative fatness showed two types of changes, continuously increasing and first increasing then decreasing, with salinity and b significantly affecting the type of change (P&lt;0.05) and depth having a highly significant effect (P&lt;0.01). The bigeye grunt off the coast Sierra Leone exhibited significant seasonal growth characteristics, with significant differences in growth characteristics between male and female individuals. This study suggested that salinity may be the main factor affecting its growth and development. In addition, this study hypothesised that the peak breeding season may occur during the dry season, beginning in December and ending before April of the following year. The study provides updated and more comprehensive insights into the biology and ecology of the bigeye grunt offshore Sierra Leone, West Africa, which can provide scientific basis for its resource assessment, development and utilization, and resource management.

Healthcare visits were reduced during COVID-19 pandemic causing the disturbance of the sustainability in NAFLD monitoring. Telemedicine acts to maintain connectivity between patients and healthcare professionals. This review aimed to assess telemedicine helps to monitoring in NAFLD. The database was searched from The PubMedCentral and ScienceDirect from 2020 to 2023. We assessed the Cochrane Risk of Bias (RoB) for randomized controlled trial (RCT) and the Newcastle-Ottawa scale for non-RCTs systematic reviews. Meta-analyses with random-effects model to determine the pooled mean difference (MD) and p-value. There were three RCT and two non-RCT were included (n=239) with 56.9% males and the mean age was 51.3 years. Median intervention lasted 5.5 months. The parameter were body weight (BW), body mass index (BMI), waist circumference, liver function (AST/ALT), lipid profile and HbA1c. Metaanalysis showed telemedicine had a significant effect on improving outcomes for BW (MD -2.81: 95% CI, -4.11, -1.51, P 0.0001) and BMI (MD -1.01: 95% CI, -1.47, -0.55, P 0.0001) compared to standard care, while the AST/ALT were not significantly reduced. Other laboratory parameter were decreased from systematic reviews. Telemedicine through mobile-based applications could be an option for monitoring body weight and BMI in NAFLD patients facing the pandemic.

This study investigated how broader parental factors including parental happiness, parental play engagement, and parenting stress are related to Korean children’s happiness and weight status across three years via indirect pathways through the children’s energy-related behaviors of healthy and unhealthy food intake, physical activity, and screen time. Data from 1551 Korean parent pairs and 7-yaer-old children in the Panel Study on Korean Children were analyzed. Path analysis and gender-based structural equation modeling were conducted. Maternal happiness was negatively related to child screen time. Maternal play engagement showed positive concurrent associations with child healthy food intake and physical activity and negative associations with screen time. Maternal parenting stress was negatively related to child healthy eating. There was one significant finding related to fathers’ role on children’s energy-related behaviors, happiness, and weight status: the positive association between parental happiness and boys’ unhealthy food intake. Child screen time was positively related to child weight status and negatively to child happiness at each age. Broader maternal parenting factors can serve as a protective factor for childhood happiness and weight status in 7-to 9-year-olds through being associated with a reduction in child screen time.

Fat has a high energy density and excessive fatness has been recognized as a problem for egg production and the welfare of chickens. The identification of a genetic polymorphism controlling fat deposition would be helpful to select against excessive fatness in the laying hen. This study aimed to estimate genomic heritability and identify the genetic architecture of abdominal fat deposition in a population of chickens from a Dongxiang blue-shelled local breed crossbred with the White Leghorn. A genome-wide association study wase conducted on abdominal fat percentage, egg production and body weights using a sample of 1534 hens genotyped with a 600K Chicken Genotyping Array. The analysis yielded a heritability estimate of 0.19 ± 0.04 for abdominal fat percentage, 0.56 ± 0.04 for body weight at 72 weeks, 0.11 ± 0.03 for egg production and 0.24 ± 0.04 for body weight gain. The genetic correlation of abdominal fat percentage with egg production between 60 and 72 weeks of age was 0.35 ± 0.18. This implies a potential trade-off between these two traits related to allocation of resource. Strong positive genetic correlations were found between fat deposition and weight traits. A promising locus close to COL12A1 on chromosome 3, associated with abdominal fat percent, was found in the present study. The other region located around HTR2A on chromosome 1, where allele substitution was predicted to be associated with body weight gain, accounted for 2.9% of phenotypic variance. Another region located on chromosome 1, but close to SOX5, was associated with egg production. These results may be used to influence the balanced genetic selection for laying hens.

