Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

“Money has always been something of an embarrassment to economic theory. Everyone agrees that it is important; indeed, much of macroeconomic policy discussion makes no sense without reference to money. Yet, for the most part theory fails to provide a good account for it.” (Banerjee and Maskin, 1996, p. 955)The debate about whether or not a growth imperative exists in debt based, interest bearing mone- tary systems has not yet been settled. It is the goal of this paper to introduce a new perspective in this discussion.For that purpose an SFC computational model is constructed which simulates a post Keynesian Endogenous Money system without including economic parameters such as production, wages, consumption and savings. A case is made that isolating the monetary system allows for better analysis of the inherent properties of such a system.Loan demands, which are assumed to happen, are the driving force of the model. Simulations can be run in two modes, each based on a different assumption. Either the growth rate of the money stock is assumed to be constant or the loan rate, expressed as a percentage of the money stock, is assumed to be constant.Simulations with varying parameters are run in order to determine the conditions under which the model converges to stability, which is defined as converging to a bounded debt rate.The analysis shows that stability of the model is dependent on net bank profit ratios, expressed relative to their debt assets, remaining below the growth rate of the money stock. Based on these findings it is argued that the question about the existence of a growth imperative in debt based, interest bearing monetary systems needs to be reframed. The question becomes whether a steady state economy can realistically support such a system without destabilising it. In order to answer this question real world behavior of economic actors must be included in the model.It is concluded that there are indications that it might not be feasible for a steady state economy to support a stable debt based, interest bearing monetary system without strong interventions. However, more research is necessary for a definite answer. Real world observable data should be analysed through the lens of the presented model to bring more clarity.

The aim of the present trial was to evaluate the growth performance of buffalo calves fed diets characterized by different forage/concentrate ratio with or without the Saccharomyces Cerevisiae supplementation (CBS 493.94, Yea-Sacc®). Twenty-four male buffalo calves (mean age 145.1 ± 16.1 days; mean weight 108.0 ± 18.7) were assigned randomly to 4 groups, homogeneous for age, fed four different diets: diet 1 F:C ratio 50:50; diet 2 F:C ratio 30:70; diet 3 F:C ratio 50:50 + Yea-Sacc® and diet 4 F:C ratio 30:70 + Yea-Sacc®. Buffalo calves were individually weighted before the start of the experiment and the data were used as a covariate, monthly until the end of the trial. Dry matter intake (DMI), daily weight gain (DWG) and feed conversion ratio (FCR) were calculated. The differences in diets’ composition significantly (p

Our objective was to investigate the effects of topically applied neuropeptide Y (NPY) on ischemic wounds. Initially, the animal model for ischemic wound healing was validated using 16 male Sprague-Dawley albino rats. In the intervention study, an additional 28 rats were divided into three groups: NPY (0.025%), the positive control insulin-like growth factor-I (IGF-I, 0.0025%), and the hydrogel carrier alone (control). The hydrogel was selected due to its capacity to prolong NPY release (p &lt; 0.001), as demonstrated in a Franz diffusion cell. In the animals, an 8-mm full-thickness wound was made in a pedunculated dorsal ischemic skin flap. Wounds were then treated and assessed for 14 days, and procured at the end of the experiment for in situ hybridization analysis (RNAscope®) targeting NPY receptor Y2R and for meticulous histologic examination. Wound healing rates, i.e. the percentage wound area changes, did not show an increase with NPY (p = 0.938) but did with rhIGF-I (p = 0.039) compared to the control. Y2R mRNA was not detected in the wounds or adjacent skin but was identified in the rat brain (positive control). Light microscopic examination revealed trends of increased angiogenesis and enhanced inflammatory cell infiltration with NPY compared to control. An interesting secondary discovery was the presence of melanophages in the wounds. Our findings suggest the potential of NPY to enhance neovascularization under ischemic wound healing conditions, but further optimization of the carrier and dosage is necessary. The mechanism is elusive but likely involves NPY receptor subtypes other than Y2R.

This paper aims to provide a comprehensive review of the historical trajectory of deforestation in Ethiopia, spanning an extensive timeframe and exploring its major driving factors. Over the span of three millennia, Ethiopia has experienced persistent deforestation, resulting in a significant reduction of its once-large forest and woodland resources. Currently, small, degraded forests and woodlands exist in isolated patches, located in remote areas such as the southwest and southeast. Major deforestation in Ethiopia unfolded progressively, first along a north-south axis and more recently shifting from the highlands to the lowlands. The northern and central highlands lost most of their natural forests before the turn of the 20th century, while significant loss in the southern highlands occurred over the past 150 years, and in the lowlands over the past 50 years. This deforestation is primarily attributed to the expansion of ox-plow agriculture and population pressure resulting from natural birth and internal migration. Despite efforts to counter deforestation and promote restoration, mostly since the 1970s, successes remain limited. A noteworthy exception in this regard is the introduction of Eucalyptus during the turn of the 20th century and the subsequent expansion of it, mainly in the form of small-scale farmer-led farm forestry. Today, Eucalyptus become the most preferred, well-adapted, widely planted, and the major supplier of wood materials in Ethiopia. The limited success in restoration is attributed to the reliance on campaign-based strategy, lack of private sector involvement, the intertwining of restoration with political agenda, and poorly defined property rights on land, forests, and trees. The consequences of deforestation and resultant environmental degradation have profoundly influenced the socio-economic dynamics of Ethiopia, giving rise to issues such as food insecurity, poverty, migration, and political instability.

Seaweed polysaccharides can substitute synthetic compounds present in commercial stimulants and fertilizers, used in agriculture to improve crops yield and vigor. In this study, three different poly-saccharides (alginate, agar and carrageenan) were extracted from one brown seaweed, Saccorhiza polyschides, and two red seaweeds, Gracilaria gracilis and Chondrus crispus, respectively, and applied on potted turnip greens (Brassica napus L.), with intention to analyze their impact on plant growth, development and metabolism. Turnip plants treated with polysaccharides, specially, carrageenan of Chondrus crispus showed the best results in improving the crop’s productivity, such as plant length and weight, number of leaves, nutrient and pigment content, and soil fertility, compared with turnip plants from the negative control or treated with a commercial leaf fertilizer. λ-carrageenan extracted from the tetrasporophyte generation of Chondrus crispus had the highest bioactivity and positive effect in turnip plants among all treatments. λ-carrageenan has shown that can improve plant growth, increase plant’s biomass, and root system, enhance photosynthetic activity, increase the uptake of soil nutrients, and protect plants against abiotic and biotic stresses, stimulating the production of secondary metabolites and manage its defense pathways. Seaweed extracted polysaccharides have the potential to be used in sustainable agriculture.

