Many studies were done in the development of drought stress-tolerant transgenic plants, including crop plants. Rice is considered to be a vital crop target for improving drought stress tolerance. Much transgenic rice showed improved drought stress tolerance was reported to date. They are genetically engineered plants that are developed by using genes that encode proteins involved in drought stress regulatory networks. These proteins include protein kinases, transcription factors, enzymes related to osmoprotectant or plant hormone synthesis, receptor-like kinase. Of the drought stress-tolerant transgenic rice plants described in this review, most of them display retarded plant growth. In crop crops, plant health is a fundamental agronomic trait that can directly affect yield. By understanding the regulatory mechanisms of retarded plant growth under drought stress, conditions are necessary precursors to developing genetically modified plants that result in high yields.

Complex proteomic and physiological approaches to study cold and heat stress responses in plant mitochondria are still limited. Variations in the mitochondrial proteome of cauliflower (Brassica oleracea var. botrytis) curds after cold and heat and after stress recovery were assayed by 2D PAGE in relation to respiratory parameters. Quantitative analysis of the mitochondrial proteome revealed numerous stress-affected protein spots. In cold alternative oxidase isoforms were extensively upregulated; major downregulations in the level of photorespiratory enzymes, porine isoforms, oxidative phosphorylation (OXPHOS) and some low-abundant proteins were observed. On the contrary, distinct proteins, including carbohydrate metabolism enzymes, heat-shock proteins, translation, protein import, and OXPHOS components were involved in heat response and recovery. Few metabolic regulations were suggested. Cauliflower plants appeared less susceptible to heat; closed stomata in heat stress resulted in moderate photosynthetic, but only minor respiratory impairments, however photosystem II performance was unaffected. Decreased photorespiration corresponded with proteomic alterations in cold. Our results show that cold and heat stress not only operate in diverse mode (exemplified by cold-specific accumulation of some heat shock proteins), but exert some associations on molecular and physiological levels. This implies more complex model of action of investigated stresses on plant mitochondria.

Neurodegenerative disorders such as Parkinson’s disease (PD), Alzheimer’s disease (AD), Amyloidal lateral sclerosis (ALS), and Huntington disease (HD) are the most concerned disorders due to the lack of effective therapeutics and dramatic rise in affected cases. Although these disorders have diverse clinical manifestations, yet they all share a common cellular stress response. These cellular stress responses including neuroinflammation, oxidative stress, proteotoxicity, and ER-stress, which combats with stress conditions, but the overwhelming cellular stress response induces cell damage. Small molecules such as flavonoids could reduce cellular stress and have gained much attention in recent years. Evidence has shown the potential use of flavonoids in several ways such as antioxidants, anti-inflammatory, and anti-apoptotic, yet their mechanism is still elusive. This review provides an insight into the mechanistic ways of flavonoids against cellular stress response that prevent the pathogenesis of neurodegenerative disorders.

While sex ratios at birth (SRB) have been shown to vary within and across populations, after over a century of research, explanations have remained elusive. A variety of ecological, demographic, economic, and social variables have been evaluated, yet their association with SRB has been equivocal. Here, in an attempt to shed light on this unresolved topic within the literature, we approach the question of what drives variation in SRB using detailed longitudinal data spanning the frontier-era to the early 20th century in a US population. Using several measures of environmental harshness, we find that fewer boys are born during challenging times. However, these results hold only for the frontier-era and not into a period of rapid industrialization. We argue that the mixed state of the literature may result from the impact and frequency of exogenous stressors being dampened in post-industrial societies.

Although migraine belongs to the main causes of disability worldwide the mechanisms of its pathogenesis are poorly known, which is among the reasons that this disease is underdiagnosed and undertreated. As migraine diagnosis is based on the subjective assessment of symptoms, there is a need to establish objective markers of its occurrence and severity. Tryptophan (TRP) metabolism has been associated with the pathogenesis of neurological and psychiatric disorders. In the present work, we investigated an association between migraine and the urine concentration of TRP and its metabolites 5-hydroxyindoleacetic acid (5-HIAA), kynurenine (KYN), kynurenic acid (KYNA) and quinolinic acid (QA) in 21 low-frequency episodic migraine patients and 32 controls. Migraine patients displayed lower urinary levels of 5-HIAA and KYNA, but KYN and QA were enhanced as compared with the controls. Consequently, the patients were characterized by different values of the 5-HIAA/TRP, KYN/TRP, KYNA/KYN, and KYNA/QA ratios. Furthermore, urinary concentration of 5-HIAA was negatively correlated with Migraine Disability Assessment score, monthly migraine, and monthly headache days. A negative correlation between Patient Health Questionnaire 9 scores assessing depression. In conclusion, the urinary 5-HIAA level may be an easy-to-determine marker of migraine occurrence and severity and may contribute to the identification of migraine patients with depression.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

