As the coronavirus disease 2019 (COVID-19), which is caused by the novel SARS-CoV-2, continues to spread rapidly around the world, there is a need for well validated serological assays that allow the detection of viral specific antibody responses in COVID-19 patients or recovered individuals. In this study, we established and used multiple indirect Enzyme Linked Immunosorbent Assay (ELISA)-based serological assays to study the antibody response in COVID-19 patients. In order to validate the assays we determined the cut off values, sensitivity and specificity of the assays using sera collected from pre-pandemic healthy controls, COVID-19 patients at different time points after disease-onset, and seropositive sera to other human coronaviruses. The developed SARS-CoV-2 S1 subunit of the spike glycoprotein and nucleocapsid (N)-based ELISAs not only showed high specificity and sensitivity but also did not show any cross-reactivity with other CoVs. We also show that all RT-PCR confirmed COVID-19 patients tested in our study developed both virus specific IgM and IgG antibodies as early as week one after disease onset. Our data also suggest that the inclusion of both S1 and N in serological testing would capture as many potential SARS-CoV-2 positive cases as possible than using any of them alone. This is specifically important for tracing contacts and cases and conducting large-scale epidemiological studies to understand the true extent of virus spread in populations.

The probiotic bacterial strain Lactobacillus plantarum ZS2058 has been proved to manifest comprehensive functions, which were due to ability to synthesise conjugated fatty acids (CFAs). To investigate the specific functions of CFAs produced by this probiotic bacterium, α-linolenic acid was isomerized by Lactobacillus plantarum strain ZS2058, and two different conjugated α-linolenic acid (CLNA) isomers were successfully isolated. These isoforms, CLNA1 (c9, t11, c15-CLNA, purity 97.48%) and CLNA2 (c9, t11, t15-CLNA, purity 99.00%), both showed the ability to inhibit the growth of three types of colon cancer cells in a time- and concentration-dependent manner. In addition, the expression of MDA in Caco-2 cells was increased by CLNA1 or CLNA2, which indicated lipid peroxidation was related to the antiproliferation activity of CLNAs. Examination of the key protein of pyroptosis showed that CLNA1 induced the cleavage of caspase-1 and gasdermin-D, while CLNA2 induced the cleavage of caspase-4, 5 and gasdermin-D. The addition of relative inhibitors could alleviate the pyroptosis by CLNAs. CLNA1 and CLNA2 showed no effect on caspase-3, 7, 9 and PARP-1, which were key proteins associated with apoptosis. And no sub-diploid apoptotic peak appeared in the result of PI single staining test. In conclusion, CLNA1 activated caspase-1 and induced Caco-2 cell pyroptosis, whereas CLNA2 induced pyroptosis through the caspase-4/5-mediated pathway. The inhibition of Caco-2 cells by the two isomers was not related to apoptosis. This is the first report showing the ability of CLNAs to activate antioxidant defenses resulting in pyroptosis.

The novel coronavirus COVID- 19 disease is extremely contagious and has been spread worldwide. First COVID-19 case was identified in December, 2019 and within three months, more than one million affected cases and over 65,000 deaths have been reported. SARS-coronavirus 2 (SARS-CoV-2) also known as 2019-nCoV is a causative agent of COVID-19 disease and belongs to the SARS CoV (Severe Acute Respiratory Syndrome corona virus) family. The SARS-CoV-2 enters the human body by binding its viral surface spike protein with the host angiotensin-converting enzyme 2 (ACE2) receptors and cause infection. To prevent the virus entry and its transmission in the human body, we focused on the two domains of ACE2: i) the N-terminal extracellular binding domain (18-740 residues) reported for coronavirus spike interaction, and ii) the C-terminal cytoplasmic region (762-805 residues) to prevent the virus transmission. Therefore, we proposed: i) inhibition of receptor binding domain (RBD) of SARS-CoV-2 and human ACE2 protein may prevent the virus entry to the host and ii) inhibition of phosphorylation at Ser-787 of ACE2 protein may prevent the transmission of the virus in the COVID-19 patients. In the past, the critical role of Ser 787 in human ACE2 protein has been experimentally verified in SARS-CoV transmission, that upon binding to the receptor, SARS- CoV induces CKII- mediated phosphorylation of ACE2 at Ser-787 that in-turn facilitate virus entry to host cells, followed by replication and activation of ACE2, initiates downstream signaling leading to lung fibrosis. Therefore, in this study, we have suggested post-translational modification (PTM) O-β-GlcNAcylation, and two compounds Chloroquine and 2-hydroxybenzohydrazine might share the common pathways to prevent the COVID-19 infection in human. The addition of O-β-GlcNAcylation at same or neighboring Ser/ Thr residues results in phosphorylation inhibition and a change in protein structural and functional confirmations. Thereby, using neural networking methods, we have identified Ser/ Thr residues in ACE2 that are potential sites for phosphorylation and / or O-β-GlcNAcylation. Molecular docking showed that UDP-GlcNAc has more binding affinity with Ser-787 than the phosphoryl group. Moreover, chloroquine and 2-hydroxybenzohydrazine also showed great potential to bind at Ser-787 that may result in inhibition of Ser-787 phosphorylation and downstream signaling. Furthermore, O-β-GlcNAcylation, chloroquine and 2-hydroxybenzohydrazine showed their high affinity at ACE2-SARS-CoV-2receptor binding domain that may prevent the entry of SARS-CoV-2 into human body. In conclusion, inhibition of human ACE2 phosphorylation at Ser-787 and ACE2-SARS-CoV-2 binding domain could be promising targets against SARS-CoV-2 infection.

As of 26 March 2020, Pakistan had 1179 cases of COVID-19, with most 421 cases from Sindh, 394 cases, 131 cases, 123 cases, 84 cases, 25 cases and 01 cases from Punjab, Balochistan, Khyber Pakhtunkhwa, Gilgit-Baltistan, Islamabad Capital Territory, and Azad Jammu and Kashmir respectively. Travel-related cases were the main source of SARS-CoV-2 infection during the early phase of the pandemic in Pakistan. Nevertheless, cases of local virus transmission are increasing day by day. As of 26 March 2020, nine deaths have been reported from COVID-19. The case fatality rate is 0.8%, which is less compare to China, Italy, USA, and Iran. The SIR (Susceptible-Infected-Recovered) model of epidemiological analysis predicts that almost 90 million population will be infected in the coming days with 5% critical cases that need health care facilities. However, the Pakistan health care system cannot provide services to this much population. Hence, we need to act timely to reduce this number by restricting local transmission of the disease. This can be done by mass testing, quarantine, isolation and social distancing of the active coronavirus cases in Pakistan. Moreover, better communication between the authorities is very much required to control disease transmission.

Since the onset of coronavirus disease 2019 (COVID-19) pandemic, the virus kept developing and mutating into different variants over time that also gained increased transmissibility and spread in populations at a higher pace, culminating in successive waves of COVID-19 cases. The scientific community has developed vaccines and antiviral agents against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) disease. Realizing that growing SARS-CoV-2 variations significantly impact the efficacy of antiviral therapies and vaccines, we have summarized the appearance and attributes of SARS-CoV-2 variants for future perspectives in drug design, bringing up-to-date hints for developing therapeutic agents targeting the variants. The Omicron variant is among the most mutated form; its strong transmissibility and immune resistance capacity have prompted international worry. Most mutation sites currently being studied are located in the BCOV_S1_CTD of the S protein. Despite this, several hurdles remain, such as developing vaccination and pharmacological treatment efficacies for emerging mutants of SARS-CoV-2 strains. In this review, we present an updated viewpoint on the current issues faced by the emergence of various SARS-CoV-2 variants. Furthermore, we discuss the clinical studies conducted to assist the development and dissemination of vaccines, small molecule therapeutics, and therapeutic antibodies having broad-spectrum action against SARS-CoV-2 strains.

Wastewater-based surveillance is emerging as an important tool for COVID-19 pandemic trending. Current methods of wastewater collection, such as grab and auto-composite sampling, have drawbacks that impede effective surveillance, especially from small catchments with limited accessibility. Passive samplers, which are more cost-effective and require fewer resources to process, are promising candidates for monitoring wastewater for SARS-CoV-2. Here, we compared traditional auto sampling with passive sampling for SARS-CoV-2 detection in wastewater. Torpedo-style 3D printed passive sampler device containing both cotton swabs and electronegative filter membranes was used. Between April and June 2021, fifteen passive samplers were placed at a local hospital wastewater outflow alongside an auto sampler. Reverse transcription and quantitative polymerase chain reaction (RT-qPCR) was used to detect SARS-CoV-2 in the samples after processing and RNA extraction. The swab and membrane of the passive sampler showed similar detection rates and Ct values for SARS-CoV-2 RNA for the N1 and N2 gene targets. The passive method performed as well as the grab/auto sampling, with no significant differences between N1 and N2 Ct values. There were discrepant results on two days with negative grab/auto samples and positive passive samples, which might be related to the longer duration of passive sampling in the study. Overall, the passive sampler was rapid, reliable and cost-effective, and could be used as an alternative sampling method for the detection of SARS-CoV-2 in wastewater.

There is a new public health crisis threatening the world with the emergence and spread of novel coronavirus (SARS-CoV-2). The outbreak of coronavirus disease 2019 (COVID-19), which originated in Wuhan, China, in December 2019, has been declared a public health emergency of international concern by WHO. Most patients infected with SARS-CoV-2 exhibited symptoms of fever, cough, myalgia, fatigue and shortness of breath. Many infected people may be asymptomatic. It is generally believed that airway exposure to respiratory droplets from an infected patient is the main transmission route of this disease. However, apart from respiratory source, other source specimens like faecal matter and urine could be possible for COVID-19 infectivity. The spreading other routes of the virus has been alarming sign, both for public and health care professionals. Understanding the spreading routes of SARS-CoV-2 is crucial for patient management and defining biosafety strategies for public and health care workers.

A big race for the search for novel lead has begun due to the emergence of COVID-19 across the globe. More than 6,00,000 cases of afflicted patients worldwide has been reported till date with high mortality and morbidity. At present no approved drugs are known for COVID-19. Phylogenetic analysis present strong nucleotide sequence similarity of around 80% with SARS-CoV. Therefore, the drugs used for treating SARS-CoV and MERS are being used for SARS-CoV-2 also. Recently, the crystal structure of COVID-19 is reported and hence, we have used this tom predict the binding affinity with SARS-CoV-2-main protease and prepared a pharmacophore that may be used for future design of novel inhibitors.

Increasing evidence points to host Th17 inflammatory responses as contributing to the severe lung pathology and mortality of lower respiratory tract infections from coronaviruses. This includes host inflammatory and cytokine responses to COVID-19 caused by the SARS-2 coronavirus (SARS CoV2). From studies conducted in laboratory animals, there are additional concerns about immune enhancement and the role of potential host immunopathology resulting from experimental human COVID-19 vaccines. Here we summarize evidence suggesting there may be partial overlap between the underlying immunopathologic processes linked to both coronavirus infection and vaccination, and a role for Th17 in immune enhancement and eosinophilic pulmonary immunopathology. Such findings help explain the link between viral-vectored coronavirus vaccines and immune enhancement and its reduction through alum adjuvants. Additional research may also clarify links between COVID-19 pulmonary immunopathology and heart disease.

Following the WHO's declaration of a public health emergency due to the COVID-19 outbreak, the subsequent quarantine and confinement measures that were adopted, including distance learning measures, were shown to have caused a significant deterioration in the mental health of medical students. The goal of this study was to explore the mediating role of resilience and life satisfac-tion in the relationship between perceived stress and burnout among medical students in the con-text of COVID-19. A transversal assessment was performed using an online questionnaire, to which 462 students responded. The instruments applied were the Perceived Stress Scale-10, the Resilience Scale-25 items, the Satisfaction with Life Scale (SWLS) and the Burnout Scale (Olden-burg Inventory). A regression model was estimated for each dimension of burnout. The results revealed that resilience and life satisfaction play a mediating role in the association between stress and the dimensions of burnout. This suggests that measures of promoting mental health based on resilience and improving perceptions of life should be implemented.

In dentistry, maxillofacial surgery, traumatology, and orthopedics, there is a need to use osteoplastic materials that have not only osteoinductive and osteoconductive properties but are also convenient for use. In the study, compositions based on collagen hydrogel were developed. Polylactide granules (PLA) or a traditional bone graft, a mixture of hydroxyapatite and β-tricalcium phosphate (HAP/β-TCP), were used for gel filling to improve mechanical osteoconductive properties of compositions. The mechanical tests showed that collagen hydrogels filled with 12 wt% highly porous PLA granules (elastic modulus 373 ± 55 kPa) or 35 wt% HAP/β-TCP granules (elastic modulus 451 ± 32 kPa) had optimal manipulative properties. All composite components were cytocompatible. The cell’s viability was above 90%, and the components’ structure facilitated the cell’s surface adhesion. The bone morphogenetic protein-2 (BMP-2) provided osteoinductive composition properties. It was impregnated directly into the collagen hydrogel with the addition of fibronectin or inside porous PLA granules. The implantation of a collagen hydrogel with BMP-2 and PLA granules into a critical-size calvarial defect in rats led to the formation of the most significant volume of bone tissue: 61 ± 15%. It was almost 2.5 times more than in the groups where a collagen-fibronectin hydrogel with a mixture of HAP/β-TCP (25 ± 7%) or a fibronectin-free composition with porous PLA granules impregnated with BMP-2 (23 ± 8%) were used. Subcutaneous implantation of the compositions also showed their high biocompatibility and osteogenic potential in the absence of a bone environment. Thus, the collagen-fibronectin hydrogel with BMP-2 and PLA granules has optimal biocompatibility, osteogenic, and manipulative properties.

We reviewed the association between seasonal influenza vaccination and the risk of SARS-CoV-2 infection or complicated illness or poor outcome (e.g. severe disease, need for hospitalization or ventilatory support, or death) among COVID-19 patients. None of the studies that were reviewed (n=12) found a significant increase in the risk of infection or in the illness severity or lethality, while some reported significantly inverse associations. Our findings support measures aimed at raising influenza vaccination coverage in the coming months.

In December 2019, a novel coronavirus (SARS-CoV-2) was identified in patients with pneumonia (called COVID-19) in Wuhan, Hubei Province, China. SARS-CoV-2 shares high sequence similarity and uses the same cell entry receptor, angiotensin-converting enzyme 2 (ACE2), as does severe acute respiratory syndrome coronavirus (SARS-CoV). Several studies have provided bioinformatic evidence of potential routes for SARS-CoV-2 infection in respiratory, cardiovascular, digestive and urinary systems. However, whether the reproductive system is a potential target of SARS-CoV-2 infection has not been determined. Here, we investigate the expression pattern of ACE2 in adult human testis at the level of single-cell transcriptomes. The results indicate that ACE2 is predominantly enriched in spermatogonia, Leydig and Sertoli cells. Gene ontology analyses indicate that GO categories associated with viral reproduction and transmission are highly enriched in ACE2-positive spermatogonia while male gamete generation related terms are down-regulated. Cell-cell junction and immunity related GO terms are increased in ACE2-positive Leydig and Sertoli cells, but mitochondria and reproduction related GO terms are decreased. These findings provide evidence that human testes are a potential target of SARS-CoV-2 infection which may have significant impact on our understanding of the pathophysiology of this rapidly spreading disease.