Cancer is the second leading cause of death worldwide. Key to cancer initiation and progression is the crosstalk between cancer cells and their microenvironment. The extracellular matrix (ECM) is a major component of the tumour microenvironment and integrins, main cell-ECM adhesion receptors, are involved in every step of cancer progression. However, accumulating evidence has shown that integrins can act as tumour promoter but also as tumour suppressor factors, revealing that the biological roles of integrins in cancer are complex. This incites a better understating of integrin function in cancer progression. To achieve this goal, simple model organisms, such as Drosophila, offer a great potential to unravel underlying conceptual principles. Here, we find that in the Drosophila wing disc epithelium the PS integrins act as suppressors of tumours induced by a gain of function of the oncogenic form of Ras, RasV12. We show that PS integrin depletion enhances the growth, delamination and invasive behaviour of RasV12 tumour cells, as well as their ability to affect the tumour microenvironment. These results strongly suggest that integrin function as tumour suppressors might be evolutionary conserved. Drosophila can be used to understand the complex tumour modulating activities conferred by integrins, thus facilitating drug development.

The aim of this paper was to test isolated and pre-selected bacteria strains from Nile tilapia intestinal mucus, collected in Brazilian commercial fish farming, to use as probiotics in the feeding. The variable were growth performance, hematology, microbiology and immunology. These strains were submitted to in vitro inhibition tests of pathogenic bacteria. Then, they were identified by PCR and sequencing, and comparing using the BLAST software. The experiment was carried out in the Fisheries Institute, Sao Paulo, Brazil, for 84 days, following the randomized experiment design with seven treatments and three replicates (21 experimental units): T0 – control, T1 – Bacillus velezensis, T2 – Bacillus pumilus, T3 – Bacillus subtilis, T4 –Enterococcus hirae T5 – Enterococcus faecium and T6 – mix of bacteria strains used to this experiment. The variables analyzed were: growth performance, DGGE (Denaturing gradient gel electrophoresis), phagocytes respiratory burst activity, hematology and bromatology. As result, the bacteria strains B. pumilus (T2) and all bacteria mix (T6), included in Nile tilapia diet, promoted better biomass values, with similar feed conversion rate of control group (p<0,05). Apparently, the microorganisms use does not affect the health and well-fare of the fish. The hematology index, except basophils and thrombocytes numbers do not demonstrated differences among the groups, as well as glycemia, lactate level, respiratory burst and lysozyme activities. In conclusion, the isolated and pre-selected bacteria from intestinal mucus of Nile tilapia, B. pumilus (T2) and mix (T6 - B. velezensis, B. pumilus, B. subtilis, E. hirae and E. faecium) improve the growth performance and may be used as probiotics for Nile tilapia.

Polymeric immunoglobulin receptor (pIgR) plays an important role in mediating mucosal defenses, but the association between its single nucleotide polymorphisms (SNPs) and traits (such as growth and disease-resistant) in birds is scarcely known. In this research, we aimed to detect the single nucleotide polymorphisms of the pIgR gene in the chicken F2 resource population and discern the possible associations between pIgR SNPs and chicken growth, disease-resistant, respectively. Six-SNPs (3, 9, 15, 16, 19, and 21) in chicken (Gallus gallus) were significantly associated with disease-resistant in the pIgR gene (P < 0.05). The major allele genotype with SNP 9 and SNP 19 occurred more frequently with high Newcastle Disease Virus (NDV) antibody rates; the major allele genotype with the SNP 3 was predominant in those with significantly lower NDV antibody rates (P < 0.05); heterozygous with the SNP 15 and SNP 21 occurred more frequently with high avian leukemia virus (ALV) antibody rates; the TT genotypes with the SNP 16 was predominant in those with low infectious bursal disease (IBD) antibody rates (P < 0.05). Besides, SNP 12 showed significant associations with body weights (BW) and shank lengths (SL) (P < 0.05). Genotyping revealed that the C allele occurred more frequently in breeds with high growth rates and the T allele was predominant in those with low growth rates at 8, 10, and 12w of age (P < 0.05). This polymorphic site may serve as a useful target for the marker assisted selection of growth and disease-resistant traits in chicken.

In this research, a new conceptual framework introduced to analysis of water security. Using the exponential, logistic growth model, and employing the historical population of Tabriz city from 1956 to 2016, the future period (2022-2100) population predicted. Pearson Correlation, Spearman's Rho and Kendall's rank coefficients were used for analyzing correlation between population and water consumption. In addition, the amount of city water demand in the future period predicted using the ordinary least square model. Then, water stress and water scarcity indices calculated for Tabriz city in the future period. Results indicated that the mathematical population growth models are very suitable for prediction of city population. There was a significant positive correlation between the city population and water demand. In addition, the amount of water demand will proportionally increase with rising number of population. Finally, linear and quadratic equations presented for city water demand based on the city population number. It can be concluded that Tabriz city will be faced with severe water stress in the future period. The proposed new method in this study can be used for other different cities of the world. Also, Results will be helpful for decision makers in optimum management of urban water resources.

In this study, we evaluated how gut microbes associated with hepatopancreatic and gonadal expression genes impact on growth traits in different sex of M. rosenbergii. By comparing the relative abundance of gut microbes between the male (high weight gain, HiWG) and female (low weight gain, LoWG) animals, we have shown that at the phyla, family and genera level, the abundance of microbes existed significantly difference between both group. At the genera level, the abundance of Candidatus Hepatoplasma and unidentified Chloroplast lower in the LoWG animals than in the HiWG animals, and Lactobacillus and Ligilactobacillus have opposed trend. The abundance of Candidatus Hepatoplasma and unclassfied Chloroplast was associated with the growth traits in the HiWG group. The Lolium perenne microbial species belong to unclassfied Chloroplast genera have tight association with Ralstonia pickettii, both might association on Geobacter anodirecteducens abundance, which correlation with the expression of glutathione peroxidase and collagen, which were highly expressed in the hepatopancreas and gonads of HiWG group animals of M. rosenbergii and might promote growth and development. These associations were not detected in the female LoWG group.

