The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

The article considers a way to compare large bulks of experimental data with theoretical calculations, in which the quality of theoretical models is clearly demonstrated graphically. Published theoretical data of the three-fluid dynamic model (3FD) applied to the experimental data from heavy-ion collisions at the energy range \sqrt{s_{NN}} = 2.7 - 63 GeV are used as example of application of the developed methodology. When analyzing the results, the quantum nature of the fireball, created at heavy ion collisions, was taken into account.

With reference to Planck scale, Mach’s relation, increasing support for large scale cosmic anisotropy and preferred directions and by introducing two new parameters Gamma and Beta, right from the beginning of Planck scale, we make an attempt to estimate ordinary matter density ratio, dark matter density ratio, mass, radius, temperature, age and expansion velocity (from and about the baby universe in all directions). We would like suggest that, from the beginning of Planck scale, 1) Dark matter can be considered as a kind of cosmic foam responsible for formation of galaxies. 2) Cosmic angular velocity is directly proportional to squared cosmic temperature. 3) Ratio of critical temperature to actual temperature plays a heuristic role in understanding ordinary and dark matter density ratios. 4) Cosmic expansion velocity increases with decreasing total matter density ratio. 5) There is no need to consider dark energy for understanding cosmic acceleration.

With reference to Planck scale, Mach's relation and by introducing two new parameters Gamma and Beta, right from the beginning of Planck scale, we make an attempt to estimate ordinary matter density ratio, dark matter density ratio, mass, radius, temperature, age and expansion velocity (from and about the Planck mass in all directions). In analogy with currently believed cosmic acceleration, with a decreasing trend of total matter density ratio, cosmic expansion velocity can be shown to be increasing. By considering $H_0\cong 70$ km/sec/Mpc, estimated current cosmic mass, radius, total matter density, expansion velocity, temperature and age are: $4.3352\times {10}^{53}\mathrm{kg},$ $3.207\times {10}^{26}\mathrm{m},$ $3.138\times {10}^{-27}\mathrm{kg}{.\mathrm{m}}^{-3},$ $2.43c,$ $2.721\mathrm{K}$ and $19.78\mathrm{Billion}\mathrm{years}$ respectively. Point to be noted is that, with reference to Planck scale, cosmic temperature seems to be redshifted by a factor ${\left(Z_T\right)}_t\cong \sqrt{1+\ln \left(H_{pl}/H_t\right)}-1$ where $\left(H_{pl},H_t\right)$ represent Planck scale and time dependent Hubble parameters respectively. As a peculiar case, considering the equality of current Hubble parameter and current angular velocity, current cosmic rotational kinetic energy can be estimated to be 0.667 times the current critical energy. It needs further study.

The saturation properties of symmetric and asymmetric nuclear matter have been computed using the finite range simple effective interaction having Yukawa form-factor. The results of higher order derivatives of the energy per particle and the symmetry energy computed at saturation, namely, Q0, Ksym, Kτ, Qsym, are compared with the corresponding range of values extracted from studies involving theory, experiment and astrophysical observations. The ability of the equations of state computed with this simple effective interaction in predicting the threshold mass for prompt collapse in binary neutron star merger and gravitational redshift have been examined in terms of the compactness of the neutron star and the incompressibility at the central density of the maximum mass star. The correlations existing between neutron star properties with the nuclear matter saturation properties have been analyzed and compared with the predictions of other model calculations.

Since several years there is the discussion about dark matter in the halos of galaxies. This is aconsequence of observation of halo-velocity curves in dependence of distance which don‘t fulfillthe third Kepler-law. Maybe the ansätze are wrong. Shown is a simple physical model in classicalNewton-dynamics which fits qualitative the form of observation curves. Additional Parameters canbe used to fit the curves quantitative exactly without the hypothesis of dark matter.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

This study delves into the intricate relationships among the constituent elements, wave speed, and energy of both mechanical waves and electromagnetic waves. By establishing connections with the string vibration equation, a compelling revelation emerges. Upon equating the energy and constituent element mass of one wave cycle of a homogeneous string with those of a single wave cycle of electromagnetic waves, it is evident that the wave speed derived from the string vibration equation consistently matches the constant speed of light. From this, a hypothesis takes root: electromagnetic waves manifest as waves resulting from the vibration of a uniform, elongated string-like material. The phenomenon of superluminal speed further fortifies the validity of this conjecture.

An association between subtle changes in T2 white matter hyper-intense signals (WMHS) de-tected in fetal brain magnetic resonance imaging (fbMRI) and congenital cytomegalovirus (CMV) infection has been established. The research aim of this study is to compare children with congenital CMV infection with neurodevelopment outcome and hearing deficit with and with-out WMHS in a prospective historic cohort of 58 fbMRIs. Of these, WMHS was detected in 21. The median infection week of the WMHS group was earlier than the normal fbMRI group (8 and 17 weeks of gestation respectively). The proportion of infants treated with valganciclovir in the WMHS group was distinctly higher. Hearing impairment was not significantly different be-tween the groups. VABS scores in all 4 domains were within normal range in both groups. The median score of the motor skills corrected for week of infection was better in the WMHS group. A multivariate analysis using week of infection interaction variable of WMHS and valganciclo-vir treatment showed better motor score outcomes in the valganciclovir treatment group despite earlier week of infection. WMHS was not associated with neurodevelopmental outcome and hearing deficit. In our cohort valganciclovir treatment may have a protective effect on fetuses with WMHS by improving neurodevelopment outcome.

Polyhymnia (33 Polyhymnia) is a main belt asteroid in our solar system with a diameter of around 54km. The density of asteroid 33 Polyhymnia, located in the main asteroid belt, is calculated to be 75g/cc. Researchers have speculated the possibility that Polyhymnia could be composed of high-density superheavy elements near atomic number 164. Here we propose that Polyhymnia could be an asteroid composed of degenerate Dark Matter (DM) and there could be many such asteroids in our solar system (this is following our earlier work suggesting Planet Nine could be such an object).

