Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

TomoBreast hypothesized that hypofractionated 15 fractions/3 weeks image-guided radiation therapy (H-IGRT) can reduce lung-heart toxicity, as compared with normofractionated 25-33 fractions/5-7 weeks conventional radiation therapy (CRT). 123 women with stage I-II operated breast cancer were randomized to receive CRT (N=64) or H-IGRT (N=59). The primary endpoint used a four-items measure of the time to 10% alteration in any of patient self-reported measure, physician clinical evaluation, echocardiography or lung function tests, analyzed by intention-to-treat without exclusion. Results found comparable survivals, but H-IGRT significantly reduced the toxicity measured by lung diffusion capacity and alveolar volume as compared with CRT, G1 in 53% (31/59) versus 72% (44/61) patients, P=0.006; G2, 29% versus 48%, P=0.020. H-IGRT significantly reduced the risk of composite cardio-pulmonary alteration at 5 years, 10.2% versus 26.7%, P=0.024. In conclusion, TomoBreast is a proof-of-concept that image-guided radiation-therapy can improve the overall balance of lung-heart outcomes in breast cancer adjuvant therapy. Furthermore, the significance of the findings supports the efficacy of a small trial size design, which can be critical when clinical research resources are limited.

Novel strategies have been developed to reduce or to avoid the intravitreal injections (IVTs) of the antiangiogenic (ranibizumab; RBZ) and the anti-inflammatory (triamcinolone acetonide; TA) agents used to treat vitreoretinal diseases. One of the strategies include liposomes. In this study, it was evaluated the safety and efficacy of topical triamcinolone-loaded liposomes formulation (TALF) as an adjuvant to intravitreal RBZ therapy in treatment-naive patients with neovascular age related macular degeneration (nAMD). Subjects were randomly assigned to the RBZ-TALF or the RBZ-pro re nata (RBZ-PRN) group. Patients from the RBZ-TALF group were instructed to apply TALF for a 12-month period after a single dose of RBZ. Patients from the RBZ-PRN group received three monthly RBZ-IVTs. Retreatment with RBZ was considered in case of nAMD reactivation. Related to safety, non-ocular abnormalities were observed during TALF therapy. Owing to the efficacy, non-significant differences are identified in visual acuity or central foveal thickness when the RBZ-PRN and RBZ-TALF groups are compared. Importantly the average number of RBZ injections was significantly lower in the RBZ-TALF group (2.5 ± 1.4 vs 6.1 ± 1.3 IVTs; p=0004). Therefore, TALF used as an adjuvant to RBZ reduce the number of RBZ-IVTs retreatment with optimal visual and anatomic results.

As Automated Driving Systems (ADS) technology gets assimilated into the market, the driver’s obligation will be changed to a supervisory role. A key point to consider is the driver’s engagement in the secondary task to maintain the driver/user in the control loop. The paper’s objective is to monitor driver engagement with a game and identify any impacts the task has on hazard recognition. We designed a driving simulation using Unity3D and incorporated three tasks: No-task, AR-Video, and AR-Game tasks. The driver engaged in an AR object interception game while monitoring the road for threatening road scenarios. From the results, there was less than 1 second difference between the means of gaming task (mean = 2.55s, std = 0.1002s) to no-task (mean = 2.55s, std = 0.1002s). Game scoring followed three profiles/phases: learning, saturation, and decline profile. From the profiles, it is possible to quantify/infer drivers’ engagement with the game task. The paper proposes alternative monitoring that has utility, i.e., entertaining the user. Further experiments AR-Game focusing on real-world car environment will be performed to confirm the performance following the recommendations derived from the current test.

Aging is accompanied by frontal lobe and non-dominant hemisphere recruitment that supports executive functioning, such as inhibitory control, which is crucial to all cognitive functions. Yet, the spatio-temporal sequence of processing underlying successful inhibition and how it changes with age is understudied. Thus, we assessed N200 (conflict monitoring) and P300 (response inhibition, performance evaluation) event-related potentials (ERPs) in young and healthy older adults during comparably performed successful stop-signal inhibition. We additionally interrogated the continuous spatio-temporal dynamics of N200- and P300-related activation within each group. Young adults had left hemisphere dominant N200, while older adults had overall larger amplitudes and right hemisphere dominance. N200 activation was biphasic in both groups but differed in scalp topography. P300 also differed, with larger right amplitudes in young, but bilateral amplitudes in old, with old larger than young in the left hemisphere. P300 was characterized by an early parieto-occipital peak in both groups, followed by a parietal slow wave only in older adults. A temporally similar but topographically different final wave followed in both groups that showed anterior recruitment in older adults. These findings illuminate differential age-related spatio-temporal recruitment patterns for conflict monitoring and response inhibition that are critically important for understanding age-related compensatory activation.

This study aims to develop a performance evaluation system that can facilitate performance evaluation at region, hospital, and department levels to enable better cost management for sustainable development. A multi-level system of performance evaluation informs a hierarchical assessment of cost management from regions to hospitals to departments using diagnosis-related group (DRGs). Various metrics are developed employing the variances between targets and actuals where targets are determined from two perspectives: benchmarking using external regional prices and change management using internal data. Targets for the latter are statistically based and specifically incorporate variability. The model is applied to two hospitals, twenty departments, nine DRGs and 1071 inpatients. The analyses indicate that the approach can provide a practical evaluation tool that allows for particular characteristics at multiple levels. The system provides macro-micro and external-internal perspectives in performance, enabling high-level variances to be decomposed thereby identifying sources of performance variability and financial impact.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centered on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese and to individualize the interventions, with a focus from weight change to individual's overall well-being.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centred on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese.