Carbon dots have received much attention due to their unique physicochemical properties and diverse applications in bioimaging, optoelectronic devices, catalysis, and agriculture. Here in this work, we report a simple hydrothermal synthesis of nitrogen and phosphorus-doped carbon dots (N, P-CDs). The optical and physical properties of the synthesized N, P-CDs were analyzed using systematical spectroscopy and electrical characterization. The synthesized N, P-CDs show strong photoluminescence at 626 nm and demonstrate high stability under UV light and other conditions. Moreover, we incorporate the synthesized N, P-CDs into water spinach by root spraying and leaf spraying. It was found that N, P-CDs could effectively promote the growth of water spinach by increasing the photosynthetic rate, and the content of total phenols and anthocyanins in water spinach

In sheep raised for meat production, the relationship between external udder conformation, colostrum quality, and lamb growth rates has not received much attention. We hypothesize that ewes with a more desirable udder conformation at lambing have greater colostrum quality and increased growth rates in lambs. Fifty Suffolk ewes were used in this study. Within 6-8 hours of parturition, colostrum samples from both halves of the udder were collected and a visual scoring of the udder was conducted. Colostrum quality was measured for total protein using both optical and Brix refractometers. On day 2, day 45, and day 60 after parturition, lamb weights were recorded, and udder conformation measurements were repeated. A visual scoring system evaluating udder floor (scale 1-4), udder depth (scale 1-9), teat placement (scale 1-9), teat lesions (present or absent), and the presence of wool (present or absent) was used to assess external udder conformation. Normal udder parameters include udder depth scores of 5 or 6, udder floor score of 1 or 2, teat placement scores 4, 5, and 6, and the absence of teat lesions and wool. All ewes not meeting normal parameters were considered to have an abnormal udder. The data was analyzed using the GLM procedure. Mean total colostrum total protein was greater (p = 0.03) in ewes displaying ‘normal’ udder conformation compared with those with ‘abnormal’ (14.82±0.5 and 13.31±0.3mg/dl). Mean Brix values were also greater (p = 0.03) for ewes with a ‘normal’ udder compared to an abnormal udder confirmation, respectively (21.70±0.8 and 19.54±0.5). On day 2 after parturition, mean lamb body weight was not different between ewes with ‘normal’ and abnormal udder (5.38±0.26 vs 5.46±0.15). No difference (p > 0.05) in lamb weights were detected between ewes with normal and abnormal udder conformations on day 45 and 60 after parturition. This data provides evidence of increased colostrum total protein values and increased Brix values present in ewes with ‘normal’ udder conformation and no difference in lamb weights between udder conformations.

The aim of present study was to link the gene expression profile of selected candidate genes with blood profile, growth performance and carcass traits of Barki lambs. Thirty-eight Barki lambs were divided into 3 groups (fast, intermediate and slow growing) according to growth perfor-mance. Body tissues (muscle, liver and fat) were taken from for RNA isolation and Real-time PCR. The results indicated that, the final body weight hot carcass weight were heavier (P ≤ 0.05) in fast (49.9 Kg and 24.57) than intermediate (40.7 and 19.07 Kg) and slow (30.8 and 15.10 Kg) growing animals. The blood profile of total protein, total lipids, calcium, T3 and T4 hormones did not differ among sheep groups. Genes involved in protein biosynthesis (RPL7), fatty acid oxidation (CPT1) and lipolysis (FABP4) were up regulated in fast and intermediate growing lambs in all studied tissues. While, gene-regulating lipogenesis (ADIPOQ) was expressed simi-larly in fat and liver tissues, but increased its expression in muscle of fast and intermediate growing lambs. Expression of CAPN3 was increased in fast and intermediate growing compared to slow growing lambs. In conclusion, the current study providing an evidence for the im-portance of co-expression of these genes in main body tissues linked with growth performance of Barki lambs.

The objective of this study was to develop the least-cost starter’s diet and evaluated its effect on the growth performance of Sasso breeds and Indigenous ecotype of chicks under the local condition of the South Gondar Zone. The effects of substitution of different levels of commercial starters ration with homemade diet on the growth performance of Sasso and Indigenous chicks were studied in Hiruy Abaregay village of Farta district. The research area is 586km distant from the capital city of Addis Ababa, Ethiopia. A total of 510 Sasso T-44 and 90 Indigenous local ecotypes day-old chicks were randomly divided into five groups, each with 102 and 18 chicks, respectively. These were assigned into five treatments in which 100 (T1), 75 (T2), 50 (T3), 25 (T4), and 0% (T5) of commercial starter’s diet in factorial completely randomized design (CRD) with 3 replications for 60 days feeding period. The results obtained indicated that increased levels of substitution of a commercial diet with a homemade diet significantly depressed (p<0.001) mean daily feed consumption and retention of dry matter, nitrogen, and metabolizable energy. Growth rate as measured by mean daily weight gain, mean final body weight, and total feed consumption and feed cost were significantly miserable (p<0.001) in an increased homemade diet. On the contrary, there was an increase in feed conversion ratio and fiber content in high-level dilution of starter’s commercial diet with a homemade diet. However, the groups of chicks on 0, 25, and 50% commercial starters diets replaced by homemade diet were significantly higher (p<0.001) in mean daily feed intake, daily weight gain, feed conversion ratio, and final body weight attained. The results of this study indicated that up to 50% of expensive commercial starter’s diet could economically be replaced with the least cost homemade diet without adversely affecting the growth performance of chicks.

After approximately 6 months of age, term breastfed infants are increasingly depending on other sources of iron to avoid iron deficiency anemia. The appropriate complementary feeding must include a balance composition of foods containing an adequate amount of macro- and micronutrients to reduce the risk of iron deficiency anemia. This study aims to compare the anemia and growth status of infants receiving commercial fortified infant cereals (FIC) with infants not receiving them. We use all complete multiple Demographic Health Surveys (DHS) from 2005 to 2018 to understand global infant feeding patterns. To better control for the strong household wealth effect in nutritional choices and possibly health awareness, we use propensity score technique as applied in outcome research to better control the effect of covariates. After matching and controlling for confounders, we did find a significant association between reduced risk of anemia and consumption of FIC. After matching and adjusting for confounders the small but positive effects of consumption of FIC on Height for age z-score and Weight for Height Z-score are no longer statistically significant.

The objective of this study was to evaluate the effects of dietary supplementation with bacteriophage and β-mannanase on health and growth performance in calves. Thirty-six pre-weaning male Holstein calves were randomly allocated to one of four dietary treatments: no supplementation, 0.1% β-mannanase, 0.1% bacteriophage, and both 0.1% bacteriophage and β-mannanase supplementation in a starter. The experiment lasted from 2 weeks before weaning to 8 weeks after weaning. Twenty-two calves survived to the end of the experiment. No interaction was observed between the two methods of supplementation. A 1-kg increase in initial BW resulted in a 1.41-fold increase in the odds ratio of survival (p < 0.01). The bacteriophage supplementation tended to increase the odds ratio of survival (p = 0.09). The number of Escherichia coli in feces significantly decreased one week after weaning. β-mannanase supplementation increased the concentrates intake (p < 0.01) and tended to increase the final BW (p = 0.08). Analysis of repeated measures indicated β-mannanase supplementation increased weekly body weight gain (p = 0.018). We conclude that bacteriophage supplementation may have a positive effect on calf survival rate, while β-mannanase supplementation may increase the growth rate and intake of a starter in calves.

Researchers’ attention has been turned on Health expenditure, Carbon emissions, and economic growth as they play a focal role in the current debate on environmental protection and sustainable development. Our paper endeavors to investigate the impact of economic growth and CO2 emissions on Health expenditure for two main countries in Asia (China and India) using a dynamic panel data model estimated employing the Generalized Method of Moments (GMM) for the period 1960–2019. Our empirical results show that there is a significant relationship between health expenditure, CO2 emissions, and economic growth. The empirical evidence indicates a significant positive impact of CO2 emissions on health expenditure whiles economic growth has a negative impact on health expenditure for both countries for the period under study. The population growth rate has transposed effect on India's health spending; on the other hand, its impact on China’s health spending is significantly positive. The strong observable correlation between health expenditure and economic growth is crucial for economic development.

