As of not long ago, understanding the administrative conduct of cells has been sought after through autonomous investigation of the transcriptome or the proteome. In view of the focal creed, it was commonly accepted that there exist an immediate correspondence between mRNA records and produced protein articulations. In any case, late examinations have demonstrated that the relationship among's mRNA and Protein articulations can be low because of different factors, for example, unique half lives and post record apparatus. In this manner, a joint investigation of the transcriptomic and proteomic information can give valuable experiences that may not be translated from singular examination of mRNA or protein articulations. This article audits the current significant methodologies for joint investigation of transcriptomic and proteomic information. We order the various methodologies into eight primary classes dependent on the underlying calculation and last investigation objective. We further present analogies with different spaces and talk about the current exploration issues around there.

Heterosis or hybrid vigour is a phenomenon in which hybrid progeny exhibit superior yield and biomass to parental lines and has been used to breed F₁ hybrid cultivars in many crops. A similar level of heterosis in all F₁ individuals is expected as they are genetically identical. However, we found variation of rosette size in individual F₁ plants from a cross between C24 and Columbia-0 accessions of Arabidopsis thaliana. Big sized F₁ plants had 26.1% larger leaf area in the 1^st and 2^nd leaves than medium sized F₁ plants at 14 days after sowing in spite of the identical genetic background. We identified differentially expressed genes between big and medium sized F₁ plants by microarray; genes involved in the category of stress response were overrepresented. We made transgenic plants overexpressing 21 genes, which were differentially expressed between the two size classes, some lines had increased plant size at 14 or 21 days after sowing but not at all time points. Change of expression levels in stress responsive genes among individual F₁ plants, implying epigenetic changes, could generate the variation in plant size of individual F₁ plants in A. thaliana.

Mint is considered to have a greater number of phenolic acids, flavonoids, antioxidants and other bioactive components, and is widely used as food, medicine, spices, and flavoring agents. Thus, chemical composition is an important parameter for assessing the quality of mint. In this study, two mint cultivars were sampled, purple mint and green mint. The purple mint had much higher anthocyanin and total flavone content compared with green mint. Transcriptome and metabolome technique were employed to elucidate the regulation network of mint pigment and flavone. A total of 167,901 unigenes were obtained by high-throughput RNA-Seq and 34,608 genes were differentially expressed. The differentially expressed genes (DEGs) were mainly involved in lignin metabolic process and flavonoid biosynthetic process. A total of 143 differentially expressed metabolites (DEMs) were enriched in isoflavonoid biosynthesis, flavonoid biosynthesis, flavone and flavonol biosynthesis, and anthocyanin biosynthesis pathways. The co-analysis results of DEGs and DEMs showed that the flavone and flavonol biosynthesis pathway (ko00944) contained the most DEMs, followed by flavonoid biosynthesis pathway (ko00941) and anthocyanin biosynthesis pathway (ko00942). Furthermore, the most important nine genes and metabolites were screened using O2PLS model. The results will provide a theoretical basis for revealing pigment and flavone biosynthesis network of mint.

Neptunea cumingii is an economically important marine shellfish found in the Yellow Sea and Bohai Sea areas of China. However, due to environmental factors, such as global warming, Neptunea cumingii resources are in decline along the coast of China. In this study, samples of Neptunea cumingii were collected in Zhangzidao and Yantai during spring, summer， autumn, and winter to clarify the gene expression patterns and regulatory mechanisms in the gills in different seasons. Transcriptome analysis was conducted using Neptunea cumingii gill tissues and genes with significantly different expression levels were extracted for functional verification. The most genes with differences in expression（DEGs） were found in comparisons of the winter and summer samples. Gene enrichment analysis based on Gene Ontology and Kyoto Encyclopedia of Genes and Genomes terms showed that these DEGs were mainly involved in immune and metabolic pathways, and they had significant effects on oxidative stress, body metabolism, and protein synthesis in Neptunea cumingii. Further screening of DEGs identified 34 genes related to temperature regulation comprising 13 genes with roles in innate immunity in shellfish, 12 genes related to oxidative stress, and nine genes related to protein synthesis and energy metabolism. Eleven DEGs were randomly selected for qPCR verification and the results were consistent with the transcriptome analysis results. In summary, the transcriptome results differed significantly between seasons in the gill tissues of Neptunea cumingii. The expression levels of immune regulatory genes could be promoted in Neptunea cumingii during the high temperature season, whereas the expression of these genes may be inhibited in the low temperature season. The results obtained in this study provide insights into the molecular defense mechanisms that might allow Neptunea cumingii to adapt to climate change.

Sheep (Ovis aries) provide a vital source of protein and fibre to human populations. In coming decades, as the pressures associated with rapidly changing climates increase, breeding sheep sustainably as well as producing enough protein to feed a growing human population will pose a considerable challenge for sheep production across the globe. High quality reference genomes and other genomic resources can help to meet these challenges by: 1) informing breeding programmes by adding a priori information about the genome, 2) providing tools such as pangenomes for characterising and conserving genetic diversity, and 3) improving our understanding of fundamental biology using the power of genomic information to link cell, tissue and whole animal scale knowledge. In this review we describe recent advances in the genomic resources available for sheep, discuss how these might help to meet future challenges for sheep production, and provide some insight into what the future might hold.

We here report the de novo transcriptome assembly and functional annotation of Eusirus cf. giganteus clade g3, providing the first database of expressed sequences from this giant Antarctic amphipod. RNA-sequencing, carried out on the whole-body of a single juvenile individual likely undergoing molting, revealed the dominant expression of hemocyanins. The mRNAs encoding these oxygen-binding proteins cumulatively accounted for about 40% of the total transcriptional effort, highlighting the key biological importance of high hemocyanin production in this Antarctic amphipod species. We speculate that this observation may mirror a strategy previously described in Antarctic cephalopods, which compensate the decreased ability to release oxygen to peripheral tissues at sub-zero temperatures by massively increasing total blood hemocyanin content compared with temperate species. These preliminary results will undoubtedly require confirmation through proteomic and biochemical analyses aimed at characterizing the oxygen-binding properties of E. cf. giganteus clade g3 hemocyanins, and at investigating whether other Antarctic arthropod species exploit similar adaptations to cope with the challenges posed by the extreme conditions of the polar environment.

Pecan (Carya illinoinensis), as a popular nut tree, is widely planted in China in recent years. Grafting is an important technique for its cultivation. For a successful grafting, graft union development generally involves the formation of callus and vascular bundles at the graft union. To explore the molecular mechanism of graft union development, we applied high through-put RNA sequencing to investigate transcriptomic profiles of graft union at four time points (0d, 8d, 15d, and 30d) during pecan grafting process. We identified a total of 12,180 differentially expressed genes. In addition, we found that the content of auxin, cytokinin and gibberellin were accumulated at the graft unions during the grafting process. Correspondingly, genes involved in those hormone signaling were found to be differentially expressed. Interestingly, we found that most genes associated with cell division were up-regulated at callus formative stages, while genes related to cell elongation, secondary cell wall deposition, and programmed cell death were generally up-regulated at vascular bundle formative stages. In the meantime, genes responsible for reactive oxygen species were highly up-regulated across the graft union developmental process. These results will aid in our understanding of successful grafting in the future.

Pardosa pseudoannulata is one of the most common wandering spiders in agricultural fields and a potentially good bioindicator for heavy metal contamination. However, little is known about the mechanism by which spiders respond to heavy metals at the molecular level. In this study, high-throughput transcriptome sequencing was employed to characterize the de novo transcriptome of the spiders and to identify differentially expressed genes (DEGs) after cadmium exposure. We obtained 60,489 assembled unigenes, 18,773 of which were annotated in the public databases. Ultimately, 3450 cDNA simple sequence repeats were identified and validated as potential molecular markers in the unigenes. A total of 2939, 2491 and 3759 DEGs were detected among the three libraries of two Cd-treated groups and the control. Functional enrichment analysis revealed that metabolism processes and digestive system function were predominately enriched in response to Cd stress. At the cellular and molecular levels, significantly enriched pathways in lysosomes and phagosomes as well as replication, recombination and repair demonstrated that oxidative damage resulted from Cd exposure. Based on the selected DEGs, certain critical genes involved in defence and detoxification were analysed. These results may elucidate the molecular mechanism underlying spiders' responses to heavy metal stress.

Sweetpotato is an important miscellaneous grain crop in China, which is threatened by a variety of diseases and insect pests in the process of cultivation and production. sweetpotato stem rot is one of the common sweetpotato diseases, which seriously affects the yield and quality of sweetpotato. However, there are few studies on the mechanism of resistance to stem rot in sweetpotato. In this study, transcriptome sequencing analysis was carried out on the samples at different stages (T1, T2, T3) of stem rot pathogen infecting Xushu 48, and 44839 (T1-VS-T2), 81436 (T1-VS-T2) and 61932 (T2-VS-T3) differentially expressed genes (DEGs) were obtained. The DEGs were mainly concentrated in Alanine, aspartate and glutamate metabolism (ko00250), Carbon fixation in photosynthetic organisms (ko00710) and Amino sugar and nucleotide sugar metabolism (ko00520) and some candidate genes related to plant pathogen infection, such as receptor-like protein kinase (RLK5, RLK7), LRR receptor-like serine/threonine-protein kinase (SERK1), bHLH137, ERF9, MYB73 and NAC053, were screened. The results of this study provide genetic resources for the research on stem rot resistance of sweetpotato and provide theoretical basis for sweetpotato resistance breeding.

In this work, we tried to emphasize whole transcriptome expression changes in the Wistar rats brainstem two hours after acute stress. Most of the genes were upregulated. We detected massive shift of neuropeptides Crh, Trh,Cga, Tshb, Uts2b, Tac4, Lep and neuropeptide receptors Hcrtr1, Sstr5, Bdkrb2, Crhr2 signaling, as well as Glutamate Grin3b, Grm2 and GABA Gpr156, Acetylcholine Chrm4,Chrne, Adreno- Adra2b receptors expression uprising. Intensive increase in expression of intermediate filaments Krt83/Krt86/Krt80/Krt84/Krt87/Krt4/Krt76 and motor proteins Myo7a, Klc3 was detected. Remarkably, at this time we also observed signs of microglia activation. Both expression of anti-inflammatory cytokines Il13, Ccl24 and proinflammatory cytokin’s receptors Il9r, Il12rb1, Tnfrsf14, Tnfrsf13c, Tnfrsf25, Tnfrsf1b were increased. In the Wnt signaling pathway, we have seen increased expression of ligands-receptors Wnt1, Wnt11, Ror2, and also negative regulators Notum, Sfrp5, Sost. Also we conducted cDNA libraries normalization with duplex specific nuclease and compared results. On the basis of our RNAseq data, we chose reference genes for RT-qPCR best suitable for experiments with acute stress.

Glucose is an important carbon sources for microbial growth, and its content in infertile soils is essential for the growth of the bacterium. Since the mechanism of oligotrophic bacterium adaptation in barren soils is unclear, the research employed RNA Seq technology to examine the impact of glucose concentration on the low nutrient bacteria BS-G1 in soil affected by desertification. RNA-Seq revealed that differentially expressed genes（DEG）histidine metabolism, glutamate synthesis, HIF-1 signalling pathway, sporulation, and TCA cycle pathway of BS-G1 were significantly enriched in 0.015 g/L glucose concentration, compared with 10 g/L glucose concentration. DEG amino acids system, two-component system, Metal Ion Transport, and nitrogen metabolism system of B. subtilis BS-G1 were significantly enriched in 5 g/L glucose concentration, compared with 10 g/L glucose concentration. In addition, The present study identified its regulation pattern and key genes under the low glucose environment (7 mRNAs, 16 sRNAs). This study primarily investigates the variances in the regulatory pathways of oligotrophic bacteria BS-G1, which holds substantial importance in comprehending the mechanism underlying the limited sugar tolerance of oligotrophic bacteria.

In the recent decades, per- and polyfluoroalkyl substances (PFAS) have garnered widespread public attention due to their persistence in the environment and detrimental effects on the health of living organisms, spurring the generation of several transcriptome-centered investigations to understand the biological basis of their mechanism. In this study, we collected 2144 publicly available samples from 7 distinct animal species to examine the molecular responses to PFAS exposure and to determine if there are conserved responses. Our comparative transcriptional analysis revealed that exposure to PFAS is conserved across different tissues, molecules and species. We identified and reported several genes exhibiting consistent and evolutionarily conserved transcriptional response to PFAS, such as ESR1, HADHA and ID1, as well as several pathways including lipid metabolism, immune response and hormone pathways. This study provides the first evidence that distinct PFAS molecules induce comparable transcriptional changes and affect the same metabolic processes across inter-species borders. Our findings have significant implications for understanding the impact of PFAS exposure on living organisms and the environment. We believe that this study offers a novel perspective on the molecular responses to PFAS exposure and provides a foundation for future research into developing strategies for mitigating the detrimental effects of these substances in the ecosystem.

Enterocytozoon hepatopenaei (EHP) is an obligate intracellular parasite classified as a fungal pathogen, which causes hepatopancreatic microsporidiosis (HPM) in shrimp, resulting in large economic losses to the shrimp culture industry. However, the molecular mechanisms of how EHP affects hormonal regulation in shrimp were rarely reported. Thus, in the present study, we investigated the transcriptomic data of the hepatopancreas of EHP-infected and uninfected shrimp to study the hormonal regulation corresponding to EHP infection. The results showed that there were 157 differentially expressed genes (DEGs) at the hormonal regulatory level, of which 32 genes were upregulated and 125 genes were downregulated. Functional enrichment analysis showed that many DEGs were enriched in ecdysis-related pathways, including EGFR tyrosine kinase inhibitor resistance, thyroid hormone signaling pathway, and steroid hormone biosynthesis. Ten genes were randomly selected for qRT-PCR to verify the transcriptome sequencing results, and the results demonstrated that the expression of these genes were consistent with the results of the transcriptome. Our study provides an important dataset that contributes to further understanding of how EHP affects shrimp at the level of hormonal regulation. It provides a basis for further research and control of HPM.