The global prevalence of type 2 diabetes mellitus (T2DM) has surged in recent decades and the identification of differential glycemic responders can aid tailored treatment for prevention of pre-diabetes and T2DM. A mixed meal tolerance test (MMTT) based on regular foods offers potential to uncover differential responders in dynamical postprandial events. We aimed to fit a simple mathematical model on dynamic postprandial glucose data from repeated MMTTs among partic-ipants with elevated T2DM risk, to identify response clusters and investigate their association with T2DM risk factors and gut microbiota. Data were used from a 12-week multi-center dietary inter-vention trial involving high-risk T2DM adults, comparing high- versus low-glycemic index foods within a Mediterranean diet context (MEDGICarb). Model-based analysis of MMTTs from 155 participants (81 females, 74 males) revealed two distinct plasma glucose response clusters that were associated with baseline gut microbiota. Cluster A, inversely associated with HbA1c and waist circumference and directly with insulin sensitivity, exhibited a contrasting profile to cluster B. Findings imply that a standardized breakfast MMTT using regular foods could effectively distin-guish non-diabetic individuals at varying risk levels for T2DM using a simple mechanistic model.

Introduction. This retrospective study aimed to compare the risk factors for vascular calcification (VC) between pre-hemodialysis (HD) and prevalent HD adult patients while investigating associations with calcification biomarkers. Methods. Baseline data from 30 pre-HD and 85 HD patients were analyzed, including iPTH, vitamin D, FGF23, fetuinA, sclerostin, and VC scores (Adragao method). Multivariable linear regression identified VC predictors. Results: The prevalence of VC was similar in both groups, but HD patients had more pronounced VC scores ≥6. Pre-HD patients were older, with higher prevalence of Balkan endemic nephropathy, hypertension, and less frequent use of calcium phosphate binders. Both groups exhibited similar patterns of hyperphosphatemia, low vitamin D, and iPTH levels. In HD group normal phosphate was significantly common in patients with VC, whereas hyperphosphatemia was significantly common in patients without VC. Fetuin-A levels were higher in pre-HD patients, while FGF23 was elevated in HD patients. In pre-HD patients, male gender was associated with reduced VC risk, while in HD patients, malignancies and serum phosphate levels were negative VC predictors. Conclusion: Effective monitoring and tailored treatment of VC in CKD are still focused on phosphate regulation. Besides, mineral disturbances, hormones and biomarkers regulation, and patient-specific variables need to be considered.

Glucagon-like peptide-1 (GLP-1) is an incretin hormone that acts on the pancreas to increase insulin and decrease glucagon secretion. Albuminuria is the pivotal marker for diabetic nephropathy, which is the leading microvascular complication of diabetes mellitus. Most of the previous studies mainly focused on the clinical trials of the therapeutic renal protective effect after administration of GLP-1 receptor agonists (GLP-1 RAs), not prior to administration. Therefore, this study aimed to investigate the association between fasting plasma GLP-1 levels and albuminuria before GLP-1 RA administration. A cross-sectional study was designed to evaluate the association between fasting plasma GLP-1 levels and albuminuria in patients with type 2 diabetes mellitus (T2DM). A total of 68 T2DM participants were analyzed from the data at Wonkwang University Hospital in Iksan, Korea. Logistic regression analysis was performed to evaluate the odds ratio (OR) and 95% confidence interval (CI) of the incidence of albuminuria between the GLP-1 low group (Group L) and the high group (Group H). The OR (95% CI) for the incidence of albuminuria comparing the Group L with the Group H of fasting plasma GLP-1 levels was 3.410 (1.160-10.023), p = 0.026 after adjustment for age, gender, fasting plasma glucose, HbA1c, C-peptide, the use of ACE inhibitors or ARBs, SGLT-2 inhibitors, and DPP-4 inhibitors. As a continuous variable, the OR (95% CI) for the incidence of albuminuria associated with the reduction of each 1 pmol/L in fasting plasma GLP-1 levels was 1.673 (1.173-1.870), p = 0.018, after full adjustment. This study showed the negative association between fasting plasma GLP-1 levels and the incidence of albuminuria in Korean patients with T2DM, before GLP-1 RA administration. This result suggests that endogenous GLP-1 may play a role in attenuating albuminuria.

During the recent pandemics of COVID-19, sequencing technics became powerful tool for gaining information about the SARS-CoV-2 virus and using this knowledge in our advantage. Thanks to this advantage, scientists over the world were able to search for emerging variations, watching the virus evolving in real time. Assembly of the virus genomes is crucial part of getting this kind of useful information. In our study, we sequenced 79 samples from nasopharyngeal swabs of COVID-19 patients. Positivity on disease was evaluated by qRT-PCR. By studying assembly success rate, we noticed, that Ct-value of qRT-PCR can predict success of genome assembly and SARS-CoV-2 lineage assignment. In this work we described the relationship between Ct-value and further steps of genome construction and its assignment to specific viral strain.

A series of supported CuO-based nanoparticle catalysts were prepared by impregnation method and used for the synthesis of glycerol carbonate from glycerol and CO2 in the presence of 2-cyanopyridine as a dehydrant and DMF as a solvent. The effects of supports (activated alumina, silicon dioxide, graphene oxide, graphene, and activated carbon), CuO loading amount, calcination temperature, and reaction parameters on the catalytic activity of catalyst were investigated in detail. XRD, FTIR, SEM, BET, and CO2-TPD were used for the characterization of the prepared catalysts. It is found that CuO/Al2O3 shows a higher catalytic activity, which depends on the CuO loading amount and calcination temperature. The surface area and amount of basic sites of the catalyst exhibit crucial effect on the catalytic activity of CuO/Al2O3. Furthermore, there is a synergistic effect between the catalyst and 2-cyanopyridine that the former has higher activation ability for glycerol and the latter acts not only as a dehydrant, but also as a promoter for CO2 activation. Recycling experiments reveal that this catalyst can be reused at least five cycles without any inactivation. Based on the experiment results and FTIR characterization, a possible reaction mechanism for the carbonylation of glycerol and CO2 is proposed.

A balanced chromosomal translocation disrupting DISC1 (Disrupted in Schizophrenia 1) gene has been linked to psychiatric diseases, such as major depression, bipolar disorder and schizophrenia. Since the discovery of this translocation, many studies have focused on understating the role of the truncated isoform of DISC1, hypothesizing that the gain of function of this protein could be behind the neurobiology of mental conditions, but not so many studies have focused in the mechanisms impaired due to its loss of function. For that reason, we perform an analysis on the cellular proteome of primary neurons in which DISC1 was knocked down with the goal of identifying relevant pathways directly affected by DISC1 loss of function. Using an unbiased proteomic approach, we found that the expression of 31 proteins related to neurodevelopment (e.g. CRMP-2, stathmin) and synaptic function (e.g. MUNC-18, NCS-1) is regulated by DISC1 in primary mouse neurons. Hence, this study reinforces the idea that DISC1 is a unifying regulator of both neurodevelopment and synaptic function, thereby providing a link between these two key anatomical and cellular circuitries.

To date, uncertainty remains about how long the protective immune responses against SARS-CoV-2 persists and reports of suspected reinfection began to be described in recovered patients months after the first episode. Viral evolution may favor reinfections, and the recently described spike mutations, particularly in the receptor binding domain (RBD) in SARS-CoV-2 lineages circulating in the UK, South Africa, and most recently in Brazil, have raised concern on their potential impact in infectivity, immune escape and reinfection. We report a case of reinfection from distinct SARS-CoV-2 lineages presenting the E484K mutation in Brazil, a variant associated with escape from neutralizing antibodies.

Angiogenesis mediated by proteins such as Fibroblast Growth Factor – 2 (FGF-2) is a vital component of normal physiological processes and has also been implicated in contributing to disease state associated with various microbial infections. Previous studies by our group and others have shown that Candida albicans, a common agent of candidiasis, induces FGF-2 expression in vitro, and angiogenesis in brains and kidneys during systemic infections. However, the underlying mechanism(s) via which the fungus increases FGF-2 expression and the role(s) that FGF-2/angiogenesis plays in C. albicans disease remain unknown. Here we show, for the first time, that C. albicans hyphae (and not yeast cells) increase the FGF-2 response in human endothelial cells. Moreover, candidalysin, a toxin secreted exclusively by C. albicans in the hyphal state is required to induce this response. Our in vivo studies show that, in the systemic C. albicans infection model, mice treated with FGF-2 exhibit significantly higher mortality rates when compared to untreated mice not given the angiogenic growth factor. Even treatment with fluconazole could not fully rescue infected animals that were administered FGF-2. Our data suggest that the increase of FGF-2 production/angiogenesis induced by candidalysin contributes to the pathogenicity of C. albicans.

Inactivated SARS-CoV-2 vaccine (CoronaVac) is commonly used in national immunization programs. However, the immune response significantly declined within a few months. Our study assessed the immune response against SARS-CoV-2 after receiving booster shots of BNT162b2 or ChAdOx1 among health care workers who previously received CoronaVac as their primary immunization. Fifty-six participants received ChAdOx1 and forty-two participants received BNT162b2 were enrolled into this study which evaluated the immune responses including anti-SARS-CoV-2 spike total antibodies (Elecsys®), surrogated viral neutralization test (sVNT) to ancestral strain (cPass™; GenScript) and five variants of concern (Alpha, Beta, Gamma, Delta, and Omicron) (Luminex; multiplex sVNT) and the ELISpot with spike (S1 and S2) peptide pool against the ancestral SARS-CoV-2 strain. The samples were analyzed at baseline, 4, and 12 weeks after primary immunization as well as 4 and 12 weeks after receiving the booster. This study showed a significantly higher B-cell response among the BNT162b2 than the ChAdOx1 booster group, particularly against the Omicron variant, as well as a trend of good T-cell immune response in the BNT162b2 group. Moreover, the immune response rapidly declined at 12 weeks after the booster. A fourth dose or a second booster should be recommended, especially for reducing Omicron severity.

Abstract The COVID-19 pandemic has tremendously affected the African continent and the rest of the world. Most businesses have closed and a lot of people have lost their jobs. The aviation industry has been shaken to the core with airlines losing millions of dollars and flights being cancelled. The tourism industry has consequently been affected due to restricted travel of tourists, impacting wildlife conservation and livelihoods. Schools, colleges and universities have been closed. The virus has infected millions of people and hundreds of thousands of people have died globally putting strain on health systems especially those of hard hit countries. Various countries all over the world have put measures to control the spread of the virus through lockdowns and social distancing policies. The reduced economic activities and mobility of people has resulted in improved air quality, cleaner water and beaches in some countries. However there are also negative impacts such as challenges in waste management, increased pharmaceutical and household waste and discovery of the corona virus in wastewater, a potential threat to public health. A considerable amount of research has been done on the socio-economic impacts of COVID-19 in Africa but there is still limited research on its impact on the environment. This paper serves to highlight the observed and potential environmental impacts of COVID-19 in Africa.

Catastrophic mass flows originating from the high mountain cryosphere often cause hazard cascades. With increasing human activities in the alpine region and the sensitivity of glaciers, snow and permafrost to climate warming, the cryospheric hazard risks tend to be more active in the Tibetan Plateau(TP). The remoteness and inaccessibility of high mountain regions make the remote sensing technology the most effective approach for monitoring and investigating the cryospheric hazards. Exploring the evolution process and impact of ice avalanches and subsequent hazards are crucial to understand drivers and nature of mass flow process chain in order to prevent and mitigate potential hazard consequences. In this study, the glacier and ice-rock avalanches occurred in Arutso and Sedongpu basins in Tibet were investigated on the basis of Sentinel-2 time-series images and in-situ investigation, the evolution process of these events were reconstructed, and impacts and driving factors were analyzed. The massive Chamoli rock-ice avalanche occurred in February 2021 in the western Himalayas was also reviewed using using same methods. The study shows that Arutso glacier No. 53 (Arutso-53) avalanche completely melted away in July 2018 after two years from occurrence to final disappearance, while Arutso glacier No. 50 (Arutso-50) avalanche completely melted by the end of August 2023 after lasting for seven years. Four large-scale ice-rock avalanche and debris flow events in the Sedongpu basin in 2017 and 2018 not only had significant impacts on the river flow, landscape and geomorphologic shape in the basin, but also caused serious disasters in the basin and downstream. In March 2021, a small-scale ice-rock avalanche and debris flow event occurred again in the Sedongpu basin. The glacier and ice-rock avalanches occurred in Tibet area were mainly induced by climate warming, heavy precipitation and seismic activity, which acting on specific topographic and geomorphic structure of glacier properties in the high mountain regions. Catastrophic hazard events originating from the high-elevation glacier and ice-rock collapses in the mountain cryosphere and subsequent hazard cascades in the TP and Himalayas highlight the importance of mountain hazard monitoring, early warning systems and sustainable mountain development.

Severe COVID-19 patients show impaired IFN-I response due to decreased IFN-β production, allowing persistent viral load and exacerbated inflammation. The SARS-CoV-2 nucleocapsid protein has been implicated in inhibiting IFN-I response through interfering with IFN-I signaling. This study reveals that SARS-CoV-2 nucleocapsid protein enhances interaction between human SUMO-conjugating enzyme UBC9 and MAVS. Increased MAVS-UBC9 interaction leads to enhanced SUMOylation of MAVS, inhibiting its ubiquitination, resulting in the inhibition of phosphorylation events involving IKKα, TBK1, and IRF3, disrupting IFN-I signaling. These results provide essential insights into the intricate regulation of the host's innate immunity during SARS-COV-2 invasion. Understanding these complex molecular mechanisms is crucial in developing effective therapeutic interventions against COVID-19 and potential future viral outbreaks.

Rats fed a high-fat diet with a single streptozotocin (STZ) injection developed obesity, prediabetes, cardiac hypertrophy and diastolic dysfunction. Here we aimed to explore the renal consequences of prediabetes in the same groups of rats. Male Long-Evans rats were fed normal chow (CON; n = 9) or high-fat diet containing 40% lard and were administered STZ at 20 mg/kg (i.p.) at week four (prediabetic rats, PRED, n = 9). At week 21 cardiac functions were examined (Koncsos et al., 2016) and blood and urine samples were taken. Kidney samples were collected for histology, immunohistochemistry and for analysis of gene expression. High-fat diet and streptozotocin increased body weight gain and visceral adiposity, and plasma leptin, elevated fasting blood glucose levels, impaired glucose and insulin tolerance, despite hyperleptinemia, plasma C-reactive protein concentration decreased in PRED rats. Immunohistochemistry revealed elevated collagen IV protein expression in the glomeruli, and Lcn2 mRNA expression increased, while Il-1β mRNA expression decreased in both the renal cortex and medulla in PRED vs. CON rats. Kidney histology, urinary protein excretion, plasma creatinine, glomerular Feret diameter, desmin protein expression and cortical and medullary mRNA expression of TGF-β1, Nrf2, PPARγ were similar in CON and PRED rats. Reduced AMPKα phosphorylation of the autophagy regulator Akt was the first sign of liver damage, while serum lipid and liver enzyme levels were similar. In conclusion, glomerular collagen deposition and increased lipocalin-2 expression were the early signs of kidney injury, while most biomarkers of inflammation, oxidative stress and fibrosis were negative in the kidneys of obese, prediabetic rats with mild heart and liver injury.