COVID-19 is an infectious disease, growth of which depends upon the linked stages of the epidemic, the average number of people one person can infect and the time it takes for those people to become infectious themselves. We have studied the COVID-19 time series to understand the growth behaviour of COVID-19 cases series. A structural break occurs in the COVID-19 series at the change time form one stage to another. We have performed the structural break analysis of data available for 207 countries till April 20, 2020. There are 42 countries which have recorded five breaks in COVID cases series. This means that these countries are in the sixth stage of growth transmission and show a downward pattern in reporting in the daily cases, whereas countries with two and three breaks, record the rapid growth pattern in the daily cases. From this study, we conclude that the more the breaks in the series, there is more possibility to determine the constant or decreasing rate of daily cases. It is well fitted using lognormal distribution as this distribution is archived at its highest peak after some period and then suddenly it decreases at a longer time period. This can be seen in various countries like China, Australia, New Zealand and so on.

The observed data of COVID-19 progression in Pakistan for first 50 days from the first patient been reported has shown quite an unusual trend which is in opposition to clear exponential spread pattern of any infectious disease. The data of positive cases of 50 days of disease progression has been collected from COVID-19 dashboard of Pakistan and analyzed to see the graphical trend and to forecast the behaviour of disease progression for next 30 days. Mathematical equations regarding exponential growth are used to analyse the disease progression and different possible trajectories are plotted to understand the approximate trend pattern. The possible projections estimated 20k-456k positive cases within 80 days of disease spread in Pakistan. Although, the disease progression pattern is not perfectly exponential, it is still threatening a major fraction of susceptible population and demands effective strategic planning and control.

This paper aims to research whether there is link between FDI inflows and Economic growth in the Republic of Seychelles Island. The ordinary least square results obtained shows that in the impact of FDI inflows on economic growth is low. Small Island Developing States attracts less FDI inflow because they are limited to few resources that attracts overseas firms which results in retarded development. The research lighted that impact of foreign direct investment on host countries does not only depend on the quality and quantity of the FDI inflows but some other variables such as the internal policies and the management skills, market structures, economic trends among others.

Fusarium graminearum is a cereal pathogen responsible for economic losses worldwide every year. An understanding of its growth is key to control its infection, but current growth models are limited because their size-based approach provides little information about the mold's metabolism. Recently, a RGB (red, green and blue) imaging analysis demonstrated the predictability of F. graminearum color change as it grows in yeast extract agar (YEA). This study aimed to verify the same phenomenon in oats (a_w = 0.94, 0.97 and 0.99) and rice (a_w = 0.97, 0.98 and 0.99). Photos were taken using a professional camera and a smartphone (iPhone 6) after incubation and during the subsequent 16 days, and average RGB was quantified using ImageJ software. The photos showed very similar color variations, regardless of the type of grain or a_w. The mold first adopted a k-selection strategy by growing as a mycelium and then a r-selection strategy, increasing spore production. All RGB channels showed positive Pearson correlations between them (p < 0.001) and it was possible to design a model showing two lag phases, the first prior to a mycelial phase and the second prior to a sporular phase at the end of the experiment.

This paper examines the indirect effect of democracy on economic growth using a dataset of 17 MENA countries from 1990 to 2015. Democracy is assumed to affect growth through a series of channels: education, health, physical capital accumulation per labor, government consumption, and trade openness. A system of six simultaneous equations, 3SLS, is used to estimate the effect of democracy on growth through these channels. For further analysis, the countries are classified into groups according to the democratic status on the one side, and the level of income on the other. The results indicate that democracy enhances growth through its positive effect on health in all classifications of countries within the MENA region. However, the effect of democracy on growth through education and physical capital/labor is non-monotonic. Democracy always hinders growth through government size and trade openness. Once all of these indirect effects are accounted for, the overall effect of democracy on growth is negative in less democratic countries and poor countries, but positive in more democratic countries and rich countries.

The paper examines the impact of inward remittances flows on per capita GDP growth in Bangladesh during 1976-2012. We find that the growth effect of remittances is negative at first but becomes positive at a later stage, an evidence of a non-linear. Unproductive use of remittances was rampant in the beginning when they were received by migrant families but better social and economic investments led to more productive utilisation of remittances receipts at later periods. This was the possible mechanism behind the U-shaped relationship. Unlike what is suggested in the literature that the effect of remittances is more pronounced in a less financially developed economy, our evidence do not show that the effect of remittances on per capita GDP growth in Bangladesh is conditional on the level of financial development.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Microbial growth has been of prime importance to the researchers in health and biotechnology industries. It has been known to be closely associated to the secretion of extracellular polymeric substances that help in the formation of colonies. Inter-microbial communication happens within such colonies by means of extracellular electron transfer mediated by the aforementioned polymeric substances. Conventionally, different phases of microbial growth are monitored with the aid of a traditional UV-Visible spectrophotometer by measuring the optical density of the liquid medium at 280 nm. In this paper, we have developed an alternative novel way to sense different growth phases employing electrochemical means i.e. two-terminal cyclic voltammetry. This cyclic voltammetry relies on the extracellular electron transfer mechanism taking place via the polymeric substances secreted by the microorganisms, measured by the temporal area changes in the current-voltage hysteresis curves in the inoculated nutrient broth. This work paves a new way to detect the biological activity in the medium, which can be directly correlated to the population of microorganisms. It would be of immense interest to scientists and researchers working in the field of microbiology as well as in development of biosensors, electrochemical sensors etc. which would be helpful in absence of traditional spectrophotometers.

This paper introduces a theory for the evolution of corporates in which the growth and sustainability strategies are developed simultaneously. Since the introduction of corporate sustainability, it has been an extra cost for risk mitigation and making ‘compensating’ positive impact. The world has reached a tipping point of volatility, mainly due to climate change but also by emergence of COVID-19, so that the applicability of existing corporate structures is under question and these poses high risk to the existence of our planet. On the other hand, the technology cost for sustainable investment has reached a parity in comparison with non-sustainable alternatives. Therefore, our proposed Organic Grow Theory introduces a step-by-step approach so that corporates can grow and be profitable without compromising the ability of future generations to meet their needs. It is concluded that, a new structure for corporate, called Founcorp, would be needed to direct corporates to evolve being a responsible legal entity.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Background: This study aimed to assess the impact of a nutrition-care bundle on growth and neurodevelopmental outcomes of micro-preterm infants born in a level III neonatal intensive care unit (NICU) by two years corrected age. Methods: A nutrition-care bundle emphasizing the prompt initiation of parenteral nutrition at birth, initiation of enteral feeds within 6 hours after birth, and early addition of human milk fortifiers was implemented in 2015 for infants born &lt;26 weeks gestation. This before-and-after study evaluated growth and neurodevelopmental outcomes in infants born between 2012-2013 (before-nutrition-bundle BNB) and 2016-2017 (after-nutrition-bundle ANB). Results: A total of 145 infants were included in the study. Infants in the ANB group (n=73) were smaller (birthweight and gestational age), and there were more male infants and multiples included compared to the BNB group (n=72). Enteral feeds and fortifiers started earlier in the ANB group. Growth velocity and weight-z-score changes were similar in both groups during NICU stay and post-discharge. Systemic steroid use, but not cohort, was linked to lower Bayley scores across all domains. Conclusions: Implementing a nutrition-care bundle was not consistently associated with improved weight-gain and neurodevelopmental outcomes in the micro-preterm infant population, likely due to ongoing high-quality nutritional care by the clinical team.