In kidney transplant recipients, belatacept is usually pursued indefinitely after it has been started. In the setting of the belatacept shortage and after having evaluated the benefit-risk ratio, we established a strategy consisting of time-limited belatacept therapy / transient calcineurin inhibitor withdrawal, whose results are analyzed in that study. We considered all the kidney transplant recipients that had been switched from conventional immunosuppressive therapy to belatacept and then for whom belatacept has been withdrawn intentionally. Furthermore, in the first 8 patients, we assessed changes in peripheral blood mononuclear cells (PBMC) transcriptome using RNAseq before and 3 months after belatacept withdrawal. Over the study period, 28 out of 94 patients had belatacept intentionally withdrawn including 25 (89%) switched to low-dose CNI. One rejection due to poor compliance occurred. The eGFR after 12 months remained stable from 48 ± 19 ml.1.73m^-2 to 46 ±17 ml.1.73m^-2 (p = 0.68). However, patients that resumed belatacept / withdrew CNIs (n=10) had a trend towards a better eGFR comparing with the others (n =15): 54 ± 20 ml.1.73m^-2 vs eGFR 43 ± 16 ml.1.73m^-2 respectively (p = 0.15). The only factor associated with belatacept resumption was when the withdrawal took place during the COVID-19 outbreak. Transcriptome analysis of PBMCs, did not support rebound in alloimmune response. These findings underpin the use of belatacept as part of a time-limited therapy, in selected kidney transplant recipients, possibly as an approach to allow efficient vaccination against SARS-Cov-2.

Growing cells is the typical mode of operation in many aspects of biotechnology and metabolic engineering. This comes about due to cell growth processes creating a driving force that pull metabolic flux along different metabolic pathways, that indirectly help move substrate to product. But, there is an alternative mode of operation that uses resting (non-growing) cells to achieve similar or even higher productivities. In general, resting cells are provided with carbon substrates for biocatalytic reactions but starved of nitrogen or phosphorus. Such resting cells have been usefully employed in many forms of biocatalysis and biotransformation, with or without cofactor regeneration. However, much remains unknown about the transcriptome and metabolome of resting cells in biotransformation settings. This short writeup provides the backdrop of resting cells in biocatalysis, documents their use in biotransformation with application examples, and identifies research gaps that could be filled with contemporary RNA-seq and mass spectrometry proteomics technology. Overall, utility of resting cells in biocatalysis and the extant knowledge gap in their fundamental physiology are highlighted in this resource.

Bacillus subtilis NCD-2 showed a promising biocontrol effect against plant soil-borne diseases, and was developed as a commercial microbial fungicide against cotton verticillium wilt in China. Spores were main ingredient of the fungicide and played the crucial role in biological control of plant diseases. Therefore, the key to reducing the cost of fungicide was to find ways to increase the number of spores of strain NCD-2 during fermentation. In this study, 755 substances were evaluated by Phenotype Microarray technology, and 5 kinds of carbon sources and 1 kind of nitrogen source were found to promote the metabolism of strain NCD-2. Among carbon sources L-arabinose showed strongest ability to promote the bacteria growth and sporulation of strain NCD-2. When L-arabinose was used as a single carbon source, it could increase the bacteria concentration and the sporulation efficiency of strain NCD-2 by 2.04 times and 1.99 times, respectively, compared with D-glucose. Moreover, L-arabinose could significantly decrease the autolysis of strain NCD-2 revealed by microscopy observation. The mechanism for promoting the sporulation by L-arabinose was analysed by RNA-seq sequencing. Results showed that total of 790, 923 and 1270 genes were up-regulated and 639, 850 and 1001 genes were down-regulated under L-arabinose supplies when cultured at 8 h, 12 h and 16 h, respectively. Fourteen differentially expressed genes associated with arabinose transportation and sporulation were selected for qRT-PCR analysis, and the result showed basically consistent expression trend with transcriptome. Notably, genes associated with arabinose metabolism, sporulation, spore resistance to heat and spore coat formation were significantly up-regulated, and genes associated with sporulation-delaying protein were significantly down-regulated under L-arabinose supplies. msmX gene which was involved in arabinose transport in Bacillus genus was deleted, and the mutant decreased the growth and sporulation by 53.71% and 86.46%, respectively, when compared to strain NCD-2 wild type. Complementary of the mutant by importing intact msmX gene could restore the growth and sporulation of the mutant strain. In conclusion, arabinose played an important role in regulating the growth and sporulation of strain NCD-2.

Sweet sorghum is an important bioenergy grass and valuable forage with a strong adaptability to saline environments. However, little is known about the mechanisms of sweet sorghum coping with ion toxicity under salt stresses. Here, we first evaluated the salt tolerance of a sweet sorghum cultivar “Lvjuren” and determined its ion accumulation traits under NaCl treatments; then explored key genes involved in Na+, Cl−, K+ and NO3− transport using transcriptome profiling and qRT-PCR method. The results showed that the growth and photosynthesis of sweet sorghum were unaffected by 50 and 100 mM NaCl treatments, indicative of a strong tolerance of this species to salt stresses. Under NaCl treatments, sweet sorghum could efficiently exclude Na+ from shoots and accumulate Cl− in leaf sheaths to avoid their overaccumulation in leaf blades; meanwhile, it possessed a prominent ability to sustain NO3− homeostasis in leaf blades. Transcriptome profiling identified several differentially expressed genes associated with Na+, Cl−, K+ and NO3− transport in roots, leaf sheaths and leaf blades of sweet sorghum after 200 mM NaCl treatment for 6 and 48 h. Moreover, transcriptome data and qRT-PCR results indicated that HKT1;5, CLCc and NPF7.3-1 should be key genes involved in Na+ retention in roots, Cl− accumulation in leaf sheaths and maintenance of NO3− homeostasis in leaf blades, respectively. Many TFs were also identified after NaCl treatment, which should play important regulatory roles in salt tolerance of sweet sorghum. This work lays a preliminary foundation for clarifying the molecular basis underlying the adaptation of sweet sorghum to adverse environments.

To further investigate the immune response of Macrobrachium rosenbergii against Aeromonas veronii, comparative transcriptomic analyses of the M. rosenbergii hepatopancreas were conducted on challenge and control groups at 6, 12, and 24 h post-infection (hpi), independently. A total of 51,707 high-quality unigenes were collected from the RNA-seq data, and 8,060 differentially expressed genes (DEGs) were discovered through paired comparisons. Among three comparison groups, KEGG pathway enrichment analysis showed that 173 immune-related DEGs were considerably clustered into 28 immune-related pathways, including the lysosome and phagosome, etc. Moreover, the expression levels of the four key immune-related genes (TOLL, PAK1, GSK3β, and IKKα) were evaluated at various stages following post-infection in the hepatopancreas, hemolymph, and gill. Both PAK1 and GSK3β genes were highly upregulated in all three tissues at 6 hpi with A. veronii; TOLL was up-regulated in the hepatopancreas and hemolymph but down-regulated in the gill at 6 hpi; and IKKα was up-regulated in hemolymph and gill, but down-regulated in the hepatopancreas at 6 hpi. These findings lay the groundwork for understanding the immune mechanism of M. rosenbergii after contracting A. veronii.

Middle East Respiratory Syndrome coronavirus (MERS-CoV) infects dromedary camels and zoonotically infects humans, causing a respiratory disease with severe pneumonia and death. With no approved antiviral or vaccine interventions for MERS, vaccines are being developed for camels to prevent virus transmission into humans. We have previously developed a chimpanzee adenoviral vector-based vaccine for MERS-CoV (ChAdOx1 MERS) and reported its strong humoral immunogenicity in dromedary camels. Here, we looked back at total RNA isolated from three immunised dromedaries pre and post-vaccination during the first day; and performed RNA sequencing and bioinformatic analysis in order to shed light on the molecular immune responses following a ChAdOx1 MERS vaccination. Our finding shows that a number of transcripts were differentially regulated as an effect of the vaccination, including genes that are involved in innate and adaptive immunity, such as type I and II interferon responses. The camel Bcl-3 and Bcl-6 transcripts were significantly upregulated, indicating a strong activation of Tfh cells, B cell, and NF-kB pathways. In conclusion, this study gives an overall view of the first changes in the immune transcriptome of dromedaries after vaccination; it supports the potency of ChAdOx1 MERS as a potential camel vaccine to block transmission and prevent new human cases and outbreaks.

Streptococcus suis is a zoonotic pathogen causing serious infections in both swine and humans. Although metals are essential for life, excess amounts of metals they are toxic to bacteria. when accumulated in excess amounts. Except for zinc, Transcriptome-level data of the mechanisms for resistance to metal-induced toxicity in S. suis are available for no metals other than zinc. have not been investigated from the transcriptome level in S. suis. Herein, we explored the transcriptome-level changes of in S. suis in response to ferrous iron and cobalt toxicity by RNA sequencing. Many A lot of genes were differentially expressed in the presence of excess ferrous iron and cobalt. Most of the genes in response to cobalt toxicity showed the same expression trends as those were expressed in the same trend in response to ferrous iron toxicity. qRT-PCR analysis of the selected genes confirmed the accuracy of RNA sequencing results. Bioinformatics analysis of the differentially expressed genes indicated that ferrous iron and cobalt have similar impacts effects on the cellular processes of S. suis. Treatment with ferrous Ferrous iron treatment resulted in down-regulation of several oxidative stress tolerance-related genes involved in oxidative stress tolerance and up-regulation of the genes in an amino acid ABC transporter operon. Expression of the several genes in the arginine deiminase system was down-regulated in the presence of after ferrous iron and cobalt treatment. Collectively, our results suggested that S. suis alters the expression of a lot of multiple genes to respond to ferrous iron and cobalt toxicity.

Study in black rice has gain prominence in recent times due to its high nutritive value, curative effect, and anti-oxidant properties. However, its poor agronomic traits, including low yield necessitates the incorporation of the colour-grain trait into elite varieties through plant breeding techniques. SSR markers play an important role in plant identification and breeding. Here, the generation of reference-based transcriptome, annotation of transcriptome datasets, and a large set of simple sequence repeat (SSR) markers derived from Black rice have been described. In all 28664 SSRs were predicted in 34978 (48.59%) expressed transcripts. However, 7068 (20.20%) transcripts were found to have more than one SSR. The identified SSRs were dominated by tri-nucleotide and tetra-nucleotide repeats representing about 54.11% and 33.31% respectively, of total SSRs. Validation of selected markers associated with anthocyanin trait performed across different black rice accessions established the reliability of the process used for mining SSR markers. The SSR markers identified in this study could be used to select varieties with desired traits, and to investigate the genetic mechanism underlying anthocyanin accumulation in the pericarps of black rice. Furthermore, the findings from this study may prove beneficial in future genetic diversity studies, primer development, and selective breeding programs.

Heavy metal pollution is an increasing global concern. Among heavy metals, mercury (Hg) is especially dangerous because of its massive release into the environment and high toxicity, especially for aquatic organisms. The molecular response mechanisms of algae to Hg exposure are mostly unknown. Here, we combine physiological, biochemical, and transcriptomic analysis to provide, for the first time, a comprehensive view on the pathways activated in Chromera velia in response to toxic levels of Hg. Production of hydrogen peroxide and superoxide anion, two reactive oxygen species (ROS), showed opposite patterns in response to Hg²⁺ while reactive nitrogen species (RNS) levels did not change. A deep RNA sequencing analysis generated a total of 307,738,790 high-quality reads assembled in 122,874 transcripts, representing 89,853 unigenes successfully annotated in databases. Detailed analysis of the differently expressed genes corroborate the biochemical results observed in ROS production and suggests novel putative molecular mechanisms in the algal response to Hg²⁺. Moreover, we indicated that important transcription factor (TF) families associated with stress responses differentially expressed in C. velia cultures under Hg stress. Our study presents the first in-depth transcriptomic analysis of C. velia, focusing on the expression of genes involved in different detoxification defense systems in response to heavy metal stress.

Objective: Rett syndrome (RTT) is an X-linked neurodevelopmental disorder caused by mutations in MeCP2, a transcription factor. MeCP2 mutations cause abnormal expression of downstream genes and eventually lead to brain dysfunction. The role of MeCP2 in brain neural development remains unclear. To further elucidate this role, a MeCP2-null rat model was created with the CRISPR/cas9 system. Method: A MeCP2-cas9 vector was constructed and then microinjected into fertilized rat ova in vitro. Two mutations by CRISPR/cas9 were confirmed to cause deletions in exon 2 of MeCP2 via DNA sequencing, and protein expression was measured by Western blotting. Transcriptome data for three brain tissues, the cerebellum, cerebral cortex and hippocampus, were obtained via next-generation sequencing. Results: MeCP2-null rats were successfully obtained, and preliminary analysis showed that the MeCP2-null rats exhibited motor dysfunction and anxious and depressed behaviour. In addition, differentially expressed genes (DEGs) were identified in the three MeCP2-null brain tissues compared to wild-type rat brain tissues. In the rat cerebellum, 388 downregulated DEGs were mainly involved in the calcium ion signalling pathway and the PI3K-Akt signalling pathway. In the cerebral cortex, 386 upregulated DEGs were primarily involved in intracellular signal transduction, protein phosphorylation and the MAPK signalling pathway. In the hippocampus, the DEGs were related to the MAPK signalling pathway. Conclusion: We constructed a MeCP2-null rat model with unique features with CRISPR/cas9 technology to study RTT and analysed DEGs in three rat brain tissues to highlight potential targets for the development of new medicines.

To understand the molecular mechanism associated with growth variability in bivalves, the Solexa/Illumina technology was employed to analyze the transcriptomic profiles of extreme growth rate differences (fast- VS. slow-growing individuals) in one full-sib family of the ark shell Scapharca subcrenata. De novo assembly of S. subcrenata transcriptome yielded 276,082,016 raw reads, which were assembled into 98,502 unique transcripts by Trinity strategy. A total of 6,357 differentially expressed genes (DEGs) were obtained between fast- and slow-growing individuals, with 580 up-regulated expression and 5777 down-regulated expression. Functional annotation revealed that the largest proportion of DEGs were classified to the large or small subunit ribosomal protein, all of which showed significantly lower expression levels in fast-growing group than those in slow-growing group. GO enrichment analysis identified the maximum of DEGs to biological process, followed by molecular function and cellular component. Most of the top enriched KEGG pathways were related to energy metabolism, protein synthesis and degradation. These findings reveal the link between gene expression and contrasting phenotypes in ark shells, which support that fast-growing individuals may be resulted from decreased energy requirements for metabolism maintenance, accompanying with greater efficiency of protein synthesis and degradation in bivalves.