Exposure to extreme heat is a known risk factor that is associated with increased heat-related illness (HRI) outcomes. The relevance of heat wave definitions could change across the health conditions and geographies due to the heterogenous climate profile. This study compared the sensitivity of 28 heat wave definitions associated with HRI emergency department visits over five summer seasons (2011-2016), stratified by two physiographic regions (Coastal and Piedmont) in North Carolina. The HRI rate ratios associated with heat waves were estimated using the generalized linear regression framework assuming a negative binomial distribution. We compared the Akaike Information Criterion (AIC) values across the heat wave definitions to identify an optimal heat wave definition. In the Coastal region, heat wave definition based on daily maximum temperature with a threshold >90^th percentile for two or more consecutive days had the optimal model fit. In the Piedmont region, heat wave definition based on the daily minimum temperature with a threshold value >90^th percentile for two or more consecutive days was optimal. Additionally, we observed that the optimal heat wave definitions from this study captured moderate and frequent heat episodes than the national weather service (NWS) heat products that worked best for extreme heat episodes. This study compared the HRI morbidity risk associated with epidemiologic-based heat wave definitions and with NWS heat products. Our findings could be used for public health education and suggest recalibrating NWS heat products.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Acute HSV-1 infection is associated with mild symptom, such as fever and lesions of the mouth, face and skin. This phase is followed by a latency period before reactivation which is associated with symptoms ranging from ulcers to encephalitis. Despite available anti-HSV-1 drugs, the development of new antiviral agents is sought due to the presence of resistant viruses. Melatonin, a molecule secreted by the pineal gland, has been shown to be an antioxidant, inducer of antioxidant enzymes, and regulator of various biological processes. Clinical trials have explored its therapeutic utility in conditions including infections. This study focuses on melatonin's role in HSV-1 replication and the underlying mechanisms. Melatonin was found to decrease the synthesis of HSV-1 proteins in infected Vero cells measured by inmunofluorescence indicating an inhibition of HSV-1 replication. Additionally, it regulates the activities of antioxidant enzymes and affects proteasome activity. Melatonin activates the unfolded protein response (UPR) and autophagy and suppresses apoptosis in HSV-1-infected cells. In summary, melatonin demonstrates an inhibitory role in HSV-1 replication by modulating various cellular responses, suggesting its potential utility in the treatment of viral infections.

Video gamers can play to negate the psychological impact of stress (Pine et al., 2020), which may become problematic when users over-rely on the stress-relief potential of gaming. This study used a repeated-measures experimental design to investigate the relationships between stress, video gaming, and problematic video gaming behaviours in a convenience sample of 40 students at a UK university. Results indicated that positive affect increased and negative affect decreased, whilst a biological stress measure (Instantaneous Pulse Rate) also decreased after a short video gaming session (t(36) = 4.82, p < .001, d = 0.79). Results also suggest that video gaming can act as a short-term buffer against the physiological impact of stress. Further research should focus on testing individuals who have been tested for Gaming Disorder as opposed to a general population. Research could also utilise variations of the methodological framework used in this study to examine the intensity of a stress-relief effect under different social situations. The study’s findings in relation to published work are also discussed.

Stresses due to drought and high soil salt content are the most severe threats to global rice pro-duction, causing a significant decline in rice yield. Therefore, this study examined the effects of treatment with various plant extracts on the stresses on rice plants associated with drought and high salinity. Additionally, this study examined various physiological and biochemical parameters such as growth, photosynthetic activity, chlorophyll content, and lipid peroxidation in rice plants after treatment with selected plant extracts under drought and salt stress conditions. Out of the eleven extracts tested, four extracts, namely soybean leaf, soybean stem, Chinese chive, and onion extracts, were found to effectively reduce drought stress. A reduction of only 24-37% in shoot fresh weight was observed in rice plants under drought stress that were treated with these ex-tracts compared to the 78% reduction observed in control plants. In addition, rice plants under salt stress which were treated with soybean leaf, soybean stem, moringa (Moringa oleifera), and Undaria pinnatifida extracts were observed to have lower reductions in shoot fresh weight (3-23%) com-pared to the control plants (43%). The effectiveness varied with the concentrations of the plant ex-tracts. Water content was higher in the rice plants treated with extracts than in the control plants after 6 days of drought and salt stress, but not after 4 days of drought and salt stress. Although photosynthetic efficiency (Fv/Fm) and electron transport rate (ETR), and the content of pigments (chlorophyll and carotenoid) varied based on the types and levels of stress and the extracts that the rice plants were treated with, generally photosynthetic efficiency and pigment contents were higher in the treated rice compared to control plants than in the control plants. Reactive oxygen species (ROS) such as the superoxide radical, hydrogen peroxide (H2O2), and malondialdehyde (MDA) levels increased as the duration of the period of stress increased. ROS and MDA levels were lower in the treated rice compared to control plants. Proline and soluble sugar accumulation also increased as the duration of the stressperiod increased. However, proline and soluble sugar ac-cumulation were lower in the treated rice compared to control plants. Generally, all the parame-ters investigated in this study were similar regardless of the plant extract used for treating the rice plants. Thus, extracts found to be effective in this study can be used to alleviate the adverse effects of stress on rice crops associated with drought and high salinity soil.

Abstract: Arterial hypertension is the main preventable risk factor for premature death and stroke worldwide and anxiety is a real public health problem. Stress is the common denominator for both cases. In the last 3 years, the aggressive exposure of the population to negative emotions (fear of disease in a pandemic, fear of war, financial instability) was the trigger factor. The psycho-neuro-endocrine mechanisms include the hypothalamic-pituitary-adrenal axis and induce sympathetic-parasympathetic imbalance, hypercortisolemia, endothelial dysfunction, oxidative stress, inflammation, cytokine growth, and atherosclerosis. The individual’s vulnerability to stress depends on many factors, but the key role in the perception of stress belongs to immunogenic personality traits. Among them, self-efficacy is a protective factor against stress. Our research aimed to evaluate the connections between psycho-emotional factors and hypertension, using psychometric tests, to identify vulnerability to stress, perceived stress level, anxiety, self-efficacy, and psychobehavioral type, for 215 patients, 104 hypertensive and 111 non-hypertensive patients. The results of the study confirmed that there is a statistically significant difference, which requires psychological screening measures to identify patients vulnerable to stress, as well as medical education courses for doctors in the field of psychology.