COVID-19, the disease caused by the new coronavirus, SARS-CoV-2, has caused significant human and economic burden. Of the three major methods to mitigate the effect of the virus, diagnostics have become the focal point because vaccines and therapeutics, despite the intense effort of scientists worldwide, will take months to develop, test for safety and efficacy, scaleup and distribute to millions. This perspective aims to clarify some of the issues related to COVID-19 diagnostics and highlights some of the challenges key stakeholders including policymakers, businesses, managers, scientists and individuals face during this evolving pandemic.

The reaction mechanism of the carboxylation of K-2-naphthoxide was investigated by density functional theory calculations and spectroscopic studies. The reaction intermediates and products were confirmed by CO₂ adsorbed-FTIR and ¹H-NMR measurements. Four steps of the reaction pathway were identified: CO₂ activation, electrophilic substitution, CO₂-K complex rearrangement, and H-shift, producing 2-hydroxy-1-naphthoic acid (2,1-HNA), 2-hydroxy-3-naphthoic acid (2,3-HNA), and 2-hydroxy-6-naphthoic acid (2,6-HNA). The occurrence of CO₂-K complex rearrangement was also confirmed. These energy profiles of reaction pathways for the reaction intermediates were well consistent the experimental results on the carboxylation of K-2-naphthoxide.

We have developed a simple, rapid, high-throughput RBD-based ELISA to assess the humoral immunity against emerging SARS-CoV-2 virus variants. The cDNAs of the his-tagged RBD proteins of the virus variants were stably engineered into HEK cells secreting the protein into the supernatant, and RBD purification was performed by Ni-chromatography and buffer exchange by membrane filtration. The simplified assay uses single dilutions of sera from finger-pricked native blood samples, purified RBD in 96-well plates, and a chromogenic dye for development. The results of this RBD-ELISA were confirmed to correlate with those of a commercial immunoassay measuring antibodies against the Wuhan strain, as well as direct virus neutralization assays assessing the cellular effects of the Wuhan and the Omicron (BA.5) variants. Here we document the applicability of this ELISA to assess the variant-specific humoral immunity in vaccinated and convalescent patients, as well as to follow the time course of selective vaccination response. This simple and rapid assay, easily modified to detect humoral immunity against emerging SARS-CoV-2 virus variants, may help to assess the level of antiviral protection after vaccination or infection.

Oral diseases remain a major health problem worldwide, with the World Health Organisation reporting that oral health neglect affects almost half of the world’s population. Quorum sensing molecules (QSMs) influence oral biofilms in various ways with knowledge of direct oral QSM-host interaction being limited, and such studies could provide more insight into the cross-kingdom communication occurring during oral disease development. This review aims to explore the literature on oral QSM-host interaction and to highlight areas of advancement in this field. QSM CSP-1 produced by Gram-positive oral bacteria was found to interact with T2R receptors, activating NF-kB signalling and leading to remodeling of the cytoskeleton. AI-2 in the oral cavity was found in various studies to elicit an inflammatory response in specific oral cells. Overall AHL detection methods remain an area for development, through which greater understanding of oral QSMs’ influence on host cells can be achieved. In conclusion, from the current literature it can be inferred that that QSMs are utilised by host cells to detect bacterial presence and in the majority of cases elicit an immune response towards the environmental QSMs. This may provide a base to target QSMs as novel treatment of oral diseases.

Mammalian seminal plasma contains a multitude of bioactive components, including lipids, glucose, mineral elements, metabolites, proteins, cytokines and growth factors, with various functions during insemination and fertilization. The seminal plasma protein PDC-109 is one of the major soluble components of the bovine ejaculate and is crucially important for sperm motility, capacitation and acrosome reaction. A hitherto underappreciated function of seminal plasma is its anti-microbial and anti-viral activity, which may limit sexual transmission of infectious diseases during intercourse. We have recently discovered that PDC-109 inhibits the membrane fusion activity of influenza virus particles and significantly impairs viral infections at micromolar concentrations. Here we investigated whether the antiviral activity of PDC-109 is restricted to Influenza or if other mammalian viruses are similarly affected. We focused on Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), the etiological agent of the Coronavirus Disease 19 (COVID-19), thoroughly assessing PDC-109 inhibition with SARS-CoV-2 Spike (S)-pseudotyped reporter virus particles, but also live-virus infections. Consistent with our previous publications we found significant virus inhibition, albeit accompanied by substantial cytotoxicity. Using time-of-addition experiments however, we discovered treatment regimen that enable virus suppression without affecting cell viability. We furthermore demonstrated that PDC-109 is also able to impair infections mediated by the VSV glycoprotein (VSVg) thus indicating a broad pan-antiviral activity against multiple virus species and families.

Covid-19 pandemic has captivated scientists to investigate if this new disease can affect the central nervous system (CNS). The most challenging symptoms of Covid-19 are related to respiratory distress, and most patients admitted in intensive care units cannot breathe by their own. Therefore, a crucial question is if respiratory distress can be partially explained by the CNS affection. SARS-Cov-2 is a beta-coronavirus that shares high similarities with SARS-CoV. The infection of SARS‐CoV has been reported in the brains from both patients and experimental animals, where the brainstem was heavily infected. Those coronaviruses have been able to invade the brainstem via a synapse‐connected route to the medullary respiratory center, where the infected regions included the nucleus of the solitary tract and nucleus ambiguous. The vagal afferent nerves from receptors in the lung communicate with the medulla and pons respiratory control centers to coordinate inspiration and expiration. This suggests that neuroinvasion of SARS‐CoV‐2 might play a role in the acute respiratory failure of Covid-19. Therefore, acute respiratory distress in Covid-19 can be partially explained by brainstem dysfunction, suggesting the needs of more specific and aggressive treatments with the direct participation of neurologists and neurointensivists.

Proprotein convertases activate various envelope glycoproteins and participate in cellular entry of many viruses. We recently showed that the convertase furin is critical for the infectivity of SARS-CoV-2. This study investigated the implication of the two cholesterol-regulating convertases SKI-1 and PCSK9 in SARS-CoV-2 entry. We used cell-to-cell fusion assays in HeLa cells and pseudoparticle entry into Calu-3 cells. SKI-1 increases cell-to-cell fusion by enhancing the activation of SREBP-2, whereas PCSK9 reduces cell-to-cell fusion by promoting the cellular degradation of ACE2. Metalloprotease activation is sensitive to enhanced cholesterol levels resulting from SKI-1-activated SREBP-2 that leads to enhanced S2’ formation. However, high metalloprotease activity results in S2’ shedding into a new C-terminal fragment (S2”), leading to reduced cell-to-cell fusion. Indeed, S-mutants that increase S2’’ formation, abolish S2’ and cell-to-cell fusion, as well as pseudoparticles entry, indicating that the formation of S2’’ prevents SARS-CoV-2 cell-to-cell fusion and entry. We next demonstrated that PCSK9 enhanced the cellular degradation of ACE2, thereby reducing cell-to-cell fusion. However, different from the LDLR, a canonical target of PCSK9, the C-terminal CHRD domain of PCSK9 is dispensable for the PCSK9-induced degradation of ACE2. Molecular modeling suggested binding of ACE2 to the Pro/Catalytic domains of mature PCSK9. Thus, both cholesterol-regulating convertases SKI-1 and PCSK9 can modulate SARS-CoV-2 entry via two independent mechanisms.

During the current COVID-19 pandemic caused by SARS-CoV-2, clinicians and scientists are working assiduously to unravel its pathophysiology and find effective treatments. An impressive number of papers has been published on SARS-CoV-2, exposing the complexity of the disease, the tendency of scientists to form hypotheses within their area of expertise, and the lack of orchestration of research. Hypotheses and research findings mainly complement each other, though sometimes controversies can be discerned among various theories and study results. Our overview aims to portray the ‘big picture’ of COVID-19, visualising the interwovenness of different pathophysiological pathways, with a focus on cytokine-induced pathology, the sequelae of ACE2 downregulation, and thrombosis associated with microvascular injury. It aids in overseeing the effects of repurposed drugs on intended targets, but also alerts to the (adverse) effects on interacting pathways. The overview shows how comorbidities probably increase susceptibility to (severe) COVID-19 and provides the possible pathophysiological origin of signs, symptoms, and biochemical abnormalities.

Home Security Systems are very important features of modern residential and office setups. This system is used to keep home safe from harmful gases, fire and intruders. It must be affordable, reliable and effective. In this paper, a GSM based home security system has been designed and implemented. The system consists of a GSM Module, MQ-2 smoke detector, Ultrasonic sonar sensor, LM35 temperature sensor, Arduino Uno and relay module. The MQ-2 smoke detector is used to detect harmful gases i.e. LPG, CH₄, CO, Alcohol, Smoke or Propane. Any of the harmful gases stated above is detected it will warn the owner by activating the buzzer and displaying a warning message on the LCD display. It will also send a SMS to the owner. Our system can also measure temperate and if the temperature is increased above a certain range it will compensate it by activating Air Conditioner through the relay module. The system will also send a SMS to the owner. It can also detect intruders using Ultrasonic sensor and warn us through buzzer, SMS and displaying message on the LCD. Our system is reliable as it has very fast response and cost effective and it has been developed using our own technologies.

Studies have shown that COVID-19 patients with prediabetes frequently present with high plasma glucose levels on hospital admission. However, whether the glycemic abnormalities are temporary or persist after recovery from the illness is unclear. We conducted a prospective cohort study of 69 COVID-19 patients with prediabetes (HbA1c 5.7-6.4%) who were admitted to a tertiary care hospital in Chennai, India, from May to October 2020 and were discharged alive. Over a mean follow-up of 146.6 (SD: 72.5) days, the mean fasting plasma glucose rose by 16.8 mg/dl (from 119.3-136.1 mg/dl), 2-hr post-prandial glucose by 61.0 mg/dl (from 176.2-237.2 mg/dl), and HbA1c by 0.6% (5.9-6.5%). Of the 49 (84.5%) patients who were discharged with glucose-lowering medications, 40 (81.6%) continued taking them at the first follow-up visit (mean of 50.1 days from admission), and 39 (79.6%) continued taking them at the second follow-up visit (mean of 114.3 days from first the follow-up visit). In addition, 12.1% of patients developed new-onset diabetes after recovery from the illness. Continuous monitoring of glycemia and detecting new-onset diabetes in COVID-19 patients with prediabetes after recovery are essential, as the metabolic effects of SARS-CoV-2 persist for several months.

Developing nanomaterials with the capacity to restrict the growth of bacteria and fungus is of current interest. In this study, nanocomposites of poly(2-hydroxyethyl methacrylate) (PHEMA) and carbon nanotubes (CNTs) functionalized with primary amine, hydroxyl, and carboxyl groups were prepared, and characterized. An analysis by Fourier transform infrared (FT-IR) spectroscopy and X-ray photoelectron spectroscopy showed that PHEMA chains were grafted to the functionalized CNTs. The morphology of the prepared nanocomposites studied by field emission scanning electron microscopy (FE-SEM), and transmission electron microscopy (TEM) shows significant changes with respect to the observed for pure PHEMA. The thermal behavior of the nanocomposites studied by differential scanning calorimetry (DSC) revels that the functionalized CNTs affects strongly the mobility of the PHEMA chains. Tests carried out by thermogravimetric analysis (TGA) were used to calculate the degree of grafting of the PHEMA chains. The ability of prepared nanocomposites to inhibit the growth of the fungus Candida albicans, and the bacteria Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli was evaluated. A moderated antifungal and antibacterial capacity of the prepared nanocomposites was determined.

Facilitative glucose transporters (GLUT) are transmembrane transporter of proteins involved in glucose transport across the plasma membrane. To date, there is no information about glucose transporter 2 (GLUT2) in blunt snout bream (Megalobram aamblycephala). In this study, GLUT2 were cloned and characterized from blunt snout bream, and its-expression in response to diets with different carbohydrate levels (17.1%; 21.8%; 26.4%; 32.0%; 36.3% and 41.9% of dry matter). In this study, the full-length cDNA of GLUT2 was 2577 bp, including a 5’-untranslated region (UTR) of 73 bp, a 3’-UTR of 992 bp, and an open reading frame of 1512 bp, encoding a polypeptide of 503 amino acids with predicted molecular weight of 55.046 kDa and theoretical isoelectric point of 7.52. GLUT2 has twelve across the membrane area locating at 7-29; 71-93; 106-123; 133-155; 168-190; 195-217; 282-301; 316-338; 345-367; 377-399; 412-434; 438-460 aimo acids respectively. Conservative structure domains located at 12-477 aimo acids belonging to sugar porter family major facilitator superfamily (MFS) transporter. The blunt snout bream GLUT2 showed high identity to their orthologs in other fish species and mammals. Quantitative real-time (qRT)-PCR assays revealed that GLUT2 expression was high in the liver, intestine and kidney; highest in the liver. Compared with the control group (17.1%), high dietary carbohydrate levels (32.0%; 36.3% and 41.9%) resulted in high plasma glucose at 3h after feeding, but high plasma glucose were back to basal at 24h after feeding. Furthermore, high dietary carbohydrate levels significantly improved the glycolysis and inhibitied gluconeogenesis by augmentation of GK and PK expression, inhibition of PEPCK and G6P mRNA levels (P<0.05). However, GLUT2; GK; PK; PEPCK and G6P mRNA levels were back to basal.

A mild, efficient, and photocatalytic synthesis of 6-phosphorylated phenanthridines via tandem radical addition/cyclization/aromatization of 2-isocyanobiphenyls with diarylphosphine oxides is reported. The method features operational simplicity, metal-free conditions, using low-cost rose Bengal as catalyst and sustainable air as terminal oxidant at room temperature, and providing the desired products in moderate to good yields.