Natural deep eutectic solvents (NADES) have been shown as selective and environmentally friendly solvents for the extraction of bioactive compounds. However, studies on the solubility of low molecular weight carbohydrates (LMWC) in NADES are scarce. In this work, new solubility data of LMWC in NADES are provided and a new approach based on the use of these solvents for the efficient fractionation of bioactive carbohydrates was explored for the first time. Several mono- and disaccharides and three NADES based on choline chloride (ChCl) and different donors [2-ethylene glycol (EtG), glycerol (Gly) and ethanedioic acid dihydrate (Eth)] were considered. While degradation of carbohydrates, mainly ketoses, was detected with ChCl:Eth due to its acidic nature, ChCl:EtG and ChCl:Gly were found to be useful alternatives for selectively separating bioactive ketoses and their corresponding aldoses (e.g. lactulose/lactose and tagatose/galactose) present in equimolar binary mixtures. In addition, the usefulness of ChCl:EtG for the selective enrichment of lactulose to be used as food ingredient or nutraceutical was proven (from a 25% in the reaction mixture to a 56% in the purified sample). NADES could be used for the selective fractionation of value-added carbohydrates from interfering sugars for several applications including food science, engineering or pharmaceuticals.

Dissolved organic matter (DOM) derived from organic fertilizers may increase soil phosphorus (P) availability. However, the frequently observed correlation between soil P availability and dissolved organic carbon (DOC) content has led to an excessive focus on DOC content at the expense of DOM properties. The present study investigated the influence of DOM characteristics on soil P availability by using a 6-year field experiment and microcosms of P sorption in paddy soil. Our results showed that partial replacement of chemical P fertilizer with manure or crop straw increased P fertilizer-use efficiency, even when decreasing chemical P input by 34 %, compared to normal chemical fertilization. The microcosm experiment demonstrated that DOM properties, rather than total DOC content, determine soil P sorption capacity, despite the significant correlation between DOC content and P availability observed in the field experiment. Manure-DOM exerted stronger inhibitory effects on P sorption than straw-DOM, and high molecular weight (HMW)-fractionated DOM exerted stronger inhibitory effects on P sorption than low-molecular-weight-fractionated DOM by 16-20%. The mechanism was rooted in the HMW DOM with unique characteristics (e.g., strong aromaticity, hydrophobicity, abundant humic-like components, carboxyl groups, and benzene ring structures) competing for soil P sorption sites (e.g., reduction in specific surface area and micropore volume), decreasing the soil surface charge (e.g., zeta potential), and thereby suppressing P sorption in paddy soil. Our study points out a promising avenue for regulating organic matter properties with organic fertilization to improve P use efficiency in agricultural soils.

This paper introduces the spatial component in cross-section econometric estimations and specifically, the spatial dependence effect inherent in some of the variables involved in the modelling process. First, the spatial structure of the data from thematic maps is observed and Moran's spatial autocorrelation indicators are presented. Subsequently, the spatial weights matrix is built under different specifications. Finally, several modelling specification strategies are shown and the interpretation of the estimated coefficients. The theoretical concepts are illustrated with examples and their corresponding R software codes. This code and databases are available in a freely accessible repository in the BE2SHARE-EUDAT platform so that they can be easily reproduced.

Traditional end-effector robots for arm rehabilitation are usually attached a­t the hand, primarily focusing on coordinated multi-joint training. Therapy at an individual joint level of the arm for severely impaired stroke survivors is not always possible with existing end-effector robots. The Arm Rehabilitation Robot (AREBO)—an end-effector robot—was designed to provide both single and multi-joint assisted training while retaining the advantages of traditional end-effector robots, such as ease of use and cost-effectiveness (compared to exoskeletons). This work presents the design, optimization, and characterization of AREBO for training single-joint movements of the arm. The AREBO has three actuated and three unactuated degrees of freedom, allowing it to apply forces in any arbitrary direction at its endpoint and self-align to arbitrary orientations within its workspace. The AREBO’s link lengths were optimized to maximize its workspace and manipulability. The AREBO provides single-joint training in both unassisted and adaptive weight support modes using a human arm model to estimate the human arm's kinematics and dynamics without using additional sensors. The characterization of the robot’s controller and the algorithm for estimating the human arm parameters were performed using a two degrees of freedom mechatronic model of the human shoulder joint. The results demonstrate that: (a) the movements of the human arm can be estimated using a model of the human arm and robot’s kinematics, (b) the AREBO has similar transparency to that of existing arm therapy robots in the literature, and (c) the adaptive weight support mode control can adapt to different levels of impairment in the arm. This work demonstrates how an appropriately designed end-effector robot can be used for single-joint training, which can be easily extended to multi-joint training. Future work will focus on the evaluation of the system on patients with any neurological condition requiring arm training.