To mitigate the COVID-19 infection, many world governments endorsed the cessation of non-essential activities, such as the school attendance. Thereby, forcing the evolution of the teaching model to the virtual classroom. In the present work we show the application of a modified version of the adapted COVID-19 stress scales (ACSS) which also included teaching anxiety and preparedness, and resilience for academic professionals in Mexico, during the unprecedented transformation of the education system undergone in the COVID-19 quarantine. Most of the studied variables: gender, age, academic degree, household occupants, having a disease, teaching level, teaching mode, work hours, resilience, teaching anxiety and preparedness, and fear of being an asymptomatic patient (FOBAP), showed significant statistical correlation between each other (p<0.050) and to the 6 areas of the ACSS (danger, contamination, social economical, xenophobia, traumatic stress and compulsive checking). Our results further showed that the perceived stress and anxiety, fell into the category of absent to mild with only the danger section of the ACSS falling into the moderate category. Finally, resilience generated throughout the quarantine, seems to be a predictor of the adaptation the academic professional has undergone to cope with stress.

Drought is one of the major stress factors affecting growth and development of plants. In this context, drought-related losses of crop plant productivity impede sustainable agriculture all over the world. In general, plants responses to water deficit by multiple physiological and metabolic adaptations at the molecular, cellular and organism levels. To understand the underlying mechanisms of drought tolerance, adequate stress models and arrays of reliable stress markers are required. Therefore, in this review we comprehensively address currently available models of drought stress, based on culturing plants in soil, hydroponic or agar culture. These experimental setups give access to different aspects of plant response to drought, like decrease of tissue water potential, reduction of stomata conductance and photosynthesis efficiency, accumulation of low-molecular weight solutes (metabolic adjustment) and drought protective proteins. Till now, this pattern of markers was successfully extended to the methods of enzyme chemistry, molecular biology and omics techniques. Thus, conventional tests can be efficiently complemented by determination of phytohormone and reactive oxygen species (ROS) contents, activities of antioxidant enzymes, as well as comprehensive profiling of transcriptome, proteome and metabolome.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

The epigenetic mechanism of DNA methylation is essential for regulating gene expression and adaptation in plants, especially when exposed to various environmental stressors such as drought, heat, and nutrient availability. The impact of these stressors can lead to alterations in DNA methylation patterns and gene expression, which this study aims to investigate. Specifically, we are interested in understanding how DNA methylation plays a role in controlling the expression of stress-response genes, as well as genes involved in plant growth and development. To accomplish this, we are analyzing the changes in DNA methylation patterns and gene expression in response to different stressors like drought and heat. Our research findings suggest that DNA methylation is a vital regulator of plant adaptation to environmental stress, and we hope to gain further insight into these mechanisms by identifying genes that exhibit differential expression in response to stress and analyzing their DNA methylation status. This study offers valuable insights into the development of crops that can thrive under changing climate conditions.

Plant-microbial interactions are very crucial for the terrestrial ecosystem. At the rhizospheric, phyllospheric and endospheric regions, these interactions occur through different signalling pathways and play a pivotal role as they strengthen the plant defence mechanism against pathogen attacks and other stresses. A better knowledge of these relationships will help to develop novel solutions for sustainable agriculture and safeguarding the global food supply in the context of climate change and mounting environmental concerns. This chapter emphasises the role of the microbiome in providing resistance to plants against various environmental stresses and aiding in their improved adaption. This chapter also underscores the impact of the microbiome in providing resilience to plants under changing climatic scenarios.

Klotho (KL) is a glycosyl hydrolase and aging-suppressor gene. Stress is a risk factor for depression and anxiety that are highly comorbid with each other. The aim of this study was to determine KL is regulated by estrogen and plays an important role in sex differences in stress resilience. Our results showed that KL was regulated by estrogen in rat hippocampal neurons in vivo and in vitro and was essential for estrogen-mediated increase in the number of presynaptic vesicular glutamate transporter 1 (Vglut1) positive clusters on the dendrites of hippocampal neurons. The role of KL in sex differences in stress responses was examined in rats using three-week chronic unpredictable mild stress (CUMS). CUMS produced a deficit in spatial learning and memory, anhedonic-like and anxiety-like behaviors in male but not female rats, which was accompanied by a reduction in KL protein levels in the hippocampus of male, but not female rats. This demonstrated the resilience of female rats to CUMS. Interestingly, knockdown of KL protein levels in the rat hippocampus of both sexes caused a decrease in stress resilience in both sexes, especially in female rats. These results suggest that regulation of KL by estrogen plays an important role in estrogen-mediated synapse formation, and KL plays a critical role in the sex differences in cognitive deficit, anhedonic-like and anxiety-like behaviors induced by chronic stress in rats, highlighting an important role of KL in sex differences in stress resilience.