Since the discovery of the first reported case with Zinc-deficiency in Iran¹ by Prasad et al. in 1961, the knowledge on Zinc has increased significantly. Zinc is the second most abundant common trace mineral in the human body, responsible for vital biological functions from cell growth and development to cell homeostasis and immune response ^2,3. Up to a fifth of the global population is estimated to suffer from different degrees of Zinc deficiency⁴. In the western world, Zinc deficiency is more prevalent among the geriatric population³, vegans/vegetarians, and people with certain underlying conditions⁴such as liver cirrhosis, inflammatory bowel disease, and various auto-immune disorders^4,5. Zinc and Zinc deficiency has been associated with several infectious diseases ^2,3. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) which is responsible for the ongoing pandemic belongs to the family of coronaviruses. SARS-CoV-2 has a high genetic similarity to another family member, SARS-CoV, which caused the first major epidemic of the 21^st century^6,7. Currently, there is no evidence linking the anti- SARS-CoV-2 response and the element Zinc. Herein and in light of the SARS-CoV-2 pandemic, we marshal the evidence associating the element Zinc with the anti-viral and antibacterial immune response as well as the cytokine storm and lung injury. Such a revisit of the precedent evidence may inspire further investigation assessing the relationship between Zincemia status and the anti-viral response in SARS-CoV-2 patients.

We describe a 90-year-old male presenting with disequilibrium, loss of balance and difficulty walking for three days prior to initial presentation. Interestingly, he denied cough, fever or dyspnea prior to arrival. Over the course of 48 hours, the patient developed acute respiratory distress syndrome (ARDS) requiring intubation, diagnosed with COVID-19 infection and was treated in the intensive care unit where he died. Since the initial cases in Wuhan China in Dec 2019, the medical and epidemiological communities have learned much about the presenting features, symptomatology, epidemiology, transmission and common physical, laboratory and radiological findings of this disease. Although common symptoms are already established, it is very important to learn and record atypical symptoms or presentations of this highly contagious disease. By doing so, we will be able to recognize earlier atypical symptoms and prevent the environmental exposure to Health care workers and future patients as well. We report that Central disequilibrium may be such as initial presenting sign and symptom of impending respiratory failure from SARS-CoV-2 virus. These atypical findings such as presyncope may precede common respiratory complications of SARS-CoV-2.

Covid-19 is a new coronavirus disease first described in December 2019. This respiratory illness is severe and potentially fatal. Severe cases make up to 15%, lethality ranges between 1.5 and more than 10 %. What is urgently needed is an efficient pharmacological treatment for the treatment of severe cases. During the infection of alveolar epithelial cells of the lung, the ACE2 receptor has a central function. The antimalarial drugs chloroquine phosphate (CQ) and hydroxychloroquine (HCQ) impair in vitro the terminal glycosylation of ACE2 without significant change of cell-surface ACE2 and, therefore, might be potent inhibitors of SARS-CoV-2 infections. Starting inhibition at 0.1 µM, CQ completely prevented in vitro infections at 10 µM, suggesting a prophylactic effect and preventing the virus spread 5 hours after infection. In a first clinical trial, CQ was effective in inhibiting exacerbation of pneumonia, improving lung imaging findings, promotion of virus-negative conversion, and shortening the disease. In addition, HCQ, which is three times more potent than CQ in SARS-CoV-2 infected cells (EC50 0.72 µM), was significantly associated with viral load reduction/disappearance in COVID-19 patients compared to controls. Theoretically, CQ and HCQ could thus be effectively used in the treatment of SARS-CoV pneumonia. From a pharmacological standpoint, however, the major problems of oral treatment with these drugs are possible severe side effects and toxicity. Concretely, this relates to (a) the inconsistent individual bioavailability of these drugs at the alveolar target cells, depending on intestinal resorption, hepatic first-pass metabolism and accumulation in liver, spleen and lung, and (b) the need for a relatively high concentration of 1-5 µM at the alveolar surface. Therefore, we propose in a first dose estimation the use of HCQ as an aerosol in a dosage of 2-4 mg per inhalation in order to reach sufficient therapeutic levels at the alveolar epithelial cells. By using a low-dose non-systemic aerosol, adverse drug reactions will markedly be reduced compared with oral application. This increase in tolerability enables a broader use for prevention and after contact with an infected person, which would be an advantage especially for the high-risk, often multi-morbid and elderly patients. Empirical data on self-medication with a one-week aerosol application by two of the authors is presented. Inhalation was well tolerated without relevant side effects.

Hepatic encephalopathy (HE) is a form of brain dysfunction that is specifically caused by liver insufficiency and/or portal-systemic shunt. The exact nature of HE is debated, so that conflicting uses of the term HE may cause inconsistencies in its detection and, in turn, issues with its management. This review highlights the meaning of the term HE on the basis of both its historical origins and current consensus. It also provides criteria for the diagnosis of the condition, on the basis of its phenotypes and the risk factors for its occurrence. The procedure for differential diagnosis from other conditions which result in similar phenotypes is considered, together with precipitants and confounders. Finally, the current multidimensional approach for the correct clinical recording of HE episodes is discussed.

Metformin use in pregnancy is increasing worldwide as randomised controlled trial (RCT) evidence is emerging demonstrating its safety and efficacy. The Metformin in Gestational Diabetes (MiG) RCT changed practice in many countries demonstrating that metformin had similar pregnancy outcomes to insulin therapy with less maternal weight gain and a high degree of patient acceptability. A multicentre RCT is currently assessing the addition of metformin to insulin in pregnant women with type 2 diabetes. RCT evidence is also available for the use of metformin for women with Polycystic Ovarian Syndrome and for non-diabetic women with obesity. No evidence of an increase in congenital malformations or miscarriages has been observed even when metformin is started before pregnancy and continued to term. Body composition and metabolic outcomes at two, seven and nine years have now been reported for the offspring of mothers treated in the MiG study. In this review, we will briefly discuss the action of metformin and then consider the evidence from the key clinical trials.

The host glycosylation mechanism synthesizes the carbohydrates of glycoproteins of viral envelopes. Due to the loss of the Cytidine Monophospho-N-Acetylneuraminic Acid Hydroxylase gene by some mammalian species, including humans (negative-CMAH), Neu5Gc is no longer synthesized. Uptake of Neu5Gc by negative-CMAH species, through the intake of food products derived from positive-CMAH mammals, leads to incorporating Neu5Gc-glycans in the glycocalyx (xenosialylation). Neu5Gc, being a Mammalian-associated Carbohydrate Antigen (MCA), acts as a non-self-antigen, inducing an inflammatory reaction (Xenosialitis), and triggering the production of circulating antiNeu5Gc antibodies to attack/remove all incorporated Neu5Gc. In the state of Xenosialitis, the virus-neutralizing antibodies produced by a heavily xenosialylated patient following exposure to viral infection (including SarsCoV2) or anti SarsCoV2 vaccination cross-react against all incorporated non-self Neu5Gc-MCA glycans due to their resemblance with viral envelope antigens synthesized by the host glycosylation mechanism. In addition, the circulating anti-XeSias antibodies determine the massive removal of the circulating neutralizing FC-xeno-contaminated antibodies by the serum, living only the hyper-inflammatory agalattosylated antiviral IgG antibodies. Therefore, we hypothesize that the combination of antibody cross-reaction against non-self Neu5Gc-MCA glycans and the massive removal of the xeno-contaminated newly formed neutralizing antibodies in favor of hyper reactive antibodies, could be the cause of the massive inflammatory reaction (cytokine storm, coagulopathies, neuropathies) observed in Covid 19 patients or after anti-SarsCoV2 vaccination. This analysis is an invitation to investigate the post-infectious and/or post-vaccination adverse phenomena in the light of xenosialization as a key to understanding the severe post viral and post vaccine complications, including SARS-CoV2 infection or related vaccination.

(1) Background: Some evidence suggests that cannabidiol (CBD) has potential to help alleviate HIV symptoms due to its antioxidant and anti-inflammatory properties. Here we examined acute CBD effects on various behaviors and the endocannabinoid system in HIV Tat transgenic mice. (2) Methods: Tat transgenic mice (female/male) were injected with CBD (3,10,30 mg/kg) and assessed for antinociception, activity, coordination, anxiety, and recognition memory. Brains were taken to quantify endocannabinoids and related lipids. Additionally, CBD and metabolite 7-hydroxy-CBD were quantified in the plasma and cortex. (3) Results: Tat decreased striatal-related nociception and locomotion, with some sex-dependent effects on coordination. CBD had no effect on nociception and coordination, but increased locomotor activity. For anxiety, differential CBD effects were noted for sex, with decreasing anxiety-like behavior in males only. In the striatum and spinal cord, male sex was associated with lower 2-arachidonoylglycerol and with elevated concentrations of its proinflammatory metabolite arachidonic acid. CBD metabolism was altered by sex and Tat. (4) Conclusion: Findings indicate that acute CBD effects are not altered by HIV Tat, and CBD has minimal effects on behavior and the endocannabinoid system. Interestingly, sex-dependent alterations were noted for endocannabinoids and related lipids, which may be of relevance in view of potential CBD-based treatment options for people living with HIV.

A new variant of the SARS-CoV-2 Omicron BA.5 virus has displaced all previous variants of the virus around the world. Preliminary assessment of the effectiveness of drugs for the prevention and treatment of COVID-19 requires the availability of infection models in animals. In this study, we characterize the infection model SARS-CoV-2 Omicron BA.5 and its progeny sublineage BE.1 in hACE2-transgenic mice and in Syrian hamsters. Both sublineages turned out to be pathogenic for animals – the challenged animals showed weight loss, a high level of viral load and acute inflammation in the lungs. Part of BA.5-infected mice died after virus challenge, indicating that this virus variant is more pathogenic than the previous BA.1 variant but less pathogenic than Wuhan variant.

Currently, there is no effective antiviral therapy recommended for the new coronavirus disease 2019 pneumonia (COVID-19). The purpose of this pilot study was to evaluate the safety of Ozonized Saline Solution (O₃SS) used as a complementary therapy in adult patients COVID-19. Twenty-five adult patients who were hospitalized with mild to severe COVID-19 symptoms, who met the inclusion criteria and were being treated from April 18^rd to April 26th, 2020, at the Viamed Virgen De La Paloma Hospital, Madrid, Spain were included in this study. Patients were allocated to receive standard care (SC) that included 200-400 mg hydroxychloroquine twice daily for 5-7 days plus Tocilizumab 400 mg twice daily for 5 days, low molecular weight heparin (LMWH) and 40 mg-60 mg metil-prednisone plus O₃SS, 200 mL, 3-5 µg/mL daily for 10 days. No control group was included, data were compared to clinical trials in this subject. Primary outcomes of treatment with O₃SS were an improvement of clinical symptoms and a reduction in mortality. Secondary end points evaluated included participant clinical status, laboratory examinations, and duration of viral shedding. None of the patients treated with SC + O₃SS died. Improvements in symptoms such as dyspnea, weakness, and reduction in body temperature were observed and corresponded with an improvement of laboratory finding including D-dimer, fibrinogen, LDH, and CRP. No side effects from the O₃SS treatment were observed. Conclusions: COVID-19 patients with mild to severe symptoms who received intravenous O₃SS as a complementary therapy demonstrated no side effects. This preliminary data will be served as base for a future study of the efficacy of this therapy.

The solvent extraction of gold(III) by undiluted 2-ethylhexanol or dissolved in toluene from HCl solution has been investigated. The numerical analysis of gold distribution data suggests the formation of HAuCl4·L and HAuCl4·2L (L= 2-ethylhexanol) species in the organic phase with formation constants K11= 38 and K12= 309, respectively. The results derived from gold(III) distribution have been implemented in a solid-supported liquid membrane system. The influence of several variables on gold transport was considered: feed and receiving phases stirring speeds, HCl and gold concentrations in the feed phase and carrier concentration in the membrane phase as well as the presence of base metals (Fe,Cu,Ni) and PGMs in the feed phase. Also, diffusional resistances to mass transfer are estimated. Gold is recovered as zero valent nanoparticles.

Background: COVID-19 represents a threat for frailty patients. Objective: Investigate efficacy, safety and economic value of treatment with Molnupiravir in a cohort of fragile patients affected by COVID-19. Methods: Observational, prospective study. The data collected allowed to assess efficacy and safety of Molnupiravir in real life, compare the results with a subgroup of patients treated with Nirmatrelvir-Ritonavir and to effect a cost-effectiveness analysis. Results: In January-December 2022, 435 patients (225 males, 220 females; median age 72 years), were enrolled; 24 patients were unvaccinated, 280 patients had ≥2 risk factors. Molnupiravir appeared to give better results than the SOC both clinically and economically. In these patients in comparison with literature data or SOC, hospitalization was 2.5% vs 6.8% (p&lt;0.005), overall adverse effects 14,3% vs 30.4% (p&lt;0.0001), severe adverse effects 2.6 vs 6.9% (p&lt;0.001), thus involving a potential total savings of about € 92.954 per patient (8% of standard of care cost). Conclusions: early Molnupiravir treatment helped fragile patients who partially responded to vaccine, or with absolute contraindications to vaccination, to overcome COVID-19 without the need of hospitalization. Molnupiravir represents a clinical and economic effective treatment, avoiding disease progression in old patients suffering from multiple pathologies and taking several drugs.

The COVID-19 pandemic is a devastating blow to the entire world community and changes the order of human life. All efforts and strategies are being carried out to contain and reduce the spread of the SARS-COV-2 virus, both by tightening the health protocol and using vaccines to the public. Currently, several vaccines are available and have passed phase 3 clinical trials, such as vector vaccines (Gamaleya Sputnik V Russia, University of Oxford/AstraZeneca, CanSino, and Janssen Pharmaceutical Companies), mRNA-based vaccines (Moderna/BioNTech/Fosun Pharma/Pfizer), inactivated vaccines (SinoVac and SinoPharm from China, Covaxin from Bharat Biotech India), and adjuvanted recombinant protein nanoparticles (Novavax from the USA) are expected to be able to suppress the spread of the virus and produce a minimum of 70 percent herd-immunity in a population. Each vaccine's efficacy varies from the lowest, namely the Sinovac vaccine (CoronaVac) 50% to the highest the Novavax vaccine (NVX-Cov2373) 96% effectivity value. Moreover, further rigorous research is still being carried out for the development of an effective and efficient vaccine.

Proteases catalyse irreversible posttranslational modifications that often alter a biological function of the substrate. The protease dipeptidyl peptidase 4 (DPP4) is a pharmacological target in type 2 diabetes therapy primarily because it inactivates glucagon-like protein-1. DPP4 also has roles in steatosis, insulin resistance, cancers and inflammatory and fibrotic diseases. In addition, DPP4 binds to the spike protein of MERS virus, causing it to be the human cell surface receptor for that virus. DPP4 has been identified as a potential binding target of SARS-CoV-2 spike protein, so this question requires experimental investigation. Understanding protein structure and function requires reliable protocols for production and purification. We developed such strategies for baculovirus generated soluble recombinant human DPP4 (residues 29-766) produced in insect cells. Purification used differential ammonium sulphate precipitation, hydrophobic interaction chromatography, dye affinity chromatography in series with immobilised metal affinity chromatography, and ion exchange chromatography. The binding affinities of DPP4 to the SARS-CoV-2 full-length spike protein and its receptor binding domain (RBD) were measured using surface plasmon resonance and ELISA. This optimised DPP4 purification procedure yielded 1 to 1.8 mg of pure fully active soluble DPP4 protein per litre of insect cell culture with specific activity >30 U/mg, indicative of high purity. No specific binding between DPP4 and CoV-2 spike protein was detected by surface plasmon resonance or ELISA. In summary, a procedure for high purity high yield soluble human DPP4 was achieved and used to show that, unlike MERS-CoV, SARS-CoV-2 does not bind human DPP4.