Fetal growth restriction (FGR) is a major concern in perinatal care. Various medications have been proposed as potential treatments for this serious condition. Nonetheless, there is still no definitive treatment. We studied tadalafil, a phosphodiesterase-5 inhibitor, as a therapeutic agent for FGR in clinical studies and animal experiments. In this review, we summarize our preclinical and clinical data on the use of tadalafil for FGR. Our studies in mouse models indicated that tadalafil improved FGR and hypertensive disorders of pregnancy. In addition, tadalafil protected cerebral nerve development in FGR offspring. The clinical trials we have conducted to date, including a case–control study, a phase I trial, and a phase II trial, have indicated the efficacy of tadalafil in prolonging pregnancy, as well as a good safety profile for fetuses and neonates. The number of fetal, neonatal, and infant deaths was significantly lower in those receiving tadalafil treatment group than that in controls, and no severe adverse maternal events associated with tadalafil were observed. Although further studies are needed to establish the usefulness of tadalafil in FGR treatment, our research indicates that the use of tadalafil in FGR treatment may be a paradigm shift in perinatal care.

This paper evaluates the global sustainable competitiveness of three blocks of power (US, China and EU) based on OGT (Organic Growth Theory) structure. In addition, a sensitivity analysis of COVID-19 on three measures of global sustainable competitiveness, economy, environment and social is also presented. OGT is a well-thought-through and standard framework for evaluation of any type of organiza-tion in their pathway to experience truly sustainable growth. GDP (Gross Domestic Product) is used as an economic measure; total carbon emissions equivalent is used as an environmental measure and HMI (Human Development Index) as a social measure. It is concluded that the pandemic has paused the evolution of countries to be truly world centric countries. However, the recovery plans seem to be highly aligned with the OGT scores and it is expected that the scores to improve dramatically.

Studies show Human Milk Oligosaccharides (HMOs) influence on infant growth were conflicted. This study aims to determine the relationship between HMO profiles and weight growth indicators of infants ages 0-4 months in Indonesia. A prospective longitudinal study was conducted among 120 mother-infant pairs aged 0 – 4 months from the hospital and Public Health Center in Jakarta between August 2021 – May 2022. The gene analysis for the Secretor and Lewis status of the mother were performed by using targeted Next Generation Sequencing (NGS) and Sanger at baseline. The HMO profiles (2'FL, LNFP I, LNT, LNnT, 3'SL, and 6'SL), breast milk calories, and fat were examined at 0, 2, and 4 months. Weight for age z-score, weight for length z-score, infection episode, and mother's body mass index were examined every month. Data were analyzed using Pearson or Spearman correlation test (correlation coefficient), general linear model for repeated measures ANOVA test and Friedman test (mean difference between and within groups, respectively) and logistic regression unadjusted OR (association between dependent and independent variables), with a p-value <0.05 considered statistically significant. Infants' weight velocities were higher among high LNT and 3'SL levels in the second month, and in high 2'FL and LNFP I mothers in the fourth month. HMO profile (2’FL, LNFP I, and LNT) of lactating mothers have a positive relationship with weight growth indicators, and innovative interventions to enhance HMO concentration among mothers should be considered as one of the ways to improve infant growth.

Normally, people lose between 50 and 100 hairs a day and generate new ones from the stem cells of hair follicles, but in people suffering from baldness, the condition called alopecia or androgenetic alopecia, the stem cells remain inactive and are unable to regenerate new hair. The stages of hair growth have been studied to better understand how hair grows and what might be done to prevent or treat premature hair loss. Anagen is referred to as the active phase of hair growth in which the hair shaft is produced by the hair follicle, whereas during catagen and telogen phases the lower part of hair follicle regresses until its growth stops. Although 9% of hair follicles remain in telogen at any one time, a variety of factors including growth factors and cytokines promote the transition from telogen to anagen and the subsequent stimulation of hair growth. In this work, we discuss a new possible treatment, AMPLEX PLUS that could help significantly slow hair loss and encourage new hair growth.

Vine growth habit (VGH) is a notable property of wild soybean plants that also holds a high degree of importance in the context of domestication as it can preclude the use of these wild cultivars for the breeding and improvement of domesticated soybean. Here, a bulked segregant analysis (BSA) approach was employed to study the genetic etiology of VGH in soybean plants by integrating linkage mapping and population sequencing approaches. To develop a recombinant inbred line (RIL) population, the cultivated Zhongdou41 (ZD41) soybean cultivar was bred with ZYD02787, a wild soybean accession. The VGH status of each line in the resultant population was assessed, ultimately leading to the identification of 6 and 9 QTLs from the BSA sequencing of the F4 population and F6- F8 population sequence mapping, respectively. One QTL shared across these analyzed generations was detected on chromosome 19. Three other QTLs detected by BSA-seq were validated and localized to 90.93 kb, 2.9 Mb, and 602.08 kb regions of chromosomes 6 and 13, respectively harboring 14, 53, and 4 genes. Four consistent VGH-related QTLs located on chromosomes 10, 13, and 19 were detected by both analytical approaches in a minimum of two environments, while an additional five loci on chromosomes 2, 10, and 18 were detected in at least two environments only via ICIM mapping. Of the detected loci, five had been reported previously whereas six represent novel QTLs. Together, these data offer new insight into the genetic basis for VGH in soybean plates, providing a rational basis to inform the use of wild accessions in future breeding efforts.