This paper serves as a seamless continuation of the previous work titled "Special Spirals are Produced by the ROTASE Galactic Spiral Equations with the Sequential Prime Numbers." Upon revisiting the data, a noteworthy observation emerged: the special spirals can be meticulously aligned with the prime spiral on a point-by-point basis through careful scaling and rotation for the parameter ρ remaining a constant greater than one. As ρ increases, both the scaling factor and rotation angle exhibit a corresponding augmentation, albeit with an intriguing caveat—the rotation angle asymptotically approaches its limit of 90°. Notably, the galactic spiral can be perceived as a remarkably close approximation of the Archimedean spiral, with the degree of proximity increasing as ρ grows larger. Furthermore, an intriguing correspondence arises when ρ takes on a value of 1; at this value, the galactic spiral bears a striking resemblance to the Fermat spiral, the space between two consecutive spiral loops undergoes a continuous reduction as the loop's radius expands, yet it never diminishes to zero; simultaneously, the area between two successive loops experiences an augmentation with the value of ρ.

In this letter, we construct an effective field theory of gravity at large distances. We obtain to the leading order for large distances: a cosmological constant term and a logarithmic term in addition to the usual General Relativistic terms. The novel logarithmic term has important implications in explaining phenomena such as flat galactic rotation curves and stronger gravitational lensing than predicted that are generally attributed to the presence of dark matter.

The sedimentary characteristics of the special interlayer contained in the section of the Sparking Lake dam revealed by the 8.8 Jiuzhaigou earthquake in 2017 are obviously different from the tufa in the dam body, and they are considered to be prehistoric flood relics. Based on the study of the particulate matter from the 8.8 Jiuzhaigou earthquake, this paper combines comparative petrographic, mineralogical, geochemical and chronological studies of the special interbedded sediments of the Sparking Lake dam with other genetic samples to obtain homology information and genetic links, as well as to explore the tufa depositional dynamics and earthquake disaster subsidence. The palaeoseismic benefit in the discontinuity layer is explored, and the palaeoseismic information embedded in the profiles is extracted, providing a new idea to reconstruct the palaeoseismic events in the tufa deposition sequence. According to X-ray diffraction, laser particle size analysis and scanning electron microscope experiments, the particulate matter in the Jiuzhaigou mountains has its own specific mineralogical characteristics. The mineral composition of the particulate matter is basically calcite. The particle size is large, and the single particle is mostly angular and subangular. The fracture morphology observed under the single particle microscope is uneven, showing the characteristics of dust caused by earthquake disasters. Geochemical analysis data show that the provenance of various types of particles in the same area is stable, indicating the homology of terrestrial carbonate sedimentation in the karst system. Combined with mineralogy and grain size morphology, the interbedded particles in the tufa depositional profile have the potential application of palaeoseismic archives to record extreme seismic events. The palaeoseismic date was inferred from the chronological data of special interlayered sediments in the tufa dam body. Therefore, the tufa bedding can be related to the palaeoearthquake, and the special interlayer of the tufa section can be used to reconstruct palaeoearthquakes.

Dirac’s equation depicts electron mass as either positive or negative. Taken as correct description of nature, the equation identifies electron mass as ‘electrically active’ and therefore fundamentally different from the ordinary, ‘electrically passive’ mass. Following this cue, I demonstrate that electron mass (m_e) is the natural elementary mass: positive (m_e⁺) and negative (m_e^–) elementary masses neutralise to an elementary unit of the electrically passive mass (2m_e⁰). Further, I show that electron mass (m_e^± ) and the electrostatic field (e_f^±) surrounding it compose an elementary charge (e^±), thereby relating charge to mass. Two plain principles underlie these findings. 1) Electric charge and gravitational mass have a common root: positive (e⁺) and negative (e^–) charges coexist as neutral charge (2e⁰), which is the quantum of gravitational mass. 2) Charge is a static (nonrelativistic) ‘atom of electricity’ and obeys the laws of electrostatics; electron is the same ‘atom of electricity’ at ultrahigh (relativistic) speed and obeys the laws of electrodynamics. That is, charges are electricity at rest; electrons are electricity in motion – ‘same physical entities two behavioural identities.’ A decisive proof that this paradigm shift correctly portrays is that it verifiably unifies Newton’s law of gravity and Coulomb’s law of electrostatics to: 8G/m_pm_e = K/e²; where G and K are the respective constants, m_p the proton mass, m_e the electron mass, and e the elementary charge. Ultimately, the insights simplify matter to pure ‘atoms’ of positive and negative electricity.

The extremely high rotation of some SMBHs is the origin of their relativistic rotational energy that results in their relativistic mass. Relativistic mass creates their relativistic gravity which is a partial answer to the missing dark matter.

Here, I present an alternate solution for the dark matter problem. I show that the stars of a galaxy’s arm attract each other with a force other than gravity, producing a chain of stars. We already have an abundance of data (ring and multiring galaxies) as proof for the existence of this strong stars’ chain. This attraction force does not end at the galaxy’s boundaries but gets deeper into the cosmos, and it may explain the dark-energy problem. This attraction force affects only stars and seems to have no effect on planets. I also offer a novel timeline order for the well-known galaxies using Hubble classification. I nominate entangled particles for the role that causes this phenomenon.

Particulate matter (PM) represents an air quality management challenge for confined swine production systems. Because of the limited space and ventilation rate, PM can reach relatively high concentrations in swine barns. PM in swine barns possesses different physical, chemical, and biological characteristics than that in the atmosphere and other indoor environments. As a result, it exerts different environmental and health effects and creates some unique challenges regarding PM measurement and mitigation. Numerous research efforts have been made, generating massive data and information. However, relevant review reports are sporadic. This study aims to provide an updated comprehensive review of swine barn PM, focusing on publications since 1990. It covers various topics, including PM characteristics, sources, measurement methods, and in-barn mitigation technologies. Since PM in swine barns is of primarily biological origins, bioaerosols are reviewed in great detail. Relevant topics include bacterial/fungal counts, viruses, microbial community composition, antibiotic-resistant bacteria, antibiotic resistance genes, endotoxins, and (1→3)-β-D-glucans. For each topic, existing knowledge is summarized and discussed and knowledge gaps are identified. Overall, PM in swine barns is complicated in chemical and biological composition and highly variable in mass concentrations, size, and microbial abundance. Feed, feces, and skins constitute the major PM sources. Regarding in-barn PM mitigation, four technologies (oil/water sprinkling, ionization, alternation of feed and feeders, and recirculating air filtration) are dominant. However, none of them have been widely used in commercial barns. A collective discussion of major knowledge gaps and future research needs is offered at the end of the report.