In this work, pure TiO₂ and binary nanocomposites of Fe₃O₄/TiO₂ and Ag/TiO₂ were synthesized in order to improve photocatalytic performance of these samples for degradation of 2, 4-dichlorophenol (2, 4-DCP) as an organic pollutant. A range of analytical techniques including XRD, DRS, SEM/EDX, and elemental mapping were employed to reveal the crystal structure, morphology and property of the nanocomposites. XRD data demonstrated that the prepared samples are purely in TiO₂ anatase phase and cubic spinel Fe₃O₄ exist in the synthesized nanocomposite. We calculated the TiO₂ crystal size from XRD patterns, in the range of 8.35-11.09 nm. The presence of Ag, Fe, O, and Ti atoms in the synthesized nanocomposites was confirmed by SEM/EDX. We obtained 30.43, 32.02 and 42.40 % degradation of 2, 4-DCP (100 ml 2, 4-DCP 40 ppm and 0.01 g catalyst) for pure TiO₂, Fe₃O₄/TiO₂ and Ag/TiO₂, respectively, after 180 min of irradiation under visible light. Similar conditions were employed for 2, 4-DCP degradation under UV irradiation, we obtained 53.05, 51.00 and 71.50 % degradation of 2, 4-DCP pure TiO₂, Fe₃O₄/TiO₂ and Ag/TiO₂, respectively. Thus, the synthesized binary nanocomposites exhibited higher photocatalytic activity compared to pure TiO₂ under visible light.

Since the COVID-19 caused by SARS-CoV-2 break out in Wuhan China from Dec. 2019, it has spread to hundreds of countries up to now. Scientists from all over the world have paid tremendous efforts to research and try to control the disease. Previous studies suggested that some of the wild animals could be intermediate hosts between humans and origination of SARS-CoV-2, and some companion animals of humans can be infected by SARS-CoV-2, which raised our curiosity about cross-infection of SARS-CoV-2 between animals and humans. Thus, we select some kinds of animals that might have contact with humans to estimate the susceptibility to SARS-CoV-2 in different animals by evolutionary analysis of their receptors for SARS-CoV-2. The results show that some companion animals of the Felidae family like the cat has a higher infection possibility while the species of the Rodent family like the rat and mouse having close contact with humans show an opposite result, which consist with recent animal experiments and researches. These should raise concerns about cross-infection between human and companion animals or animals having close contact with humans which might turn animals into depositaries of the coronavirus even after control of SARS-CoV-2 spreading and cause second or more waves of infections after social reopening. Another side of our results stands by the opinion that bioinformatic analysis can be consistent with experiments in some respects so that we can prevent unnecessary sacrifice of laboratory animals in future experiments.

Autism has been described as a gastrointestinal and neurological condition that is represented by impairments in language and social situations. Recently reported increases in the occurrence of Autism Spectrum Disorder (ASD) have resulted in increased research into the environmental differences between areas with a high occurrence, as in the “Western” diet populations, and a more locally derived diet population, wherein the rate appears to be significantly less. Thirty autistic children (USA) ages 6 to 21, were sampled at three different intervals: prior to any intervention, post-xylitol intervention, and post-probiotic intervention. The sampling consisted of buccal swabs for MITOSWAB testing, and saliva for metatranscriptomics to determine the entire range of microorganisms and the metabolome. In addition, a “Blue Zone” subject component that included 30 Colombian children, ages 6-16, and who were healthy and within normal behavior standards, also had buccal swabbing and salivary sampling performed for comparison along with 30 healthy (no history medications, illnesses, or behavior issues) USA children matched for age and gender. Saliva samples were analyzed metatranscriptomically and artificial intelligence was utilized to discern important differences in the microbiome that included bacteria, archaea, fungi, and viruses, and microbial functions. Significant differences were noted, and seen in the temporal data, demonstrating shifts that may have been precipitated by the interventions, with both the probiotics and the polyols. Particular bacterial strains were significantly more prevalent in the autism subject group including a strain that reduces neurotransmitters by enzymatic degradation. This provided supporting evidence to the hypothesis that the occurrence of autism may also be influenced by low Gamma Amino Butyric Acid (GABA) levels during development. Also, of interest was the un-expected finding that verbal skills dramatically increased in 6 of the 30 ASD subjects following xylitol supplementation.

Background: given the various clinical manifestations that characterize coronavirus disease 2019 (COVID-19), the scientific community is constantly searching for biomarkers with prognostic value. Surfactant protein A (SP-A) and D (SP-D) play a crucial role in ensuring proper alveolar function and an alteration of their serum levels have been reported in several pulmonary diseases characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis. Consid-ering that such clinical manifestations can also occur during severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, we wondered if these collectins could act as prognostic markers. Methods: in this regard, serum levels of SP-A and SP-D were measured by enzyme immunoassay in patients with SARS-CoV-2 infection (n=51) at admission (T0) and after 7 days (T1) and compared with healthy donors (n=11). Results: SP-D increased in COVID-19 patients com-pared to healthy controls during the early phases of infection, while a significant reduction was observed at T1. Stratifying SARS-CoV-2 patients according to disease severity, increased serum SP-D levels were observed in severe compared to mild patients. Conclusions: In the light of these results SP-D, but not SP-A, seems to be an eligible marker of COVID-19 pneumonia and the early detection of SP-D serum levels could be crucial for a preventive clinical management.

In this paper, the computational fluid dynamics (CFD) method has been used to simulate the gas flow and the catalytic hydrogenation process of the C-2 hydrogenation adiabatic reactor in a practical ethylene production unit of a chemical plant. The laminar finite-rate model was used for the chemical reaction model. The standard two-equation model was used for the turbulence model. The exponent-function kinetic model was used for the reaction dynamics model. The simulation results were in good agreement with the actual industrial data obtained from the C-2 hydrogenation reactor, and the distributions of reaction parameters such as temperature and component concentrations in the reactor were further analyzed. Based on the validated CFD models, the structure and operating conditions of the reactor, as well as hydrogen load distribution ratios, are simulated for comparing the comprehensive performance metrics of ethylene selectivity and acetylene conversion rate; as a result, we can obtain the optimal temperature of 312 K, the optimal hydrogen/acetylene ratio of 0.10 as well as the optimal hydrogen load distribution ratio of 4:4:2, and the diameter/height ratio exerts a marginal effect on the selectivity, conversion rate and harmonic mean of the reactor.

The emergence of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) linked with coronavirus disease 2019 (COVID-19) poses a serious threat to public health worldwide. Firstly, the SARS-CoV-2 was reported in Wuhan, Hubei Province, China in December 2019. Initially, the major proportion of virus-infected cases (i.e. about 99%) was reported in China and now it is being reported in other counties as well. Humans begin to be infected within their communities and transmittance of the viral epidemic increased rapidly due to lack of understanding of its transmission routes and precautionary measures. The existence of SARS-CoV-2 in China threatened the population greatly due to the high incidence of fatal respiratory infections. Current investigations speculated that this virus transferred into a human from viral-infected bats. However, the process of interspecies viral transmission is an important scientific question to be addressed. Due to the continuous increase in the patients infected with COVID-19 associated pneumonia, the World Health Organization (WHO) has included this viral epidemic to the priority list of diseases. Therefore, accelerated research developments are required to control the spread of this outbreak, as it is declared as a public health emergency by WHO especially in the absence of efficacious drugs and vaccines. Our review encompasses the recent status of disease severity in China, a particular replication mechanism of SARS-CoV-2 and potential risks and precautionary measures required to avoid contact with this fatal viral infection.

COVID-19 pandemic in first seven months has led to more than 15 million confirmed infected cases and 600,000 deaths. SARS-CoV-2, the causative agent for COVID-19 has proved a great challenge for its ability to spread in asymptomatic stages and a diverse disease spectrum it has generated. This has created a challenge of unimaginable magnitude not only affecting human health and life but also potentially generating a long-lasting socioeconomic impact. Both medical sciences and biomedical research have also been challenged consequently leading to a large number of clinical trials and vaccine initiatives. While known proteins of pathobiological importance are targets for these therapeutic approaches, it is imperative to explore other factors of viral significance. Accessory proteins are one such trait that have diverse roles in coronavirus pathobiology. Here we analyze certain genomic characteristics of SARS-CoV-2 accessory protein ORF8, predict upon its protein features and review current available literature regarding its function. We have also undertaken review of ORF8 homolog ORF8ab from SARS-CoV with a purpose of developing holistic understanding of these proteins for reason that coronaviruses have been infecting humans repeatedly and might continue to do so. Despite low nucleotide and protein identity and differentiating genome level characteristics, there appears to be significant structural integrity and functional proximity between these proteins pointing towards their high significance. There is further need for comprehensive genomics and structural-functional studies to lead towards definitive conclusions regarding their criticality and that can eventually define their relevance to therapeutics development.

Background: The purpose of this study was to examine the prevalence and effects of current smoking on adverse outcomes among hospitalized COVID-19 patients. Methods: We performed a systematic review of the literature (PubMed) for studies published until April 25. Studies were included into the analysis if they satisfied all of the following criteria: 1. To present hospitalized patients with COVID-19. 2. To classify patients into less and more severe disease, irrespective of the severity definition (defined as “adverse ourtcome”). 3. To present data on the smoking status, separately for each severity classification. We identified 18 (from a total of 1398) relevant studies. Pooled current smoking prevalence was compared with the gender-adjusted, population-based expected prevalence by calculating Prevalence Odds Ratio (POR). The association between current, compared to non-current and former, smoking and adverse outcome was examined by calculating Odds Ratio (OR). All analyses were performed using random-effects meta-analysis. Results: Among 6515 patients, 440 of whom were current smokers, the pooled prevalence of current smoking was 6.8% (95%CI: 4.8-9.1%) and the POR was 0.21 (95%CI: 0.16-0.26, P < 0.001). In Chinese studies only, the POR was 0.22 (95%CI: 0.17-0.27, P < 0.001). Current smokers were more likely to have an adverse outcome compared to non-current smokers (OR: 1.53, 95%CI: 1.06-2.20, P = 0.022). However, they were less likely to have an adverse outcome compared to former smokers (OR: 0.42, 95%CI: 0.27-0.74, P = 0.003). Conclusion: An unexpectedly low prevalence of current smoking was observed among hospitalized patients with COVID-19. Hospitalized current smokers had higher odds compared to non-current smokers but lower odds compared to former smokers for an adverse outcome. The possibility that nicotine may have a protective effect in COVID-19 which may be masked by smoking-related toxicity and by the abrupt cessation of nicotine intake when smokers are hospitalized should be explored.

This study aims to determine the seroprevalence of SARS-CoV-2 in pregnant women attending antenatal consultations (ANC) in Senegal. A non-redundant consecutive recruitment of participants was carried out between, March and July 2021 during the Delta wave of COVID-19. The plasma samples biobanked at -80°C were subjected to an enzyme-linked immunosorbent assay (ELISA) for the qualitative detection of IgG and IgM antibodies of SARS-CoV-2 using the WANTAI SARS-CoV-2 Ab ELISA (Wantai Biological Pharmacy Enterprise, Beijing). To assess factors associated with seropositivity, bivariate analysis was per-formed with JMP® Pro Version 15.0.0 software (SAS Institute Inc., Cary, NC, 1989–2021). For frequencies below 5%, chi2 or Fischer tests were performed. In all cases, significant statistical threshold was set at p-values considered to be less than 0.05. A total of 1,227 pregnant women were recruited in five health facil-ities, including two in Dakar (n=166) and one in each of the following regional capitals: Saint-Louis (n=400), Ziguinchor (n=264) and Kédougou (n=397). The median age among was 25 years [18 - 50]. The overall sero-prevalence observed was 64.9% (797/1227), with higher exposure rates in Dakar with 71.6% (119/166) and Ziguinchor with 68.1% (180/264). Kédougou and Saint-Louis reported 62.9% (250/397) and 62% (248/400), respectively. According to age group, the seroprevalence was 62.6% (331/528), 66.6% (238/357), 63.5% (148/223) and 67.2% (80/119) respectively for [18-23], [24-29], [30-35] and ≥36 years old. This variability in the seroprevalence of SARS-CoV-2 according to the localities was not statistically significant (p=0.7024). We found no association between factors such as recruitment period, age, level of education, marital and pro-fessional status.

SARS-CoV-2 is severe acute respiratory syndrome coronavirus 2 which induces severe pneumonia that has considerable death rate. In this article, we summarised the evolution of SARS CoV-2 from alpha to omicron variant. The origin, transmission capability, and innate immunity potential of the Omicron variety remain unknown in the aftermath of its appearance. It's also unclear whether further varieties based on Omicron may emerge in the future. However, there is no question that the Omicron version of SARS-CoV-2 would not be the last. The COVID-19 pandemic has become more difficult to control due to the constant appearance of new SARS-CoV-2 mutations. We have discussed about the epidemiology, treatment plans for SARS CoV-2 and preventive strategies for future pandemic.

The pandemic history of pathogenic SARS-CoV-2 associated COVID-19 infection began in December 2019, with its emergence in Wuhan, China. Pertaining to its high transmissibility and wide host adaptability, this new and unique human coronavirus spread across the planet affecting almost every country, inflicting 91 million people and causing 1.9 million deaths (as of January 17th, 2021). Limited or negligible pre-existing immunity to multiple SARS-CoV-2 variants has resulted in severe morbidity and mortality worldwide, as well as a record-breaking surge in the use of medical-surgical supplies and personal protective equipments. In response to the global need for effective sterilization techniques, this study evaluated the virucidal efficacy of FATHHOME’s self-contained, ozone-based dry-sanitizing device, by dose and time response assessment. We tested inactivation of human coronavirus, HCoV-OC43, a close genetic model of SARS-CoV-2, on porous (N95 filtering facepiece respirator/FFR) and nonporous (glass) surfaces. We started our assays with 20 ppm of ozone for 10 min exposure, which was able to effectively reduce, 99.8% and 99.9% of virus from glass and N95 FFR surfaces, respectively. Importantly, the virus was completely inactivated, below the detection limit (over 6-log10 reduction) with 25 ppm ozone for 15 mins on both tested surfaces. As expected, a higher ozone concentration (50 ppm) resulted in faster inactivation of HCoV-OC43 with 100% inactivation in 10 mins from both the surfaces, with no residual ozone present after completion of the 5-minute post exposure recapture cycle and no measurable increase in ambient ozone levels. These results confirmed that FATHHOME’s device may provide a safe and viable solution for rapid decontamination of SARS-CoV-2- from worn items, frequently touched items, and PPE including N95 FFRs, face shields and other personal items.