A large number of studies have indicated that plant community modulate the yield, improve growth and promote development of host plants, and among them rhizosphere growth-promoting bacteria play an important role in increasing crop yield. Bacteria benefit from the plant nutrients provided by the roots, but plants can benefit from their rhizobacteria as well. Rhizobia are considered as the most important candidate for plant growth promotion in comparison with rhizobacteria due to their endophytic nature and nitrogen fixing ability. They can also provide auxins which play a notable function in plant growth and plant-microbe interactions. Bacillus spp., the sporulating Gram-positive bacteria, have important roles in plant growth promotion and induction of systemic resistance. Pseudomonas are Gram-negative aerobic chemoheterotroph and are usually found in the environment. Streptomyces are important groups of soil bacteria from the actinomycetes family. Most of them are efficient rhizosphere and rhizoplane colonizers, and they can also be endophytes colonizing inner tissues of host plants. The present review aims to present the most up-to-date findings and results regarding the effects of plant growth promoting bacteria on yield of different crops, especially sorghum. Furthermore, the mechanisms of the actions of different bacteria briefly illustrated, aiming to present future needs to be addressed in sustainable crop production. Plant growth promoting rhizobacteria inoculation with different plants or treating plants with microbe-to-plant signal constituents can be an effectual technique to stimulate crop growth. They are also active in protecting crops from phytopathogens and environmental stress, plant pathogens and they have positive roles in nutrient cycling.

With the objective of studying the influence of elicitors on growth, yield and quality of kalmegh we carried out an investigation for two consecutive years. Nine treatments with three replications were laid out in CRD design. Chitosan, Yeast extract, Jasmonic acid and Salicylic acid were evaluated at different concentrations. CHT 1000 ppm exhibited highest plant height (73.91 cm) and secondary branches (29.07) at the time of harvest. Primary branches and number of leaves per plant were highest in CHT 1000 ppm (26.36; 88.32) which were on par with SA 200 ppm (26.28; 81.51). Plant spread was highest in SA 200 ppm (35.46 cm2) which was on par with CHT 1000 ppm (35.11 cm2). CHT and SA sprays were recorded with on par results for yield parameters but highest fresh (42.34 g) and dry (18.30) herbage yield per plant were exhibited with SA 200 ppm. Highest total chlorophyll (4.459 mg g-1) and total andrographolides (3.494%) content were recorded in SA 200 ppm spray. Significant and positive improvement in growth, yield and quality of kalmegh was noticed with Salicylic acid spray @ 200 ppm at 30 and 60 DAS signifying its use in cultivation of kalmegh for high productivity, quality and better returns for farmers.

Silicon-based thin-films and nanostructures are of paramount importance in a wide range of applications, including microelectronics, photovoltaics, large area sensors, as well as biomedicine. The wide accessibility of silicon and its relatively low cost have driven a continuous improvement of the technology based on this element. Plasma technology has been widely used for the synthesis of coatings and nanostructures based on silicon. Moreover, it has given a fundamental contribution for continuously improving the control of the physicochemical properties of silicon-based materials, and for allowing the synthesis of nanometric structures with well-defined shape and morphology. In this work, we have reviewed the most interesting developments of plasma-assisted processed for the synthesis of Si-based materials, both inorganic and organic, in the last five years. A special attention has been given to the new techniques, or modifications of already existing ones, that open new possibilities for the synthesis of materials with new properties, as well as nanostructures with novel characteristics.

β-Ga2O3 is a well-known semiconductor material for power devices and other applications. Recently, β-Ga2O3 has also been reported as a scintillator material with a light yield of approximately 8400 ph./MeV, scintillation decay time of &lt;1 μs, and density of 6.44 g/cm3. In this study, 2-inch diameter β-Ga2O3 single crystals were prepared by oxide crystal growth using the cold crucible (OCCC) method under various oxygen partial pressures. In the OCCC method, as in the cold crucible method, a high frequency is applied directly to the oxide materials, which are heated and melted, and the melt is held by the outermost solid material itself that is cooled by water using a copper hearth. In the OCCC method, crystal growth is performed while rotating the seed crystal, as in the Czochralski method, to increase the crystal diameter. The optical properties and radiation responses of the crystals grown under various oxygen partial pressures were evaluated.

Cancer diseases lead to the second-highest death rate all over the world. The dynamics of invasion of cancer cells into the human body tissues and metastasis are the main causes of death in patients with cancer. This study deals with theoretical investigation of the dynamics of invasion of cancer cells for tumour growths in human body tissues using discretized Cahn-Hilliard, concentration and reaction-diffusion equations which were solved by Finite Difference Method with the aid of MATLAB computer software. A Crank-Nicolson numerical scheme was developed for the discretized model equations. The numerical result obtained was used to describe the dynamics of cancer invasion of tissues with respect to cancer cells density on tumour growth, turbulence and mobility and equilibrium between charge and discharge of cancer cells. The results of the study provide new insights into combating cancer disease by providing mitigating and intervention measures to this major health problem.

Stunting, during the Covid-19 pandemic, is increasingly becoming a big problem in the world, especially in poor and developing countries. Observational studies have shown that stunting is associated with poor nutrition, especially a plant-based diet, inflammation, caused by infection, enteric dysfunction, an environment with clean water, inadequate sanitation and hygiene (WASH), and endogenous inflammation associated with excess adiposity. This causes nutritional interventions to be often unsuccessful (Kemenkes RI, 2018).The government intervenes to reduce stunting to the target party, which is divided into two categories. The first category is specific nutrition intervention, namely monitoring children under five at the posyandu, giving immunizations, giving vitamin A, giving Supplementary Foods (PMT), and others. The second category is sensitive nutrition interventions, namely the provision of drinking water and proper sanitation, postnatal family planning (KB) services, providing information related to stunting, food social assistance, conditional cash assistance, and others. (KEMEN-PMK, 2018). WHO states, that the impact of stunting can be divided into short-term and long-term impacts. The short-term impacts are; increased incidence of morbidity and mortality; cognitive, motor, and verbal development in children is not optimal; and increased healthcare costs. While the long-term impact; Posture that is not optimal as an adult (shorter than usual); Increased risk of obesity and other diseases; The decline in reproductive health; Less than optimal learning capacity and performance during school years; and Low productivity and work capacity (Kemenkes RI, 2018). The nursing goal is to help people achieve quality, holistic health. Implementation of Modeling and Role Modeling Theory is an option in implementing nursing care for children with stunting. “Modeling” is gaining an understanding of the client’s world from the client’s perspective. That is to build a “model” of the client’s worldview. “Role‑Modeling” is based on the assumption that all humans want to interact with others, they want to carry out selected roles in society. Role-Modeling is using the client’s model of the world to plan interventions that meet his or her perceived needs, grow, develop and heal. Role-Modeling requires that we aim to build trust, promote a positive orientation and a sense of control, affirm strengths and set specific mutual goals.