Nine crossbred finishing barrows randomly assigned to 3 dietary treatments were used to investigate the effects of dietary lysine on muscle growth related metabolic and signaling pathways. Muscle samples were collected from the longissimus dorsi of individual pigs after feeding the lysine-deficient, lysine-adequate, or lysine-excess diet for 5 weeks, and the total RNA was extracted afterwards. Affymetrix Porcine Gene 1.0 ST Array was used to quantify the expression levels of 19,211 genes. A total of 674 transcripts were differentially expressed (P ≤ 0.05); 60 out of 131 transcripts (P ≤ 0.01) were annotated in the NetAffx database. Ingenuity pathway analysis showed that dietary lysine deficiency may lead to (1) increased muscle protein degradation via the ubiquitination pathway as indicated by the up-regulated DNAJA1, HSP90AB1 and UBE2B mRNA, (2) reduced muscle protein synthesis via the up-regulated RND3 and ZIC1 mRNA, (3) increased serine and glycine synthesis via the up-regulated PHGDH and PSPH mRNA, and (4) increased lipid accumulation via the up-regulated ME1, SCD, and CIDEC mRNA. Dietary lysine excess may lead to (1) decreased muscle protein degradation via the down-regulated DNAJA1, HSP90AA1, HSPH1, and UBE2D3 mRNA, and (2) reduced lipid biosynthesis via the down-regulated CFD and ME1 mRNA.

Lily tepals have a short lifespan. Once the tepals senesce, the ornamental value of the flower is lost. Some cultivars have attractive purple ovaries and fruits which greatly enhance the ornamental value of Asiatic hybrid lilies. However, little is known about the molecular mechanisms of anthocyanin biosynthesis in Asiatic hybrid lily ovaries. To investigate the transcriptional network that governs purple ovary coloration in Asiatic hybrid lilies, we obtained transcriptome data from green ovaries (S1) and purple ovaries (S2) of Asiatic ‘Tiny Padhye’. Comparative transcriptome analysis revealed 4228 differentially expressed genes. Differential expression analysis revealed that nine unigenes including four CHS genes, one CHI gene, one F3H gene, one F3′H gene, one DFR gene, and one UFGT gene were significantly up-regulated in purple ovaries. One MYB gene, LhMYB12-Lat, was identified as a key transcription factor determining the distribution of anthocyanins in Asiatic hybrid lily ovaries. Further qPCR results showed unigenes related to anthocyanin biosynthesis were highly expressed in purple ovaries of Asiatic ‘Tiny Padhye’ at stages 2 and 3, while they showed an extremely low level of expression in ovaries of Asiatic ‘Yellow Pixels’ during all developmental stages. In addition, shading treatment significantly decreased pigment accumulation by suppressing the expression of several unigenes related to anthocyanin biosynthesis in ovaries of Asiatic ‘Tiny Padhye’. These results could further our understanding of the molecular mechanisms of anthocyanin biosynthesis in Asiatic hybrid lily ovaries.

REV-ERBα and its paralog, REV-ERBβ encoded by NR1D1 and NR1D2 genes, are key nuclear receptors that link the circadian timing system and metabolic homeostasis. Since heme is an endogenous ligand, REV-ERBs have been considered key components of the circadian molecular clock that can be pharmacologically targeted to treat various circadian rhythm-related diseases, such as cardiometabolic, inflammatory, and neuropsychiatric diseases, as well as cancer. REV-ERBs are believed to be functionally redundant and compensatory, although they often affect the expression of gene subsets in an isoform-specific manner. Therefore, this study aimed to identify the redundant and distinct roles of each isoform in controlling its target genes by comparing the transcriptome profiles of a panel of mutant U2OS human osteosarcoma cells in which either NR1D1 or NR1D2 was ablated. Indeed, our transcriptomic analyses revealed that most REV-ERB-regulated genes were controlled by redundant or even additive actions. However, the RNA expression profiles of each single mutant cell line also provided strong evidence for isoform-dependent actions. For example, REV-ERBα were more responsible for regulating the NF-κΒ signaling pathway, whereas a group of extracellular matrix components required REV-ERBβ to maintain their expression. We found that REV-ERBs have isoform-selective functions in the regulation of certain circadian output pathways, despite their overlapping roles in the circadian molecular clock. Thus, the development of isoform-selective REV-ERB modulators may help treat metabolic disturbances and certain types of cancer.

In recent years, magnetic fields have emerged as a non-thermophysical treatment with a signifi-cant impact on microbial fermentation processes. Brassica trispora is a microorganism known for its indus-trial-scale production of lycopene and high yield of single cells. This study aimed to in-vestigate the impact of low frequency magnetic fields on lycopene synthesis by Brassica trispora and elucidate the underlying mechanism for enhancing lycopene yield. The results indicated that both the intensity and duration of the magnetic field treatment influenced the cell. Exposing the cell to a 0.5 mT magnetic field for 48 hours on the second day of fermentation resulted in a lyco-pene yield of 1473.16 mg/L, representing a re-markable increase of 216.1% compared to the con-trol group. Transcriptome analysis revealed that al-ternating magnetic field significantly up-regulated genes related to ROS and cell membrane structure, leading to a substantial increase in lycopene production. Scanning electron microscopy revealed that the magnetic field treatment resulted in rough, loose, wrinkled surface morphology of the mycelium, along with a few mi-cropores, thereby altering the cell membrane permeability to some extent. Moreover, there was a significant increase in intracellular ROS content, cell membrane permeability, key enzyme activi-ty involved in lycopene metabolism, and ROS-related enzyme activity. In conclusion, the alter-nating fre-quency magnetic field can activate a self-protective mechanism that enhances lyco-pene synthesis by modulating intracellular ROS content and cell membrane structure. These find-ings not only deepen our understanding of the impact of magnetic fields on microbial growth and metabolism but also provide valuable insights for developing innovative approaches to en-hance carotenoid fermentation.

Pollination in angiosperms depends on a complex communication between pollen grains and stigmas, classified as wet or dry, depending on the presence or absence of secretions at the stigma surface, respectively. In species with wet stigma, the cuticle is disrupted and the presence of exudates is indicative of their receptivity. Most stigma studies are focused on few species and families, many of them with self-incompatibility systems. However, there is scarce knowledge about the stigma composition in Fabaceae, the third angiosperm family, whose stigmas have been classified as semidry. Here we report the first transcriptome profiling and DEGs of Vicia faba L. styles and stigmas from autofertile (flowers able to self-fertilize in absence of manipulation whose exudate is released spontaneously) and autosterile (flowers that need to be manipulated to break the cuticle and release the exudates to be receptive) inbred lines. From the 76,269 contigs obtained from the de novo assembly, only 45,1% of the sequences were annotated with at least one GO term. A total of 115,920, 75,489 and 70,801 annotations were assigned to Biological Process (BP), Cellular Component (CC) and Molecular Function (MF) categories, respectively and 5,918 differentially expressed genes (DEGs) were identified between the autofertile and the autosterile lines. Among the most enriched metabolic pathways in the DEGs subset were those related with aminoacid biosynthesis, terpenoid metabolism or signal transduction. Some DEGs have been related with previous QTLs identified for autofertility traits, and their putative functions are discussed. Results derived from this work provides an important transcriptomic reference for style-stigma processes to aid understanding of the molecular mechanisms involved in faba bean fertilization.

Parkinson's disease (PD) stands as the most prevalent degenerative movement disorder, characterized by the loss of dopaminergic neurons in the substantia nigra of the midbrain. In this study, we assessed the transcriptome by analyzing post-mortem mRNA extracted from the substantia nigra of individuals with PD and healthy controls. A total of 16,148 transcripts were identified, with 92 mRNAs displaying differential expression between PD and control groups. Specifically, 33 mRNAs were significantly upregulated, while 59 mRNAs were downregulated in PD compared to controls. The identification of statistically significant signaling pathways, with an adjusted p-value threshold of 0.05, unveiled noteworthy insights. Particularly, enriched categories included cardiac muscle contraction (involving genes such as ATPase Na+/K+ transporting subunit beta 2 (ATP1B2), solute carrier family 8 member A1 (SLC8A1), and cytochrome c oxidase subunit II (COX2)), GABAergic synapse (involving GABA type A receptor-associated protein like 1 (GABARAPL1), G protein subunit beta 5 (GNB5), and solute carrier family 38 member 2 (SLC38A2)), autophagy (involving GABARAPL1 and tumor protein p53-inducible nuclear protein 2 (TP53INP2)), and Fc gamma R-mediated phagocytosis (involving amphiphysin (AMPH)). These findings uncover new pathophysiological dimensions underlying PD, including the involvement of cardiac muscle contraction and specific mitochondrial activity. This knowledge not only contributes to better diagnostic precision but also paves the way for the development of new targeted therapies.Keywords: mRNAs; RNA sequencing; Parkinson’s disease; transcriptome analysis; substantia nigra

Keywords: Organic selenium; Nano-selenium; Drought stress; Physiological response; Transcriptome

Aspergillus montevidensis is an important domesticated fungus that has been applied to produce many traditional fermented foods under high osmotic conditions. However, the detailed mechanisms of tolerance to osmotic stress remain largely unknown. Here, we construct a target-deleted strain (ΔLeuRS) of A. montevidensis and found that the ΔLeuRS mutants grew slowly and suppressed the development of the cleistothecium compared to the wide-type strains (WT) under salt-stressed conditions. Furthermore, differentially expressed genes (P<0.0001) governed by LeuRS were involved in salt tolerance, ABC transporter, amino acid metabolism, sugar metabolism, and reproduction process. The ΔLeuRS strains compared to WT strains under short- and long-term salinity stress especially altered accumulation levels of metabolites, such as amino acids and derivatives, carbohydrates, organic acids, and fatty acids. The study provides new insights into the underlying mechanisms of salinity tolerance and lays a foundation for favor improvement of foods fermented with A. montevidensis.

Autophagy is an evolutionarily conserved mechanism for degrading and recycling different cellular components in both normal development and stress conditions. Our recent research demonstrated that autophagy-mediated compartmental cytoplasmic deletion is essential for pollen germination. However, how autophagy regulates pollen germination to ensure its fertility remains largely unknown. Here, we applied multi-omic analyses to investigate the downstream pathways of autophagy in the process of pollen germination. Although ATG2 and ATG5 play similar roles in regulating pollen germination, high-throughput transcriptomic analysis reveals that silencing ATG5 has greater impact on the transcriptome than silencing ATG2. Cross-comparisons of transcriptome and proteome analysis reveal that gene expression at mRNA level and protein level are differentially affected by autophagy. Furthermore, high-throughput metabolomics analysis demonstrates that pathways related amino acid metabolism and aminoacyl-tRNA biosynthesis can be affected by both ATG2 and ATG5 silencing. Collectively, our multi-omic analyses reveal a central role of autophagy in cellular metabolism, which is critical for the initiation of pollen germination and the guarantee of pollen fertility.

Improving plant nitrogen use efficiency (NUE) is important for many crops, especially in hybrid breeding. Reducing nitrogen inputs is key for achieving sustainable rice production and decreasing environmental problems. Here, we analyzed the transcriptomic and physiological changes in two indica restorer lines (Nanhui511 and Minghui23) under high (HN) and low nitrogen (LN) conditions. Nanhui511 (NH511) was more sensitive to different nitrogen supplies and exhibited higher nitrogen uptake and NUE under HN conditions by increasing lateral root and tiller numbers in the seedling and maturation stages, respectively. It also exhibited a lower survival rate than that of MH23 when planted in chlorate-containing hydroponic solution, indicating its high nitrogen uptake ability under different nitrogen supply conditions. When transferred from LN to HN conditions, NH511 had 2456 differentially expressed genes, whereas MH23 had only 266. Furthermore, genes related to nitrogen utilization showed differential expression in NH511 under HN conditions, while the opposite was observed in MH23. These results will help decrease certain limitations of hybrid rice breeding and provide novel data for high-NUE hybrid rice cultivation.

The objective of this study was to identify key transcription factors involved in lipid metabolism and immune response related to the differentially expressed genes (DEG) from the liver samples of 35 pig model for metabolic diseases fed diets containing either 1.5 or 3.0% soybean oil (SOY1.5 or SOY3.0). A total of 281 DEG between SOY1.5 and SOY3.0 diets (log2fold-change ≥ 1 or ≤ −1; FDR-corrected p-value &lt; 0.1) were identified, in which 129 were down-regulated and 152 were up-regulated in SOY1.5 group. The functional annotation analysis detected transcription factors linked to lipid homeostasis and immune response, such as RXRA, EGFR, and SREBP2 precursor. These findings demonstrated that key transcription factors related to lipid metabolism could be modulated by dietary inclusion of soybean oil. It could contribute to nutrigenomics research field that aims to elucidate dietary interventions in animal and human health, as well as to drive the food technology and science.

A definitive transcriptome atlas for the non-coding expressed elements of pathogenic mycobacteria does not exist. Incomplete lists of non-coding transcripts can be obtained for some of the reference genomes (e.g. Mycobacterium tuberculosis H37Rv) but to what extent these transcripts have homologues in closely related species or even strains is not clear. This has implications for the analysis of transcriptomic data; non-coding parts of the transcriptome are often ignored in the absence of formal, reliable annotation. Here, we review the state of our knowledge of non-coding RNAs in pathogenic mycobacteria, emphasising the disparities in the information included in commonly used databases. We then proceed to review ways of combining computational solutions for predicting the non- coding transcriptome with experiments that can help refine and confirm these predictions.

Ectopic expression of the MYB transcription factor of AmROSEA1 from Antirrhinum majus has been reported to change anthocyanin and other metabolites in several species. In this study, we found that overexpression of AmRosea1 significantly improved the tolerance of transgenic rice to drought and salinity stress. Transcriptome analysis revealed that a considerable amount of stress-related genes were affected by exogenous AmRosea1 during both drought and salinity stress treatments. These affected genes are involved in stress signal transduction, the hormone signal pathway, ion homeostasis and the enzymes that remove peroxides. This work suggests that the AmRosea1 gene is a potential candidate for genetic engineering of crops.

Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

The diversity of leaf characteristics, including leaf color, is a prominent subject of study in plant science. Leaf color is predominantly determined by the synthesis and functionality of chlorophyll, a key component of photosynthesis. The regulation of chlorophyll synthesis and degradation involves complex gene interactions, and disruptions in these processes can lead to abnormal chlorophyll synthesis and impact leaf color. This study focuses on Bambusa multiplex f. silverstripe, a natural variant with various leaf colors, including green, white, and green-white leaves. The variations in leaf color are attributed to genetic factors and their influence on gene expression. By employing RNA-seq, we investigate the molecular mechanisms behind chlorophyll anomalies and genetic factors in Silverstripe. Our findings shed light on the complexity of gene interactions and regulatory networks that underlie leaf color diversity and provide valuable insights for future research and plant breeding.

Alfalfa is an important forage crop around the world. LncRNAs are considered to be a class of functional biomacromolecules, while little is known about lncRNAs in alfalfa. In this study, RNAs from different tissues of alfalfa were sequenced and anlyzed with full-length transcriptome sequencing technology, yielding the full-length transcripts dataset of alfalfa. Based on sequencing and public RNA-seq data, lncRNAs of alfalfa were predicted genome-wide by CPC2 and PLEK. The results showed most lncRNAs shared low sequence conservation with those in other plant species, part of which seems originate from plastid genome. We also identified 88563 lncRNAs, approximately 99.8% of total lncRNAs, with possibility of coding small ORFs using two prediction tools. Our research generated the biggest sequence set of alfalfa lncRNAs, and revealed some plastid originated lncRNAs with high sequence conservation.

Chinese pepper rust is a live parasitic fungal disease caused by Coleosporium zanthoxyli, which seriously affects the cultivation and industrial development of Z. armatum. Cultivating and planting resistant cultivars is considered the most economical and environmentally friendly strategy to control this disease. Therefore, the mining of excellent genes for rust resistance and analysis of the mechanism of rust resistance are the key strategies to achieve the targeted breeding of rust resistance. However, there is no relevant report on pepper rust resistance at present. The aim of the present study was to further explore the resistance mechanism of pepper by screening the rust-resistant germplasm resources in the early stage. Combined with the analysis of plant pathology, transcriptomics, and metabolomics, we found that the genes and metabolites related to phenylpropanoid metabolism were highly enriched in resistant varieties after pathogen infection, which indicated that phenylpropanoid metabolism might mediate the resistance of Z. armatum. This finding was further confirmed by real-time quantitative polymerase chain reaction analysis, which revealed that the expression levels of core genes involved in phenylpropane metabolism in disease-resistant varieties were high. In addition, the difference in flavonoid content in the leaves between resistant and susceptible varieties further supported the conclusion that the flavonoid pathway is one of the main pathways involved in resistance formation in Chinese pepper, and MeJA is involved in the formation of resistance. Our research results not only help to better understand the resistance mechanism of Z. armatum rust but also contribute to the breeding and utilization of resistant varieties.

To explore the expression characteristics and biological functions of related genes of medicago terrestris under long day conditions, and to lay a foundation for revealing the molecular mechanism of medicago terrestris under long day conditions. The leaves of 'R108' tribulus Medicago sativa at branch stage (A), bud stage (B), initial flowering stage (C) and full flowering stage (D) were sequenced by RNA-Seq technology. The genome of Medicago sativa, a related species of Tribulus tribulus, was used as a reference genome for sequence comparison. The transcriptomes of three adjacent periods (A vs B, B vs C, C vs D) were analyzed for differentially expressed genes and photoperiod related differentially expressed genes were screened. A total of 6875 differentially expressed genes were detected. GO functional analysis showed that differentially expressed genes were mainly involved in biological processes, cell components and molecular functions, among which the most differentially expressed genes were involved in cell components. KEGG enrichment analysis showed that differentially expressed genes were mainly involved in circadian rhythm, photosynthesis - antenna protein, ribosome metabolism and other pathways. The number of single nucleotide variants detected by cSNP analysis was 312875, and the frequency of A/G and C/T were the highest. The function of eggNOG was divided into 23 categories, with a total of 26745 genes having similarities, 9008 genes were classified as function unknown, 2669 genes were classified as signal transduction mechanism, 2194 genes were classified as transcription, etc. In different developmental stages (A vs B, B vs C, C vs D), 3463 up-regulated and 3412 down-regulated differentially expressed genes were found. The difference between up-regulated and down-regulated genes was the most obvious between bud stage and initial flowering stage. In addition, a total of 79 flowering genes were found, of which 51 differential genes were screened out to participate in photoperiodic regulation pathway, 23 differential genes were up-regulated, and 28 differential genes were down-regulated. The ratio of gene-LOC11410562(GI), gene-LOC11435974(CO), gene-LOC11422615(TOC1) and gene-LOC11432385(LHY) was higher than that of gene-LOC25500742(PHYA) and gene-LOC11 431402(ELF3), gene-LOC11434778(Col13), gene-LOC25498015(Col6), and gene-LOC11415514(Col9) were preexpressed. The above differentially expressed genes were significantly expressed in different development stages of Terrestris alfalfa, which laid a foundation for further study of the molecular mechanism of Terrestris alfalfa.

Drought and salinity are among the most important abiotic stress factors that limit the productivity in economically important plants. Although genes from wild relatives or unadapted germplasm have often been used for stress tolerance breeding, only few studies have examined wild relatives to understand the genetic and molecular basis of stress tolerance. In this study, we monitored the changes in gene expression profiles of leaf and root tissues of two wild barleys (Hordeum spontaneum L.) accessions from Israel after treatment with salt (NaCl) and drought (PEG) stress. We identified a total of 641 differentially expressed genes across 24 conditions (2 accessions, 2 stress conditions, 2 tissues and 3 time points). Our gene expression analyses revealed large numbers of differentially expressed genes in different accessions by different stress treatments. In addition, the number of genes altered in the leaves of stress-exposed plants of both genotypes was higher than those altered in the roots. Interestingly, there was a relatively little overlap between the leaf and the root stress-responsive gene expression patterns, suggesting that different stress-associated processes might be operating in these tissues during stress adaptation. Overall, our results revealed a number of candidate genes and plant processes associated with stress tolerance in wild barley. Wild barley would be a useful source of new genetic variation for drought and salt stress tolerance. Our results could provide new insights into the mechanisms of drought and salt stress tolerance in wild barley and should be useful for genetic improvement of salt-drought tolerance in cultivated barley.

(1) Background: Breast cancer is a frequent heterogeneous disorder diagnosed in woman and is a high cause of mortality of them in reason to rapid metastasis and disease recurrence. Ferroptosis can inhibit breast cancer cell growth, improve the sensitivity of chemotherapy and radiotherapy and inhibit distant metastases so potentially acts on tumor micro-environment; (2) Methods: Ferroptosis/Extracellular matrix remodeling literature text-mining results were integrated in breast cancer transcriptome cohort according their distant relapse free survival (DRFS) under adjuvant therapy (anthracyclin+taxanes) and also in MDA-MB-231 transcriptome functional experiments with ferroptosis activations (GSE173905); (3) Results: Ferroptosis/Extracellular matrix remodeling text-mining identified 910 associated genes in at list 10 articles. Univariate Cox analyses censored on breast cancer (GSE25066) selected 252 individual significant genes and 171 of them found with an adverse expression. Functional enrichment of these 171 adverse genes predicted basal breast cancer signatures. By text-mining some ferroptosis significant adverse selected genes shared citations in domain of ECM remodeling such as: TNF, IL6, SET, CDKN2A, EGFR, HMGB1, KRAS, MET, LCN2, HIF1A, TLR4. A molecular score based on expression the eleven genes was found predictive of worst prognosis breast cancer at univariate level: basal subtype, short DRFS, high grade values 3 and 4, estrogen and progesterone receptors negative and nodal stages 2 and 3. This eleven gene signature was validated as regulated by ferroptosis inductors (erastin and RSL3) in triple negative breast cancer cellular model MDA-MB-231.; (4) Conclusions: Crosstalk between ECM remodeling-Ferroptosis functionalities allowed to define a molecular score which have been characterized as an independent adverse parameter in prognosis of breast cancer patients. Gene signature of this molecular score have been validated to be regulated by erastin/RSL3 ferroptosis activators. This molecular score could be promising to evaluate ECM impact of ferroptosis target therapies in breast cancer.

In China, the demand for rabbit meat is also increasing, and the production for rabbit meat is important. However, the underlying mechanisms of regulate skeletal muscle growth and development in rabbits remain unclear. The purpose of this study was to identify candidate genes related to skeletal muscle growth in rabbits and explore their potential regulatory mechanisms. RNA-seq technique was used to compare the differences of skeletal muscle transcriptome in Fujian white rabbits at different developmental stages (day 20 and 26 of embryos and birth 1, 30 and 60-day-olds) with a total of 25 individual selected. A total of 9737 DEGs that were acquired from the five groups were annotated into three ontologies of the GO database: biological process (BP), cell component (CC), and molecular function (MF). For KEGG analysis, there are 8249 genes were enriched in 1148 pathways, of which 67 pathways were significantly enriched, mainly in Hypertrophic cardiomyopathy (HCM), the PPAR signaling pathway, MAPK signaling pathway. Among all comparison groups, SE was the most abundant AS event. Real-time PCR verified that the expression patterns of differential genes were consistent with the transcriptome sequencing results. These results will provide a molecular regulation mechanism of muscle growth and development in Fujian white rabbits, and should serve an important theoretical basis for improving meat performance and growth rate of Chinese local meat rabbit breeds.

Advancements in genomics, bioinformatics and genome editing have uncovered new dimensions in gene regulation. Post-transcriptional modifications by the alternative splicing of mRNA transcripts are critical regulatory mechanisms of mammalian gene expression. In the heart, there is an expanding interest in elucidating the role of alternative splicing in transcriptome regulation. Substantial efforts have been directed towards investigating this process in heart development and failure. However, few studies have shed light on alternative splicing products and their dysregulation in congenital heart defects (CHDs). While elegant reports have shown the crucial roles of RNA binding proteins (RBPs) in orchestrating splicing transitions during heart development and failure, the impact of RBPs dysregulation or genetic variation on CHDs has not been fully addressed. Herein, we review the current understanding of alternative splicing and RBPs’ roles in heart development and CHDs and discuss the impacts of perinatal splicing transition and its dysregulation in CHDs. We further summarize discoveries made of causal splicing variants in key transcription factors that have been implicated in CHDs. Improved understanding of the roles of alternative splicing in heart development and CHDs may potentially inform novel preventive and therapeutic advancements for newborn infants with CHDs.

The emergence of drug-resistant parasitic nematodes of both humans and livestock calls for development of alternative and cost-effective control strategies. For the economically important ruminant strongylid Haemonchus contortus, Barbervax® remains the only registered vaccine available. Here we compared the microbiome, genome-wide diversity and transcriptome of H. contortus adult male populations that survived vaccination with an experimental vaccine after inoculation in sheep. Our genome-wide SNP analysis revealed 16 putative candidate vaccine evasion genes. However, we did not identify any evidence for changes in microbial community profiling based of 16S rRNA gene sequencing results of vaccine surviving parasite populations. A total of 58 genes were identified as significantly differentially expressed with six being long non-coding (lnc) RNAs and no putative candidate SNP associated genes. The genes highly upregulated in surviving parasites from vaccinated animals were associated with GO terms belonging to predominantly molecular function and a few biological processes that may have facilitated evasion or potentially lessened the effect of the vaccine. These included five targets: astacin (ASTL), carbonate dehydratase (CA2), phospholipase A2 (PLA2), glutamine synthetase (GLUL) and fatty acid-binding protein (FABP3). We searched all five DEG targets against the proteomes of selected Nematoda (Clades III, V, IV, C, I) and Platyhelminthes (Clades Monogenea, Trematoda, Cestoda, Rhabditophora) to determine homologs within the H. contortus NZ_HCO_NP v1.0 genome and identified single-copy orthologous groups (OGs) in selected proteomes. All but one (FABP3) demonstrated high levels of duplication and wide-spread occurrence in closely related Caenorhabditis elegans and Pristionchus pacificus, with complete absence of all five gene targets among other Clade III (Toxocara canis) and V (Ascaris suum, Ascaris lumbricoides and Parascaris univalens) nematodes, further supporting their vital biological functions in nematodes. Phylogenetic analyses inferred the presence of only ASTL and CA2 in almost all Nematoda, platyhelminthes and metazoans examined, with loss of GLULs observed among all outgroup vertebrate species and the presence of FABP3 in only three other species (Schmidtea mediterranea, Fasciola gigantica and F. hepatica). Our tertiary structure predictions and modelling analyses were used to perform in silico searches of all published and commercially available inhibitor molecules or substrate analogues with potential broad-spectrum efficacy against nematodes of human and veterinary importance.

Identification of the differentially-expressed genes is important for clarification of the complex molecular mechanisms under drought conditions. In this experiment, transcriptome profiles of sensitive and tolerant tomato genotypes under drought stress were analyzed. Three up-regulated genes were selected, included CAB3 (Chlorophyll a-b binding protein3), SAMDC (S-adenosylmethionine decarboxylase proenzyme), and ACS9 (1-aminocyclopropane-1-carboxylate synthase 9). After bioinformatics analysis, tomato genotypes were subjected to drought stress and gene expression was determined using Real-Time-PCR. Physiological parameters of genotypes were also measured by spectrophotometer-based methods. According to the results, these three genes play a key role in stress tolerance. Expression of the CAB3 gene in both sensitive and tolerant genotypes was not significantly different compared to the control, but the SAMDC gene decreased in both genotypes and the ACS9 gene decreased in sensitive genotype and increased in tolerant genotype. The physiological analysis also showed that under stress conditions, the photosynthetic system of the plant was disrupted and the chlorophyll content was reduced, but, proline content and antioxidant enzymes activity increased, in which their quantity in the tolerant genotype was significantly higher than sensitive. Under drought stress, due to damage to the lipid membrane, Malondialdehyde content also increased, in which the sensitive genotype was more affected.