In this paper we investigate how the Reionization process is affected by early galaxy formation in different cosmological scenarios. We use a semi-analytic model with suppressed initial power spectra to obtain the UV Luminosity Function in thermal Warm Dark Matter and sterile neutrino cosmologies. We retrace the ionization history of intergalactic medium with hot stellar emission only, exploiting fixed and variable photons escape fraction models ( fesc). For each cosmology, we find an upper limit to fixed fesc, which guarantees the completion of the process at z <6.7. The analysis is tested with two limit hypothesis on high-z ionized hydrogen volume fraction, comparing our predictions with observational results.

The search for dark matter is one the hottest topics in Physics today. The fact that about 80% of the matter of the Universe is of unknown nature has triggered an intense experimental activity to detect such kind of matter and a no less intense effort on the theory side to explain it. Given the fact that we do not know well the properties of dark matter, searches from different fronts are mandatory. Neutrino telescopes are part of this experimental quest and offer specific advantages. Among the targets to look for dark matter, the Sun and the Galactic Center are the most promising ones. Neutrino telescopes have put the best limits on spin-dependent cross section of proton-WIMP scattering. Moreover, they are competitive in the constraints on the thermally averaged annihilation cross-section for high WIMP masses when looking at the Galactic Centre. Other results are also reviewed.

Background: Exposure in utero to particulate matter (PM2.5 and PM10) is associated with maladaptive health outcomes. Although exposure to prenatal PM2.5 and PM10 have cord blood DNA methylation signatures at birth, signature persistence into childhood and saliva cross-tissue applicability has not been tested. Methods: In the Fragile Families and Child Wellbeing Study, a United States 20-city birth cohort, average residential PM2.5 and PM10 during pregnancy was estimated using air quality monitors with inverse distance weighting. Saliva DNA methylation at ages 9 (n=749) and 15 (n=793) was measured using the Illumina HumanMethylation 450k BeadArray. Cumulative DNA methylation scores for particulate matter were estimated by weighting participant DNA methylation at each site by meta-analysis effect estimates from Gruzieva et al. 2019 and standardizing the sums. Using mixed effects regression analysis, we tested the associations between cumulative DNA methylation scores at ages 9 and 15 and PM exposure during pregnancy, adjusted for child sex, age, race/ethnicity, maternal income to needs ratio, nonmartial birth status, and saliva cell type proportions. Results: Our study sample was 50.5% male, 56.3% non-Hispanic Black, and 19.8% Hispanic, with median income to needs ratio of 1.4. In the third trimester, mean PM2.5 exposure levels were 27.9 ug/m3/day (standard deviation: 7.0, 23.7% of observations exceeded safety standards) and PM10 were 15.0 ug/m3/day (standard deviation: 3.1). An interquartile range increase in PM2.5 exposure (10.73 g/m3/day) was associated with -0.0287 standard deviation lower cumulative DNA methylation score for PM2.5 (95% CI: -0.0732, 0.0158, p=0.20) across all participants. An interquartile range increase in PM10 exposure (3.20 g/m3/day) was associated with -0.1472 standard deviation lower cumulative DNA methylation score for PM10 (95% CI: -0.3038, 0.0095, p=0.06) across all participants. The PM10 findings were driven by the age 15 subset where an interquartile range increase in PM10 exposure was associated with -0.024 standard deviation lower cumulative DNA methylation score for PM10 (95% CI: -0.043, -0.005, p=0.012). Findings were robust to adjustment for PM exposure at ages 1 and 3. Conclusion: In utero PM10 associated DNA methylation differences persist until age 15 and can be detected in saliva. Benchmarking the persistence and cell type generalizability is critical for epigenetic exposure biomarker assessment.

In this paper, after reviewing some of the most important concepts about Dark Matter and methods of its registration, in particular by using SQUIDs, a toy uniform model for Dark Matter and Dark Energy is proposed. In the frame of the model Dark Matter particles is interpreted as an excitation of Dark Energy field. The devices based on SQUID, in particular the SQUID-paramagnetic absorber and the SQUID-magnetostrictor systems, both suitable for investigations of above problems, are considered. Estimates, is carried out within this model, indicate the possibility of experimental detection of the "ether wind" pressure, created by the non-corpuscular incoming flow, corresponding to the galactic orbital motion of the Earth.

White matter hyperintensity (WMH) has been considered the primary biomarker from small-vessel cerebrovascular disease to Alzheimer’s disease (AD) and has been reported for its correlation of brain structural changes. To perform WMH related analysis with brain structure, both T1-weighted (T1w) and (Fluid Attenuated Inversion Recovery(FLAIR) are required. However, in a clinical situation, it is limited to obtain 3D T1w and FLAIR images simultaneously. Also, the most of brain segmentation technique supports 3D T1w only. Therefore, we introduced the semi-supervised learning method that can perform brain segmentation using FLAIR image only. Our method achieved a dice overlap score of 0.86 for brain tissue segmentation on FLAIR, with the relative volume difference between T1w and FLAIR segmentation under 4.8%, which is just as reliable as the segmentation done by its paired T1w image. We believe our semi-supervised learning method has a great potential to be used to other MRI sequences and provide encouragement to people who seek brain tissue segmentation from a non-T1w image.

Here we propose a modification of the gravitational field on large scales as an alternate explanation for the discrepancy in the value of the Hubble constant as implied by Planck observations of the CMBR in the early Universe and that deduced from other distance indicators in the present epoch.

The acceleration of the universe is described as a consequence of the extrinsic curvature of the space-time embedded in a bulk space, defined by the Einstein-Hilbert. Using the linear approximation of Nash-Green theorem, we obtain the related perturbed equations in which just the gravitational-tensor field equations contribute to propagation of cosmological perturbations. In accordance with Big Bang Nucleosynthesis and solar constraints, we calculate numerically the effective Newtonian function Geff to constrain the related parameters of the model. We numerically solve the growth density equation for two possible family of solutions leading to an interesting overdensity and, in some cases, a mild damping of the growth profiles, with a top amplification of the growth perturbations around 14% in comparison with LCDM model and quintessence. The effective gravitational Phi and Newtonian curvature Psi are also analysed showing mild perturbations in early times induced only by the extrinsic curvature differently from the LambdaCDM standards.