The severity of coronavirus disease 2019 (COVID-19), caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), greatly varies from patient to patient. In the present study, we explored and compared mutation profiles of SARS-CoV-2 isolated from mildly affected and severely affected COVID-19 patients in order to explore any relationship between mutation profile and disease severity. Genomic sequences of SARS-CoV-2 were downloaded from GISAID database. With the help of Genome Detective Coronavirus Typing Tool, genomic sequences were aligned with the Wuhan seafood market pneumonia virus reference sequence and all the mutations were identified. Distribution of mutant variants was then compared between mildly and severely affected groups. Among the numerous mutations detected, 14,408C>T and 23,403A>G mutations resulting in RNA-dependent RNA polymerase (RdRp) P323L and spike protein D614G mutations, respectively, were found predominantly in severely affected group (>82%) compared with mildly affected group (<46%, p<0.001). The 241C>T mutation in the non-coding region of the genome was also found predominantly in severely affected group. The 3,037C>T, a silent mutation, also appeared in relatively high frequency in severely affected group. We concluded that RdRp P323L and spike protein D614G mutations predominate in severely affected COVID-19 patients. Further studies will be required to explore whether these mutations have any impact on the severity of COVID-19.

Like all RNA viruses, SARS-CoV-2 shows high mutation rate, which has led to the emergence of new variants. Among them, Gamma and Delta developed at the turn of 2020-2021 in Amazonas and India, two ecoregions characterized by hot-humid weather, very similar to that of the summer season due to climate change in Italy, the first Western country to have been hit hard by COVID-19 and to experience lockdown restrictions in a democratic framework of 58,85 million people. Methods: during the state of national health emergency and the Draghi government, the Civil Defense Department daily released the aggregate data coming from the Ministry of Health, the Higher Institute of Health, the Independent Provinces and the Italian Regions, in order to inform about the pandemic situation in Italy. Among these data there were the number of deaths, hospitalizations in intensive care units (ICU), non-ICU patients, contagions, and performed swabs. By means of a team effort, we have collected and elaborated all these data, comparing COVID-19 pandemic in Italy during the summers 2020 (following the nationwide lockdown), 2021 and 2022. Results: from summer 2020 (before mass vaccination) to summers 2021 (after primary mass vaccination) and 2022 (after booster mass vaccination) all pandemic trend indicators have showed a sharp worsening in Italy. COVID-19 deaths increased by ≈298% and ≈834%, ICU hospitalizations by ≈386% and ≈310%, non-ICU hospitalizations by ≈224% and ≈600%, contagions by ≈627% and ≈6.850% (i.e. ≈68,50 times), swabs by ≈354% and ≈370%, and the mean positivity rate passed from ≈1% to ≈2% and ≈20%, respectively. Conclusions: SARS-CoV-2 can be transmitted in any climate, including areas with hot and humid weather, and the emergence of variants adapted to hot-humid climate may result in summer COVID-19 outbreaks, even in neither tropical nor subtropical countries. Although COVID-19 vaccines can confer cross-protection against newly emerging variants, this cross-immunity is obviously not absolute but limited, also taking into account that vaccine protection wanes considerably after 6 months. It follows that a subject vaccinated at the beginning of winter will not be completely covered in the height of summer, without forgetting the unvaccinated. As a final remark, the long nationwide lockdown made it possible to flatten SARS-CoV-2 circulation and, therefore, its negative impact on Italy during summer 2020.

Novel coronavirus disease (COVID-19) has affected nearly 7 million individuals and claimed more than 0.4 million lives to date. There are several reports of gender differences related to infection and death due to COVID-19. This raises important questions such as “Whether there are differences based on gender in risk and severity of infection or mortality rate?” and “What are the biological explanation and mechanisms underlying these differences?” Emerging evidence has proposed sex-based immunological, genetic, and hormonal differences to explain this ambiguity. Besides biological differences, women have also faced social inequities and economic hardships due to this pandemic. Several recent studies have shown that independent of age males are at higher risk for severity and mortality in COVID-19 patients. Although susceptibility to SARS-CoV-2 was found to be similar across both genders in several disease cohorts, a disproportionate death ratio in men can be partly explained by the higher burden of pre-existing diseases and occupational exposures among men. From an immunological point of view, females can engage a more active immune response, which may protect them and counter infectious diseases as compared to men. This attribute of better immune responses towards pathogens is thought to be due to high estrogen levels in females. Here we review the current knowledge about sex differences in susceptibility, the severity of infection and mortality, host immune responses, and the role of sex hormones in COVID-19 disease.

The global population is currently experiencing the impact of the SARS-CoV-2 coronavirus, which has caused the Coronavirus Disease 2019 (COVID-19) pandemic. By our profound comprehension of COVID-19, encompassing the involvement sequence of the respiratory tract, gastrointestinal system, and cardiovascular apparatus, the multiorgan symptoms of this infectious disease have been discerned. Metabolic-associated fatty liver disease (MAFLD) is a pervasive public health concern, intricately linked with metabolic dysregulation and estimated to afflict one-fourth of the global adult population. The burgeoning focus on the association between COVID-19 and metabolic dysfunction-associated fatty liver disease (MAFLD) is justified by the potential role of the latter as a risk factor for both SARS-CoV-2 infection and the subsequent emergence of severe COVID-19 symptoms. Investigations have suggested that changes in both innate and adaptive immune responses among metabolic dysfunction-associated fatty liver disease (MAFLD) patients may play a role in determining the severity of COVID-19. The remarkable similarities observed in the cytokine pathways implicated in both diseases imply the existence of shared mechanisms governing the chronic inflammatory responses characterizing these conditions. The effect of metabolic dysfunction-associated fatty liver disease (MAFLD) on the severity of COVID-19 illness remains uncertain, as indicated by conflicting results in cohort investigations.

Since the beginning of 2020, tetracycline (TC), such as minocycline (MINO), has been used to inhibit coronavirus disease 2019 (COVID-19). Traditional Japanese Kampo medicine, such as Saiko-keishi-to (SKT), has recently received a lot of attention for its anti-severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) effects. We describe a COVID-19 patient treated with MINO and SKT in anticipation of their anti-SARS-CoV-2 properties. A 90-year-old male patient with Alzheimer’s disease was referred to a medical clinic due to fever, appetite loss, and general malaise. Based on positive SARS-CoV-2 rapid antigen tests, he was diagnosed with COVID-19. He did not have COVID-19 pneumonia, but he had difficulty in eating on his own. As a result, he was referred to a hospital for admission. After admission, he was treated with molnupiravir to avoid aggravation. Seven days after his admission, he was discharged. After his discharge, he was referred to our hospital as an outpatient due to a prolonged mild fever and general malaise. As a precaution, a real-time reverse transcription-polymerase chain reaction (RT-PCR) test was performed, which yielded a positive result. Therefore, the aforementioned symptoms were thought to be caused by prolonged COVID-19. He was treated with MINO and SKT due to the anti-viral properties of these two drugs. The RT-PCR test became negative 7 days after receiving this treatment, and the fever and general malaise subsided.

The coronavirus disease 2019 (COVID-19) pandemic has caused considerable global disruption to clinical practice. This article will review the impact that the pandemic has had on oncology clinical trials. It will assess the effect of the COVID-19 situation on the initial presentation and investigation of patients with suspected cancer. It will also discuss the impact of the pandemic on the subsequent management of cancer patients and how clinical trial approval, recruitment and conduct were affected during the pandemic. An intriguing aspect of the pandemic is that clinical trials investigating treatments for COVID-19 and vaccinations against the causative virus, SARS-CoV-2, have been approved and conducted at unprecedented speed. In light of this, this re-view will also discuss the potential that this enhanced regulatory environment could have on the running of oncology clinical trials in the future.

Vision is our primary sense as the human eye is the gateway for more than 65% of information reaching the human brain. Today’s increased exposure to different wavelengths and intensities of light from Light Emitting Diodes (LEDs) sources could induce retinal degeneration and accompanying neuronal cell death. Damage induced by chronic phototoxic reactions occurring in the retina accumulates over years and it has been suggested to be responsible for the etiology of many debilitating ocular conditions. In this work, we examined how LED stimulation affects vision by monitoring changes in the expression of death and survival factors as well as microglial activation in LED-induced damage (LID) of the retinal tissue. We found an LED exposure-induced increase in the mRNA levels of major apoptosis-related markers -BAX, Bcl-2, and Caspase-3 and an accompanying wide-spread microglial and Caspase-3 activation. Everyday LED light exposure was accounted for all the described changes in the retinal tissue of mice in this study, indicating that overuse of non-filtered direct LED light can have detrimental effects on the human retina as well.

(1) Background: Nicotine is implicated in the SARS-COV-2 infection through activation of the α7-nAChR and over-expression of ACE2. Our objective is to clarify the role of nicotine in SARS-CoV-2 infection exploring its molecular and cellular activity. (2) Methods: HBEpC or si-mRNA-α7-HBEpC were treated for 1, 48 h or continuously with 10-7 M Nicotine, a concentration mimicking human exposure to a cigarette. Cell viability and proliferation were evaluated by trypan blue dye exclusion and cell counting, migration by cell migration assay, senescence by SA-beta-Gal activity, and anchorage-independent growth by cloning in soft agar. Expression of Ki67, p53/phospho-p53, VEGF, EGFR/pEGFR, phospho-p38, intracellular Ca+2, ATP and EMT were evaluated by ELISA and/or western blotting. (3) Results: Nicotine induced through α7-nAChR (i) increase in cell viability (ii) cell proliferation; (iii) Ki67 over-expression, (iv) phospho-p38 up-regulation (v) EGFR/pEGFR over-expression; (vi) increase in basal Ca+2 concentration, (vii) reduction of ATP production; (viii) decreased level of p53/phospho-p53, (ix) delayed senescence, (x) VEGF increase, (xi) EMT and consequent (xii) enhanced migration, and (xiii) ability to grow independently of the substrate. (4) Conclusions: Based on our results and on evidence showing that Nicotine potentiates viral infection it is likely that Nicotine is involved in SARS-CoV-2 infection and severity

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), an RNA virus, is responsible for coronavirus disease 2019 (COVID-19) pandemic of 2020. Experimental evidence suggests that microRNA can mediate an intracellular defence mechanism against some RNA viruses. The purpose of this study was to identify microRNA with predicted binding sites in the SARS-CoV-2 genome, compare these to their microRNA expression profiles in lung epithelial tissue and make inference towards possible roles for microRNA in mitigating coronavirus infection. We hypothesize that high expression of specific coronavirus-targeting microRNA in lung epithelia may protect against infection and viral propagation, conversely low expression may confer susceptibility to infection. We have identified 128 human microRNA with potential to target the SARS-CoV-2 genome, most of which have very low expression in lung epithelia. Six of these 128 microRNA are differentially expressed upon in vitro infection of SARS-CoV-2. Twenty-eight and 23 microRNA also target the SARS-CoV and MERS-CoV, respectively. In addition, 48 and 32 microRNA are commonly identified in two other studies. Further research into identifying bona fide coronavirus targeting microRNA will be useful in understanding the importance of microRNA as cellular defence mechanism against pathogenic coronavirus infections.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), known to cause 2019-coronavirus disease (COVID-19) pandemic is a zoonotic coronavirus and crosses species to infect human populations, where an efficient transmission of virus occurs human-to-human. Nationwide lockdown is being adopted to stop public transport, keep people at their homes and out of their work, and maintain social distancing. In turn, large geographic areas in the world (including China, Italy, Spain, and USA) has been almost halted. This temporary halt is significantly slashing down the air pollution (air pollutants and warming gases) in most cities across the world. This paper: (i) introduces both COVID-19 and air pollution; (ii) overviews the relation of air pollution with respiratory/lung diseases; (iii) compiles and highlights major data appeared in media and journals reporting lowering of air pollution in major cities those have been highly impacted by the COVID-19; and also (iv) lists the way forward in the present context. Because COVID-19 is an ongoing pandemic and currently far from over, strong conclusions could not be drawn with very limited data at present. The temporary slashed down global air pollution as a result of COVID-19 restrictions are expected to stimulate the researchers, policy makers and governments for the judicious use of resources; thereby minimise the global emissions, and maintain their economies once the pandemic eases. On the other, lifting of the nationwide lockdown and eventual normalisation of the temporarily halted sectors may also reverse the currently COVID-19 pandemic-led significantly slashed down global air pollution that could make the future respiratory health crisis grimmer.

Aim: To perform a descriptive analysis of eating patterns and biophysical conditions of previously diagnosed and currently under treatment individuals from a semi-urban Mayan community of Yucatan, and to contrast them with T2DM therapeutic guidelines. Methods: The present study is derived from a randomized clinical trial conducted at Komchen, Yucatan. Participants’ diagnosed with T2DM were included. A 24-hour dietary recall, anthropometric parameters (weight, visceral fat, height, and waist circumference), biochemical (HbA1c) and clinical (blood pressure) variables were evaluated and compared via hypothesis test with T2DM treatment cut-off points (based on World Health Organization criteria). Results: Anthropometric characteristics differ significantly from the ideal criteria. Obesity prevalence within women with T2DM was 92.9%. Only 21% of the participants were under T2DM control (≤7%). Energy and carbohydrates consumption, significantly exceed therapeutic guidelines, whereas protein, fat, and fiber intake were lower than the recommendations. Conclusions: Komchen’s diet, concomitantly with food characteristics, could be related to glycemic decontrol. There is a disproportion in macronutrients consumption in favor of carbohydrates, probably associated with socioeconomic limitations, food availability, and price. Developing nutritional assistance programs which contemplate cultural and economic factors in this Mayan population must be taken into consideration.

In the Mediterranean area, vegetation dynamics and phenology analyzed over a long time can have an important role in highlighting changes in land use and cover as well as the effect of climate change. Over the last 30 years, remote sensing has played an essential role in bringing about these changes thanks to many types of observations and techniques. Satellite images are to be considered an important tool to grasp these dynamics and evaluate them in an inexpensive and multidisciplinary way thanks to Landsat and Sentinel satellite constellations. The integration of these tools holds a dual potential: on one hand, allowing to obtain longer historical series of reflectance data, while on the other hand, making data available with a higher frequency even within a specific timeframe. The study aims to conduct a comprehensive cross-comparison analysis of long-time series pixel values in the Mediterranean regions. For this scope comparisons between Landsat-7 (ETM+), Landsat-8 (OLI), and Sentinel-2 (MSI) satellite sensors were conducted based on surface reflectance products. We evaluated these differences using Ordinary Least Squares (OLS) and Major Axis linear regression (RMA) analysis on points extracted from over 15,000 images across the Mediterranean basin area from 2017 to 2020. Minor but consistent differences were noted, necessitating the formulation of suitable adjustment equations to better align Sentinel-2 reflectance values with those of Landsat-7 or Landsat-8. The results of the analysis are compared with the most used harmonization coefficients proposed in the literature, revealing significant differences. The root mean square deviation, the mean difference and the orthogonal distance regression (ODR) slope show an improvement of the parameters for both models used (OLS and RMA) in this study. The discrepancies in reflectance values lead to corresponding variations in the estimation of biophysical parameters, such as NDVI, showing an increase in the ODR slope of 0.3. Despite differences in spatial, spectral, and temporal characteristics, we demonstrate that integration of these datasets is feasible through the application of band-wise regression corrections for a sensitive and heterogeneous area like those of the Mediterranean basin area.