Indiana Vesiculovirus (IVV; formerly as Vesicular stomatitis virus and Vesicular stomatitis Indiana virus) causes a disease in livestock that is very similar to the foot and mouth disease thereby an outbreak may lead to significant economic loss. Long-read sequencing (LRS) -based approaches revealed a hidden complexity of the transcriptomes in several viruses already. This technique was utilized already for the sequencing of the IVV genome, but our study is the first for the application of this technique for the profiling of IVV transcriptome. Since LRS is able to sequence full-length RNA molecules, and thereby providing more accurate annotation of the transcriptomes than the traditional short-read sequencing methods. The objectives of this study were to assemble the complete transcriptome of using nanopore sequencing, to ascertain cell-type specificity and dynamics of viral gene expression and to evaluate host gene expression changes induced by the viral infection. We carried out a time-course analysis of IVV gene expression in human glioblastoma and primate fibroblast cell lines using a nanopore-based LRS approach and applied both amplified and direct cDNA sequencing, as well as cap-selection for a fraction of samples. Our investigations revealed that, although the IVV genome is simple, it generates a relative complex transcriptomic architecture. In this study, we also demonstrated that IVV transcripts vary in structure and exhibit differential gene expression patterns in the two examined cell types.

Mucosal melanomas (MM) are rare aggressive cancers in humans and one of the most common forms of oral cancers in dogs. Similar biological and histological features are shared between MM in both species making dogs a powerful model for comparative oncology studies of melanomas. Although exome sequencing recently identified recurrent coding mutations in canine MM, little is known about changes in non-coding gene expression and more particularly in canine long non-coding RNAs (lncRNAs), which are commonly dysregulated in human cancers. Here, we sampled a large cohort (n= 52) of canine normal/tumor oral MM from three predisposed breeds (poodles, Labrador retrievers and golden retrievers) and used deep transcriptome sequencing to identify more than 400 differentially expressed (DE) lncRNAs. We further prioritized candidate lncRNAs by comparative genomic analysis to pinpoint 26 dog-human conserved DE lncRNAs, including SOX21-AS, ZEB2-AS and CASC15 lncRNAs. Using unsupervised co-expression networks analysis with coding genes, we inferred potential functions of DE lncRNAs suggesting associations with cancer-related genes, cell cycle and carbohydrate metabolism GO terms. Finally, we exploited our multi-breed design to identify DE lncRNAs per breed. This study provides a unique transcriptomic resource for studying oral melanoma in dogs and highlights lncRNAs that may potentially be diagnostic or therapeutic targets for human and veterinary medicine.

The early generative phase of cauliflower (Brassica oleracea var. botrytis) curd ripening is sensitive to the water deficit. Mitochondrial responses under drought within Brassica genus are poorly understood. The main goal of this study was to investigate the mitochondrial biogenesis of three cauliflower cultivars varying with drought tolerance. Diverse quantitative changes (down-regulations mostly) in the mitochondrial proteome were assayed by 2D PAGE coupled with LC-MS/MS. Respiratory (e.g. CII, CIV and ATP synthase subunits), transporter (including diverse porin isoforms) and matrix multifunctional proteins (e.g. components of RNA editing machinery) appeared diversely affected in their abundance under two drought levels. Western immunoassays showed also cultivar-specific responses of selected mitochondrial proteins. Dehydrin-related tryptic peptides found in few 2D spots that appeared immunopositive with dehydrin-specific antisera highlighted the relevance of mitochondrial dehydrin-like proteins for the drought response. The level of selected messengers participating in drought response was also determined. We conclude that the mitochondrial biogenesis was strongly, but diversely affected in various cauliflower cultivars and associated with drought tolerance on the proteomic and functional levels. However, transcriptomic and proteomic regulations were largely uncoordinated due to the suggested altered availability of messengers for translation, mRNA/ribosome interactions and/or miRNA impact on transcript abundance and translation.

Colorectal cancer is a high-incidence tumor that has a high mortality rate due to its frequent metastasis to the liver. The difference in genes, proteins, and immune microenvironment between the primary and metastatic sites causes them to show different responses to treatment. Colorectal cancer liver metastasis patients also tend to show poorer treatment response and prognosis. Therefore, in this paper, we summarize the heterogeneity exhibited after colorectal cancer liver metastasis from five aspects (gene, transcriptome, protein, metabolism, and immunity), and we found that except for the genetic heterogeneity, the other four aspects exhibite significant heterogeneity, which might serve as a new therapeutic direction and a prognostic marker for patients with liver metastasis. Finally, the therapeutic modalities regarding tumors are rapidly evolving, and we have also summarize the new clinical therapeutic modalities currently proposed based on these heterogeneities, aiming to provide new therapeutic ideas for the clinical treatment of patients with colorectal cancer liver metastases.

Pigs are susceptible to cold stress due to the absence of brown fat caused by the partial deletion of uncoupling protein 1 during their evolution. Some local pig breeds in China, exhibit potential cold adaptability, but research has primarily focused on fat and intestinal tissues. Skeletal muscle plays a key role in adaptive thermogenesis in mammals, yet the molecular mechanism of cold adaptation in porcine skeletal muscle remains poorly understood. This study investigated the cold adaptability of two pig breeds, Mashen pigs (MS) and Large White pigs (LW), in a 4-day cold (4°C) or room temperature (25°C) environment. We recorded phenotypic changes and collected blood, and longissimus dorsi muscle for transcriptome sequencing. Finally, a candidate gene was randomly selected for functional exploration in porcine skeletal muscle satellite cells. A decrease in body temperature and body weight in both LW and MS pigs under cold stress, accompanied by increased shivering frequency and respiratory frequency. However, MS pigs demonstrated stable physiological homeostasis, indicating a certain level of cold adaptability. LW pigs primarily responded to cold stress by regulating heat production and Glycolipid energy metabolism. MS pigs exhibited a distinct response to cold stress, involving regulation of heat production, energy metabolism pathways, robust fatty acid oxidation ability, and stronger immune response. Furthermore, the functional exploration of PRSS8 in porcine skeletal muscle satellite cells revealed it affected cellular energy metabolism and thermogenesis by regulating ERK phosphorylation. These findings shed light on the diverse transcriptional responses of skeletal muscle in LW and MS pigs under cold stress, offering valuable insights into the molecular mechanisms underlying cold adaptation in pigs.

In recent years, many studies have reported that several distinct families of transcription factor (TF) genes play crucial roles in the response of plants to abiotic stress. Although some of these families got systematically studied in many species, little knowledge exists about these genes in oil palm (Elaeis guineensis Jacq.). In this study, 20 genes differentially expressed in the leaves of oil palm plants subjected to salinity or drought stress and encoding TFs belonging to four families of TFs - MYB, HD-ZIP, NF-Y, and HSFF - got selected for further characterization. The genes underwent a structural and functional annotation, besides having their RNA-Seq expression profile validated by the qPCR technique, and a correlation analysis of their response under both stresses got performed. The annotation analysis of the promoter region showed the presence of seven cis-acting elements, all already reported to be involved in plants' response to abiotic stress. The structural and functional characterization of the proteins encoded by the selected genes showed that some groups present patterns of conserved regions and are orthologs to genes already linked to salinity or drought resistance in other plant species. It was possible to confirm the RNA-Seq expression profile of 19 genes, only gene 4 showed the opposite response when using qPCR. Through correlation analysis, it was possible to observe a high level of similarity in the behavior of the 20 genes in response to drought or salinity stress, a behavior already reported in other species. The results presented here shed light on the role of 20 TFs in the leaves of young oil palm plants under severe levels of soil salinity or water deprivation. The high level of similarity in the molecular response to both stresses allowed the identification of genes that might grant strategies aiming to develop oil palm plants with a tolerance to both salinity and drought at once.

Rapeseed (Brassica napus L.) is a globally important oilseed crop with various uses, including consumption of its succulent stems as a seasonal vegetable, but its uniaxial branching habit limits the stem yield. Therefore, developing a multi-stem rapeseed variety has become increasingly crucial. In this study, a nature mutant of wild type from germplasm resources with stable inheritance of the multi-stem trait (MS) was obtained and showed abnormal shoot apical meristem (SAM) development and increased main stem number compared to WT. Histological and scanning electron microscopy analyses revealed multiple SAMs in the MS mutant, while only a single SAM was found in WT. Compared to WT, the mutant exhibited increased accumulation of cytokinins (CKs), transcriptome and RT-qPCR analyses showed the expression of genes involved in CK biosynthesis and metabolism pathways were altered in MS mutant. These findings provide insight into the mechanism of multiple main stems formation in Brassica napus L. and lay a theoretical foundation for breeding multi-main stem rapeseed vegetable varieties.

We performed a comprehensive analysis of angiosarcoma (AS) genomic biomarkers and their associations with the site of origin. We aimed to describe the genomic landscape of AS in a cohort of 143 cases of AS profiled by Caris Life Sciences. Data of Next Generation Sequencing (NGS) with a 592 gene panel was available for the entire cohort. Fifty-three cases had data of Whole Exome Sequencing (WES) which we used to study the microenvironment phenotype. Immuno-therapy (IO) response biomarkers: Tumor Mutation Burden (TMB), Microsatellite Instability (MSI) and PD-L1 status were included. IO-response markers were present in 36.4% of the cohort and in 65% of head and neck AS (H/N-AS) (p<0.0001). H/N-AS cases had predominantly muta-tions in TP53 (50.0%, p=0.0004), POT1 (40.5%, p<0.0001) and ARID1A (33.3%, p=0.5875). In breast AS, leading alterations were MYC amplification (63.3%, p<0.0001), HRAS (16.1%, p=0.0377), and PI3KCA (16.1%, p=0.2352). A microenvironment with a high immune signature, associated with better response to IO, was present in 13% of the cases. This signature was evenly distributed among different primary sites. We found that the molecular biology for AS varies significantly according to the primary site. Our findings can facilitate the design and optimiza-tion of therapeutic strategies for AS to overcome resistance to IO and targeted therapies.

In the last couple of years, the implementation of long-read sequencing (LRS) technologies for transcriptome profiling has uncovered an extreme complexity of viral gene expression. In this study, we carried out a systematic analysis on the pseudorabies virus transcriptome by combining our current data obtained by using Pacific Biosciences Sequel and Oxford Nanopore Technologies MinION sequencings with our earlier data generated by other LRS and short-read sequencing techniques. As a result, we identified a number of novel genes, transcripts, and transcript isoforms, including splice and length variants, and also confirmed earlier annotated RNA molecules. One of the major findings of this study is the discovery of a large number of 5’-truncated putative mRNAs embedded into larger host mRNAs. A large fraction of these RNA molecules contain in-frame ORFs, which may encode N-terminally truncated polypeptides. These study demonstrates that the PRV transcriptome is much more complex than previously appreciated.

Plants grown under fluctuating light impact plant developments compared with those grown under non-fluctuating light conditions. However, our knowledge on the underlying regulatory mechanisms is still quite limited, particularly from the transcriptional perspective. In order to investigate the influence of different light intensity distributions on tomato plant development, we designed three fluctuating light intensity distributions with the non-fluctuating light intensity as control and compared the transcriptional differences after five weeks of treatment. We found plant height and aerial/root weight were significantly reduced under all fluctuating light treatments. Transcriptome analysis revealed that the number of up and down regulated genes had a distinct distribution pattern between different treatments and control. The largest difference between the numbers of down and up regulated genes was found between treatment 1 and 3, reaching to a total of 416 genes. The number and type of the top 20 enriched pathways differed between treatments and control. The largest number of genes enriched was involved in the biosynthesis of secondary metabolites. These results provide insights into the transcriptional regulations of tomato under different light intensity distributions.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, are caused by a combination of multiple events that damage neuronal function. A well-characterized biomarker of neurodegeneration is proteinaceous aggregates accumulation in the brain. However, the gradually worsening symptoms of neurodegenerative diseases are unlikely to be solely due to the result of a mutation in a single gene, but rather a multi-step process involving epigenetic changes. Multiple epigenetic studies have revealed that modification of histones accompanied by both the local and global remodeling of the chromatin structure and alternations in transcriptional patterns are closely associated with the pathogenesis of neurodegenerative diseases. Unlike DNA mutations, epigenetic alterations are reversible, and therefore raise the possibilities for therapeutic intervention including dietary modifications. Additionally, reactive oxygen species may contribute to the pathogenesis of Alzheimer’s disease and Parkinson’s disease. Given that the antioxidant properties of plant-derived phytochemicals are likely to exhibit pleiotropic effects against ROS-mediated epigenetic alternation, dietary intervention may be promising for the management of neurodegeneration in these diseases. In this review, the state-of-the-art applications using single-cell multi-modal omics approaches including genetics, and epigenetics, and dietary approaches for the identification of novel biomarkers and therapeutic approaches for the treatment of neurodegenerative diseases are discussed.

Acanthamoeba keratitis (AK) is a blinding corneal infection caused by the protozoan Acanthamoeba. The long-term course of AK suggests the host immunity could not kill Acanthamoeba rapidly. The immune status is still unclear in the late stage of AK. The comparative transcriptome analysis was made based on the bulk RNA sequencing of cornea tissues from AK patients and donors. Differentially expressed genes and enriched signaling pathways were calculated. CIBERSORT algorithm was used for Immune infiltration analysis of cornea tissue between AK and normal controls. A total of 2668 differentially expressed genes, including 1477 upregulated genes and 1191 downregulated genes, were detected. Gene Ontology analysis revealed that the pathways were significantly enriched in leukocyte migration, regulation of T cell activation, the external side of plasma membrane, collagen-containing extracellular matrix, immune receptor activity and cytokine binding. KEGG pathway analysis showed that the pathways were significantly enriched in the cytokine-cytokine receptor interaction, hematopoietic cell lineage and Staphylococcus aureus infection pathway. The immune infiltration profiles varied little between AK and normal controls. Compared with normal tissue, cornea tissue of AK contained a higher proportion of M0 macrophages and CD8 T cells, while resting memory CD4 T cells contributed to a relatively lower portion (P &lt; 0.05). Finally, the expression levels of cell markers and SLAMF7/STAT6 pathway were confirmed by histopathology examinations, RT-qPCR and western blot.