An immune-inflammatory response is accompanied by increased nitro-oxidative stress. The aims of this mechanistic review are to review: a) the role of redox sensitive transcription factors and enzymes, ROS/RNS production and the activity of cellular antioxidants on the activation and performance of macrophages, dendritic cells, neutrophils, T cells, B cells and natural killer cells; b) the involvement of high-density lipoprotein (HDL), apolipoprotein (Apo)A1, paraoxonase (PON)-1, and oxidized phospholipids in the regulation of the immune response; and c) the detrimental effects of hypernitrosylation and chronic nitro-oxidative stress on the immune response. The redox changes during immune-inflammatory responses are orchestrated by the actions of nuclear factor (NF)-κB, HIF1alpha, the mechanistic target of rapamycin (mTor), the phosphatidylinositol 3‑kinase (PI3K) / protein kinase B (AKT) signalling pathway, mitogen-activated protein (MAP) kinases, 5' AMP-activated protein kinase (AMPK), and peroxisome proliferator-activated receptor (PPAR). The performance and survival of individual immune cells is under redox control and sensitive to intracellular and extracellular levels of ROS/RNS and is heavily influenced by cellular anti-oxidants including the glutathione and thioredoxin systems, nuclear factor erythroid 2-related factor 2 (Nrf-2), and the HDL complex. Chronic nitro-oxidative stress and hypernitrosylation inhibit the activity of those antioxidant systems, the tricarboxylic acid cycle, mitochondrial functions, and the metabolism of immune cells. In conclusion, those redox-associated mechanisms modulate metabolic reprogramming of immune cells, macrophage and T helper cell polarization, phagocytosis, production of pro- versus anti-inflammatory cytokines, immune training and tolerance, chemotaxis, pathogen sensing, antiviral and antibacterial effects, Toll-like receptor activity, and endotoxin tolerance.

Purpose: To investigate the alterations in nitro-oxidative stress (OS) and antioxidant status in adolescents with metabolic syndrome (MetS) and whether these alterations occur independently from effects of overweight or obesity.Methods: Blood was collected in 47 adolescents with MetS and 94 adolescents without MetS as assessed with the International Diabetes Federation criteria. The International Obesity Task Force (IOTF) criteria were used to classify the subjects into those with overweight or obesity. We measured nitro-oxidative biomarkers including nitric oxide metabolites (NOx), lipid hydroperoxides (LOOH), and malondialdehyde (MDA), and antioxidant biomarkers, i.e. total radical-trapping antioxidant parameter (TRAP), paraoxonase (PON)-1 activity, thiol (SH-) groups, as well as tumor necrosis factor-α, glucose, insulin, triglycerides, uric acid and high-density lipoprotein cholesterol (HDL-C).Results: Logistic regression analysis showed that increased MDA and NOx and a lowered TRAP/uric acid ratio were associated with MetS. Machine learning including soft independent modeling of class analogy (SIMCA) showed that the top-3 most important features of MetS were increased glucose and MDA and lowered HDL-C. Support vector machine using MDA, glucose, insulin, HDL-C, triglycerides and body mass index as input variables yielded a 10-fold cross-validated accuracy of 89.8% when discriminating MetS from controls. The association between MetS and increased MDA was independent from the effects of overweight-obesity. glucose, insulin, triglycerides and HDL-C.Conclusion: In adolescents, increased MDA formation is a key component of MetS, indicating that increased production of reactive oxygen species with consequent lipid peroxidation and aldehyde formation participate in the development of MetS.

French bean (Phaseolus vulgaris L.) a member of family Leguminosae is a useful source of protein (∼22%), minerals (folate), vitamins and fibre. Abiotic and biotic stresses are the constraints to high yield and production of French bean. Varieties reluctant to diseases as well as abiotic stresses is among the top breeding objectives for the French bean. Mendelian ratios could know the genetically reliable forms of resistance, whereas it's more robust to understand the intricate kinds, often referred to as quantitative trait loci (QTL). Here, we review and compile the information from the studies related to the identification of QTLs for critical biofortification traits, biotic and abiotic stresses in French bean. Successful map-based cloning requires QTLs represent single genes which could be isolated in near-isogenic lines, and also the genotypes could be unambiguously inferred by progeny testing. Overall, this information will be useful for directing the French bean breeders to select a suitable method for the inheritance evaluation of quantitative traits and determining the novel genes in germplasm resources to ensure that much more potential of genetic information may be uncovered.

This study was undertaken to elucidate the role of trehalose (Tre) in mitigating oxidative stress under salinity and low P in maize. Eight-day-old maize seedlings of two maize varieties, BARI Hybrid Maize-7 and BARI Hybrid Maize-9 were subjected to salinity (150 mM NaCl), low P (5 µM KH2PO4) and their combined stress with or without 10 mM Tre for 15-d.Salinity and combined stress significantly inhibited the shoot length, root length, and root volume, whereas, low P increased the root length and volume in both genotypes. Exogenous Tre in the stress treatments increased all of the growth parameters as well as decreased the salinity, low P and combined stress-mediated Na+/K+, ROS, MDA, LOX activity and MG in both genotypes. Under salinity and low P stress, the SOD activity increased in both genotypes, but the activity decreased in combined stress. POD activity increased in all stress treatments. Interestingly, Tre application enhanced the SOD activity in all the stress treatments but inhibited the POD activity. Both CAT and GPX activity were increased by saline and low P stress while the activities inhibited in combined stress. Similar results were found for APX, GR, and DHAR activities in both genotypes. However, MDHAR activity was inhibited in all the stresses. Interestingly, Tre enhanced CAT APX, GPX, GR, MDHAR and DHAR activities suggesting the amelioration of ROS scavenging in maize under all the stresses. Increased GST activity in presence or absence of Tre might involve in detoxification of hydroperoxides as well as leaf senescence. On the other hand, increased glyoxalase activities in saline and low P stress in BHM-9 suggested better MG detoxification system because of down-regulation of Gly-I activity in BHM-7 in those stresses. Tre also increased the glyoxalase activities in both genotypes under all the stresses. Tre improved the growth in maize seedlings by decreasing Na+/K+, ROS, MDA, and MG through regulating antioxidant and glyoxalase systems.