Abstract: Cancer survivors are at an increased risk for cardiovascular disease (CVD). However, the association between particulate matter (PM) and CVD risk among cancer survivors (alive >5 years since diagnosis) is unclear. We investigated the risk of CVD among 40,899 cancer survivors within the Korean National Health Insurance Service database. Exposure to PM was determined by assessing yearly average PM levels obtained from the Air Korea database from 2008 to 2011. PMs with sizes <2.5 (PM2.5), <10 (PM10), or 2.5-10 (PM2.5-10) μm in diameter were compared, with each PM level exposure further divided into quintiles. Patients were followed up from January 2012 to date of CVD event, death, or December 2017, whichever came earliest. Adjusted hazard ratios (aHRs) and 95% confidence intervals (CIs) for CVD were calculated using Cox proportional hazards regression by PM exposure levels. Compared with cancer survivors in the lowest quintile of PM2.5 exposure, those within the highest quintile had a greater risk for CVD (aHR 1.31, 95% CI 1.07-1.59). Conversely, increasing PM10 and PM2.5-10 levels were not associated with increased CVD risk (p for trend 0.078 and 0.361, respectively). Cancer survivors who reduce PM2.5 exposure may reduce their risk of developing CVD.

Because Newton's gravity and Einstein's general theory of relativity are macroscopic gravitational theories, therefore, this paper attempts to establish a set of quantum gravity theory of the microscopic expression of Newton's and Einstein's theory of gravity to make up for the shortcomings of the existing macro-gravity theory at the micro level, and further develop the macroscopic gravity theory into the microscopic field. Based on the cognition of the field theory model, from the general assumption, space-time is further regarded as an ideal fluid, from the perspective of the distribution of ideal fluid density, this paper derives the Newton's universal gravitational equation and Einstein's general relativity equation. On the micro level, the gravitational field is further interpreted as a gradient field of space-time density; the Newtonian potential is further interpreted as the density of an object at the micro level; gravity is further interpreted as the potential pressure(space-time pressure) exhibited by the gradient of the density of the object at the micro level; flection space-time is further interpreted as the embodiment of the gradient distribution of the ideal fluid (space-time) density at the micro level. Based on a modified gravitational model, it explains the dynamics of the stars' rotation and revolution.

In this study the data of the OPERA and MINOS experiments, together with those related to the SN1987A supernova, are discussed in the context of the recent theories proposed for the superluminal muon neutrino. It is proved that for the models in which the Lorentz symmetry is violated, the decay mechanism leading to neutrino oscillation becomes possible. Within this framework, a new model based on the Hartman effect is proposed, according to which the neutrino becomes superluminal by quantum tunnelling, crossing a potential barrier generated by its interaction with the earth's crust matter. This model does not violate the Lorentz symmetry since the tachyonic state is generated by the quantum fluctuation of the neutrino initial energy, even if it requires to conjecture the presence of a quantum field that we ascribe to be that due to dark matter. In this model all superluminal neutrino decay mechanisms proposed in other studies are allowed. The hypothetical boson mediating the interaction between neutrino and dark matter is also discussed.

The human virome is an area of increasing interest with relation to human health and disease. It has been demonstrated to alter in concert with the bacterial microbiome in early life and was also found to be different in patients with certain diseases such as inflammatory bowel disease. However, all virome analyses are hampered by a lack of annotated representative database sequences, often referred to as the ‘viral dark matter’. Here we provide the first description of the gut DNA virome in elderly individuals (>65 years old) as well as the description of novel bacteriophages not present in current reference databases. Diversity analysis comparing elderly persons from different residence locations (community living vs long term care facilities) did not reveal any difference in their virome diversity profiles despite the reported differences at the bacteriome level. An abundance of Microviridae of the subfamily Gokushovirinae were present in the faeces of elderly individuals. Several novel members of the order Caudovirales were also characterized and annotated. Assignment of host bacteria to detected viral genomes was attempted using a combination of CRISPR spacers, tRNA genes and a probabilistic approach. Further characterization of the viral dark matter is necessary for developing tools and expanding databases to study the human virome. This study focused on the virome of an aging human cohort with the goal of illuminating part of the viral dark matter.

Satellite-based monitoring can retrieve ground-level PM_2.5 concentrations with higher-resolution and continuous spatial coverage to assist in making management strategies and estimating health exposures. The Sichuan Basin has a complex terrain and several city clusters that differ from other regions in China: it has an enclosed air basin with a unique planetary boundary layer dynamic which accumulates air pollution. The spatiotemporal distribution of 1-km resolution Aerosol Optical Depth (AOD) in the Sichuan Basin was retrieved using the improved dark pixel method and Moderate Resolution Imaging Spectroradiometer (MODIS) data in this study. The retrieved seasonal AOD reached its highest values in spring and had the lowest values in autumn. The higher correlation (r = 0.84, N = 171) between the ground-based Lidar AOD and 1-km resolution MODIS AOD indicated that the high-resolution MODIS AOD could be used to retrieve the ground-level PM_2.5 concentration. The Lidar-measured annual average extinction coefficient increased linearly with the Planetary Boundary Layer Height (PBLH) in the range of 100 ~ 670 m, but exponentially decreased between the heights of 670 ~ 1800 m. Both the correlation and the variation tendency of simulated PBLH from WRF_SHIN/CALMET were closer to the Lidar observation than that of three other Planetary Boundary Layer (PBL) schemes (the Grenier-Bretherton-McCaa (GBM) scheme, the he Total Energy-Mass Flux (TEMF) scheme and the University of Washington (UW) scheme), which suggested that the simulated PBLH could be used in the vertical correction of retrieval PM_2.5. Four seasonal fitting functions were also obtained for further humidity correction. The correlation coefficient between the aerosol extinction coefficient and the fitted surface-level PM_2.5 concentration at the benchmark station of Southwest Jiao-tong University was enhanced significantly from 0.62 to 0.76 after vertical and humidity corrections during a whole year. During the evaluation of the retrieved ground-level PM_2.5 with observed values from three cities, Yibin (YB), Dazhou (DZ), and Deyang (DY), our algorithm performed well, resulting in higher correlation coefficients of 0.78 (N = 177), 0.77 (N = 178), and 0.81 (N = 181), respectively.