Pre-implantation horse conceptuses require nutrients and signals from histotroph, the composition of which is regulated by luteal progesterone and conceptus-secreted factors. To distinguish progesterone and conceptus effects we shortened the period of endometrial progesterone-priming by asynchronous embryo transfer. Day 8 embryos were transferred to synchronous (day 8) or asynchronous (day 3) recipients, and RNA sequencing was performed on endometrium and conceptuses recovered 6 and 11 days later (embryo days 14 and 19). Asynchrony resulted in many more differentially expressed genes (DEGs) in conceptus membranes (3473) than endometrium (715). Gene ontology analysis identified upregulation in biological processes related to organogenesis and preventing apoptosis in synchronous conceptuses on day 14, and in cell adhesion and migration on day 19. Asynchrony also resulted in large numbers of DEGs related to ‘extracellular exosome’. In endometrium, genes involved in immunity, the inflammatory response, and apoptosis regulation were upregulated during synchronous pregnancy and, again, many genes related to extracellular exosome were differentially expressed. Interestingly, only 14 genes were differentially expressed in endometrium recovered 6 days after synchronous versus 11 days after asynchronous transfer (day 14 recipient in both). Among these, KNG1 and IGFBP3 were consistently up-regulated in synchronous endometrium. Furthermore bradykinin, an active peptide cleaved from KNG1, stimulated prostaglandin release by cultured trophectoderm cells. The horse conceptus thus responds to a negatively asynchronous uterus by extensively adjusting its transcriptome, whereas the endometrial transcriptome is modified only subtly by a more advanced conceptus.

Viroids are smallest pathogen that consist of non-capsidated, single-stranded non-coding RNA replicons and exploits host factors for their replication and propagation. The severe stunting disease caused by Citrus bark cracking viroid (CBCVd) is a serious threat, which spread rapidly within hop gardens. In this study, we employed comprehensive transcriptome analyses to dissect host-viroid interactions and identify gene expression changes associated with disease development in hop. Our analysis revealed that CBCVd-infection resulted in the massive modulation of activity of over 2000 genes. Expression of genes associated with plant immune responses (protein kinase and mitogen-activated protein kinase), hypersensitive responses, phytohormone signaling pathways, photosynthesis, pigment metabolism, protein metabolism, sugar metabolism and modification and others were altered, which could be attributed to systemic symptom development upon CBCVd-infection in hop. In addition, genes encoding RNA-dependent RNA polymerase, pathogenesis-related protein, chitinase as well as those related to basal defense responses were up-regulated. The expression levels of several genes identified from RNA sequencing analysis were confirmed by qRT-PCR. Our systematic comprehensive CBCVd-responsive transcriptome analysis provides a better understanding and insights into complex viroid-hop plant interaction. This information will assist further in the development of future measures for the prevention of CBCVd spread in hop fields.

A high intake of carbohydrates, associated with obesity, is one of the major causes of fatty liver disease in humans. This study investigated how high carbohydrate intake induces fatty liver disease in Blunt snout bream (Megalobrama amblycephala). Blunt snout bream were fed a high-carbohydrate diet (HCBD) for 60 days. Their growth indices were evaluated, and the transcriptomes, metabolites, biochemistry, and histology of their blood and livers were analyzed. The final weight, weight gain, specific growth rate, and feed conversion ratio were all higher in the HCBD group than in the control group, but not significantly so (P > 0.05). The hepatosomatic index (HSI) differed significantly in the two groups (P < 0.05), and the metabolomics results showed that a high carbohydrate intake induced significant increases in plasma α/β-glucose, succinate, and tyrosine, which could increase hepatic glycogen and triglyceride. Low levels of betaine were also found in the livers of the HCBD group. The histology and blood biochemistry results suggested abnormal liver, with excessive lipid accumulation and liver damage. A transcriptome analysis and quantitative reverse transcription–PCR (RT–qPCR) indicated that the expression of the factors INSR, IRS, PI3K, PDK, AKT, ACC, IL6, AP1, ChREBP-MLX, PEPCK, and FBP in the insulin signaling pathway was significantly upregulated and that of SOCS3, GSK3β, and AMPK significantly downregulated in the HCBD. This pattern is associated with the nonalcoholic fatty liver disease (NAFLD) pathway. This study extends our understanding of how high carbohydrate causes increased fat deposition in the liver, enhanced glycolysis (α/β-glucose) in the plasma, and reduced betaine in the liver. This leads to activation of hepatocyte insulin resistance and lipogenesis by regulating the expression of genes related to fatty liver disease.

Traditional methods for discovery and development of new drugs can be a very time-consuming and expensive process because it includes several stages such as compound identification, pre-clinical and clinical trials before the drug is approved by the US Food and Drug Administration (FDA). Therefore, drug repurposing, namely using currently FDA-approved drugs as therapeutics for other diseases than what they are originally prescribed for, is emerging to be a faster and more cost-effective alternative to current drug discovery methods. In this paper, we have described a three-step in silico protocol for analyzing transcriptomics data using online databases and bioinformatics tools for identifying potentially repurposable drugs. The efficacy of this protocol was evaluated by comparing its predictions with the findings of two case studies of recently reported repurposed drugs: HIV treating drug Zidovudine for the treatment of Dry Age-Related Macular Degeneration and the antidepressant Imipramine for Small-Cell Lung Carcinoma. The proposed protocol successfully identified the published findings, thus demonstrating the efficacy of this method. In addition, it also yielded several novel predictions that have not yet been published, including the finding that Imipramine could potentially treat Severe Acute Respiratory Syndrome (SARS), a disease that currently does not have any treatment or vaccine. Since this in-silico protocol is simple to use and does not require advanced computer skills, we believe any motivated participant with access to these databases and tools would be able to apply it to large datasets to identify other potentially repurposable drugs in the future.

Innovative strategies to control malaria are urgently needed. Exploring the interplay between the Plasmodium sp. parasites and host red blood cells (RBC) offers opportunities for novel antimalarial interventions. Pyruvate kinase deficiency (PKD), characterized by heightened 2,3-diphosphoglycerate (2,3-DPG) concentration, has been associated with protection against malaria. Elevated 2,3-DPG levels, a specific mammalian metabolite, may hinder glycolysis, prompting us to hypothesize its potential contribution to PKD-mediated protection. We investigated the impact of the extracellular supplementation of 2,3-DPG on the Plasmodium falciparum intraerythrocytic developmental cycle in vitro. Results showed an inhibition of parasite growth, resulting from significantly less progeny from 2,3-DPG-treated parasites. We analyzed differential gene expression and the transcriptomic profile of P. falciparum trophozoites, from in vitro cultures submitted or not submitted to the action of 2,3-DPG, using Nanopore Sequencing Technology. The presence of 2,3-DPG in the culture medium was associated to a significant differential expression of 71 genes, mostly associated to GO terms nucleic acid binding, transcription, or monoatomic anion channel. Further, several genes related to the cell cycle control were downregulated in treated parasites. These findings suggest that the presence of this RBC-specific glycolytic metabolite impact the expression of genes transcribed during the parasite trophozoite stage and the number of merozoites released from individual schizonts, which supports the potential role of 2,3-DPG in the mechanism of protection against malaria by PKD.

In recent years, frequent occurrences of low temperature disasters due to global climate change have significantly impacted the normal growth of crops. Research has indicated that inorganic selenium (which is more toxic) can not only enhance the effects of low temperature stress but also increase selenium content on plants; however, there is a scarcity of studies investigating the impacts of organic selenium and nano-selenium on crops. In order to investigate whether organic selenium and nano-selenium can enhance low-temperature tolerance and increase selenium content in pak choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), different concentrations (0, 5, 10, 20 mg L-1) of exogenous selenium were applied in this experiment to assess their effects on plant growth, nutritional quality and antioxidant properties. RNA-Seq technology was used to sequence the transcriptome of the leaves. Based on the transcriptome data, a Weighted Gene Co-expression Network Analysis (WGCNA) was employed to construct a network that associates with physiological traits related to stress resistance. Two highly correlated gene co-expression modules were identified, and within them, nine hub genes associated with endocytosis, antioxidant stress, absorption, transport, and metabolism of selenium were discovered. The results indicated that the beneficial effects on yield and total selenium content under low temperature were attributed to (1) protection of photosynthetic pigments for enhancing photosynthetic capacity by the up-regulation of LHca2, LHcb1, LHca1, LHcb4 in KEGG pathway: photosynthesis-antenna proteins; (2) activation of antioxidant system for efficient ROS homeostasis such as SOD, POD and CAT by the genes such as Superoxide dismutase, Monodehydroascorbate and (3) selenium absorption by endocytosis, seleninum transportation by ABC transporter gene family and selenium metabolism related genes such as Cysteine synthase, Glutaredoxin. These findings provide a foundation for further investigation into the molecular mechanisms underlying the effects of organic selenium and nano-selenium on cyanochloride production at low temperatures.

Cancer researchers are fascinated by the chemistry of diverse natural products which show exciting potential as anticancer agents. In this study, we aimed to investigate the anticancer properties of watermelon rind extract (WRE) by examining its effects on cell proliferation, apoptosis, senescence, and global gene expression in human renal cell adenocarcinoma cells (HRAC-769-P) in vitro. Our metabolome data analysis of WRE exhibited untargeted phyto-constituents and targeted citrulline (22.29 µg/mg). HRAC-769-P cells were cultured in RPMI-1640 media and treated with 22.4, 44.8, 67.2, 88.6, 112, 134.4, and 156.8 mg mL-1 for 24, 48, and 72 hrs. At 24 hrs after treatment, (88.6 mg ml-1 of WRE) cell proliferation significantly reduced, more than 34% compared to the control. Cell viability decreased 48 and 72 hours after treatment to 45% and 37%, respectively. We also examined poly caspase, SA-beta-galactosidase (SA-beta-gal), and wound healing activities using WRE. All treatments induced an early poly caspase response and a significant reduction in cell migration. Further, we analyzed the transcript profile of the cells grown at 44.8 mg ml-1 of WRE after 6 hours using RNA sequencing (RNAseq) analysis. We identified 186 differentially expressed genes (DEGs), including 149 upregulated genes and 37 downregulated genes, in cells treated with WRE compared to the control. The differentially expressed genes were associated with NF-Kappa B signaling and TNF pathways. Crucial apoptosis-related genes such as BMF, NPTX1, NFKBIA, NFKBIE, and NFKBID might induce intrinsic and extrinsic apoptosis. Another possible mechanism is a high quantity of citrulline may lead to induction of apoptosis by the production of increased nitric oxide. Hence, our study suggests the potential anticancer properties of WRE and provides insights into its effects on cellular processes and gene expression in HRAC-769-P cells.

Bromodomain (BRD)-containing proteins are involved in many biological processes, most notably epigenetic regulation of transcription, and BRD protein dysfunction has been linked to many diseases, including tumorigenesis. However, the role of BRD proteins in the pathogenesis of uterine fibroids (UFs) is entirely unknown. The present study aimed to determine the expression pattern of BRD9 protein in UFs and matching myometrium and further assess the impact of BRD9 inhibitors on UF phenotype and epigenetic/epitranscriptomic changes. Our studies demonstrated that the levels of BRD9 were significantly upregulated in UFs compared to matched myometrium, suggesting that the aberrant BRD protein expression may contribute to the pathogenesis of UFs. We then evaluated the potential roles of BRD9 using its specific inhibitor I-BRD9. Targeted inhibition of BRD9 suppressed the UF tumorigenesis with increased apoptosis and cell cycle arrest, decreased cell proliferation, and extracellular matrix deposition in UF cells. The latter is the key hallmark of UFs. Unbiased transcriptomic profiling coupled with downstream bioinformatics analysis further and extensively demonstrated that targeted inhibition of BRD9 impacted the cell cycle- and ECM-related biological pathways, reprogrammed the UF cell epigenome and epitranscriptome, and altered miRNA-mediated gene regulation in UFs. Taken together, our data support the critical role of BRD9 in UF cells and the strong interconnection between BRD9 and other pathways controlling the UF progression. Targeted inhibition of BRD proteins might provide a non-hormonal treatment option for this most common benign tumor in women of reproductive age.

The current classification of acute myeloid leukemia (AML) relies largely on genomic alterations. AML with mutated Nucleophosmin1 (NPM1-mut) is the largest of the genetically defined groups, involving about 30% of adult AMLs and is currently recognized as a distinct entity in the actual AML classifications. NPM1-mut AML usually occurs in de novo AML and is associated predominantly with a normal karyotype and relatively favorable prognosis. However, NPM1-mut AMLs are genetically, transcriptionally, and phenotypically heterogeneous. Furthermore, NPM1-mut is a clinically heterogenous group. Recent studies have in part clarified the consistent heterogeneities of these AMLs and have strongly supported the need for an additional stratification aiming to improve the therapeutic response of the different subgroups of NPM1-mut AML patients.

Following the central dogma of molecular biology, gene expression heterogeneity can aid in predicting and explaining the wide variety of protein products, functions, and, ultimately, heterogeneity in phenotypes. There is currently overlapping terminology used to describe the types of diversity in gene expression profiles, and overlooking these nuances can misrepresent important biological information. Here, we describe transcriptome diversity as a measure of the heterogeneity in 1) the expression of all genes within a sample or a single gene across samples in a population (gene-level diversity) or 2) the isoform-specific expression of a given gene (isoform-level diversity). We first overview modulators and quantification of transcriptome diversity at the gene level. Then, we discuss the role alternative splicing plays in driving transcript isoform-level diversity and how it can be quantified. Additionally, we overview computational resources for calculating gene-level and isoform-level diversity for high-throughput sequencing data. Finally, we discuss future applications of transcriptome diversity. This review provides a comprehensive overview of how gene expression diversity arises, and how measuring it determines a more complete picture of heterogeneity across proteins, cells, tissues, organisms, and species.