Telecommuting is a flexible form of work that has progressively spread over the last 40 years and which has been strongly encouraged by the measures to limit the Covid19 pandemic. There is still limited evi-dence on the effects it has on workers' health. In this survey we invited 905 workers of companies that made a limited use of telework to fill out a questionnaire to evaluate: Intrusive leadership of managers (IL), the request for work outside traditional hours (OFF-TAJD), workaholism (BWAS), effort / reward imbalance (ERI), happiness and common mental issues (CMIs), anxiety and depression, assessed by the Goldberg scale (GADS). The interaction between these variables has been studied by structural equation modeling (SEM). Intrusive leadership and working after hours were significantly associated with occu-pational stress. Workaholism is a relevant moderator of this interaction: intrusive leadership significantly increased the stress of workaholic workers. Intrusive leadership and overtime work were associated with reduced happiness, anxiety and depression. These results indicate the need to guarantee the right to disconnect, to limit the effect of the OFF-TAJD. In addition to this, companies should implement policies to prevent intrusive leadership and workaholism.

Machine Learning (ML) approaches have been fruitfully applied to several classification problems of neurophysiological activity. Considering the relevance of emotion in human cognition and behaviour, ML found an important application field in emotion identification based on neurophysiological activity. Nonetheless, the literature results present a high variability depending on the neuronal activity measurement, the signal features and the classifier type. The present work aims to provide new methodological insight on ML applied to emotion identification based on electrophysiological brain activity. For this reason, we recorded EEG activity while emotional stimuli, high and low arousal (auditory and visual) were provided to a group of healthy participants. Our target signal to classify was the pre-stimulus onset brain activity. Classification performance of three different classifiers (LDA, SVM and kNN) was compared using both spectral and temporal features. Furthermore, we also contrasted the classifiers performance with static and dynamic (time evolving) features. The results show a clear increased in classification accuracy with temporal dynamic features. In particular, the SVM classifiers with temporal features showed the best accuracy (63.8 %) in classifying high vs. low arousal auditory stimuli.

The Japanese Association for Acute Medicine Committee recently proposed a novel classification system for the severity of heat-related illnesses. The illnesses are simply classified into three stages based on symptoms and management or treatment. Stages I, II, and III broadly correspond to heat cramp and syncope, heat exhaustion, and heat stroke, respectively. Our objective was to examine whether this novel severity classification is useful in the diagnosis by healthcare professionals of patients with severe heat-related illness and organ failure. A nationwide surveillance study of heat-related illnesses was conducted between June 1 and September 30, 2012, at emergency departments in Japan. Among the 2130 patients who attended 102 emergency departments, the severity of their heat-related illness was recorded for 1799 patients, who were included in this study. In the patients with heat cramp and syncope or heat exhaustion (but not heat stroke), the blood test data (alanine aminotransferase, creatinine, blood urea nitrogen, and platelet counts) for those classified as stage III were significantly higher than those of patients classified as stage I or II. There were no deaths among the patients classified as stage I. This novel classification may avoid underestimating the severity of heat-related illness.

Background: Appendicular skeletal muscle (or lean) mass (ALM) estimated using dual-energy X-ray absorptiometry (DXA) is considered to be a preferred method for sarcopenia studies. However, DXA is expensive, has limited portability, and requires radiation exposure. Bioelectrical impedance analysis (BIA) is inexpensive, easy to use, and portable; thus BIA might be useful in sarcopenia investigations. However, a large variety of models have been commercially supplied by different companies, and for most consumer products, the equations estimating ALM are not disclosed. It is therefore difficult to use these equations for research purposes. In particular, the BIA equation is often age-dependent, which leads to fundamental difficulty in examining age-related ALM loss. The aims of the current study were as follows: (1) to develop and validate an equation to estimate ALM using multi-frequency BIA (MF-BIA) based on theoretical models, and (2) to establish sarcopenia cutoff values using the equation for the Japanese population. Methods: We measured height (Ht), weight, and ALM obtained using DXA and a standing-posture 8-electrode MF-BIA (5, 50, 250 kHz) in 756 Japanese individuals aged 18 to 86-years-old (222 men and 301 women as developing equation group and 97 men and 136 women as a cross validation group). The traditional impedance index (Ht²/Z₅₀) and impedance ratio of high and low frequency (Z₂₅₀/Z₅) of hand to foot values were calculated. Multiple regression analyses were conducted with ALM as dependent variable in men and women separately. Results: We created the following equations: ALM = (0.6947 × (Ht²/Z₅₀)) + (−55.24 × (Z₂₅₀/Z₅)) + (−10,940 × (1/Z₅₀)) + 51.33 for men, and ALM = (0.6144 × (Ht²/Z₅₀)) + (−36.61 × (Z₂₅₀/Z₅)) + (−9332 × (1/Z₅₀)) + 37.91 for women. Additionally, we conducted measurements in 1624 men and 1368 women aged 18 to 40 years to establish sarcopenia cutoff values in the Japanese population. The mean values minus 2 standard deviations of the skeletal muscle mass index (ALM/Ht²) in these participants were 6.8 and 5.7 kg/m² in men and women, respectively. Conclusion: The current study established and validated a theoretical and age-independent equation using MF-BIA to estimate ALM and provided reasonable sarcopenia cutoff values.

This study investigated the neuroprotective effects of methyl 3,4-dihydroxybenzoate (MDHB) against t-butylhydroperoxide(TBHP) induced oxidative damage in SH-SY5Y (human neuroblastoma cells) and the underlying mechanisms. SH-SY5Y were cultured in DMEM+10% FBS for 24 hours and pretreated with different concentrations of MDHB or N-acetyl-L-cysteine (NAC) for 4 hours prior to the addition of 40 μM TBHP for 24 hours. Cell viability was analyzed using the methyl thiazolyl tetrazolium (MTT) and lactate dehydrogenase (LDH) assays. An annexin V-FITC assay was used to detect cell apoptosis rate. The 2',7'-dichlorofluorescin diacetate (DCFH-DA) assay was used to determine intracellular ROS levels. The activities of antioxidative enzymes (GSH-Px and SOD) were measured using commercially available kits. The oxidative DNA damage marker 8-OHdG was detected using ELISA. Western blotting was used to determine the expression of Bcl-2, Bax, caspase 3, p-Akt and Akt proteins in treated SH-SY5Y cells. Our results showed that MDHB is an effective neuroprotective compound that can mitigate oxidative stress and inhibit apoptosis in SH-SY5Y cells