It is shown that Verlinde’s hypothetical concepts of entropic gravity can be successfully applied to the author’s previous work on the modification of the Newtonian gravity by Einstein’s Cosmological Constant. It allows a theoretical justification for Milgrom’s empirical acceleration constant, thereby revealing some fundamental differences with Verlinde’s conclusions.

We are encouraged to look beyond ɅCDM as there are no satisfactory explanations for either dark energy or dark matter. A data centred phenomenological approach supports an explanation where dark energy is Holographic Dark Information Energy, HDIE. HDIE explains many effects attributed separately to Ʌ and CDM. HDIE mimics Ʌ with sufficient energy and an equation of state parameter, w= -1.03±0.05 at redshifts z<1.35 to account for accelerating expansion. HDIE is clumped around galaxies at densities that distort space-time, explaining many CDM attributed effects. The present ratio of HDIE/baryons ~2.15, required for the observed expansion history, is equivalent to a dark matter fraction ~68%, consistent with many galaxies. The HDIE/baryon model is based largely on proven physics, provides a common explanation for dark energy and dark matter, and solves the cosmological coincidence problem. At earlier times, z > ~1.35, HDIE was phantom, w = -1.82±0.08, enabling the model to be falsified. HDIE fits Planck dark energy wo-wa plots at least as well as Ʌ, and is consistent with other results that suggest dark energy was phantom at earlier times. A new w-parameterisation is proposed, as the usual CPL parameterisation is biased and unsuitable for distinguishing between HDIE/baryon and ɅCDM models.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

The experiment was conducted to evaluate the effect of seed and fertilizer rates on biomass yield and other agronomic treats of two oat varieties (Bona-bas and Bate) at the Kuyu sub-site of Fitche Agricultural Research Center in 2022. Four levels of Nitrogen fertilizer rates (0, 23, 46, and 69 kg ha-1) and three levels of seed rates (60, 80, and 100 kg ha-1) with two oat varieties (Bona-bas and Bate) were using randomized complete block design in factorial arrangement with three replications. Soil samples before and after were collected and analyzed. The analysis of soil samples before planting indicated that the soil pH was strongly acidic (5.16) and after harvest, it raised to a strongly acidic level (5.29). The interaction effect of varieties, seed rates, and fertilizer rates showed highly significant (p<0.001) variation on the number of tillers per plant, leaf area per plant, leaf-to-stem ratio, fresh biomass yield, dry matter yield, days to maturity, and seed yield. The treatment combination of Bona-bas: FR46:SR100 has produced the highest dry matter yield (5.1 t/ha), followed by Bona-bas: FR46:SR60 and Bona-bas: FR69:SR80 which produced the same value of 4.9 t/ha dry matter yield. This study recommends that for the better agronomic performance of oat varieties, 46 kgha-1 N of fertilizer with 60 kgha-1 of seed rate is preferable to use by farmers in the study area and other areas having similar agroecologies and soil types. In addition, it is essential to conduct the year-over location to confirm the present findings and the result needs to be supported with animal evaluation trials.

Inhaled particulate matter (PM) is a key player in the millions of yearly deaths worldwide related to air pollution. The oxidative potential of PM provides an indication of its ability to promote an oxidative environment. When the human lungs are exposed to PM, the reactive oxygen species (ROS) generated in such oxidative environment, if excessive, may lead to cell damage via oxidative stress. Inflammation, endoplasmic reticulum stress, airway remodeling, and many different cell death modes (apoptosis, ferroptosis, pyroptosis, among others) can be triggered by oxidative stress via complex molecular pathways, which also involve the adaptive cellular response. But ROS can also directly interact with macromolecules such as proteins and lipids, as well as nucleic acids, having been reported to induce DNA damage and epigenetic modifications, which jeopardizes homeostasis. These facts have been extensively studied in in vitro models and confirmed in in vivo models.In this review, we delve beyond conventional assessments of airborne particles, discussing their oxidative potential and the PM-induced ROS-mediated cellular damage observed in in vitro models. The close link between oxidative stress and inflammation, and the manifestation of different cell death modes is highlighted by reviewing the latest literature. The effects of ROS on the balance of DNA damage and repair, carcinogenicity and epigenetics interplay are then analyzed. Finally, we expand on the latest reports on the antioxidants’ potential to counteract the deleterious effects of ROS, and disclose future perspectives for the topic.

This review delves into the pivotal role of green manure in advancing agricultural sustainability and enhancing soil fertility. It emphasizes the wide-ranging ecological benefits of green manure practices, particularly in tropical regions, where it fosters multiple biological processes such as nitrogen fixation and nutrient cycling. The text provides an in-depth exploration of specific green manure species, their characteristics, practical considerations, and the physical, biological, and chemical effects they have on soil. It also discusses the practical implementation of green manure techniques, including cropping, intercropping, and strip or alley cultivation. The study emphasizes the critical need for species selection and effective green manure management, shedding light on their profound impact on crop productivity and environmental sustainability. With comprehensive details on various species and their practical implications, the study offers a comprehensive understanding of green manure's potential as an alternative source to mineral fertilizers in tropical agriculture.

In the realm of cement production, clinker-producing factories emerge as both energy and material-intensive entities, emitting a substantial array of primary pollutants into the environment compared to their non-clinker producing counterparts. Our study delves into Ethiopian clinker-producing cement factories, unraveling the concentration of primary pollutants and their repercussions on neighboring communities. Venturing beyond mere statistics, we meticulously measured particulate matter (PM2.5 and PM10) and gaseous emissions (CO2, N2O, SO2) at various units within the cement factories and in nearby residential areas. The findings reveal an ambient air quality riddled with concern; PM2.5 levels ranged from 137 to 814 μg/m3, PM10 from 195 to 886 μg/m3 within the cement factories, and PM2.5 (113 to 196 μg/m3) and PM10 (125 to 453 μg/m3) in the adjacent village. Alarmingly, these particulate matter emissions exceeded the limits set by Ethiopian ambient air quality guidelines (150 μg/m3). Unraveling the health implications, respiratory diseases were notably high among individuals aged 25 to 60, followed closely by those aged 6 to 24. In contrast, the age groups 0–5 and > 61 exhibited lesser susceptibility, as infants and the elderly spent more time at home, thus reducing exposure to emissions. Our study underscores the urgent need for legal measures, calling for the establishment of buffer zones between cement factories and settlements. This proactive step, if enforced, holds the promise of mitigating cement particulate emissions and safeguarding the well-being of communities residing in proximity to these industrial giants.