The emergence of the SARS-CoV-2 Variant of Concern (VOC) Omicron has been characterized by an explosive number of cases in almost every part of the world. The dissemination of different sub-lineages and recombinant genomes also led to several posterior waves in many countries. The circulation of this VOC and its major sub-lineages (BA.1 to BA.5) was monitored in community cases and in international travelers returning to Venezuela, by a rapid partial sequencing method. The specific sub-lineage assignment was performed by complete genome sequencing. Epidemic waves of SARS-CoV-2 cases were observed among international travelers during 2022, a situation not seen before December 2021. The succession of the Omicron VOC sub-lineages BA.1 to BA.5 occurred sequentially, except for BA.3, which was almost not detected. However, the sub-lineages generally circulated two months earlier in international travelers than in community cases. The diversity of Omicron sub-lineages found in international travelers was related to the one found in the USA, consistent with the most frequent destination of international travel from Venezuela this year. These differences are compatible with the delay observed in Latin American countries in the circulation of the different lineages of the Omicron VOC.

The development of effective vaccines against SARS-CoV-2 remains a critical challenge amidst the ongoing global pandemic. This study introduces a novel approach to enhance mRNA vaccine efficacy by leveraging the untranslated region (UTR) of TMSB10, a gene identified for its significant mRNA abundance in antigen-presenting cells. Utilizing the GEO database, we identified TMSB10 among nine genes with the highest mRNA abundance in dendritic cell subtypes. Subsequent experiments revealed that TMSB10's UTR significantly enhances the expression of a reporter gene in both antigen-presenting and 293T cells, surpassing other candidates and a previously optimized natural UTR. Comparative analysis demonstrated that TMSB10 UTR not only facilitated higher reporter gene expression in vitro but also showed marked superiority in vivo, leading to enhanced specific humoral and cellular immune responses against the SARS-CoV-2 Delta variant RBD antigen. Specifically, vaccines incorporating TMSB10 UTR induced significantly higher levels of specific IgG antibodies and promoted a robust T-cell immune response, characterized by increased secretion of IFN-γ and IL-4 and the proliferation of CD4+ and CD8+ T cells. These findings underscore the potential of TMSB10 UTR as a strategic component in mRNA vaccine design, offering a promising avenue to bolster vaccine-induced immunity against SARS-CoV-2 and potentially other pathogens.

Feline calicivirus (FCV) causes upper respiratory tract disease (URTD) and sporadic outbreaks of virulent systemic disease (FCV-VSD). The basis for the increased pathogenicity of FCV-VSD viruses is incompletely understood, and antivirals for FCV have yet to be developed. We investigated the clinicoepidemiology and viral features of three FCV-VSD outbreaks in Australia and evaluated the in vitro efficacy of nitazoxanide (NTZ), 2’-C-methylcytidine (2CMC) and NITD-008 against FCV-VSD viruses. Overall mortality among 23 cases of FCV-VSD was 39%. Metagenomic sequencing identified five genetically distinct FCV lineages within the three outbreaks, all seemingly evolving in situ in Australia. Notably, no mutations that clearly distinguished FCV-URTD from FCV-VSD phenotypes were identified. One FCV-URTD strain likely originated from a recombination event. Analysis of seven amino acid residues from the hypervariable E region of the capsid in the cultured viruses provided no support for the contention that properties of these residues can reliably differentiate between the two pathotypes. On plaque reduction assays, dose-response inhibition of FCV-VSD was obtained with all antivirals at low micromolar concentrations; NTZ EC50, 0.4-0.6 µM, TI 21; 2CMC EC50, 2.7-5.3 µM, TI >18; NITD-008, 0.5 to 0.9 µM, TI >111. Investigation of these antivirals for treatment of FCV-VSD is warranted.

SARS-CoV-2 is a novel and highly pathogenic coronavirus, which was first diagnosed in Wuhan city, China, in 2019, and spread to 185 countries and territories, and as of April 29, 2020, more than 3.11 million cases were recorded, and more than 217,000 people were killed. Despite all worldwide efforts, there is currently no vaccine, any drugs available to protect people against deadly SARS-CoV-2 coronavirus. The world urgently needs a SARS-CoV-2 coronavirus vaccine or effective antiviral drugs to relieve the human suffering associated with the pandemic that kills thousands of people every day. The SARS-CoV-2 genome encode a non-structural proteins named as ORF1a/b, and structural proteins such as spike (S) glycoprotein, nucleocapsid protein (N), small envelop protein (E) and matrix protein (M). A number of studies have been shown that CoV spike (S) glycoprotein and nucleocapsid protein (N) could be promising targets for vaccine, antibodies and therapeutic drug development to combat with deadly, pandemic SARS-CoV-2. Purposes of the present paper is the sequence analysis and amino acid variations of structural proteins deduced from novel coronavirus SARS-CoV-2 strains, isolated in different countries. Multiple sequence alignment of S, N and E proteins from four different coronavirus species, are also described. It is expected that the data from these studies will be very useful for the the designing and development of vaccines, antibodies and therapeutic agents that can be used to combat with the highly pathogenic SARS-CoV-2 coronavirus worldwide.

Multispectral and 3D LiDAR remote sensing data sources are valuable tools for characterizing the 3D vegetation structure and thus understanding the relationship between forest structure, biodiversity and microclimate. This study focuses on mapping riparian forest species in the canopy strata using a fusion of Airborne LiDAR data and multispectral multi-sources and multi-resolution satellite imagery; Sentinel-2 and Pleiades at tree level. The idea is to assess the contribution of each data source in the tree species classification at the considered level. The data fusion was processed at feature-level and decision level. At feature level, LiDAR 2D attributes were derived and combined with vegetation indices. At decision level, LiDAR data was used for 3D tree crown delimitation providing unique trees or groups of trees that are used as a support for the species classification. Data augmentation techniques were used to improve the training process. Best results were obtained by the fusion of Sentinel-2 time series and LiDAR data with a Kappa of 0.66 thanks to red-edge based indices that better discriminate vegetation species and the temporal resolution of Sentinel-2 images that allows monitoring the phenological stages helping to discriminate the species.

Transferrin (TF) is a key iron carrier protein. Studies in human cohorts and in cultured adipocytes suggested that decreased transferrin expression and intracellular iron in adipocytes leads to impaired insulin responsiveness and causes differential expression of genes involved in metabolism, insulin action, and obesity. While suggestive, these studies did not definitively prove in an intact organism that altering TF expression in adipocytes is sufficient to affect glucose homeostasis and insulin resistance. In this study we created a mouse model of decreased transferrin expression only in adipocytes (Trf+/-Cre+/-) to test the hypothesis that iron trafficking in adipose tissue is sufficient to affect insulin sensitivity. Area under the glucose curve (AUCg) after intraperitoneal glucose administration was increased in the Trf+/-Cre+/- mice compared to wild type (WT) mice on a normal chow diet, and the mice were slightly heavier (p=0.02 for both). Homeostasis Model of Insulin Resistance (HOMA-IR) values were also significantly higher in the Trf+/- Cre+/- mice (p<0.05). Thus, supporting our hypothesis, analysis of mice with decreased expression of TF restricted to adipocytes showed that a decrease in adipocyte TF is sufficient to affect insulin resistance, weight, and glucose homeostasis.

Little is understood about the impact of nebulisation on the viability of SARS-CoV-2. In this study, a range of nebulisers with differing methods of aerosol generation were evaluated to determine SARS-CoV-2 viability following aerosolisation. The aerosol particle size distribution was assessed using an aerosol particle sizer (APS) and SARS-CoV-2 viability was determined after collection into liquid media using All-Glass Impingers (AGI). Viable particles of SARS-CoV-2 were further characterised using the Collison 6-jet nebuliser in conjunction with novel sample techniques in an Andersen size-fractioning sampler to predict lung deposition profiles. Results demonstrate that all the tested nebulisers can generate stable, polydisperse aerosols (Geometric standard deviation (GSD) circa 1.8) in the respirable range (1.2 to 2.2µm). Viable fractions (PFU/particle, the virus viability as a function of total particles produced) were circa 5x10^-3 and were not significantly affected by relative humidity. The novel Andersen sample collection methods successfully captured viable virus particles across all sizes; with most particle sizes below 3.3µm. MMADs (Mass Median Aerodynamic Diameters) were calculated from linear regression of log10-log10 transformed cumulative PFU data, and calculated MMADs accorded well with APS measurements and did not differ across collection method types. This data will be vital in informing animal aerosol challenge models, and infection prevention and control policies.

Background: Overcrowded housing, as well as inadequate sanitary conditions, contribute to making homeless people particularly vulnerable to the SARS-CoV-2 infection. We aimed to assess the seroprevalence of the SARS-CoV-2 infection among people experiencing homelessness on a large city-wide scale in France, taking into account different community settings. Methods: A consortium of outreach teams in 48 different locations including streets, slums, squats, emergency or transitional shelters and drop-in centres participated in the inclusion process. All participants consented to receive a validated rapid assay for immunoglobulins M (IgM) and G (IgG) antibodies and to answer a questionnaire on medical health conditions, comorbidities, historic of symptoms compatible with COVID-19, with a retrospective calendar of types of accommodation since COVID-19 crisis. Results: From June 01 to August 05, 2020, 1,156 homeless participants were enrolled in the study and tested. Seroprevalence of SARS-CoV-2 IgG/IgM antibodies was 5.6% (95%CI 2.3–7.0), with a range of 2.2% in people living on the streets to 8.1% in people living in emergency shelters (P=0.009). Around one third of the seropositive participants reported symptoms with COVID-19. Compared to the general population in Marseille (3.6%), the homeless population living in the same urban area experienced an significant increased risk of SARS-CoV-2 infection (|z|=3.65 > 1.96). Conclusion: These results highlight the need for organizing regular screening to prevent clusters forming in homeless accommodations and for providing basic resources for health maintenance.

Three patients with severe life-threatening COVID-19 who failed to achieve substantial improvement on tocilizumab, received pulse therapy with corticosteroids (methylprednisolone, 1000 mg/day IV for three consecutive days) and intravenous immunoglobulin (20 g/day IV). This was associated with a prompt resolution of respiratory failure, elimination of cytokine release syndrome, and reversal of pulmonary CT changes. The treatment was generally safe and well tolerated. There was no evidence of protracted persistence of the virus in the patients who received pulse therapy. Randomized controlled trials are necessary to specify the efficacy and safety of high-dose methylprednisolone and intravenous immunoglobulin in the treatment of severe life-threatening COVID-19 separately or in combination.

Coronavirus Disease 2019 (COVID-19), caused by a novel coronavirus named Severe Acute Respiratory Syndrome - Coronavirus-2 (SARS-CoV-2), emerged in early December 2019 in China and attained a pandemic situation worldwide by its rapid spread to nearly 167 countries with 287.239 confirmed cases and 11.921 human deaths with a case fatality rate (CFR) of around 4 per cent. Bats were considered as the reservoir host, and the search of a probable intermediate host is still going on. Animals have anticipated culprit of SARS-CoV-2 as of now. The disease is mainly manifested by pneumonia and related respiratory signs and symptoms, but the involvement of the gastrointestinal system and nervous system is also suggested. The severe form of the disease associated with death is mainly reported in older and immune-compromised patients with pre-existing disease history. Death in severe cases is attributed to respiratory failure associated with hyperinflammation. Cytokine storm syndrome associated with rampant inflammation in response to SARS-CoV-2 infection is considered as the leading killer of COVID-19 patients. COVID-19 patients were reported with higher levels of many pro-inflammatory cytokines and chemokines like IFN-g, IL-1b, IP-10, and MCP-1. Furthermore, severe cases of COVID-19 revealed higher levels of TNF-α, G-CSF, and MIP-1A. Blood profile of the COVID-19 patients exhibits lymphopenia, leucopenia, thrombocytopenia and RNAaemia along with increased levels of aspartate aminotransferase. SARS-CoV-2 infection in pregnant women does not lead to fetus mortalities unlike other zoonotic coronaviruses like SARS-CoV and MERS-CoV, with no evidence of intrauterine transmission to neonates. Rapid and confirmatory diagnostics have been developed, and high efforts are being made to develop effective vaccines and therapeutics. In the absence of any virus-specific therapeutic, internationally health care authorities are recommending adoption of effective prevention and control measures to counter and contain this pandemic virus. This paper is an overview of this virus and the disease with a particular focus on SARS-COV-2 / COVID-19 clinical pathology, pathogenesis and immunopathology along with a few recent research developments.

Background: Dental professions are at high risk of contracting novel corona virus (COVID-19) infections during the dental procedure due to the droplets and aerosols generated during various dental procedures on infected patients. To prevent and avoid the cross-infection of the infection to dental professionals or the patients attending the dental clinic, good knowledge of the infection and its prevention mechanisms is mandatory among the professionals. Until to date, there is no pooled estimate on the knowledge,attitude and practice (KAP) of dental professionals to COVID-19 in the globe. Hence, this study aimed to determine the pooled estimate of KAP of dental professionals in this pandemic disease. Methods: Article search was done electronically using Medline, Scopus, Web of Science, EMBASE, SciELO and Google Scholar from June 1, 2020 to August 20, 2020. All studies that assessed the KAP of dental professionals to COVID-19 were searched and included in this review after passing the inclusion criteria. The pooled analysis of their knowledge (sign and symptom, mode of transmission and prevention mechanisms), attitude (their concern, intention to treat suspected patients) and practice (face mask usage, hand washing and alcohol based hand rub usage, handshaking practice, deferred procedures and checkup of patients temperature) was computed using RevMan 5.3 and random effect model was used. The presence of publication bias was assessed using the funnel plot. Results: Twelve articles with a total of 5,362 study participants were included in this study. The pooled estimate revealed that 59.91% of the dental professionals had good knowledge of the signs and symptoms of COVID-19. Two-third of dental professionals know the prevention mechanisms of the infection, and 70.13% had enough knowledge of the transmission modalities of the infection. The professional attitude revealed that only 36.43% of the participants had intention to treat a patient with cough or suspected COVID-19 (36.43%, 95%CI: 8.57, 64.29). Moreover, 47.85% of the dentists were concerned about their life, and the fate of their profession due to this pandemic disease (47.85%, 95%CI: 26.74, 68.97). The pooled analysis showed only 50.86% (95%CI: 18.64, 83.09) of the study participants worn face mask and 52.63% (95%CI: 10.54, 94.71) had avoided handshaking practice during this pandemic period. Non-emergency dental procedures were canceled by 83.98%. Conclusion: The dental professional KAP is not optimal. Thus, dental professionals should be aware of the recently updated knowledge about COVID-19 and practice according to the standards of treatment guidelines, and the recommended infection control measures in dental settings. Moreover, as saliva and droplets are the major sources of infection, dentists should follow essential protocols to regulate droplet and aerosol contamination in the dental practice

Dengue is one the most significant mosquito-borne viral diseases globally, with its prevalence extending across tropical and subtropical regions, exerting a considerable financial strain on health systems. Despite decades of research leading to the development of a vaccine implemented in endemic countries, its usage remains restricted to a fraction of the population at risk of contracting dengue. Due to these limitations, there is a growing focus on research aimed at unraveling the cellular mechanisms crucial for Dengue virus (DENV) infection to pinpoint potential host targets. Multiple studies propose a pivotal role of cytoskeletal remodeling in DENV infection. Specifically, DENV alters the organization of actin to facilitate viral entry, replication, and release. In this study, we investigated the involvement of the protein c-Abl, a kinase crucial in actin dynamics, in the context of DENV infection. Our findings suggest that either silencing or pharmacological inhibition of the kinase c-Abl leads to accumulation of dengue ENV protein in vitro, associated with actin remodeling. These results illuminate cellular mechanisms that could serve as potential therapeutic alternatives for dengue management.