The objectives of this paper are to analyze the urban growth and urbanization phenomenon in Algeria. Two processes that originated respectively by the expansion of existing urban areas and the process of urbanization that took place between 1954 and 2008, a period marked by significant economic, social and political changes in Algerian society. Our analysis was mainly based on the Algerian general census of population and habitat (2008) and on the application of rank-size distribution of cities according to Zipf’s rule. This study revealed that in Algeria, the urban system is particularly marked by the dramatic expansion of small cities. Indeed, the development of small towns, through the transition from rural to urban and the residential loosening of large cities have influenced the trend towards the balance of the urban system in Algeria. Results revealed also how the "primatial" city is undergoing profound economic and social changes at the national level. These changes are most often imposed from the top as part of land-use planning policy. This study provides some insights into the demographic dynamics of cities and the evolution of urban hierarchies in Algeria, through the comparison of the different rank-size distributions of Algerian cities in space and time. Our results suggest that land-use planning strategies are the only policies capable of influencing the future of the Algerian urban system.

The purpose of this study is to examine the connection between economic growth and unemployment in Liberia between 2001 and 2019. The unit root test and the Augmented Dickey-Fuller (ADF) Co-integration test were used to examine the relationship between unemployment and GDP. The Auto Regressive Distribution Lag (ARDL) bounds test is used to determine if the variables are linked in the long run. According to the results of the ARDL model, there is no long-run relationship between unemployment and economic growth. This study' results have particularly important policy implications for Liberian economic authorities. In both the long and medium term, the observational results showed no meaningful relationship between unemployment and economic growth. The Liberian government should direct its spending toward activities that directly and indirectly promote the creation of employment and decent jobs, a conducive environment and flexible labor market policies or legislation that are not impediments to job creation, and finally, the government should prioritize labor intensive industries.

Although the vegetative stage of indoor cannabis production can be relatively short in duration, there is a high energy demand due to higher light intensities (LI) than the clonal propagation stage and longer photoperiods than the flowering stage (i.e., 16 – 24 hours vs. 12 hours). While electric lighting is a major component of both energy consumption and overall production costs, there is a lack of scientific information to guide cultivators in selecting a LI that corresponds to their vegetative stage production strategies. To determine the vegetative plant responses to LI, clonal plants of ‘Gelato’ were grown for 21 days with canopy-level photosynthetic photon flux densities (PPFD) ranging between 135 and 1430 µmol·m^-2·s^-1 on a 16-hour photoperiod (i.e., daily light integrals of ≈ 8 to 80 mol·m^-2·d^-1). Plant height and growth index responded quadratically; the number of nodes, stem thickness, and aboveground dry weight increased asymptotically; and internode length and water content of aboveground tissues decreased linearly with increasing LI. Foliar attributes had varying responses to LI. Chlorophyll content index increased asymptotically, leaf size decreased linearly and specific leaf weight increased linearly with increasing LI. Generally, PPFD levels of ≈ 900 µmol·m^-2·s^-1 produced compact, robust plants that are commercially relevant, while PPFD levels of ≈ 600 µmol·m^-2·s^-1 promoted plant morphology with more open architecture – to increase airflow and reduce the potential foliar pests in compact (i.e., indica-dominant) genotypes.

Little information is available regarding the impacts of dietary energy level on the gut microbiota and metabolites of donkeys. This studied aimed to explore the effects of dietary energy content on growth performance, intestinal microbiome and metabolome of Dezhou donkeys. Thirty-six 9-month-old male Dezhou donkeys were assigned to two groups fed low or high content energy diets (LE or HE). Results showed that donkeys fed HE had improved (P < 0.05) the average daily gain (ADG) and feed efficiency (G/F), compared with those receiving LE diet. Compared to the LE group, feeding HE specially increased the abundances of unidentified_Prevotellaceae (P = 0.02) while decreased the richness of unidentified_Ruminococcaceae (P = 0.05) of donkeys. Compared to LE group, feeding HE diet significantly (P < 0.05) affected the metabolic pathways involving the aspartate metabolism and urea cycle. In addition, the increased bacteria and metabolites in the HE-fed group exhibited a positive correlation with improved growth performance of donkeys. Taken together, feeding HE diet increased the richness of some specific bacteria and upregulated growth-related metabolic pathways, which contributed to the augmented growth performance of donkeys. Thus, it is a recommendable dietary strategy to feed HE diet to fattening donkey for superior production performance and feed efficiency.

In this study, our goal was to research land-use change by combining spatio–temporal land use/land cover monitoring (LULC (1989–2019) and urban growth modeling (1999–2039) in Benslimane, Morocco, to determine the effect of urban growth on different groups based on cellular automata (CA) and geospatial methods. A further goal was to test the reliability of the AC algorithm for urban expansion modeling. To do this, four years of satellite data were used at the same time as population density, downtown distance, slope, and ground road distance. The LULC satellite reported a rise of 3.8 km2 (318% variation) during 1989–2019. Spatial transformation analysis reveals a good classification similarity ranging from 89% to 91% with the main component analysis (PCA) technique. The statistical accuracy between the satellite scale and the replicated built region of 2019 gave 97.23 %t of the confusion matrix overall accuracy, and the region under the receiver operational characteristics (ROC) curve to 0.94, suggesting the model's high accuracy. Although the constructed area remains low relative to the total area of the municipality's territory, the LULC project shows that the urban area will extend to 5,044 km2 in 2019, principally in the western and southwestern sections. In 2019–2039, urban development is expected to lead to a transformation of the other class (loss of 1,364 km2), followed by vegetation cover (loss of 0.345 km2). In spatial modeling and statistical calculations, the GDAL and NumPy Python 3.8 libraries were successful.

The aim of the study was to analyze the in ovo injection of chemically and biologically synthesized silver nano-particles (Ag NPs) using Brassica oleracea L. var capitate f. Rubra, (BOL) conjugation with L-Arginine (L-Arg) on the immune, muscle growth, survivability and hatchability of the broiler chickens. L-Arg (100 μg) conjugated with 1000 µg of Ag NPs synthesized by (BOL)-extract and L-Arg (100 μg) conjugated with 100 µg of Ag NPs chemically synthesized were injected into fertile eggs at 8d, 14d and 18d of incubation. Living embryo and hatched chicks were calculated. Survivability and hatchability were not affected by the injected dose of L-Arg (100 μg) with 1000 µg (BOL-Ag NPs) and L-Arg (100 μg) with 100 µg (C-Ag NPs) but it significantly improved when the eggs were injected on day 14 of incubation compared with those injected on days 8 or 18. Moreover, the protein expression of muscle development markers such as myogenin and myoD were significantly up-related in 14 d of incubation whereas the heat shock proteins (HSPs) such as HSP-60 and HSP-70 were significantly up-regulated in 18 d incubation. In addition, the in ovo injection on 18 d significantly increased the serum glutamate oxaloacetate transaminase (SGOT) and serum glutamate pyruvate transaminase (SGPT) as well the immunoglobulin (IgM) levels were increased in 14d incubation period in serum at the same concentration.