Recent theory of tachyon neutrinos, providing an explanation for Dark Matter, leads to two sets of experiments for testing that theory. One predicts an enhanced signal in detection of the Cosmic Neutrino Background. The other compares models of Dark Matter used to fit data on galaxy rotation curves and also gravitational lensing. In addition, an apparent contradiction within the new theory, related to Dark Energy, is identified and addressed.

The adoption of sustainable forest management practices emerged as a contemporary imperative for forest biodiversity preservation, functional integrity, and mitigation of climate change. Within the spectrum of these practices, thinning is recognized as an environmentally sustainable strategy. The primary objective of thinning is the equitable redistribution of aboveground growth, diverting resources from younger trees to promote the accelerated development of more valuable specimens compared to unthinned forests. Thinning, while fostering aboveground changes, induces substantial alterations in soil chemical and biochemical properties. This review addresses the often-debated consequences of thinning on soil characteristics, focusing on the intricate interplay involving different thinning intensities and their impact on soil chemical and biochemical parameters. Specifically, the analysis delves into the modulation of organic carbon levels, microbial biomass, and enzymes crucial to the organic matter cycle. Two key aspects are scrutinized: firstly, the influence of thinning intensity and the temporal dimension post-thinning on soil properties; secondly, the comparative impact of thinning intensity versus the time elapsed from the thinning event on soil properties and associated biological processes. The findings underscore pivotal insights: a) temporal dynamics significantly affect soil organic matter across broadleaved (excluding beech), coniferous, and mixed forests, manifesting as early as 2-7 years post-thinning; b) thinning intensity, up to a threshold of 50%, enhances soil quality by augmenting organic carbon content, bolstering microbial communities, and amplifying associated enzyme activities. This review consolidates valuable information for forest managers, providing guidance to optimize natural processes in tandem with achieving specific management objectives. By illuminating the nuanced interactions between thinning practices and soil dynamics, this knowledge equips stakeholders to make informed decisions in the pursuit of sustainable forest management and ecological resilience.

The creation of protonated water nanoclusters from amorphous water-ice under laboratory conditions suggests the possible ejection of such nanoclusters from ubiquitous amorphous water-ice-covered cosmic dust to interstellar space. The quantum properties of these quintessential water entities introduce a tantalizing prospect that bridges the origins of dark matter, dark energy, and life in the universe. The quantum-entangled diffuse Rydberg electronic states inherent to cosmic water nanoclusters make them plausible candidates for baryonic dark matter. Moreover, they exhibit the capacity to absorb, through the microscopic dynamical Casimir effect, virtual photons originating from zero-point-energy vacuum fluctuations occurring above the water-nanocluster vibrational frequency cutoff. This selective interaction leaves only vacuum fluctuations below these frequencies with gravitational significance, cancelling the vacuum-energy catastrophe and yielding a shared genesis for dark matter and dark energy. Moreover, this theory extends its implications to the origins of life itself, proposing that RNA protocells on Earth and habitable exoplanets may have emerged from the interactions between cosmic water nanoclusters and prebiotic organic molecules, thus yielding an anthropic narrative. Collectively, these findings coalesce into a cosmological framework depicting a cyclic universe, with cosmic water nanoclusters constituting a quintessence scalar field, instead of adhering to the multiverse concept based on cosmic inflation theory. Recent observations of CMB birefringence support this quintessence.

This article investigates the unexpected re-emergence of race in both the rhetoric and activities of the British radical-right. In doing so it seeks to better understand the reasons why race has re-emerged, how race has been contemporarily deployed by the radical-right, and the extent to which the re-emergence of race will force the radical right’s recent ideological focus on religion – more specifically, the religion of Islam and Muslims as adherents – begin to retreat. It does this first by setting out the methods and approaches used throughout. From here, necessary and appropriate context is provided about the British radical-right generally and the decades old ideological turn more specifically. Next, the circumstances and reasons for the re-emergence of race are critically engaged: focusing on the immediate aftermath of 2020’s Black Lives Matter protests as also the wider socio-political landscape of contemporary Britain. Taking into account both established and newly formed groups and movements from within the British radical right, the role and function played by race is considered next. As part of this, an in-depth analysis of the role and function of race in the rhetoric and activities of Patriotic Alternative is included. In conclusion, this article reflects on a number of arguments about why the re-emergence of race among the British radical-right is - albeit to varying degrees - a cause for concern.

The sugar company Valdez S.A. Entity located within the geographical limits of the city of Milagro, needs to reduce its emissions to the environment and does not always comply with the air emissions standards for stationary combustion sources, which indicates that for equipment installed before 2003 they have a maximum limit of 300 mg / m³. A mist eliminator was designed to work inside the original wet gas scrubber of the water-tube cauldron #10, which uses Bagasse as fuel, for the generation of steam for industrial use. The research is documentary and field. The methodology used was mixed. focusing on the comparison of three types of technologies to meet the objectives, the fog eliminators types: Demister, Cyclone and Chevron. To find the appropriate complement, a comparison sheet was made, which is a table of contents evaluated quantitatively, analyzing indicators formulated in each of the contents. The results, supported by the Multiple Criteria Decision Analysis methodology, select the Chevron type fog eliminator, with the best efficiency for capture. Using AutoCAD, allows to visualize in 3D, the structural design in the gas scrubber.

Eicheon properties are discussed. It is shown that the eicheon surface allows setting a boundary condition for the vacuum polarization and obtaining a solution describing the dark matter tail in the Milky Way. That is, the dark matter in the Milky Way is explained as the F-type of vacuum polarization, which could be treated as dark radiation. The model presented is spherically symmetric, but a surface density of a baryonic galaxy disk is taken into account approximately by smearing the disk over a sphere. This allows the reproduction of the large distance shape of the Milky Way rotational curve. Andromeda's rotational curves are also discussed.