Background and Objectives: Age-related macular degeneration (AMD) is one of the major causes of central vision loss in the older age group and its dry form accounts for the majority of cases. Although several causes and mechanisms for the development and progression of AMD have previously been identified, the pathogenesis of this complex disease is still not entirely understood. As the inflammation and involvement of the immune system are strongly suggested to have a central role to promote the degenerative process and to stimulate the onset of complications, we aimed to analyze the prevalence of serum anti-retinal (ARA) and anti-endothelial cell antibodies (AECA) in patients with dry AMD and to determine their relationship with the clinical features of the disease, notably area of geographic atrophy (GA). Materials and Methods: We enrolled 41 patients with dry AMD and 50 sex- and age-matched healthy controls without AMD. The presence of ARA was determined by indirect immunofluorescence using monkey retina as an antigen substrate, while the presence of AECA was determined using cultivated human umbilical vein endothelial cells and primate skeletal muscle. Results: ARA were detected 36 (87.8%) AMD patients (titers range from 1:20 to 1:320) and in 16 (39.0%) (titers range from 1:10 to 1:40) of controls (p=0.0000). Twenty of the 41 patients (48.8%) were positive for AECA, while in a control group AECA were present only in 5 sera (10.0%). The titers of AECA in AMD patients ranged from 1:100 to 1:1000 and in the control group the AECA titers were 1:100 (p=0.0001). There were no significant correlations between the presence of AECA and disease activity. Conclusions: This study provides evidence for the possible involvement of an autoimmune process against retina and retinal vessel antigens in the pathogenesis of geographic atrophy associated with dry AMD.

Lower limb exoskeletons have the potential to reduce the prevalence of work-related musculoskeletal disorders; however, they often lack user-oriented control strategies. Human-in-the-loop (HITL) controls can adapt an exoskeleton’s assistance in real-time, to optimize the user-exoskeleton interaction. This study presents a HITL control for a knee exoskeleton to minimize the users’ physical effort, a parameter innovatively evaluated by their interaction torque with the exoskeleton (a muscular effort indicator) and metabolic cost. This work innovates by estimating the user’s metabolic cost within the HITL control through a machine-learning model. The regression model was able to estimate the metabolic cost, in real-time, with a root-mean-squared error of 0.66 W/kg and a mean absolute percentage error of 26%, making faster (10s) and less noisy estimations than a respirometer (K5, Cosmed) device. The HITL reduced the user’s metabolic cost and interaction torque by 7.3% and 32.3%, respectively, when compared to a zero-torque control. The developed HITL control surpassed both a non-exoskeleton and a zero-torque condition regarding the user’s physical effort, even for a simple task such as slow walking. Furthermore, the user-specific control enabled a lower metabolic cost than the non-user-specific assistance. This proof-of-concept demonstrated the potential for HITL controls in assisted working.

The COVID-19 pandemic has led to a substantial revolution in the incorporation of digital solutions in healthcare. This systematic review investigates the enduring physical and psychological consequences individuals experience up to two years post-recovery. Additionally, it focuses on examining the influence of mHealth interventions on these effects. Significantly, 41.7% of survivors experience lingering symptoms that have not been addressed, while 14.1% encounter difficulties in returning to work. The presence of anxiety, compromised respiratory functioning, and persistent symptoms highlight the immediate requirement for specific therapies. Telehealth, particularly telerehabilitation, presents itself as a possible way to address these difficulties. The study thoroughly examines 10 studies encompassing 749 COVID-19 patients, investigating the efficacy of telerehabilitation therapies in addressing various health markers. Telerehabilitation-based breathing exercises yield substantial enhancements in functional performance, dyspnea, and overall well-being. The results emphasize the potential of telerehabilitation to have a favorable effect on patient outcomes, however more research is needed to strengthen the existing evidence basis as one of the most important limitation is the limited number of trials and the evaluation of varied therapies. The analysis highlights the significance of digital solutions in post-COVID care and calls for ongoing research to improve comprehension and implementation of telehealth interventions in a swiftly changing healthcare environment.

In hepatocellular carcinoma (HCC), recurrence usually occurs after curative surgical resection. Currently, no approved adjuvant therapy has been shown to reduce recurrence rates. In this report, the in vivo mouse effect of sequential combination treatment with recombinant mouse interferon-alpha (rmIFN-α) and an anti-mouse-PD1 antibody on hepatitis B virus (HBV) clearance was evaluated. A phase I clinical trial was then conducted to assess the safety, tolerability, and inhibitory activity of sequential therapy with ropeginterferon alfa-2b and nivolumab in HCC recurrence in patients who have undergone curative surgery for HBV-related HCC. In animal modeling, HBV suppression was significantly greater with rmIFN-α and anti-PD1 sequential combination treatment than with their treatment alone. In the Phase I study, eleven patients completed the sequential therapy with ropeginterferon alfa-2b every two weeks at the dose of 450 µg for six doses, followed by three doses of nivolumab every two weeks up to 0.75 mg/kg. A notable decrease or clearance of HBV surface antigen was observed in two patients. Dose-limiting toxicity of grade 3 alanine transaminase and aspartate aminotransferase increases was observed in one patient. The maximum tolerated dose was determined. Currently no HCC recurrence has been observed. The treatment modality was well tolerated. The data support further clinical development of sequential combination therapy as a post-surgery prophylactic measure against the recurrence of HBV-related HCC.