A recent paradigm shift in diagnostics of medulloblastoma allows the distinction of four major groups defined by genetic data rather than histology. This new molecular classification correlates better with prognosis and will allow better clinical management for therapies targeting druggable mutations, but also offers a new combination of monitoring tumor development in real-time and treatment response by sequential liquid biopsy. This review highlights recent developments after a century of milestones in neurosurgery, radio- and chemotherapy, but also controversial theories on the cell of origin, animal models and the use of liquid biopsy.

Crustacean hyaluronidases are 1 poorly understood both in terms of their enzymatic properties and in terms of their structural features. In this work, we have shown that the hepatopancreas homogenate of the red king crab has a hyaluronidase activity that is an order of magnitude higher than its commercial counterpart. Zymography revealed the hyaluronidase activity of the protein roughly from40 to 50 kDa relative to the molecular marker used in electrophoresis. Analysis of the hepatopancreas transcriptome revealed a hyaluronidase sequence with an expected molecular weight of 42.5 kDa. It turned out that the reaction of cleavage of hyaluronate in the presence of a homogenate proceeds by the mechanism of b-elimination, which is well known for bacterial hyaluronidases. Thus, a new hyaluronidase of higher eukaryotes was found and described, which is not integrated into the modern classification of hyaluronidases.

The Pashmina and Barbari are two famous goat breeds found in the wide areas of the Indo-Pak region. Pashmina is famous for its long hair-fiber (Cashmere) production while Barbari is not-selected for this trait. So, the mRNA expression profiling in the skin samples of both breeds would be an attractive and judicious approach for detecting putative genes involved in this valued trait. Here, we performed differential gene expression analysis on publicly available RNA-Seq data from both breeds. Out of 44,617,994 filtered reads of Pashmina and 55,995,999 of Barbari which are 76.48% and 73.69% mapped to the ARS1 reference transcriptome assembly respectively. A pairwise comparison of both breeds resulted in 47,159 normalized expressed transcripts while 8,414 transcripts are differentially expressed above the significant threshold. Among these, 4,788 are upregulated in Pashmina while 3,626 transcripts are upregulated in Barbari. Fifty-nine transcripts harbor 57 genes including 32 LOC genes and 24 are annotated genes which were selected on the basis of TMM counts > 500. Genes with ectopic expressions other than uncharacterized and LOC symbol genes are Keratins (KRT) and Keratin Associated Proteins (KRTAPs), CystatinA&6, TCHH, SPRR4, PPIA, SLC25A4, S100A11, DMKN, LOR, ANXA2, PRR9 and SFN. All of these genes are likely to be involved in keratinocyte differentiation, sulfur matrix proteins, dermal papilla cells, hair follicles proliferation, hair curvature, wool fiber diameter, hair transition, hair shaft differentiation and its keratinization. These differentially expressed reported genes are critically valuable for enhancing the quality and quantity of the pashmina fiber and overall breed improvement. This study will also provide important information on hair follicle differentiation for further enrichment analyses and introducing this valued trait to other goat breeds as well.

The eyes are the sense organs through we view the world around us, and the cornea is the transparent layer which covers the outer, visible part of the eye. It is known that the gene expression of corneal endothelium depends on age. And the expressed genes of the endothelium of cornea for pediatric samples is different than that of the adult samples. The purpose or objective of this study was to characterize human corneal endothelial cell (HCEnC) gene expression and differential gene expression and to detect the expressed genes mapped to chromosomal loci associated with some corneal endothelial dystrophies. Both upregulated and downregulated genes were analyzed. For this purpose, total RNA was isolated from ex vivo corneal endothelium taken from six pediatric and five adult corneas. The complementary DNA was hybridized to the Affymetrix GeneChip 1.1 ST array. The data analysis was performed using the Enrichr software for both upregulated and downregulated genes. These are described in more detail in the results and discussion section. This study uses bioinformatics tools to identify and analyse gene sets present in the transcriptome of the corneal endothelium, and tries to find out and observe the relation of the aging effect on the corneal endothelium gene expression. The human subjects had participated voluntarily and informed consent was obtained from all before carrying out any testing procedure. Proper guidelines from the hospital ethical committee were also followed and no harmful chemicals were used on the participants. This study simply aims to raise some awareness of the given topic among the local people so that they are better able to take informed choices about their health in the near future, and also so that they seek medical help when necessary and have no inhibitions in doing so.

Poa crymophila is a perennial, cold-tolerant, native grass species, widely distributed to the Qing-hai-Tibet Plateau. However, the molecular mechanism behind the cold stress tolerance and role of key regulatory genes and pathways of P. crymophila are poorly understood yet. Therefore, the present study investigated the physiological and transcriptome responses of P. crymophila’s roots, stems, and leaves under cold stress to explore the molecular mechanism of cold tolerance. Results of the present study suggested that cold stress significantly changed the physiologic characteristics of roots, stems, and leaves of P. crymophila. In addition, the transcriptome results showed that 4434, 8793, and 14942 differentially expressed genes (DEGs) were identified in roots, stems, and leaves, respectively; however, 464 DEGs were commonly identified in these three tissues. The Gene On-tology (GO) results showed that a large numbers of DEGs were significantly enriched in the pho-tosynthetic related categories in leaves. In addition, the “response to stimulus” category was sig-nificantly enriched in roots and stems. The Kyoto Encyclopedia of Genes and Genomes (KEGG) results showed that DEGs involved in “phenylpropanoid biosynthesis” were significantly enriched in roots, “photosynthesis” and “circadian rhythm-plant” pathways significantly enriched in stems and leaves, starch and sucrose metabolism, and galactose metabolism were pathways significantly enriched in three tissues. Weighted gene coexpression network analysis (WGCNA) identified Hub genes involved in P. crymophila cold response. This study provides new insights into the molecular mechanisms underlying the cold tolerance of P. crymophila belowground and aboveground tissues. In addition, specific genes involved in Ca2+ signaling, ROS scavenging system, hormones, circadian clock, photosynthesis, and transcription factors (TFs) were identified in P. crymophila. The identi-fication of key genes may provide valuable resources for further functional genomic and breeding studies.

Atrial fibrillation (AF) is a form of sustained cardiac arrhythmia and microRNAs (miRs) play crucial roles in pathophysiology of AF. To identify novel miR-mRNA pairs, we performed RNAseq from atrial biopsies of AF and non-AF patients. Differentially expressed miRs (11-down and 9-up) and mRNAs (95-up and 82-down) were identified and hierarchically clustered in a heat-map. Subsequently, GO, KEGG, and GSEA analyses were run to identify deregulated pathways. Then, miR targets were predicted in miRDB database, and a regulatory network of negatively correlated miR-mRNA pairs was constructed using Cytoscape. To select potential candidate genes from GSEA analysis, top-50 enriched genes in GSEA were overlaid with predicted targets of differentially deregulated miRs. Besides, protein-protein-interaction (PPI) network of enriched genes in GSEA was constructed, and subsequently GO and canonical pathway analyses were run for genes in PPI network. Our analyses showed that TNF-α, p53, EMT, and SYDECAN1 signaling were among the highly affected pathways in AF samples. SDC-1 (syndecan-1) was the top-enriched gene in p53, EMT, and SYDECAN1 signaling. Consistently, SDC-1 mRNA and protein levels were significantly higher in atrial samples of AF patients. Among negatively correlated miRs, miR-302b-3p was experimentally validated to suppress SDC-1 transcript levels. Overall, our results suggested that miR-302b-3p/SDC-1 axis may involve in pathogenesis of AF.

The aim of this study was to identify the differentially expressed genes (DEG) from the skeletal muscle and liver samples of animal model for metabolic diseases in human. To perform the study, the fatty acid (FA) profile and RNA sequencing (RNA-Seq) data of 35 samples of liver tissue (SOY1.5, n=17 and SOY3.0, n=18) and 36 samples of skeletal muscle (SOY1.5, n=18 and SOY3.0, n=18) of Large White pigs were analyzed. The FA profile of the tissues was modified by the diet, mainly those related to monounsaturated (MUFA) and polyunsaturated (PUFA) FA. The skeletal muscle transcriptome analysis revealed 45 DEG (FDR 10%), and the functional enrichment analysis identified network maps related to inflammation, immune process, and pathways associated with the oxidative stress, type 2 diabetes and metabolic dysfunction. For the liver tissue, the transcriptome profile analysis revealed 281 DEG, which participate in network maps related to neurodegenerative diseases. With this nutrigenomics study, we verified that different levels of soybean oil in the pig diet, an animal model for metabolic diseases in humans, affected the transcriptome profile of skeletal muscle and liver tissue. These findings may help to better understand the biological mechanisms that can be modulated by the diet.

Maternal obesity and gestational diabetes mellitus (GDM) are linked with impaired placental function and early onset of non-communicable cardiometabolic diseases in offspring. Previous studies have highlighted that the dietary non-esterified fatty acids (NEFAs), palmitate (PA) and oleate (OA), key dietary metabolites associated with maternal obesity and GDM, are potential modulators of placental lipid processing. Using the BeWo cell line model, the current study integrated transcriptomic (mRNA microarray), metabolomic, and lipidomic readouts to characterize the underlying impacts of exogenous PA and OA on placental villous trophoblast cell metabolism. Targeted gas chromatography and thin layer chromatography highlighted that saturated and monounsaturated NEFAs differentially impact BeWo cell lipid profiles. Furthermore, cellular lipid profiles differed when exposed to single and multiple NEFA species. Additional multi-omic analyses suggested that PA exposure is associated with enrichment in β-oxidation pathways, while OA exposure is associated with enrichment in anti-inflammatory and antioxidant pathways. Overall, this study further demonstrated that dietary PA and OA are important regulators of placental lipid metabolism. Encouraging appropriate dietary advise and implementing dietary interventions that maintain appropriate placental function by limiting excessive exposure to saturated NEFAs such as PA, will continue to be crucial in the clinical management of at-risk obese and GDM pregnancies.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with septic cardiomyopathy being a common and severe complication. Despite its significant clinical impact, the molecular mechanisms underlying sepsis-induced cardiomyopathy (SICM) remain incompletely understood. In this study, we performed a comparative analysis of whole transcriptome profiles in two widely used mouse models of septic cardiomyopathy, the cecal ligation and puncture (CLP) model and the lipopolysaccharide (LPS) model. Our aim was to identify key genes and pathways involved in the development of septic cardiomyopathy and to evaluate the similarities and differences between the two models. Our findings suggested that 1) both methods can induce septic heart dysfunction within 24 hours; 2) distinct whole transcriptome expression profiles are revealed; 3) potentially different pathways are involved in causing heart failure in sepsis. The comprehensive comparison provides valuable insights into the molecular basis of septic cardiomyopathy and contributes to the ongoing search for effective treatment strategies, triggered by different factors for SICM.

Genome-wide association studies (GWAS) have identified and reproduced thousands of diseases associated loci but many of them are not directly interpretable due to the strong linkage disequilibrium among variants. Transcriptome-wide association studies (TWAS) incorporated expression quantitative trait loci (eQTL) cohorts as reference panel to detect associations with the phenotype at the gene level and were gaining popularity in recent years. For nicotine addiction, several important susceptible genetic variants were identified by GWAS, but TWAS that detected genes associated with nicotine addiction and unveiled the underlying molecular mechanism were still lacking. In this study, we used eQTL data from the Genotype-Tissue Expression (GTEx) consortium as reference panel to conduct tissue specific TWAS on cigarettes per day (CPD) over 13 brain tissues in two large cohorts: UK Biobank (UKBB; N=142,202) and the GWAS &amp; Sequencing Consortium of Alcohol and Nicotine use (GSCAN; N=143,210), and then meta-analyzed the results across tissues while considering the heterogeneity across tissues. We identified three major clusters of genes with different meta-patterns across tissues consistent in both cohorts, including homogenous genes associated with CPD in all brain tissues, partially homogeneous genes associated with CPD in cortex, cerebellum and hippocampus tissues, and lastly the tissue-specific genes associated with CPD in only few specific brain tissues. Downstream enrichment analyses on each gene cluster identified unique biological pathways associated with CPD and provided important biological insights into the regulatory mechanism of nicotine dependence in the brain.

Potato is among one of the most important food crops, yet maintaining plant productivity in this drought-sensitive crop has become a challenge. Competition for scarce water resources and the continued effects of global warming exacerbate current constraints on crop production. While plants’ response to drought in above-ground tissues has been well documented, the regulatory cascades in developing tubers have been largely unexplored. Using the commercial Canadian cultivar ‘Vigor’, plants were subjected to a drought treatment under high-tunnels causing a 4 ℃ increase in canopy temperature when compared to the well-watered control. Tubers were sampled for RNAseq and metabolite analysis. Approximately 2600 genes and 3898 transcripts were differentially expressed by at least four-fold in drought-stressed potato tubers, with 75 % and 69 % being down-regulated respectively. A further 229 small RNAs were implicated in gene regulation during drought. The comparison of protein homologues between Solanum tuberosum L. and Arabidopsis thaliana L. indicates that downregulated genes are associated with phenylpropanoid, carotenoid, and patatin biosynthesis. This suggests that there may be nutritive implications to drought stress occurring during the potato tuber bulking phase in sensitive cultivars.

The New Zealand brushtail possum (Trichosurus vulpecula), introduced from Australia in the 1850s, is an invasive species that is widespread throughout New Zealand and forms the largest self-sustained reservoir of bovine tuberculosis (Mycobacterium bovis) in the wild. Conservation and agricultural authorities regularly apply a series of population control measures to suppress brushtail possum populations. The evolutionary consequence of more than half a century of intensive population control operations on the species genomic diversity and population structure is hindered by a paucity of available genomic resources for the species. This study is the first to characterise the functional content and diversity of brushtail possum liver and brain cerebral cortex transcriptomes. Raw sequences from hepatic cells and cerebral cortex were assembled into 58,001 and 64,735 transcripts in hepatic cells and cerebral cortex, respectively. Functional annotation and polymorphism assignment of the assembled transcripts demonstrated a considerable level of variation in the core metabolic pathways that represent potential targets for selection pressure exerted by chemical toxicants. This study suggests that the brushtail possum population in New Zealand harbours considerable levels of variation in metabolic pathways that could potentially promote the development of tolerance against chemical toxicants.