It has been suggested that primordial planets could have formed in the early Universe and the missing baryons in the Universe could be explained by primordial free-floating planets of solid hydrogen. Many such planets were recently discovered around the old and metal poor stars and such planets could have formed at early epochs. Another possibility for missing baryons in the Universe could be that these baryons are admixed with DM particles inside the primordial planets. Here we discuss the possibility of admixture of baryons to the DM primordial planets discussed earlier. We consider gravitationally bound DM objects with the DM particles constituting them varying in mass from 20 to100GeV. Different fractions of DM particles mixed with baryonic matter in forming the primordial planets are discussed. For the different mass range of DM particles forming DM planets, we have estimated the radius and density of these planets with different fractions of DM and baryonic particles. It is found that for heavier mass DM particles with the admixture of certain fractions of baryonic particles, the mass of the planet increases and can reach or even substantially exceed Jupiter-mass. The energy released during the process of merger of such primordial planets is discussed. Also the energy required for the tidal breakup of such an object in the vicinity of a black hole is also discussed.

The origin of an anomalous excess of high-energy (about 100 GeV and higher) positrons in cosmic rays is one of the rare problems in this field which is proposed to be solved with dark matter (DM). Attempts to solve this problem are faced with the issue of having to satisfy the data on cosmic positrons and cosmic gamma-radiation, which inevitably accompanies positron production such as FSR (final state radiation), simultaneously. We have been trying to come up with a solution by means of two approaches: making assumptions (*) about the spatial distribution of the dark matter, and (**) about the physics of its interactions. This work is some small final step of a big investigation regarding the search for gamma suppression by employing the second approach and a model with a doubly charged particle decaying into two positrons (X++→e+e+) is suggested as the most prospective one from those considered before.

Keywords:

The white wine industry generates a large amount of wastes and composting is an alternative for recycling these residues with agronomic and environmental advantages. With this aim, grape marc and grape stalks were composted in static and turned piles, with 3 and 6 turns, to investigate the effects of pile conditions during composting in order to improve final compost quality. Thermophilic temperatures were attained soon after pile construction, and the highest maximum temperatures were achieved in the turned piles (70.5-71.8 ºC). However, pile moisture content decreased bellow recommended values after day 42 in these piles. The extremely high temperatures and low moisture content in turned piles hampered OM mineralization rates and the amount of potentially mineralizable organic matter (OM0) (391-407 g kg-1), whereas the structure of the static pile provided adequate porosity to increase OM decomposition and OM0 (568 g kg-1). This study shows that composting grape marc with stalks, for a period of 140 days, resulted in stabilized and matured compost (NH4+-N / NO3--N &lt;0.5), with good chemical characteristics for application as soil organic amendment in vineyards, without the need for rewetting or turning the piles, thus reducing the agronomic, and environmental cost of the composting process.

To evaluate the nutrient load due to the grazing of laying hens in outdoor runs, soil characteristics were monitored in three Italian organic farms. For each farm, soil samples were taken from three increasing distances from the hen house and two depths and different chemical parameters were evaluated. The comparison among the results from the different distances shows that N-NO3 and Olsen P are the most affected parameters by hen faeces: both present high values with a statistically significant difference in the area close to the poultry house and for the most superficial layer. Even TKN and TOC show significant differences between the concentrations of the first layer (more concentrated) and those of the second layer (less concentrated). In general, the surface soil layer closest to the chicken house is the portion of the outdoor run most affected by chicken droppings and represents the most critical point in terms of potential environmental impact. Therefore, it is necessary to intensify the management of the outdoor run with tools that can facilitate the grazing of animals and with vegetation that can absorb nutrients by limiting leaching and run-off.

We considered a vacuum polarization around a massive object in the eikonal approximation and found two types of vacuum polarization. The first type has the equation of state similar to radiation and can produce a halo that increases the rotation velocity of a test particle with a radial distance. The second type of vacuum polarization has a more complicated equation of state. As a static physical effect, it produces renormalization of the gravitational constant. Besides, we demonstrate that a nonstationary polarization of the second type caused by a swift increase of the galactic nuclei mass results in a gravitational potential looking like a dark matter halo.

It is proven that the Clapeyron-Mendeleev equation, originally discovered for gases with large entropy, describes the state of dark matter and energy due to enormous self-gravitation. It is shown that the dark matter exists as compact cold neutrino stars at positive temperature with size twice the Schwarzschild radius. In contrast, the dark energy is dark matter at temperature below the absolute zero, which is locked entirely in black holes, where the pressure is negative as required for the Universe intrinsic expansion. The derived dark phase diagram predicts negative critical temperatures for the Big Bang and the Big Rip of black holes.

Among the many neglected underutilized species, tuberous Andean root crops like the ahipas (Pachyrhizus ahipa) constitute a promising alternative for increasing diversity in nutrient sources and food security at a regional level. In this study, we present the content of some functional compounds in tuberous roots from several ahipa accessions and the progenies of the interspecific hybrid X207 (P. ahipa × P. tuberosus). A significant objective was to determine protein and free amino acids in the roots to evaluate their food quality as protein supply. The interspecific hybrids have been found to possess the root quality to provide the crop with a higher dry matter content. The high dry matter content of the P. tuberosus Chuin materials is retained in the root quality of the hybrids. Food functional components like carbohydrates, organic acids, and proteins were determined in several ahipa accessions and a stable (non-segregating) progeny of the interspecific hybrid, X207. The X207 roots showed a significantly higher dry matter content and a lower content in soluble sugars, but no significant differences were found in starch content or organic acids compared to the ahipa accessions. About the root mineral contents, Fe and Mn concentrations in X207 were significantly raised compared to the average of ahipa accessions. Among the ahipa and the hybrid, no prominent differences in protein content or protein amino acids were found, being both partially defective in providing sufficient daily intake of some essential amino acids. Root weight, a central component of root yield, was significantly higher in X207, but thorough field studies are required to substantiate the hybrid’s superior yield performance..

The Mediterranean region offers good weather conditions for outdoor pig production (OPP), which is considered more environmentally friendly than intensive indoor production. However, the continuous input of food and pigs' excreta increases the soil organic matter (SOM) and phosphorus (P), increasing the risk of waterbodies eutrophication. This work aimed at evaluating in OPP areas soil P dynamics and the role of SOM on P sorption and P release. The experiment was done for two years, at an area of 2.8 ha with an animal charge of 9 adults ha-1. Georeferenced soil samples were taken at 0.20 m depth, and a soil P sorption experiment was carried out. At the end of the experiment, for the background value, the levels of SOM increased between 85–376%, and Olsen P values ranged between -82–884%. SOM levels above 2% caused a decrease in the binding energy of P sorption according to the linear model b=-15.541SOM+115.20 (p <0.01) as well as a decrease of the soil P sorption capacity Qmax=-41.272SOM+298.37 (p <0.01). To avoid the accumulation of SOM and P preventing hotspots for waterbodies eutrophication, an adequate animal charge together with soil cultivation for pig grazing can be a cost-effective practice.