BACKGROUND: Stable-phase schizophrenia may comprise two distinct nosological entities namely Major Neuro-Cognitive Psychosis (MNP, largely overlapping with the deficit syndrome) and simple NP (SNP), which are defined by neuroimmune and neurocognitive abnormalities. Furthermore, cognitive impairments and PHEM (psychotic, hostility, excitation, mannerism) and negative symptoms load on the same dimension.METHODS: The current study aimed to investigate associations of psychomotor retardation (PMR) and clinical as well as biomarker characteristics of schizophrenia. We recruited 40 healthy controls and 79 schizophrenia patients and measured IgA responses to tryptophan catabolites (TRYCATs), IgM to malondialdehyde and nitroso (NO)-cysteinyl, macrophage inflammatory protein-1 (MIP-1), soluble interleukin (IL)-1 receptor antagonist (sIL-1RA), IL-10, CCL-11 as well as PMR items of different rating scales and motor screening task (MOT). RESULTS: PMR differentiated schizophrenia from controls and MNP from SNP. In addition, PMR was strongly associated with executive functions, deficits in episodic and semantic memory, PHEM and negative (PHEMN) symptoms. Around 50% of the variance in PMR was predicted by the cumulative effects of immune activation, CCL-11, TRYCATs and NO-Cysteinyl levels, and lowered natural IgM. PRM may be reliably combined with PHEMN symptoms and memory and executive impairments into one latent vector reflecting overall psychopathology.CONCLUSIONS: Current findings indicate that PMR may be a key psychopathological feature of schizophrenia and mainly MNP. In addition, PMR and associated impairments in memory and executive functions, and PHEMN symptoms may be driven by deficits in the compensatory immune regulatory system (natural IgM) combined with increased production of neurotoxic immune products, namely TRYCATs and IgM to NO-cysteinyl, and an endogenous cognition deteriorating chemokine, namely CCL-11.

Transposable elements (TE) function as one of the major effectors to respond to biological or environmental stress. The mobility of TEs, which is heavily controlled under normal conditions, may be activated by stress. LncRNAs are emerging as a crucial tool in the regulation of TEs. This study focuses on the gene expression of THAP9, a domesticated transposon and lncRNA THAP9-AS1 (THAP9-antisense1), which form a sense and antisense gene pair with a promoter overlap of approximately 350bp. Under basal conditions, THAP9 is preferentially transcribed while THAP9-AS1 is heavily down-regulated. In the S-phase of the cell cycle, THAP9 expression exhibits stress-specific effects ranging from moderate enhancement to no change. On the other hand, THAP9-AS1, which has previously been reported to be upregulated in several cancers, always demonstrates enhanced expression under stress. Moreover, THAP9-AS1 is transcriptionally favoured during stress since the stress-induced fold-increase of THAP-AS1 expression is always higher than THAP9. Interestingly, the expression of both THAP9 and THAP9-AS1 exhibit a striking periodicity throughout the S-phase, reminiscent of cell cycle regulated genes. Thus, this study sets the stage to further explore the relationship between THAP9 and THAP9-AS1 and investigate THAP9-AS1’s potential regulatory role during stress.

This article shows the alternative learning methodology to stimulate the holistic side of students’ minds to achieve the increment of the innovation skill, managing the creative competencies and level of stress. The present research study is pre-experimental research designed with prior and posterior measurement, longitudinal, explanatory, and co-relational, with the main objective to demonstrate the effect of the holistic innovation coefficient of the beneficiaries of the program “Impulsa Peru”. Program Results: It has been concluded that the experimental group is significant over the control group. Therefore, the holistic innovation methodology had an impact on the experimental group. Conclusions: Hypothesis 1 is fulfilled in which it is affirmed that the holistic innovation methodology has a positive impact on the level of coefficient of holistic innovation of the student mentors of the women recyclers of the program Impulsa Peru with a significance level of 0.05%.

The agricultural sector faces challenges due to climate change and the growing global population. Alkaline stress could adversely impact plant growth and crop production. This stressor diminishes water quality essential for crop cultivation, consequently impairing plant growth and overall productivity. Gamma-aminobutyric acid (GABA), a non-protein amino acid, may exhibit multifaceted roles in plant responses to adverse environmental conditions. Optimization of crop production in controlled environmental agriculture under artificial light attracted much attention. In the present study, we investigated the effects of different light spectra and GABA concentrations on Lollo Rosso lettuce plants under alkaline stress. Seedlings were placed under different light spectra [red (R), blue (B), white (W), 3R:1B, and 2R:1B:1far-red (FR)] and treated by GABA (0 and 50 µmol). Alkaline conditions were instituted by applying NaHCO3 at a concentration of 40 mM. The experiment incorporated a control treatment without NaHCO3. In general, R light exposure caused the highest growth performance of lettuce plants. GABA augmented biomass production in control and alkaline-treated plants across all light spectra. Additionally, it increased the concentrations of photosynthetic and protective pigments under alkaline conditions. GABA also improved the photosynthetic performance under all light spectra. Non-photochemical quenching and pigmentation were enhanced by exposure to B light, especially in plants treated with GABA. Alkaline stress induced an increase in soluble carbohydrate content in the lettuce leaves. These findings highlight the support of GABA application in facilitating coping plants to alkaline stress.