Prebiotic oligosaccharides are widely used as human and animal feed additives for their beneficial effects on the gut microbiota. However, there are limited data to assess the direct effect of such functional foods on the transcriptome of intestinal epithelial cells. The purpose of this study is to describe the differential transcriptomes and cellular pathways of colonic cells directly exposed to galacto-oligosaccharides (GOS) and fructo-oligosaccharides (FOS). We have examined the differential gene expression of polarized Caco-2 cells treated with GOS or FOS and their respective mock-treated cells using mRNA sequencing (RNA-seq). A total of 89 significant differentially expressed genes were identified between GOS and mock-treated groups. For FOS treatment, a reduced number of 12 significant genes were observed to be differentially expressed relative to the control group. KEGG and Gene Ontology functional analysis revealed that genes up-regulated in the presence of GOS were involved in digestion and absorption processes, fatty acids and steroids metabolism, potential antimicrobial proteins, energy-dependent and -independent transmembrane trafficking of solutes and amino acids. Using our data, we have established complementary non-prebiotic modes of action for these frequently used dietary fibers.

Combined awareness about the power and limitations of bioinformatics and molecular biology enables advanced research based on high-throughput data. Despite an increasing demand for scientists with a combined background in both fields, the education in dry lab and wet lab is often separated. This work describes an example of integrated education with focus on genomics and transcriptomics. Participants learn computational and molecular biology methods in the same practical course. Peer-review is applied as a teaching method to foster cooperative learning of students with heterogeneous backgrounds. Evaluation results indicate acceptance and appreciation of this approach.

In this study, a structural profiling of equid alphaherpesvirus 1 (EHV-1) transcriptome was carried out using next-generation (Illumina) and third-generation (Oxford Nanopore Technologies) sequencing platforms. We annotated the canonical mRNA molecules and their isoforms, including transcript start and end site isoforms, and splice variants. Additionally, a number of putative 5′-truncated mRNAs containing shorter in-frame ORFs were detected. We also demonstrated that EHV-1 produces a high number of non-coding transcripts, including antisense and intergenic RNAs. One of the most remarkable features of the EHV-1 is the generation of abundant fusion transcripts some of which encoding chimeric polypeptides. We observed a higher number of splicing and transcriptional overlaps than in related viruses. Additionally, we found that many upstream genes of tandem gene clusters have their own transcript end sites (TESs) besides the co-terminal TESs, which is rare in other alphaherpesviruses. We show here that the replication origins (OriS and OriL) of the virus are co-localized with promoter sequences and overlap with specific RNA molecules. Furthermore, we discovered a novel non-coding RNA (designated as NOIR) that overlaps the 5′-ends of the longer transcript variants encoded by the two main transactivator genes ORF64 and 65 bracketing the OriL. These all suggest the existence of a central regulatory system which controls the genome-wide transcription and the replication through a mechanism based on the interference between the machineries carrying out the synthesis of DNA and RNA.

Numerous dynamic and complicated processes characterize development from the oocyte to the embryo. However, given the importance of functional transcriptome profiles, long non-coding RNAs, single-nucleotide polymorphisms, and alternative splicing during embryonic development, the effect that these features have on the blastomeres of 2-, 4-, 8-, 16-cell, and morula stages of development have not been studied. Here, we conducted a scRNA-seq survey of cells from sheep from the oocyte to the blastocyst developmental stages. We then carried out experiments to identify and functionally analyze the transcriptome profiles, long non-coding RNAs, single-nucleotide polymorphisms (SNPs), and alternative splicing (AS). We founded that between the oocyte and zygote groups significantly down-regulated genes and the second-largest change in gene expression occurred between the 8- and 16-cell stages. We used various methods to construct a profile to characterize cellular and molecular features and systematically analyze the related GO and KEGG profile of cells of all stages from the oocyte to the blastocyst. This large-scale, single-cell atlas provides key cellular information and will likely assist clinical studies in improving preimplantation genetic diagnosis.

Ophelia syndrome is characterized by the coincidence of severe neuropsychiatric symptoms, classical Hodgkin lymphoma, and the presence of antibodies to the metabotropic glutamate 5 receptor (mGluR5). Little is known about the pathogenetic link between these symptoms and the role that anti-mGluR5-antibodies play. We investigated lymphoma tissue from patients with Ophelia syndrome and with isolated classical Hodgkin lymphoma by quantitative immunocytochemistry for mGluR5-expression. Further, we studied the L-1236, L-428, L-540, SUP-HD1, KM-H2, and HDLM-2 classical Hodgkin lymphoma cell lines by FACS and Western blot for mGluR5-expression, and by transcriptome analysis. mGluR5 surface expression differed significantly in terms of receptor density, distribution pattern, and percentage of positive cells. Highest expression levels were found in the L-1236 line. RNA-sequencing revealed more than 800 genes that were higher expressed in the L-1236 line in comparison to the other classical Hodgkin lymphoma cell lines. High mGluR5-expression was associated with upregulation of PI3K/AKT and MAPK pathways and of downstream targets (e.g. EGR1) known to be involved in classical Hodgkin lymphoma progression. Finally, mGluR5 expression was increased in the classical Hodgkin lymphoma-tissue of our Ophelia syndrome patient in contrast to five classical Hodgkin lymphoma-patients without autoimmune encephalitis. Given the association of encephalitis and classical Hodgkin lymphoma in Ophelia syndrome, it is possible that mGluR5-expression on classical Hodgkin lymphoma cells not only drives tumor progression but also triggers anti-mGluR5 encephalitis even before classical Hodgkin lymphoma becomes manifest.

Leishmania major is the main causative agent of cutaneous leishmaniasis in humans. The Friedlin strain of this species (LmjF) was chosen when a multi-laboratory consortium undertook the objective of deciphering the first genome sequence for a parasite of the genus Leishmania. The objective was successfully attained in 2005, and this represented a milestone for Leishmania molecular biology studies around the world. Although the LmjF genome sequence was done following a shotgun strategy and using classical Sanger sequencing, the results were excellent and this genome assembly served as the reference for subsequent genome assemblies in other Leishmania species. Here, we present a new assembly for the genome of this strain (named LMJFC for clarity), generated by the combination of two high throughput sequencing platforms, Illumina short-read sequencing and PacBio Single Molecular Real-Time (SMRT) sequencing, which provides long-read sequences. Apart from resolving uncertain nucleotide positions, several genomic regions have been reorganized and a more precise composition of tandemly repeated gene loci was attained. Additionally, the genome annotation has been improved by adding 542 genes and more accurate coding-sequences defined for around two hundred genes, based on the transcriptome delimitation also carried out in this work. As a result, we are providing gene models (including untranslated regions and introns) for 11,238 genes. Genomic information ultimately determines the biology of every organism; therefore, our understanding of molecular mechanisms will depend on the availability of precise genome sequences and accurate gene annotations. In this regards, this work is providing an improved genome sequence and updated transcriptome annotations for the reference L. major Friedlin strain.

Climate change-induced temperature fluctuations pose a significant threat to crop production, particularly in the Southern Hemisphere. This study investigates the transcriptome and physiological responses of rapeseed to post-flowering temperature increases, providing valuable insights into the molecular mechanisms underlying rapeseed tolerance to heat stress. Two rapeseed genotypes, Lumen and Solar, were assessed under control and heat stress conditions in field experiments conducted in Valdivia, Chile. Results showed that seed yield and seed number were negatively affected by heat stress, with genotype-specific responses. Lumen exhibited a 9.3% average seed yield reduction, while Solar showed a 28.7% reduction. RNA-seq analysis of siliques and seeds revealed tissue-specific responses to heat stress, with siliques being more sensitive to temperature stress. Hierarchical clustering analysis identified distinct gene clusters reflecting different aspects of heat stress adaptation in siliques, with a role for protein folding in maintaining silique development and seed quality under high temperature conditions. In seeds, three distinct patterns of heat-responsive gene expression were observed, with genes involved in protein folding and response to heat showing genotype-specific expression. Gene coexpression network analysis revealed major modules for rapeseed yield and quality, as well as the trade-off between seed number and seed weight. Overall, this study contributes to understanding the molecular mechanisms underlying rapeseed tolerance to heat stress and can inform crop improvement strategies targeting yield optimization under changing environmental conditions.

Truffles are ascomycete hypogeous fungi belonging to the Tuberaceae family of the Pezizales order that grow in ectomycorrhizal symbiosis with tree roots and are known for their peculiar aromas and flavors. Axenic culture of truffle mycelium is problematic because it is not possible in many cases, and the growth rate is meager when it is possible. This limitation prompts searching and characterizing new strains that can be handled in laboratory conditions for basic and applied studies. In this work, a new strain of Tuber borchii (strain SP1) has been isolated and cultured, and its transcriptome has been analyzed under different in vitro culture conditions. The results show that the best T. borchii SP1 growth was obtained using maltose-enriched cultures made with soft-agar and in static submerged cultures made at 22ºC. The transcriptome analysis of this strain cultured in different media indicated that most of the gene transcription effort is due to a limited number of genes (20% of genes account for 80% of the transcription), that the transcription profile of the central metabolism genes was similar in the different conditions analyzed with a transcription signal detected for around 80% of the annotated genes. The gene expression profile suggests that T. borchii uses a fermentative rather than respiratory metabolism, even in aerobic conditions. Finally, there is a reduced expression of genes belonging to secondary metabolite clusters, whereas there is a significative transcription of those involved in producing volatile aromatic compounds.

The transcriptional response of human blood leukocytes to SARS-CoV-2 infection was investigated focusing on the differences between mild and severe cases and between age subgroups. Weighted gene co-expression network analysis and comparative gene expression analysis were used. Three transcriptional modules positively associated with the traits of interest and their respective high hierarchy genes were identified. Enrichment analyses showed that the yellow module, associated with severe cases and older patients, had an overrepresentation of genes involved in inflammatory and innate immune responses, and neutrophil activation. The magenta and black modules, associated with disease severity and younger patients, contained genes related to innate immunity and inflammation and genes that regulate those responses. Subnetworks for these modules were constructed using genes enriched for innate immunity, inflammation, immunoregulation and differentially expressed genes (severe vs. mild). Their analysis evidenced that immunoregulatory functions are more activated in the modules associated with younger patients, what may help to explain the better disease course and faster recovery observed in younger COVID-19 patients. Comparative gene expression analysis between severe and mild groups, followed by gene enrichment and normalized gene expression analyses, revelated a set of 23 potential biomarkers for COVID-19 severity, of which 13 are newly described.

Alternative splicing (AS) is a gene regulatory mechanism modulating gene expression in multiple ways. AS is prevalent in all eukaryotes including plants. AS generates two or more mRNAs from the precursor mRNA (pre-mRNA) to regulate transcriptome complexity and proteome diversity. Advances in next-generation sequencing, omics technology and bioinformatics tools, and computational methods provide new opportunities to quantify and visualize AS-based quantitative trait variation associated with plant growth, development, reproduction, and stress tolerance. Domestication, polyploidization and environmental perturbation may evolve novel splicing variants associated with agronomically beneficial traits. To date, pre-mRNAs from many genes are spliced into multiple transcripts that cause phenotypic variation for complex traits, both in model plant Arabidopsis and field crops. Cataloguing and exploiting such variation may provide new paths to enhance climate resilience, resource-use efficiency, productivity, and nutritional quality of staple food crops. This review provides insights into AS variation alongside gene expression analysis to select for novel phenotypic diversity for use in breeding programs. AS contributes to heterosis, enhances plant symbiosis (mycorrhiza and rhizobium), and provides a mechanistic link between the core clock genes and diverse environmental clues.

The rapid expansion of transcriptomics from increased affordability of next-generation sequencing (NGS) technologies generates rocketing amounts of gene expression data across biology and medicine, and notably in cancer research. Concomitantly, many bioinformatics tools were developed to streamline gene expression analysis and quantification. We tested the concordance of NGS RNA sequencing (RNA-seq) analysis outcomes between the two predominant programs for reads alignment, HISAT2 and STAR, and the two most popular programs for quantifying gene expression in NGS experiments, edgeR and DESeq2, using RNA-seq data from a series of breast cancer progression specimens, which include histologically confirmed normal, early neoplasia, ductal carcinoma in situ and infiltrating ductal carcinoma samples microdissected from formalin fixed, paraffin embedded (FFPE) breast tissue blocks. We identified significant differences in aligners’ performance: HISAT2 was prone to misalign reads to retrogene genomic loci, STAR generated more precise alignments, especially for early neoplasia samples. edgeR and DESeq2 produced similar lists of differentially expressed genes in stage comparisons, with edgeR producing more conservative, though shorter, lists of genes. Albeit, Gene Ontology (GO) enrichment analysis revealed no skewness in significant GO categories identified among differentially expressed genes by edgeR vs DESeq2. As transcriptome analysis of archived FFPE samples becomes a vanguard of precision medicine, identification and fine-tuning of bioinformatics tools becomes critical for clinical research. Our results indicate that STAR and edgeR are well-suited tools for differential gene expression analysis from FFPE samples.

Stem/progenitor cell transplantation is a potential novel therapeutic strategy to induce angiogenesis in ischemic tissue, which can prevent major amputation in patients with advanced peripheral artery disease (PAD). Thus, clinicians can use cell therapies worldwide to treat PAD. However, some cell therapy studies did not report beneficial outcomes. Clinical researchers suggested that classical risk factors and comorbidities may adversely affect the efficacy of cell therapy. Some studies have indicated that the response to stem cell therapy varies among patients even in those harboring limited risk factors. This suggested the role of undetermined risk factors, including genetic alterations, somatic mutations, and clonal hematopoiesis. Personalized stem cell-based therapy can be developed by analyzing individual risk factors. These approaches must consider several clinical biomarkers and perform studies (such as genome-wide association studies (GWAS)) on disease-related genetic traits and integrate the findings with those of transcriptome-wide association studies (TWAS) and whole-genome sequencing in PAD. Additional unbiased analyses with state-of-the-art computational methods, such as machine learning-based patient stratification, are suited for predictions in clinical investigations. The integration of these complex approaches into a unified analysis procedure for the identification of responders and non-responders before stem cell therapy, which can decrease treatment expenditure, is a major challenge to increase the efficacy of therapies.