Deep neural network (DNN) watermarking is a potential approach for protecting the intellectual property rights of DNN models. Similar to classical watermarking techniques for multimedia content, the requirements for DNN watermarking include capacity, robustness, and transparency, and other factors. Studies have focused on robustness against retraining and fine-tuning. However, less important neurons in the DNN model may be pruned. Moreover, although the encoding approach in renders DNN watermarking robust against pruning attacks, the watermark is assumed to be embedded only into the fully connected layer in the fine-tuning model. In this study, we extended the method such that the model can be applied to any convolution layer of the DNN model and designed a watermark detector based on a statistical analysis of the extracted weight parameters to evaluate whether the model is watermarked. Using a nonfungible token mitigates the overwriting of the watermark and enables checking when the DNN model with the watermark was created.

The aim of this study was to evaluate the intensity of the annual sexual behavior (SB) of Boer bucks under tropical conditions in southern Mexico. For one year, 16 extensively grazing males were evaluated for SB individually with estrogenized goats. From the beginning of the experiment and every 30 days, body weight (BW), body condition (BC), testicular circumference (TC), odor intensity (OI) and SB (nudging, ano-genital sniffing, flehmen, mounting attempts, mounts with intromission, and self-urination) were recorded. The bucks showed a more intense SB during the months of November to May than during the months of June to October (p < 0.05). Greater frequency was found for nudging, ano-genital sniffing, mounting attempts, and self-urination in the months of November to May (p < 0.001). BW was lower during the months of January to August than in the months of September to December (p < 0.05). On the other hand, TC increased from October to December (p < 0.05). Similarly, the OI in males varied over time (time effect; p < 0.001). In fact, an increased odor was found from October to December. The conclusions were that breed male goats from the tropics of Guerrero have a more intense SB during the months of November to May, which corresponds to the time of the year when forage availability is the greatest.

Keywords: Obesity; hypothalamus; appetite; glucose homeostasis; weight-loss drugs; AGRP; POMC; NTS; incretins.

Build a special identical equation, use its calculation characters to prove and search for solution of any odd converging to 1 equation through (*3+1)/2^k operation, change the operation to (*3+2^m-1)/2^k, and get a solution for this equation, give a specific example to verify. Thus prove the Collatz Conjecture is true. Furthermore, analysis the sequences produced by iteration calculation during the procedure of searching for solution, build a weight function model, prove it decrease progressively to 0, build a complement weight function model, prove it increase to its convergence state. Build a (*3+2^m-1)/2^k odd tree, prove if odd in (*3+2^m-1)/2^k long huge odd sequence can not converge, the sequence must outstep the boundary of the tree after infinite steps of (*3+2^m-1)/2^k operation.

In Japan, the prevalence of low birth weight (LBW) has been estimated to be approximately 10%, which is the highest among developed countries. This high prevalence might affect the prevalence of LBW-associated diseases in the adult population of Japan. Recently, LBW has been recognized as a contributing factor to post-adaptive focal segmental glomerulosclerosis (FSGS) in adulthood; however, few reports to date have evaluated the clinical and pathological characteristics of post-adaptive FSGS. A 13-year-old girl was referred to our hospital owing to mild proteinuria, which was detected at a school urinary screening. She was born at a gestational age of 23 weeks, with a very LBW of 630 g. Dipstick urinalysis revealed grade (2+) proteinuria. Her serum creatinine level was 1.02 mg/dL, and she was diagnosed as having stage 2 chronic kidney disease (CKD). Her serum uric acid level was 7 mg/dL. Her mother and 16-years old brother had hyperuricemia, too. A percutaneous renal biopsy leads to a diagnosis of FSGS. After 3 years of treatment with an angiotensin receptor blocker, her proteinuria decreased. However, her serum creatinine level was 1.07 mg/dL, and she still had stage 2 CKD. We considered that in this patient, the first hit was her LBW, and the second hit was hyperuricemia. The second hit might be associated with the development of CKD. The birth history of patients is not usually confirmed by nephrologists. Our case demonstrates that obtaining information regarding the preterm birth and LBW of patients is important in the diagnosis of noncommunicable diseases, because school urinary screening is not routinely performed in countries other than Japan.