Many models with structures of matter associated with a structure of extra spatial dimensions have been proposed in recent decades. On employing a further generalisation from the local 4-dimensional spacetime form to a general form for proper time, we describe how matter fields resembling the Standard Model of particle physics can be accommodated far more directly than with a higher-dimensional spacetime theory. The successful identification of key features of visible matter in this non-spatial sector of extra dimensions in turn motivates seeking a candidate for dark matter residing in the original extra spatial dimension sector, and provides a close guide for the explicit form this invisible matter might take. We describe how such Standard Model and dark matter sectors in different extra-dimensional branches of generalised proper time are gravitationally connected through their common root in the local 4-dimensional spacetime and consider further possible mutual interactions and implications in comparison with existing dark matter models. A yet further possible branch of generalised proper time can be connected with dark energy models, hence in principle accounting for all three major components of cosmological structure within this framework.

When dealing with galactic dynamics, or more specifically, with galactic rotation curves, one basic assumption is always taken: the frame of reference relative to which the rotational velocities are given is assumed to be inertial. In other words, fictitious forces are assumed to vanish relative to the observational frame of a given galaxy. It might be interesting, however, to explore the outcomes of dropping that assumption; that is, to search for signatures of non-inertial behavior in the observed data. In this work, we show that the very discrepancy in galaxy rotation curves could be attributed to non-inertial effects. We derive a model for spiral galaxies that takes into account the possible influence of fictitious forces and find that the additional terms in the new model, due to fictitious forces, closely resemble dark halo profiles. Following this result, we apply the new model to a wide sample of galaxies, spanning a large range of luminosities and radii. It turns out that the new model accurately reproduces the structures of the rotation curves and provides very good fittings to the data.

Today, air quality is one of the global concerns that governments are facing. One of the main air pollutants is the particulate matter (PM) that affects human health. This article presents the modeling of a purification system by means of negative air ions (NAIs) for air pollutant removal, using computational intelligence methods. The system uses a high voltage booster output to ionize air molecules from stainless steel electrodes; its particle-capturing efficiency reaches up to 97%. With two devices (5 x 2 x 2.5 cm), 2 trillion negative ions are produced per second, and the particulate matter (PM 2.5) can be reduced from 999 to 0 mg / m3 in a period of approximately 5 to 7 minutes (in a 40 x 40 x 40 cm acrylic chamber). This negative ion generator is a viable and sustainable alternative to reduce polluting emissions, with beneficial effects on human health.

The dynamical processes of living systems are characterized by the cooperative interaction of many units. This claim enables us to portray the embryo-fetal development of the central and peripheral nervous systems in terms of assemblies of building blocks. We describe how the structure and arrangement of nervous fibers is - at least partially - dictated by biophysical and topological constraints. The far-flung field of soft-matter polymers/nematic colloids sheds new light on the neurulation in mammalian embryos, suggesting an intriguing testable hypothesis: the development of the central and peripheral nervous systems might be correlated with the occurrence of local thermal changes in embryo-fetal tissues. Further, we show a correlation between the fullerene-like arrangement of the cortical microcolumns and the Frank-Kasper phases of artificial quasicrystals assemblies. The last, but not the least, we explain how and why the multisynaptic ascending nervous fibers connecting the peripheral receptors to the neocortical areas can be viewed as the real counterpart of mathematical tools such as knot theory and braid groups. Their group structure and generator operations point towards a novel approach to long-standing questions concerning human sensation and perception, leading to the suggestion that the very arrangement and intermingling of the peripheral nervous fibers contributes to the cortical brain activity. In touch with the old claims of D’Arcy Thompson, we conclude that the arrangement and the pattern make the function in a variety of biological instances, leading to countless testable hypotheses.

In this paper, we investigate the ontological hypothesis, which implies that the spacetime is not the ultimate structure in our universe, and its existence emerges from a deeper physical entity. By using a very simple approach based on a classical problem, regarding the propagation of electromagnetic waves in empty vacuum. We were able to deduce that this deeper entity is just an omnipresent multi-rest states physical structure; aether. After that, we try to see how this aether fits in the universe that we exist in. The outcome is that its existence causes the emergence of some basic phenomena that our universe is built on. At the microscopic scale it turned out to be a source of the essential quantum phenomenon, which is currently known as the wave – particle duality. On the other hand, at the macroscopic scale it causes the emergence of spacetime curvature, around huge, massive objects like Earth, and finally, we try to visualize the prospects of aether, and how it can be a promising alternative for the dark matter.

As climate changes, our daily life has been much influenced by abnormal meteorological phenomena such as heavy rainfall, heat wave, heavy snowfall, and fine dust. Atmospheric air quality is worsening day by day and indoor air quality is also affected by interconnected daily activities throughout the inside and outside of buildings and houses. Nowadays, pollutants from various sources are emitted, transformed by sunlight, vapor, and ozone and transported into the city from country to country. Due to these reasons, there have been high demands to monitor the transportation of particulate matters and improve air quality. Monitoring of pollutants and identification of type and its concentration enables us to track and control its generation and consequently find out the solution. However, monitoring of pollutants, especially, particulate matter generation and its transportation is still not fully operated in atmospheric air due to its open nature and meteorological factors. Even though indoor air is relatively easy to monitor and control than outdoor in the aspect of specific volume and contaminant source, but it still needs to consider the meteorological parameters because indoor air is not fully separated from the outdoor air flow and contaminants transportation. In this study, optical approach using spectral sensor was attempted to reveal the feasibility of wavelength and chromaticity values of reflected light from specific particles. From the analysis of reflected light of various particulate matters according to different liquid additives, parameter studies were performed to investigate which experimental conditions can contribute to the enhanced selective sensing of particulate matters. Five different particulate matters such as household dust, soil, talc powder, gypsum powder and yellow pine tree pollen were utilized and observed to elucidate the relationship between property of particulate matter and detected light spectrum. Applicable approaches to assist current particle matter sensors and improve the selective sensing were suggested.