Background and Objectives: Chemokines have various biological functions and potential roles in the development or progression of neuroinflammatory diseases. However, the specific pathogenic roles of chemokines in age-related macular degeneration (AMD), the leading cause of blindness in older individuals, remain elusive. Chemokines interact with their receptors expressed in the endothelium and on leukocytes. The sulfation of tyrosine residues in chemokine receptors increases the strength of ligand–receptor interaction and modulates signaling. Therefore, in the present study, we aimed to construct a human recombinant sulfated CXCR3 peptide trap (hCXCR3-S2) and mouse recombinant sulfated CXCR3 peptide trap (mCXCR3-S2) to demonstrate in vivo effects in preventing choroidal neovascularization and chemotaxis. Materials and Methods: First, the effect of hCXCR3-S was validated in vitro. Interestingly, hCXCR3-S2 inhibited the migration and invasion of two human cancer cell lines. Subsequently, the in vivo efficacy of mCXCR3-S2 was investigated using a mouse model of neovascular AMD. Results: Intravitreal injection of mCXCR3-S2 attenuated choroidal neovascularization and macrophage recruitment in neovascular lesions. These in vitro and in vivo effects were significantly stronger with CXCR3-S2 than with wild-type CXCR3 peptides. Conclusion: These findings demonstrate that the sulfated form of the CXCR3 peptide trap is a valuable tool that could be supplemented with antivascular endothelial growth factors in AMD treatment.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Visual impairment and blindness are a growing public health problem, as they reduce the quality of life of millions of people. The management and treatment of these diseases represent a scientific and therapeutic challenge, since the different cellular and molecular actors involved in the pathophysiology are still being identified. The visual system components, particularly the retinal cells, are extremely sensitive to genetic or metabolic alterations, and immune cells activated by insults contribute to biological events that culminate with vision loss and irreversible blindness. Several ocular diseases are linked to retinal cell loss, and diseases such as retinitis pigmentosa, age-related macular degeneration, glaucoma and diabetic retinopathy are characterized by pathophysiological hallmarks that represent possibilities to study and develop novel treatments for retinal cells degeneration. Here, we present a compilation of revisited information on retinal degeneration, including pathophysiologic and molecular features, biochemical hallmarks and possible directions for novel treatments, aiming to assist as a guide for innovative research. The expansion of knowledge of the mechanistic bases of the pathobiology of eye diseases, including information on the complex interactions of genetic predisposition, chronic inflammation, and environmental and aging-related factors will allow the identification of new therapeutic strategies.

Migraine is a debilitating neurovascular disorder characterized by recurrent headache attacks of moderate to severe intensity. Calcitonin gene-related peptide (GGRP), which is abundantly expressed in trigeminal ganglion (TG) neurons, plays a crucial role in migraine pathogenesis. Cortical spreading depolarization (CSD), the biological correlate of migraine aura, activates the trigeminovascular system. In the present study, we investigated CGRP mRNA expression in TG neurons in a CSD-based mouse migraine model. Our in situ hybridization analysis showed that CGRP mRNA expression was observed in smaller neuronal populations. CSD did not significantly change the density of CGRP mRNA-synthesizing neurons in the ipsilateral TG. However, the cell sizes of CGRP mRNA-synthesizing TG neurons were significantly larger in the 48 h and 72 h post-CSD groups than in the control group. The proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters less than 14 μm became significantly less at several time points after CSD. In contrast, we found significantly greater proportions of CGRP mRNA-synthesizing TG neurons bearing cell diameters of 14–18 μm at 24 h, 48, and 72 h post-CSD. We deduce that the CSD-induced upward cell size shift in CGRP mRNA-synthesizing TG neurons might be causative of greater disease activity and/or less responsiveness to CGRP-based therapy.

A new treatment option for cluster headache (CH) prevention is needed. Monoclonal antibodies (mABs) against calcitonin gene-related peptide (CGRP) ligands are used as a preventative treatment for migraine. Considering the CGRP’s role in the CH attack’s ignition and upkeep, fremanezumab and galcanezumab have been evaluated for CH preventative treatment. However, only high-dose (300 mg) galcanezumab was proven for episodic CH prevention. We herein report 3 cases of migraine and comorbid CH with previous failures of preventive treatments. The 2 cases were treated with fremanezumab and the one with non-high-dose galcanezumab. All 3 cases showed good results not only on migraine but also on CH attacks. Our report suggested the efficacy of CGRP-mABs for CH prevention. Our cases differed from the cases in the phase 3 trials of CGRP-mABs for CH prevention in the following 2 points. First, the patients had both migraine and comorbid CH. Second, the combined use of CGRP-mABs with preventative drugs for CH, such as verapamil and/or prednisolone, was performed. Future accumulation of real-world data may prove the efficacy of CGRP-mABs for CH prevention.

Disrupted biological function, manifesting through the hallmarks of aging, poses as one of the largest threats to healthspan and risk of disease development, such as metabolic disorders, cardiovascular ailments, and neurodegeneration. In recent years, numerous geroprotectors, senolytics, and other nutraceuticals have emerged as potential disruptors of aging and may be viable interventions in the immediate state of human longevity science. In this review, we focus on the decrease of nicotinamide adenine dinucleotide (NAD+) with age and the supplementation of NAD+ precursors, such as nicotinamide mononucleotide (NMN) or nicotinamide riboside (NR), in combination with other geroprotective compounds to restore youthful NAD+ levels. Furthermore, these geroprotectors may enhance the efficacy of NMN supplementation while concurrently providing their own numerous health benefits. By analyzing the prevention of NAD+ degradation through inhibition of CD38 or supporting protective downstream agents of SIRT1, we provide a potential framework of the CD38/NAD+/SIRT1 axis through which geroprotectors may enhance the efficacy of NMN supplementation and reduce the risk of age-related diseases, thereby potentiating healthspan in humans.

The persistence of diseases that affect construction workforce as a result of activities on construction sites poses a danger to the sustainable development of the industry. This resulted to a huge loss of skilled labour and economic development of the industry and the entire country. The arrival of the fourth industrial revolution (4IR) technologies urges an urgent need to assess the effect of the technology’s biological driver on the construction occupation related diseases. Therefore, this study is aimed at assessing the effect of 4IR on the construction occupation related diseases in Gauteng, South Africa. The study is quantitative in design and questionnaire survey were administered to project and Health and Safety (H&S) managers in Gauteng, South African construction sector using a proportionate simple random sampling technique. For data analysis, the Warp PLS-SEM 8.0 software algorithm was used for the analysis of the collated data. The study found that the effects of the 4IR’s biological driver variables ranges between moderate to high effects for genome sequencing (GENSE) and Neurotechnology (NEURO) respectively. The combined predictive relevance of the two (2) variables predicts 64% of the construction occupation related diseases. This implies that the adoption of the driver would help reduce the causes of construction-related diseases. Hence, implies that continuous deployment of 4IR technologies would ensure that construction occupation related diseases are easily identified and put on alert.