Male infertility (MI) involves various endogenous and exogenous facts. These include oxidative stress (OS), which is known to alter several physiological pathways and it is estimated to be present at high levels in up to 80 % of infertile men. That is why since the late 20th Century, the relationship between OS and MI has been widely studied. New terms have emerged, such as Male Oxidative Stress Infertility (MOSI), which is proposed as a new category to define infertile men with high OS levels. Another important term is MOXI: Male, Antioxidants, and Infertility. Such term refers to the hypothesis that antioxidants could improve male fertility without the use of assisted reproductive technology. However, there is no evidence-based antioxidant treatments that directly improve seminal parameters or birth ratio. In this regard, there is controversy about their use. While certain scientists argue against their use due to the lack of results, others support this use because of their safety profile and low price. Some uncertainties related to the use of antioxidants for treating MI are their questionable efficacy or the difficulties to know their correct dosage. In addition, the lack of quality methods for OS detection can lead to an excessive antioxidant supplementation, resulting in “reductive stress”. Another important problem is that, although the inflammatory process is interdependent and closely linked to OS, it is usually ignored. To solve these uncertainties, new trends have recently emerged. These include the use of molecules with anti-inflammatory and antioxidant potential, and which are also able to specifically target the reproductive tissue; as well as the use of new methods that allow for reliable quantification of OS and a quality diagnosis. This review aims to elucidate the main uncertainties about MOXI and to outline the latest trends in research to achieve effective therapies with clinically relevant outcomes.

Endoplasmic reticulum (ER) is an important organelle responsible as protein synthesis regulator in plant. High salinity can also lead to the activation of ER stress, caused by the accumulation of misfolded protein. This could lead to a stress response mechanism, unfolded protein response (UPR). Failure of UPR to reverse the effect of protein misfolding will activate Programmed Cell Death (PCD). Metacaspase genes regulate programmed cell death (PCD) in plants. The present study was focused on comprehensive gene analyses of the expression patterns of type II rice metacaspase (OsMC) genes in response to the endoplasmic reticulum (ER) and salinity stress in rice leaf and OsMC4 in callus. A strong evidence of unfolded protein response (UPR) during tolerance to both ER and salinity stress was found in the present study. Overexpression of OsMC4 in rice callus as a fusion protein with TagRFP and controlled by the CaMV35 promoter caused major changes in the expression of the stress ER-marker genes, protein disulfide isomerase (PDI) and Binding immunoglobulin Protein (BiP), and OsMC4 in overexpressing calli. These expression analyses of the OsMC family provide valuable information for further functional studies on the biological roles of OsMCs in PCD related to ER and salinity stress responses.

Trypanosoma cruzi infection results in debilitating cardiomyopathy, which is a major cause of mortality and morbidity in the endemic regions of Chagas disease (CD). The pathogenesis of Chagasic cardiomyopathy (CCM) has been intensely studied as a chronic inflammatory disease until recent observations reporting the role of cardio-metabolic dysfunctions. In particular, we demonstrated accumulation of lipid droplets and impaired cardiac lipid metabolism in the hearts of cardiomyopathic mice and patients, and their association with impaired mitochondrial functions and endoplasmic reticulum (ER) stress in CD mice. In the present study, we examined whether treating infected mice with an ER stress inhibitor can modify the pathogenesis of cardiomyopathy during chronic stages of infection. T. cruzi infected mice were treated with an ER stress inhibitor 2-Aminopurine (2AP) during the indeterminate stage and evaluated for cardiac pathophysiology during the subsequent chronic stage. Our study demonstrates that inhibition of ER stress improves cardiac pathology caused by T. cruzi infection by reducing ER stress and downstream signaling of phosphorylated eukaryotic initiation factor (P-elF2α) in the hearts of chronically infected mice. Importantly, cardiac ultrasound imaging showed amelioration of ventricular enlargement, suggesting that inhibition of ER stress may be a valuable strategy to combat the progression of cardiomyopathy in Chagas patients.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

To date, soil salinity becomes a huge obstacle for food production worldwide since salt stress in plants is one of the major factors limiting agricultural productivity. It is estimated that a significant loss of crops (20%–50%) would be due to drought and salinity. To embark upon this harsh situation, numerous strategies such as plant breeding, plant genetic engineering, and a large variety of agricultural practices including the applications of plant growth-promoting rhizobacteria (PGPR) and seed biopriming technique have been developed to improve plant defense system against salt stress, resulting in higher crop yields to meet human’s increasing food demand in the future. In the present review, we update and discuss the advantageous roles of beneficial PGPR as green bioinoculants in mitigating the burden of high saline conditions on morphological parameters and on physio-biochemical attributes of plant crops via diverse mechanisms. In addition, the applications of PGPR as a useful tool in seed biopriming technique are also updated and discussed since this approach exhibits promising potentials in improving seed vigor, rapid seed germination, and seedling growth uniformity, Furthermore, the controversial findings regarding the fluctuation of antioxidants and osmolytes in PGPR-treated plants are also pointed out and discussed.