Background and Objectives: Most individuals infected by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) are asymptomatic or have mild symptoms of COVID-19, which usually resolve after few days. Regardless of symptoms, infected people can transmit the virus to others especially on the first days of infection. Quantitative reverse transcription-polymerase chain reaction (RT-qPCR) is used to confirm SARS-CoV-2 infection; some individuals show persistent PCR-positivity after recovering from COVID-19. In this study, 12 individuals who showed persistence of COVID-19 symptoms and of SARS-CoV-2 PCR-positivity were followed-up. Methods: nasopharyngeal samples were collected for SARS-CoV-2 detection by RT-qPCR; clinical and epidemiological data were analyzed. Results: that persistence of SARS-CoV-2 PCR positivity was associated with duration of symptoms (r_s 0.81338), which varied between one and 49 days, with 75% of the individuals reporting symptoms for more than two weeks; 83.33% of cases remained positive after two weeks of onset of symptoms, despite decreases in viral load. Conclusion: neither RT-qPCR test nor a symptom-based approach alone are sufficient to evaluate discontinuation of patient isolation; other factors such as viral loads and symptom severity should also be considered. Additional studies are needed to understand how RT-PCR-positivity is related to symptoms and the risk of viral transmission, and to better support isolation guidelines.

More than 1,000,000 confirmed cases of COVID-19 have been registered worldwide since the beginning of the pandemic in Wuhan on December 2019. The high mortality rate of COVID-19 is associated with age, gender and the presence of comorbidities. Biochemical data have shown that COVID-19 patients develop a local and systemic hyper-inflammatory response associated with poor outcome. Therefore, the understanding of the biological mechanisms underlying SARS-CoV-2-induced inflammation is a compelling need. Following this reasoning, here we will focus on the importance of the progressive age-related development of a pro-inflammatory state (aka inflamm-aging) in the understanding of the unbalanced inflammatory response against SARS-CoV-2 in aged people. In particular, we underpin the role of mitochondrial DNA and genomic DNA telomeric sequences in local and systemic mechanisms of inflammation. Indeed, the leakage of mtDNA out of its natural compartment (i.e. the mitochondrion), into the cytoplasm and in the extracellular environment is a powerful trigger of innate immunity and inflammation, as part of an evolutionary-conserved signaling mechanism of cellular damage (e.g. viral infection). High levels of circulating mtDNA are increased in aged people and set up as inflammatory markers of poor prognosis in intensive care unit patients. In turn, telomeric DNA, which can be released into the cytoplasm and in the extracellular environment upon cell damage, has been proven to exert potent anti-inflammatory activity. Since that aged people (particularly those affected by co-morbidity) are equipped with shortened telomeres, we posit that, in aged people affected by COVID-19 the release of mtDNA, coupled with insufficient telomeric DNA favors the onset of a detrimental inflammatory response. In this regard, we highlight that the mechanism of action of some currently used drugs, as well as potential new ones may be better understood under the light of the above-depicted theoretical framework thus explaining how studies on inflamm-aging may help to understand and combat COVID-19 pandemic.

COVID-19 pandemic is a serious problem in the world today. The SARS-CoV-2 virus that causes COVID-19 has important proteins used for its infection and development, namely the protease and spike glycoprotein. The RBD (Receptor Binding Domain) of spike glycoprotein (RBD-S) can bind to the ACE2 (Angiotensin Converting Enzyme-2) receptor at the protease domain (PD) (PD-ACE2) of the host cell, thereby leading to a viral infection. This study aims to reveal the potential of compounds contained in Curcuma sp., Citrus sp., Alpinia galanga, and Caesalpinia sappan as anti SARS-CoV-2 through its binding to 3 protein receptors. The study was conducted by molecular docking using the MOE 2010 program (licensed from Faculty of Pharmacy UGM, Indonesia). The selected protein targets are RBD-S (PDB ID:6LXT), PD-ACE2 (PDB ID: 6VW1), and SARS-CoV-2 protease (PDB ID:6LU7). The affinities of bonds formed is represented as a docking score. The results show that hesperidin, one of the compounds in Citrus sp., has the lowest docking score for all three protein receptors representing the highest affinity to bind the receptors. Moreover, all of the citrus flavonoids possess good affinity to the respected receptors as well as curcumin, brazilin, and galangin, indicating that those compounds perform inhibitory potential for the viral infection and replication. In general, the results of this study indicate that Citrus sp. exhibit the best potential as an inhibitor to the development of the SARS-CoV-2, followed by galangal, sappan wood, and Curcuma sp. that can be consumed in daily life as prophylaxis of COVID-19.

In the search of potent α-amylase inhibitors, we have synthesized seventeen derivatives of 2-mercaptobenzimidazole bearing sulfonamide (1-17) and evaluated for their α-amylase inhibitory potential. All compounds display a variable degree of α-amylase activity having IC50 values ranging between 0.90 ± 0.05 to 11.20 ± 0.30 µM when compared with the standard drug acarbose having IC50 value 1.70 ± 0.10 µM. Compound 1, 2, 11, 12 and 14 having IC50 values 1.40 ± 0.10, 1.30 ± 0.05, 0.90 ± 0.05, 1.60 ± 0.05 and 1.60 ± 0.10 µM respectively were found many folds better than the standard drug acarbose. The remaining analogs showed good inhibitory potentials. All the synthesized compounds were characterized by HREI-MS, 1H and 13C-NMR. Structure activity relationship (SAR) has been recognized for all newly synthesized analogs. Through molecular docking study, binding mode of active analogs with α-amylase enzyme was confirmed.

The dynamical equations of the susceptible-infected-recovered/removed (SIR) epidemics model play an important role to predict and/or analyze the temporal evolution of epidemics outbreaks. Crucial input quantities are the time-dependent infection ($a(t)$) and recovery ($\mu (t)$) rates regulating the transitions between the compartments $S\to I$ and $I\to R$, respectively. Accurate analytical approximations for the temporal dependence of the rate of new infections $\dot{J}(t)=a(t)S(t)I(t)$ and the corresponding cumulative fraction of new infections $J(t)=J(t_0)+\int_{t_0}^tdx\dot{J}(x)$ are available in the literature for either stationary infection and recovery rates and for a stationary value of the ratio $k(t)=\mu (t)/a(t)$. Here a new and original accurate analytical approximation is derived for general, arbitrary and different temporal dependencies of the infection and recovery rates which is valid for not too late times after the start of the infection when the cumulative fraction $J(t)\ll 1$ is much less than unity. The comparison of the analytical approximation with the exact numerical solution of the SIR-equations for different illustrative examples proves the accuracy of the analytical approach.

The Coronavirus disease-19 (COVID-19) pandemic dramatically impacted on oncologic patients' care. Since the introduction of vaccines and the demonstration of their benefit on frail patients, COVID-19 vaccinations were indicated also for oncologic population. However, data about the impact of anticancer-treatments and the timing between vaccinations and systemic therapy de-livery were not available. We aimed to evaluate potential factors influencing the outcome of COVID-19 vaccination in cancer patients. We prospectively collected data of patients undergoing COVID-19 vaccination with gas-tro-entero-pancreatic and neuroendocrine neoplasms, treated at our Institute, between 03/2021 and 12/2021. We enrolled 46 patients, 63.1% males; at the time of data collection 86.9% received two-doses of Pfizer-BioNTech and the remains Moderna vaccine. All patients obtained a subsequent im-mune-response. A significantly lower values of IgG for patients treated with chemotherapy versus other anti-cancer agents (p=0.004). No significant effect on immune-response was reported for both vaccinations performed ≤7 vs >7 days from the last systemic treatment (p=0.77) and lymphocytes count (p=0.11). The findings suggest that the optimal timing for COVID-19 vaccination and lymphocytes count are not the issue but rather the quality of the subset of lymphocytes before the vaccination to deter-mine the efficacy level of immune-response in this population.

Objective: The objective of the present study was to evaluate the activities of daily living using the Barthel Index, before and after the infection by SARS-COV-2 and to see if the results vary according to sex. Methods: The activities of daily living of 68 cohabiting geriatric patients, 34 men and 34 women, in 2 nursing homes were measured before and after SARS-COV-2 infection using the Barthel index. Results: The Covid 19 infection affects the performance of daily life activities in institutionalized elderly in nursing homes, and it does so especially the older the subject, regardless of sex. Conclusions: The Covid 19 pandemic, in addition to having claimed some victims, especially in the elderly population, has reduced the ability of these people to carry out their activities of daily life, considerably worsening their quality of life despite have been able to overcome the disease.

: During the period of COVID-19, the Chinese government implemented a series of actions to prevent the spread of the virus. It is noticed that these preventive actions have generated positive effects on air pollution in Wuhan and Beijing. And, due to the differences in city functions, geographic locations, meteorological conditions, and preventive action details between the two cities, noticeable difference is observed on how they reduced air pollution. This unfortunate incident has become a social sample for studying the industrial and livelihood activities impact on air pollution, otherwise would be highly impossible. This paper starts from observing data from NASA's real-time fine particulate matter (PM2.5) and NO2, and comparing the air pollution in this special time domain with previous years. It is discovered that both PM2.5 and NO2 have been reduced in Wuhan, while only NO2 has significant reduction in Beijing, during the COVID-19 responses. This suggests that the human activity suppression by the COVID-19 control yields different effects on different pollutants and in different cities. Possible reasons for such effects are analysed by considering the public health control levels as well as the pollutant migration, industrial activities, and the weather conditions.

Novel SARS-CoV-2, a bat based virus originated in Wuhan, China that caused a global pandemic in December, 2019 belongs to the Betacorona virus family and contains single stranded genome of ~29Kbp. The host cell invasion of SARS-CoV-2 is facilitated by interaction of C-Terminal Domain (CTD) of Spike (S) protein of virus and host ACE2 receptor in the presence of TMPRSS seine protease secreted by the host cell. In this study the mutation hotspots of S-protein will be identified and the impact of such mutation in the binding affinity will be studied. Additionally, the lead molecule which can bind to the mutated protein also will be identified. Multiple sequence alignment of the spike protein sequence of SARS-CoV-2 shows the number of single amino acid mutation hotspots such as L5F, R214L, R408I, G476S, V483A, H519Q, A520S, T572I, D614G and H655Y. Among these mutations D614G has 57.5% occurrence and G476S, V483A has 7.5% occurrence. The mutated proteins were modelled based on wild type homolog and docked to ACE2 receptor. When the mutated S protein is docked, the ∆G (binding free energy) value is very minimal in mutated protein showed the stability of variants. By the drug repurposing method, 1000 FDA approved drugs were virtually screened for its binding to RBD of S1 domain. Among these drugs Digitoxin, Gliquidone and Zorubicin Hcl binds to spike proteins with higher docking score (lesser than -8.5 Kcal/mol) to both wild type and mutants.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

The risk of lung exposure to silica nanoparticles (SiNPs) and related lung inflammatory injury is increasing with the wide application of SiNPs in a variety of industries. A growing body of research has revealed that cyclooxygenase (COX)-2/ prostaglandin E2 (PGE2) up-regulated by SiNPs toxicity has a role during pulmonary inflammation. The detailed mechanisms underlying SiNPs-induced COX-2 expression and PGE2 synthesis remain unknown. The present study aims to dissect the molecular components involved in COX-2/PGE2 up-regulated by SiNPs in human pulmonary alveolar epithelial cells (HPAEpiCs) which are one of the major targets while SiNPs are inhaled. In the present study, we demonstrated that SiNPs induced COX-2 expression and PGE2 release, which were inhibited by pretreatment with a reactive oxygen species (ROS) scavenger (edaravone) or the inhibitors of proline-rich tyrosine kinase 2 (Pyk2, PF-431396), epidermal growth factor receptor (EGFR, AG1478), phosphatidylinositol 3‑kinase (PI3K, LY294002), protein kinase B (Akt, Akt inhibitor VIII), p38 mitogen-activated protein kinase (MAPK) (p38 MAPK inhibitor VIII), c-Jun N-terminal kinases (JNK)1/2 (SP600125), Forkhead Box O1 (FoxO1, AS1842856), and activator protein 1 (AP-1, Tanshinone IIA). In addition, we also found that SiNPs induced ROS-dependent Pyk2, EGFR, Akt, p38 MAPK, and JNK1/2 activation in these cells. These signaling pathways induced by SiNPs could further cause c-Jun and FoxO1 activation and translocation from the cytosol to the nucleus. AP-1 and FoxO1 activation could increase COX-2 and PGE2 levels induced by SiNPs. Finally, the COX-2/PGE2 axis might promote the inflammatory responses in HPAEpiCs. In conclusion, we suggested that SiNPs induced COX-2 expression accompanied by PGE2 synthesis mediated via ROS/Pyk2/EGFR/PI3K/Akt/p38 MAPK- and JNK1/2-dependent FoxO1 and AP-1 activation in HPAEpiCs.

Two conundrums have puzzled COVID-19 investigators: 1) morbidity and mortality is rare among Infants and young children and 2) rates of morbidity and mortality exhibit very large variances across nations, locals and even within cities. These differences correlate with rates of Haemophilus influenzae type B (Hib) and pneumococcal vaccination, which are almost universal among infants and vary widely by geography among adults and the elderly. The higher the rate of vaccination, the lower the COVID-19 morbidity and mortality. Vaccination rates with other vaccines, including BCG and poliovirus, do not correlate with COVID-19 risks. Notably, both Hib and pneumoccoci are common co-infections with influenza and coronaviruses and are associated with more severe disease and risk of death. Whether the vaccines simply protect against COVID-19 complications, directly protect against COVID-19 infection by inducing cross-reactive immunity, or are markers for some other types of protection such as availability of better healthcare, is not yet known. What is known is that improving coverage rates of Hib and pneumococcal vaccination has significantly lowered severe morbidity and mortality in influenza epidemics and might have similar efficacy for mitigating coronavirus outbreaks. If infants and children are valid indicators, the beneficial effects might be very significant. The possibility that anti-viral proteins in milk (e.g., lactoferrin) protect against COVID-19 is also explored.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.