In this work, we analysed human isolates of nontyphoidal Salmonella enterica subsp. enterica (NTS), which were collected from salmonellosis cases in Armenia from 1996 to 2019. This disease became a leading food-borne bacterial infection in the region, with the younger age groups especially affected. The isolates were characterised by serotyping, Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) typing, and whole genome sequencing (WGS). The main serotypes were S. Typhimurium, S. Enteritidis, and S. Arizonae. ERIC-PCR indicated a high degree of clonality among S. Typhimurium strains, which were also multidrug-resistant and produced extended spectrum beta-lactamases. During the study period, the frequency of S. Typhimurium and S. Arizonae isolations were decreasing, but with the increase of S. Enteritidis and other NTS. A total of 42 NTS isolates were subjected to WGS and explored for virulence-related traits and the corresponding genetic elements. Some virulence and genetic factors were shared by all NTS serotypes, while the main differences were attributed to the serotype-specific diversity of virulence genes, SPIs, virulence plasmids, and phages. The results indicated the variability and dynamics in the epidemiology of salmonellosis and a high virulence potential of human NTS isolates circulating in the region.

Age-related macular degeneration is a progressive retinal disease that is associated with factors such as oxidative stress, decreased phagocytic activity, and inflammation. In this study, we evaluated the protective effects of SIG-1451, a non-steroidal anti-inflammatory drug developed for treating atopic dermatitis and known to inhibit toll-like receptor 4, on light-induced photoreceptor degeneration. SIG-1451 was intraperitoneally injected into rats once a day before exposure to 1000 lx light for 24 h; one day later, optical coherence tomography showed a decrease in retinal thickness, and electroretinogram (ERG) amplitude was also found to have decreased 3 d after light exposure. Moreover, SIG-1451 protected against this decrease in retinal thickness and increase in ERG am-plitude. One day after light exposure, upregulation of inflammatory response-related genes was observed, and SIG-1451 was found to inhibit this upregulation. Iba-1, a microglial marker, was suppressed in SIG-1451-injected rats. To investigate the molecular mechanism underlying these effects, we used lipopolysaccharide (LPS)-stimulated rat immortalised Müller cells. The upregu-lation of C-C motif chemokine 2　by LPS stimulation was significantly inhibited by SIG-1451 treatment, and western blot analysis revealed a decrease in phosphorylated I-κB levels. These results indicate that SIG-1451 protects photoreceptor cells by attenuating light damage progression through inhibiting inflammatory responses.

The main aim of the present study was to explore health professionals’ reported experiences and approaches to managing children who receive a designation of cystic fibrosis transmembrane conductance regulator-related metabolic syndrome/cystic fibrosis screen positive inconclusive diagnosis following a positive NBS result for cystic fibrosis. An online questionnaire was distributed via Qualtrics Survey Software and circulated to a purposive, international sample of health professionals involved in managing children with this designation. In total, 101 clinicians completed the online survey; 39 from the US, six from Canada and 56 from Europe (including the UK). Results indicated that while respondents reported minor deviations in practice, they were cognizant of recommendations in the updated guidance and for the most part, attempted to implement these into practice consistently internationally. Where variation was reported, the purpose of this appeared to be to enable clinicians to respond to either clinical assessments or parental anxiety in order to improve outcomes for the child and family. Further research is needed to determine if these findings are reflective of both a wider audience of clinicians and actual (rather than reported) practice.

The retina is a complex and fragile photosensitive part of the central nervous system which is prone to degenerative diseases leading to permanent vision loss. No proven treatment strategies exist to treat or reverse the degenerative conditions. Recent investigations demonstrate that cell transplantation therapies to replace the dysfunctional retinal pigment epithelial (RPE) cells and or the degenerating photoreceptors (PRs) are viable options to restore vision. Pluripotent stem cells, retinal progenitor cells and somatic stem cells are the main cell sources used for cell transplantation therapies. The success of retinal transplantation based on cell suspension injection is hindered by limited cell survival and lack of cellular integration. Recent advances in material science helped to develop strategies to grow cells as intact monolayers or as sheets on biomaterial scaffolds for transplantation into the eyes. Such implants are found to be more promising than the bolus injection approach. Tissue engineering techniques are specifically designed to construct biodegradable or non-degradable polymer scaffolds to grow cells as a monolayer and construct implantable grafts. The engineered cell construct along with the extracellular matrix formed, can hold the cells in place to enable easy survival, better integration and improved visual function. This article reviews the advances in the use of scaffolds for transplantation studies in animal models and its application in current clinical trials.

Cellular oxidation is responsive to external and internal stimulation and is generated via signal molecules in defense mechanisms through networks of cell proliferation, differentiation, intracellular detoxification, bacterial infection, and immune reactions. Oxidative stress is not necessarily harmful per se; it depends on the balance between oxidation and antioxidation cascades, which are induced according to stimuli and can maintain oxygen homeostasis. The reactive oxygen species (ROS) that are generated during influenza virus (IV) infection have critical effects on both the virus and host cells. In this review, we outline the link between viral infection and ROS production, using IV as an example. We introduce the current state of knowledge on the molecular relationship between cellular oxidation mediated by ROS production and various effects of IV infection. We also summarize the potential anti-IV agents that act by targeting oxidative stress.