Plants are continually exposed to multiple stresses, which co-occur in nature and the net effects are frequently more non-additive (i.e., synergistic or antagonistic) suggesting ‘unique’ responses respect to that of the individual stress. Further, plant stress responses are not uniforms showing a high spatial and temporal variability among and along the different organs. In this respect, the present work investigated the morphological responses of different root types (seminal, seminal lateral, primary, primary lateral) of maize plants exposed to single (drought and heat) and combined stress (drought + heat). Data were evaluated by a specific root image analysis system (WinRHIZO) and analyzed by uni- and multi-variate statistical analysis. The results indicated that primary root and their laterals were the types more sensitive to the single and combined stresses while the seminal laterals specifically responded to the combined only. Further, antagonistic and synergistic effects were observed for the specific traits in the primary and their laterals and in the seminal lateral roots in response to the combined stress. These results suggested that maize root system modified specific root types and traits to face with different stressful environmental conditions highlighting that the adaptation strategy to the combined stress may be different from that of the individual ones. The knowledge of “unique or shared” responses of plant to multiple stress can be utilized to develop varieties with broad spectrum stress tolerance.

The present study investigated the effect of different ambient temperature and relative humidity (RH) but equal temperature-humidity index (THI) on laying performance, egg quality, heterophil to lymphocyte ratio (H/L ratio), corticosterone (CORT) concentration in blood, yolk and albumen, and plasma biochemical parameters in laying hens. One hundred and twenty commercial hens (Hy-Line Brown) aged 60 weeks were allocated into 2 environmental chambers. Laying hens were subjected to either one of two thermal treatments, i.e., 26ºC and 70% RH (LH75) and 30ºC and 30% RH (HL75) for 28 days. Both thermal treatments had equal THI being 75. Neither LH75 nor HL75 affected (P > 0.05) laying performance including egg production, egg weight, egg mass, feed intake, and feed conversion ratio. Plasma biochemical parameters such as total cholesterol, high-density lipoprotein cholesterol, triglyceride, calcium, magnesium, and phosphorus was not altered (P > 0.05) by thermal treatments. As to the stress indicators, both environment regimes failed (P > 0.05) to affect blood H/L ratio and CORT levels in plasma, yolk and albumen although albumen CORT levels were elevated (P < 0.05) in LH75 vs. HL75 at days 3, 7, and 28. In conclusion, our study suggests that laying hens performed and responded equally when they were exposed to equal THI environment conditioned from either 26ºC and 70% RH or 30ºC and 30% RH. The results of this study will be served as a scientific basis for management decisions and handling under thermally challenging conditions.

The world is currently, subjected to the worst health crisis documented in modern history; an epidemic led by the novel coronavirus disease 2019 (COVID-19). At the epicenter of this crisis, healthcare professionals continue working to safeguard our well-being. To the regular high levels of stress, COVID new heights even more to healthcare professionals so depending on the area, specialty, and type of work. Here we investigated what are the tendencies, or areas most affected. Through an adaptation of the original COVID-stress scale, we developed a remote, fast test designed for healthcare professionals of the Northeastern part of Mexico, an important part of the country with economic and cultural ties to the US. Our results showed 4 key correlations as highly dependent: Work area – Xenophobia (p &lt; 0.045), Work with COVID patients - Traumatic stress (p &lt; 0.001) and Total number of COVID patients per day – Traumatic stress (p &lt; 0.027), and Total number of COVID patients - Compulsive checking and reassurance. Overall concluding that normal levels of stress have increased (mild – moderate). Additionally, we further determine that the fear of being an asymptomatic patient (potential to spread without knowing) continues being a concern.

Rapid and accurate prediction of residual stress in metal additive manufacturing processes is of great importance to guarantee the quality of the fabricated part to be used in a mission-critical application in the aerospace and automotive industries. Experimentation and numerical modeling are valuable tools for measuring and predicting the residual stress; however, to-date conducting experimentation and numerical modeling is expensive and time-consuming. Thus, herein, a physics-based thermomechanical analytical model is proposed to predict the residual stress of the additively manufactured part rapidly and accurately. A moving point heat source approach is used to predict the temperature field by considering the effects of scan strategies, heat loss, and energy needed for solid-state phase transformation. Due to the high temperature gradient in this process, part experiences a high amount of thermal stress following solidification which may exceed the yield strength of the material. The thermal stress is obtained using Green’s function of stresses due to the point body load. The Johnson-Cook flow stress model is used to predict the yield surface of the part under repeated heating and cooling. As a result of the cyclic heating and cooling and the fact that the material is yielded, the residual stress build-up is predicted based on incremental plasticity and kinematic hardening behavior of the metal according to the property of volume invariance in plastic deformation in coupling with the equilibrium and compatibility conditions. The computational methodology is realized with the laser powder fusion of maraging steel 350 as a material of example. The validation of the predictive models has been presented in terms of the comparison of predicted and measured scan-direction and build-direction residual stress distributions along depth of build under various process parameter combinations. Moreover, for the first time, the Jonson-Cook parameters of maraging steel 350 are predicted using analytical modeling of machining forces and non-linear optimization techniques.