The COVID-19 pandemic starting in the first half of 2020 has changed the lives of everyone across the world. Reduced mobility was essential due to it being the largest impact possible against the spread of the little understood SARS-CoV-2 virus. To understand the spread, a comprehension of human mobility patterns is needed. The use of mobility data in modelling is thus essential to capture the intrinsic spread through the population. It is necessary to determine to what extent mobility data convey the same message of mobility within a region. This paper compares different mobility data sources by constructing spatial weight matrices and further compares the results through hierarchical clustering. This provides insight for the user into which data provides what type of information and in what situations a particular source is most useful.

One of the major challenges in the post-genomic era is elucidating the genetic basis of human diseases. In recent years, studies have shown that polygenic risk scores (PRS), based on aggregated information from millions of variants across the human genome, can estimate individual risk for common diseases. In practice, the current medical practice still predominantly relies on physiological and clinical indicators to assess personal disease risk. For example, caregivers mark individuals with high body mass index (BMI) as having an increased risk to develop type 2 diabetes (T2D). An important question is whether combining PRS with clinical metrics can increase the power of disease prediction in particular from early life. In this work we examined this question, focusing on T2D. We show that an integrated approach combining adult BMI and PRS achieves considerably better prediction than each of the measures on unrelated Caucasians in the UK Biobank (UKB, n=290,584). Likewise, integrating PRS with self-reports on birth weight (n=172,239) and comparative body size at age ten (n=287,203) also substantially enhance prediction as compared to each of its components. While the integration of PRS with BMI achieved better results as compared to the other measurements, the latter are early-life measurements that can be integrated already at childhood, to allow preemptive intervention for those at high risk to develop T2D. Our integrated approach can be easily generalized to other diseases, with the relevant early-life measurements.

Although it is known that the gut microbiota (GM) can be modulated by diet, the efficacy of specific dietary interventions in determining its composition and diversity in obese patients remains to be ascertained. The present work aims to evaluate the impact of a moderately hypocaloric Mediterranean diet on the GM of obese and overweight patients (OB). The GM of 23 OB patients (F/M= 20/3) was compared before (T0) and after 3 months (T3) of the nutritional intervention (NI). Fecal samples were analyzed by Illumina MiSeq sequencing of the 16S rRNA gene. At baseline, the GM characterization confirmed the typical obesity-associated dysbiosis. After 3 months of NI, patients presented a statistically significant reduction of the body weight and fat mass, along with changes in the relative abundance of many microbial patterns. In fact, we observed an increased abundance in several Bacteroidetes taxa (i.e. Sphingobacteriaceae, Sphingobacterium, Bacteroides spp., Prevotella stercorea) and depletion of many Firmicutes taxa (i.e. Lachnospiraceae members, Ruminococcaceae and Ruminococcus, Veillonellaceae, Catenibacterium, Megamonas). In addition, the phylum Proteobacteria showed an increased abundance, while the genus Sutterella, within the same phylum, decreased after the intervention. Metabolic pathways, predicted by bioinformatic analyses, showed a decrease in membrane transport and cell motility after NI. The present study extends our knowledge of the GM profiles in OB, highlighting the potential benefit of a moderate caloric restriction in counteracting the gut dysbiosis.