Exercise facilitates weight control, partly through effects on appetite regulation. Single bouts of exercise induce a short-term energy deficit without stimulating compensatory effects on appetite, whilst limited evidence suggests that exercise training may modify subjective and homeostatic mediators of appetite in directions associated with enhanced meal-induced satiety. However, large variability in responses exists between individuals. This article reviews the evidence relating to how adiposity, sex and habitual physical activity modulate exercise-induced appetite, energy intake and appetite-related hormone responses. The balance of evidence suggests that adiposity and sex do not modify appetite or energy intake responses to acute or chronic exercise interventions, but individuals with higher habitual physical activity levels may better adjust energy intake in response to energy balance perturbations. The effect of these individual characteristics and behaviours on appetite-related hormone responses to exercise remains equivocal. These findings support the continued promotion of exercise as a strategy for inducing short-term energy deficits irrespective of adiposity and sex, as well as the ability of exercise to positively influence energy balance over the longer term. Future well-controlled studies are required to further ascertain potential mediators of appetite responses to exercise.

We take what we see, hear, smell and feel for the reality. However, as neuroscientists, we know that this reality, that is, our perceptual world, is in fact made up by the brain from the processing of the nerve impulses coming from receptors. Ancient Greeks used to think that this perceptual world, sometimes called our 3D movie (Chalmers), is emitted and has its own physical nature. Given how real the 3D movie looks to us, it is still difficult today to consider that all we would be dealing with would be patterns of brain activity The present study thus aimed at testing whether the perceptual world could have some physical existence in addition to that of the neural patterns responsible for it. To achieve that goal, we tried to see whether brains could be sensitive to the 3D movie of others. This, admittedly unusual, operational hypothesis was based on two assumptions. First, brains are sensitive to the 3D movie, as our experience includes reactions to our perceptual world. Second, the physicality at stake does not differ across individuals. We recorded the event-related brain potentials (ERPs) evoked by stimuli of the international affective picture system in pairs of closely-related participants. Most importantly, they could neither see the stimuli simultaneously presented to their partners nor their reactions to them. As in Bouten et al. (2015), around 400 ms after the onset of the stimuli, ERPs started being more positive in inconsistent conditions. Namely, when the two subjects of each pair were presented with the same stimulus whereas they were told it would be a different one and vice-versa (i.e., different-stimuli expected to be same). ERPs were less positive when the two subjects of a pair were presented with the same stimuli and were told they were the same and conversely (i.e., different-stimuli expected to be different). The same experiment was then run in pairs of strangers. No significant effect of consistency on ERPs was observed even though participants could, this time, see, in the very periphery of their visual field, the reactions of their partner to the stimuli. We thus use the results of both studies to support a new version of the emission theory of consciousness and to suggest that the sensitivity to the perceptual world of others may depend on their prior familiarity with it.

The workplace is an ideal setting for health promotion. The regular medical examination of workers enables us to screen for numerous diseases, spread good practices and correct lifestyles, and obtain a favourable risk/benefit ratio. The continuous monitoring of the level of workers' wellbeing using a holistic approach that goes beyond the simple prevention of occupational risks enables us to promptly identify problems in work organization and the company climate. Problems of this kind can be adequately managed by using a participatory approach. In this study participatory ergonomics groups were used to improve occupational life in a small company. After intervention we observed a reduction in levels of perceived occupational stress measured with the effort / reward imbalance model, and an improvement in psychological wellbeing assessed by means of the Goldberg anxiety / depression scale. Although the limited size of the sample calls for a cautious evaluation of this study, the GEP© strategy proved to be a useful tool due to its cost-effectiveness.

Chronic degeneration of the Retinal Pigment Epithelium (RPE) is a precursor to pathological changes in the outer retina. The RPE monolayer, which lies beneath the neuroretina, daily internalises and digests large volumes of spent photoreceptor outer segments. Impaired cargo handling and processing in the endocytic/phagosome and autophagy pathways leads to the accumulation of lipofuscin and N-retinylidene-N-retinylethanolamine aggregates and chemically-modified compounds such as malondialdehyde and 4-hydroxynonenal within RPE. These contribute to increased proteolytic and oxidative stress, resulting in irreversible damage to post-mitotic RPE cells and development of blinding conditions such as Age-related Macular Degeneration, Stargardt disease and Choroideremia. Here, we review how impaired cargo handling in the RPE results in their dysfunction, discuss new findings from our laboratory and consider how newly discovered roles for lysosomes and the autophagy pathway could provide insights into retinopathies. Studies of these dynamic, molecular events have also been spurred on by recent advances in optics and imaging technology. Mechanisms underpinning lysosomal impairment in other degenerative conditions including storage disorders, a-synuclein pathologies and Alzheimer’s disease are also discussed. Collectively, these findings help transcend conventional understanding of these intracellular compartments as simple waste disposal bags to bring about a paradigm shift in the way lysosomes are perceived.

Health-Related Quality of Life (HRQoL) encompasses the comprehensive evaluation of an indi-vidual's health and well-being across multiple dimensions. Mindfulness, recognized as a scientifi-cally supported strategy for anxiety management, plays a role in enhancing both physical and mental health. The Gut-Brain Axis (GBA) serves as the bidirectional communication link between the gastrointestinal system and the central nervous system. This study aims to explore the associa-tion between Mindfulness and factors influencing the GBA in both healthy individuals and those with Inflammatory Bowel Diseases (IBD). A cross-sectional investigation involved 338 adults, in-cluding 50 IBD patients, utilizing validated Greek scales for Mindfulness (MAAS-15), Mediterra-nean Diet (14-MEDAS), and HRQoL (EQ-5D-5L). The questionnaire gathered demographic, an-thropometric, and lifestyle data. Among healthy participants, EQ-5D-5L showed a moderate cor-relation with the MAAS-15 scale (r=0.389, p

In this case series, we examine the impact of the Titan-iR Pro® deep spectrum biotherapeutic device on brain function in healthy individuals. Here we present 15 participants, aged 26-68 years, who enrolled in this open-label study, designed to assess the effect of a single 15-minute course of deep spectrum biotherapy on brain function. Although symptom-free upon enrollment, participants had diverse medical histories with some displaying early signs of cognitive decline. As part of the evaluation, all participants engaged in electroencephalogram (EEG) recording sessions that focused on assessing event-related potential (ERP) evaluations, including audio P300 amplitudes and latencies (speeds), neurocognitive testing, and physical reaction times. Following the Titan-iR Pro intervention an improvement in EEG-based cognitive markers was observed. These results underscore the importance of further investigation into the potential of advanced and deep spectrum photobiomodulation in the prevention and treatment of cognitive decline and other neurological disorders.