Salinity is a serious environmental hazard which limits world agricultural production by adversely affects plant physiology and biochemistry. Hence increase tolerance against salt stress is very important. In this study, we explored the function of β-aminobutyric acid (BABA) in enhancing salt stress tolerance in rapeseed (Brassica napus L.). After pretreatment with BABA, seedlings were exposed to NaCl (100 mM and 150 mM) for 2 days. Salt stress increased Na content and decreased K content in shoot and root. It disrupted the antioxidant defense system by producing reactive oxygen species (ROS; H2O2 and O2•−), methylglyoxal (MG) content and causing oxidative stress. It also reduced the growth and photosynthetic pigments of seedlings but increased proline (Pro) content. However, BABA pretreatment in salt-stressed seedlings increased ascorbate (AsA) and glutathione (GSH) contents; GSH/GSSG ratio; and the activities of ascorbate peroxidase (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), glutathione reductase (GR), glutathione peroxidase (GPX), superoxide dismutase (SOD), catalase (CAT), glyoxalase I (Gly I), and glyoxalase II (Gly II) as well as growth and photosynthetic pigments of plants. In addition, compared to salt stress alone BABA increased Pro content, reduced the H2O2, MDA and MG contents and decreased Na content in root and increased K content in shoot and root of rapeseed seedlings.

Being a chilling-sensitive staple crop, rice (Oryza sativa L.) is vulnerable to climate change. The competence of rice to withstand chilling stress should, therefore, be enhanced through technological tools. The present study employed chemical intervention like application of sodium nitroprusside (SNP) as nitric oxide (NO) donor and elucidated the underlying molecular mechanisms of NO-mediated chilling tolerance in rice. At germination stage, germination indicators were interrupted by chilling stress (5.0 ± 1.0°C for 8 h day‒1), while pretreatment with 100 μM SNP markedly improved the indicators. At seedling stage (14-day-old), chilling stress caused stunted growth with visible toxicity along with alteration of biochemical markers, for example, increase in oxidative stress markers (superoxide, hydrogen peroxide, and malondialdehyde) and osmolytes (total soluble sugar; proline and soluble protein content, SPC), and decrease in chlorophyll (Chl), relative water content (RWC), and antioxidants. However, NO application attenuated toxicity symptoms with improving growth performance which might be attributed to enhanced activities of antioxidants, mineral contents, Chl, RWC and SPC. Furthermore, principal component analysis indicated that water imbalance and increased oxidative damage were the main contributors to chilling injury, whereas NO-mediated mineral homeostasis and antioxidant defense were the critical determinants for chilling tolerance in rice. Collectively, our findings revealed that NO protects against chilling stress through valorizing cellular defense mechanisms, suggesting that exogenous application of NO could be a potential tool to evolve cold tolerance as well as climate resilience in rice.

Water stress (WS) and heat stress (HS) have a negative effect on soybean plant growth and crop productivity. During WS, soybean plants opt for survival through ion homeostasis and the conformations of proteins are disconcerted as plant cells lose water while HS leads to difficulties in flowering and fruiting. Some of these changes include oxidative stress leading to the destruction of photosynthetic apparatus, macromolecules within cells and the onset of complex signaling cascades. Changes in the physiological characteristics, proteome, and certain metabolites investigated on molecular and cellular functions were studied in two soybean cultivars exposed to different heat and water stress conditions independently and in combination. Leaf protein composition was studied using 2-DE and complemented with MALDI TOF mass spectrometry. While two cultivars displayed genetic variation in response to water and heat stress, thirty-nine proteins were significantly altered in their relative abundance in response to WS, HS and combined WS+HS in both cultivars; a majority of them involved in metabolism, response to heat and photosynthesis showing significant cross-tolerance mechanisms. Functional analysis revealing a majority of heat responsive-proteins were more abundant during HS and combined stress (WS+HS) whereas these proteins were low to WS in cultivar PI 471938 and heat shock proteins were in low abundance to water, heat and combined stresses in cultivar R95-1705. Most protein abundances were not correlated with their expression at mRNA levels in PI cultivar, however, in cultivar R 95, the expression levels of transcript follow their relative abundance in proteins. Our systems bioinformatics analyses revealed that MED37C, a probable mediator of RNA polymerase transcription II protein showed potential interacting partners in Arabidopsis and our studies signifies the marked impact of this protein in PI cultivar. Elevated activities in antioxidant enzymes indicate that the PI-371938 cultivar has the ability to restore the oxidation levels and sustain the plant during the stress. Our study hypothesizes the plant’s development of cross-stress tolerance which will help foster the ongoing ventures in genetic modifications in stress tolerance.

Hypotrochoidal profile contours have been produced in industrial applications in recent years using twin-spindle processes, and they are considered effective high-quality solutions for positive shaft–hub connections. This study mainly concerns analytical approaches to determine the bending stresses in hypotrochoidal profile shafts. The formulation was developed according to bending principles using the mathematical theory of elasticity and conformal mappings. The loading was further used to investigate the rotating bending behaviour. The stress factors for the classical calculation of maximum bending stresses were also determined for all those profiles presented and compiled in the German standard DIN3689-1 for practical applications. The results were also compared with the corresponding numerical and experimental results, and very good agreement was observed. Additionally, based on previous work, the stress factor was determined for the case of torsional loading to calculate the maximum torsional stresses in the standardised profiles, and the results are listed in a table. This study contributes to the further refinement of the current DIN3689 standard.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.