Different cohort studies documented a lower glomerular filtration rate (GFR) in former extremely low birth weight (ELBW, <1000 g) neonates throughout childhood when compared to term controls. The current aim is to pool these studies to describe the GFR pattern over the pediatric age range. To do so, we conducted a systematic review on studies reporting on GFR measurements in former ELBW cases while GFR data of healthy age-matched controls included in these studies were co-collected. Based on 248 hits, 6 case-control and 3 cohort studies were identified, with 444 GFR measurements in 380 former ELBW cases (median age 5.3-20.7 years). The majority were small (17-78 cases) single center studies, with heterogeneity in GFR measurement (inulin, Cystatin C or creatinine estimated GFR formulae) tools. Despite this, the median GFR (ml/kg/1.73m²) within case-control studies was consistently lower (-13, range -8 to -25%) in cases, so that a relevant minority (15-30%) has a eGFR<90 mgl/kg/1.73m²). Consequently, this pooled analysis describes a consistent pattern of reduced eGFR in former ELBW cases throughout childhood. Research should focus on perinatal risk factors for impaired GFR and long-term outcome, but is hampered by single center cohorts, study size, and heterogeneity of GFR assessment tools.

Failure of various weight-loss programs and long-term maintenance of favorable body composition in all kinds of people is high, since the majority go back to old dietary patterns. Many studies have documented the efficacy of a plant-based diet (PBD) for body mass management, but there are opinions that maintaining a PBD is difficult. We aimed to evaluate the long-term success of a whole-food plant-based (WFPB) lifestyle program. We investigated the differences in the obesity indices and lifestyle of 151 adults (39.6 ± SD 12.5 years), who were on our program for short (0.5–<2 years), medium (2–<5 years), or long term (5–10 years). Body-composition changes were favourable for all three groups, both genders and all participants. There were no differences in relative body-composition changes (BMI, body fat percentage and muscle mass index (MMI)) between the three groups. All participants improved their BMI (baseline mean pre-obesity BMI range (kg/m²): 26.4 ± 5.6 to normal 23.9 ± 3.8, p < 0.001), decreased body mass (–7.1 ± 8.3 kg, p < 0.001) and body fat percentage (–6.4 ± 5.6 % points, p < 0.001). Those with the highest BMI at baseline lost the most of: a) BMI units, b) total body mass and c) body fat (a) (kg/m²) (–5.6 ± SD 2.9, –2.4 ± 1.8 and –0.9 ± 1.5), b) (kg) (–16.1 ± SD 8.8, –7.1 ± 5.4 and –2.5 ± 4.5) and c) (% points) (–9.5 ± SD 5.7, –6.6 ± 4.6 and –4.7 ± 5.3) for participants who had baseline BMI in obese, overweight and normal range, respectively; p_{baseline vs. current} < 0.001 for all). 85.6% (101 out of 118) of parents of underage children (< 18 years), introduced WFPB lifestyle to their children. WFPB lifestyle program provides long-term lifestyle changes for reversal of obesity and is effective transferred to the next generation.

This study aimed to evaluate the impact of selected pregnancy pathologies statistically depending on overweight/obesity and excessive maternal weight gain during pregnancy on women who gave birth in the years 2013–2015 at the Second Department of Gynecology and Obstetrics at the University Hospital in Bratislava, Slovakia. In a retrospective study, we analyzed data gathered from the sample, which consisted of 7,122 women. Our results indicate a positive statistical dependency of the groups of women with overweight and obesity and gestational hypertension (adjusted odds ratio [AOR]=15.3; 95% CI 9.0−25.8 for obesity), preeclampsia (AOR=3.4; 95% CI 1.9−6.0 for overweight and AOR=13.2; 95% CI 7.7−22.5 for obesity), and gestational diabetes mellitus (AOR=1.9; 95% CI 1.2−2.9 for overweight and AOR=2.4; 95% CI 1.4−4.0 for obesity). A higher incidence of pregnancies terminated by cesarean section was observed in the group of obese women. Gestational weight gain above the IOM (the Institute of Medicine) recommendations was associated with a higher risk of pregnancy terminated by C-section (AOR=1.2; 95% CI 1.0−1.3), gestational hypertension (AOR=1.7; 95% CI 1.0−2.7), and infant macrosomia (AOR=1.7; 95% CI 1.3−2.1). Overweight and obesity during pregnancy significantly contribute to the development of pregnancy pathologies and increased incidence of cesarean section. Systematic efforts to reduce weight before pregnancy through pre-pregnancy dietary counseling, regular physical activity, and healthy lifestyle should be the primary goal.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.