High-grade gliomas are extremely fatal tumors, marked by severe hypoxia and therapeutic resistance. Autophagy is a cellular degradative process that can be activated by hypoxia, ultimately resulting in tumor advancement and chemo-resistance. Our study aimed to examine the link between autophagy markers expression in low (LGG) and high-grade gliomas (HGG). In 39 glioma cases, we assessed protein expression of autophagy markers LC3B, p62, and DRAM by immunohistochemistry (IHC) and mRNA expression of autophagy genes; PI3K, AKT, m-TOR, PTEN, ULK1, ULK2, UVRAG, Beclin 1 and VPS34 using RT-qPCR. Livak’s method was used to analyze the relative changes in gene expression and multi-variate Anova test and Spearman's correlation tests were performed for statistical significance. LC3B, p62, and DRAM expression were positive in 64.1%, 51.3%, and 28.2% of glioma cases respectively. The expression of LC3B and p62 was notably higher in HGG compared to LGG. VPS34 exhibited a significant differential expression and increased fold change and demonstrated strong positive correlations with Beclin1 (rs=0.768), UVRAG (rs=0.802), and ULK2 (rs=0.786) in HGG compared to LGG, thus highlighting the potential link between autophagy and glioma progression. We Provide preliminary data for functional analysis of autophagy using cell culture model and to identify potential targets for therapeutic interventions

We report the first correction by Prime editing of a mutation in the RYR1 gene, paving the way to gene therapies for RYR1-related myopathies. The RYR1 gene codes for a calcium channel named Ryanodine receptor 1, which is expressed in skeletal muscle fibers. The failure of this channel causes muscle weakness in patients, which degenerates into motor disabilities. Currently, there are no effective treatments for these diseases, which are mainly caused by point mutations. Prime editing allows the modification of precise nucleotides in the DNA. Our results showed a 59% correction rate of the T4709M mutation in the RYR1 gene in human myoblasts by RNA delivery of the Prime editing components. It is to be noted that the T4709M is recessive, and thus, persons having a heterozygous mutation are healthy. These results are the first demonstration that it is possible to correct mutations in the RYR1 gene.

Aging induces numerous physiological alterations, with immunosenescence emerging as a pivotal factor. This phenomenon has attracted both researchers and clinicians, prompting pro-found questions about its implications for health and disease. Among the contributing factors, one intriguing actor in this complex interplay is human cytomegalovirus (CMV), a member of the herpesvirus family. Latent CMV infection exerts a profound influence on the aging immune system, potentially contributing to age-related diseases. This review delves into the intricate relationship between immunosenescence and CMV, revealing how chronic viral infection im-pacts the aging immune landscape. We explore the mechanisms through which CMV can im-pact both the composition and functionality of immune cell populations and induce shifts in in-flammatory profiles with aging. Moreover, we examine potential role of CMV in such pathol-ogies as cardiovascular diseases, cancer, neurodegenerative disorders, COVID-19, and Long COVID. This review underlines the importance of understanding the complex interplay be-tween immunosenescence and CMV. It offers insights into the pathophysiology of aging and age-associated diseases, as well as COVID-19 outcomes among the elderly. By unraveling the connections between immunosenescence and CMV, we gain a deeper understanding of aging's remarkable journey and the profound role that viral infections play in transforming the human immune system.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Lipofuscin accumulates with age as intracellular fluorescent granules originating from incomplete lysosomal digestion of phagocytosed and autophagocytosed material. The purpose of this review is to provide an update on the current understanding of the role of oxidative stress and/or lysosomal dysfunction in lipofuscin accumulation and its consequences, particularly for retinal pigment epithelium (RPE). Next, the fluorescence of lipofuscin, spectral changes induced by oxidation, and its contribution to retinal fluorescence are discussed. This is followed by reviewing recent developments in fluorescence imaging of the retina, and the current evidence on the prognostic value of retinal fluorescence for the progression of age-related macular degeneration (AMD), the major blinding disease affecting elderly people in developed countries. The evidence of lipofuscin oxidation in vivo, and the evidence of increased oxidative damage in AMD retina ex vivo lead to the conclusion that imaging of spectral characteristics of lipofuscin fluorescence may serve as a useful biomarker of oxidative damage which can be helpful in assessing the efficacy of potential antioxidant therapies in retinal degenerations associated with accumulation of lipofuscin and increased oxidative stress. Finally, amendments to currently used fluorescence imaging instruments are suggested, to be more sensitive and specific for imaging spectral char-acteristics of lipofuscin fluorescence.

The human polyamines spermine and spermidine are essential for cell function, and their properties have been extensively studied. However, research results of experiments conducted without understanding the properties of polyamines have been evaluated and published by reviewers who appear to have little knowledge of the properties of polyamines. It is sad that some studies repeat what was done more than half a century ago before polyamines were characterized. First, I explain the basic properties of polyamines that researchers need to know. Then, the relationship between changes in polyamine levels in the body and age- and lifestyle-related diseases is discussed. In addition, the epigenetic mechanism of action of polyamines in relation to healthy longevity and, conversely, age- and lifestyle-related diseases and the progression of senescence are discussed. Spermine, which increases with a polyamine-rich diet, acts to suppress aberrant gene methylation and proinflammatory status associated with aging. Meanwhile, chronic inflammation associated with aging induces the enzyme activity of spermine oxidase, which breaks down spermine and produces acrolein, resulting in reduced spermine levels. Acrolein, a toxic aldehyde that increases with age- and lifestyle-related diseases, is thought to accelerate these diseases.

Amphetamine is a psychostimulant drug with a high risk of toxicity and death when misused. Abuse of amphetamines is associated with an altered organic profile, which includes omega fatty acids. Low omega fatty acid levels are linked to mental disorders. Using the Comparative Toxicogenomic Database (CTD), we investigated the chemical profile of the brain in amphetamine-related fatalities and the possibility of neurotoxicity. We classified amphetamine cases as low (0-0.5 g/ml), medium (&gt;0.5 to 1.5 g/ml), and high (&gt;1.5 g/ml) based on amphetamine levels in brain samples. All three groups shared 1-octadecene, 1-tridecene, 2,4-di-tert-butylphenol, arachidonic acid, docosahexaenoic acid (DHA), eicosane, and oleylamide. We identified chemical-disease associations using the CTD tools and predict an association between docosahexaenoic and arachidonic acids and curated conditions like autistic disorder, disorders related to cocaine, Alzheimer's disease, and cognitive dysfunction. An amphetamine challenge may cause neurotoxicity in the human brain due to a decrease in omega-3 fatty acids and an increase in oxidative products. Therefore, in cases of amphetamine toxicity, supplement therapy may necessitate preventing omega-3 fatty acid deficiency.

Building on the job demands-resources (JD-R) and the allostatic load (AL) models, in this study we investigated the role of smart working (SW) in the longitudinal association between workload/job autonomy (JA) and a possible biomarker of work-related stress (WRS) in the hair, namely the cortisol to dehydroepiandrosterone sulphate (DHEA(S)) ratio, during the COVID-19 pandemic. Overall, 124 workers completed a self-report questionnaire (i.e., psychological data) at Time 1 (T1) and collected a strand of hair (i.e., biological data) three months later (Time 2, T2). Results from moderated multiple regression analysis showed that smart working at T1 was negatively associated with hair cortisol/DHEA(S) ratio at T2. Additionally, the interaction between workload and SW was significant, with workload at T1 being positively associated with hair cortisol/DHEA(S) ratio at T2 among smart workers. Overall, this study indicates that SW can be conceived as a double-edged sword, with both positive and negative consequences on employee well-being. Furthermore, our findings suggest that hair cortisol/DHEA(S) ratio is a promising biomarker of WRS. Practical implications that organizations and practitioners can adopt to promote organizational well-being are discussed.

During the last decades, zebrafish (Danio rerio) has become one of the most important model organisms to study different physiological and biological phenomena. Research field of carbonic anhydrases (CAs) and carbonic anhydrase related proteins (CARPs) is not an exception in this. The best-known known function of CAs is the regulation of acid-base balance. However, studies performed with zebrafish, among others, have revealed important roles for these proteins in many other physiological processes, some of which have been unpredicted in the light of the previous studies and suggestions. Examples are roles in zebrafish pigmentation as well as motor coordination. Disruption of the function of these proteins may generate even lethal outcomes. In this review, we summarize the current knowledge of CA-related studies performed in zebrafish.

Objectives: The aim of this study was to compare the performance of the EQ-5D-Y-3L (Y-3L) and the expanded five level version, the EQ-5D-Y-5L (Y-5L). Methods: Children/adolescents with an acute or chronic health condition and from the general population completed the Y-5L and Y-3L self-report questionnaires. Performance of the Y-5L and Y-3L was determined by comparing feasibility, redistribution of dimension responses, discriminatory power, validity, and test-retest reliability. Results. Five hundred and fifty children/adolescents completed baseline measures and 173 completed repeat measures. The ceiling effect decreased by 15% from the Y-3L to Y-5L. Informativity of dimensions improved by 0.094 on the Y-5L. There was a range of 4-9% inconsistent responses moving from the Y-3L to Y-5L. Convergent validity of the Visual Analogue Scale (VAS) and Y-3L, Y-5L dimensions was similar, weak to moderate (r_s range: 0.18 – 0.38) but similar and strong on paired Y-3L and Y-5L dimensions: Kendall Tau B (range 0.69 – 0.80) and Gamma (range 0.92 – 0.98). The Y-5L and Y-3L showed moderate to substantial agreement for test-retest reliability across dimensions and VAS scores in stable chronic health conditions and fair agreement for the general population. Conclusion: The EQ-5D-Y-5L is a valid, reliable extension of the Y-3L for children/adolescents across health conditions and healthy children/adolescents. The expanded levels reduced the ceiling effect. The relative informativity of report across dimensions increased on the Y-5L compared to the Y-3L with retention of the evenness of reporting. The convergent validity and test-retest reliability of the Y-5L was comparable to the Y-3L.

Dehydrolutein accumulates in substantial concentrations in the retina. The aim of this study was to compare antioxidant properties of dehydrolutein with other retinal carotenoids, lutein and zeaxanthin, and their effects on ARPE-19 cells. The time-resolved detection of characteristic singlet oxygen phosphorescence was used to compare the singlet oxygen quenching rate constants of dehydrolutein, lutein, and zeaxanthin. The effects of these carotenoids on photosensitized oxidation were tested in liposomes, where photooxidation was induced by light in the presence of photosensitizers, and monitored by oximetry. To compare the uptake of dehydrolutein, lutein, and zeaxanthin, ARPE-19 cells were incubated with carotenoids for up to 19 days, and carotenoid contents were determined by spectrophotometry in cell extracts. To investigate the effects of carotenoids on phototocytotoxicity, cells were exposed to light in the presence of rose bengal or all-trans-retinal. The results demonstrate that the rate constants for singlet oxygen quenching are 0.77x1010, 0.55x1010, and 1.23x1010 M-1s-1 for dehydrolutein, lutein and zeaxanthin, respectively. Overall, dehydrolutein is similar to lutein or zeaxanthin in protection of lipids against photosensitized oxidation. ARPE-19 cells accumulate substantial amounts of both zeaxanthin and lutein but no detectable amounts of dehydrolutein. Cells pre-incubated with carotenoids are equally susceptible to photosensitized damage as cells without carotenoids. Carotenoids provided to cells together with the extracellular photosensitizers offer partial protection against photodamage. In conclusion, the antioxidant properties of dehydrolutein are similar to lutein and zeaxanthin. The mechanism responsible for its lack of accumulation in ARPE-19 cells deserves further investigation.