The impact of monetary policies and their implementation by exchange rate covered the economic condition of Ghana. The social inclusion and conversion factors change the implemented policies of nations, where the real price, trade, technology, a price rate and price level of ratio take an important part of growth. The reform of the financial sector favors the free floating of the exchange rate and global trade by under the premise of flexible exchange rates. The tragedy of country growth and exchange rate toward a trajectory of growth with the growth-enhancing effect through social inclusion, conversion factors, price level ratio, exchange rate, merchant rate, export and trade services. The research study is based on secondary study and social inclusion equity indicators with public resources, building human resources and social protection for economic development has determined. The monetary policies are classified by the different evidence and trade indicators. The significant influence of growth and internal policies has affected trade and exchange rates with growth and reserve policies. The results have computed by linear regression and it proved that social inclusion and alternative conversion factors impact on the global trade and create short term binary relationship.

The composition of bacteria in the gastrointestinal tract of piglets is easily affected by environmental changes, particularly during the weaning period. Compound strains of Lactobacillus reuteri and Lactobacillus salivarius were supplemented to piglets during pre- and post-weaning to determine their effects in improving the growth performance and ameliorating the diarrhea rate and stress caused by antioxidation in piglets. A larger number of L. reuteri and L. salivarius colonized the distal segment of the ileum and the total numbers of Lactobacillus spp. and Bifidobacterium were higher in the ileal mucous membrane and cecal lumen with probiotics supplementation. The numbers of antioxidative and immune molecules were increased in the plasma following compound bacteria (CL) supplementation, whereas cortisol and endotoxin levels were lower and growth hormone and insulin-like growth factor 1 were higher. Spearman’s and KEGG analysis of the bacterial operational taxonomic unit and antioxidative and immune indices and metabolic genes indicated that the body growth modulation by CL supplementation could be attributed to optimization of the intestinal bacterial composition. Collectively, these results suggest that supplementation with CL could reduce stress and improve the growth performance of piglets during weaning by optimizing the intestinal bacterial composition.

The aim of the study was to analyze the in ovo injection of chemically and biologically synthesized silver nano-particles (Ag NPs) using Brassica oleracea L. var capitate f. Rubra, (BOL) conjugation with L-Arginine (L-Arg) on the immune, muscle growth, survivability and hatchability of the broiler chickens. L-Arg (100 μg) with 1000 µg (BOL-Ag NPs) and L-Arg (100 μg) with 100 µg (C-Ag NPs) were injected into fertile eggs at 8, 14 and 18 of incubation. Survival and hatched chicks were calculated. Survivability and hatchability were unaffected by the injected dose of L-Arg (100 μg) with 1000 µg (BOL-Ag NPs) and L-Arg (100 μg) with 100 µg (C-Ag NPs) but it significantly improved when the eggs were injected on day 14 of incubation compared with those injected on days 8 or 18. Moreover, the protein expression of muscle development markers such as myogenin and myoD were significantly up-related in 14 d incubation whereas the heat shock proteins (HSPs) such as HSP-60 and HSP-70 were significantly up-regulated in 18 d incubation. In addition, the in ovo injection on 18 d significantly increased the serum glutamate oxaloacetate transaminase (SGOT) and serum glutamate pyruvate transaminase (SGPT) as well the immunoglobulin (IgM) levels were increased in 14-day incubation period in serum at the same concentration. Collectively, these results indicate that injecting L-Arg (100 μg) with 1000 µg of BOL-Ag NPs or L-Arg (100 μg) with 100 µg of C-Ag NPs to eggs at day 14 after incubation could improve their hatchability, survival rate, and muscle growth marker.

Mapping settlement extents at the annual time step has a wide variety of applications in demography, public health, sustainable development, and many other fields. Recently, while more multitemporal urban feature or human settlement datasets have become available, issues still exist in remotely-sensed imagery due to coverage, adverse atmospheric conditions, and expenses involved in producing such feature sets. These challenges make it difficult to increase temporal coverage while maintaining high fidelity in the spatial resolution. Here we demonstrate an interpolative and flexible modeling framework for producing annual built-settlement extents. We use a combined technique of random forest and spatio-temporal dasymetric modeling with open source subnational data to produce annual 100m x 100m resolution binary settlement maps in four test countries of varying environmental and developmental contexts for test periods of five-year gaps. We find that in the majority of years, across all study areas, the model correctly identified between 85-99% of pixels that transition to built-settlement. Additionally, with few exceptions, the model substantially out performed a model that gave every pixel equal chance of transitioning to the category “built” in each year. This modelling framework shows strong promise for filling gaps in cross-sectional urban feature datasets derived from remotely-sensed imagery, provide a base upon which to create future built/settlement extent projections, and further explore the relationships between built area and population dynamics.

Size-based fungal growth studies have limitations. For example, the growth in size stops in closed systems once it reaches the borders and poorly describes the metabolic status, especially in the stationary phase. This might lead mycotoxin studies to unrealistic results. Color change could be a viable alternative as pigments are results of the mold’s metabolic activity. This study aimed to verify the possibility of using gray values and the RGB system to analyze the growth of Fusarium graminearum. It consisted color and area measurement using the ImageJ software for specimens grown in yeast extract agar (YEA). The results suggest the usability of color and gray values as reliable tools to analyze the growth of F. graminearum.

Seeds of three C₃ and one C₄ annual weedy species were collected from agricultural fields in Beltsville, Maryland in 1966 and 2006, when atmospheric CO₂ concentrations averaged about 320 and 380 mmol mol^-1, respectively. Plants from each collection year were grown over a range of CO₂ concentrations to test for adaptation of these weedy species to recent changes in atmospheric CO₂. In all three of the C₃ species, the increase in CO₂ concentration from 320 to 380 mmol mol^-1 increased total dry mass at 24 days in plants from seeds collected in 2006, but not in plants from seeds collected in 1966. Shoot and seed dry mass at maturity was greater at the higher growth CO₂ in plants collected in 2006 than in 1966 in two of the species. Down regulation of photosynthetic carboxylation capacity during growth at high CO₂ was less in the newer seed lots than in the older in two of the species. Overall, the results indicate that adaptation to recent changes in atmospheric CO₂ has occurred in some of these weedy species.

The aims of the study were to evaluate seedling growth and survival of Prunus africana provenances in awi highland based on ecological requirement of the tree. We measured survival and growth of three P.africana provenances seedlings found in Ethiopia (provenances sources namely: Gedeo, Jibat and Munnessa). Design of experiment with randomized complete block design (RCBD) with three replications. Seedlings planted at 2m, 2.5m and 3m distance between plants, plot, and blocks respectively. A plot size of 10mx10m and 25 plants are found per plot (0.01ha). We used ANOVA to test differences in survival, and growth among provenances over time. Results concluded that, provenances have no significant variation among in establishment rate, plant height and collar diameter growth. Of these provenances, Jibat was the first in establishment (56%), second in height (1.97m) and diameter (2.89cm). Gedeo was stood first in height (2.30m) but second in establishment rate (52%) and thickness(3.45cm), but Munessa with very good growth in diameter(3.59cm) might be prefreed for bark extraction followed by Gedeo, last in height (1.75m),but established second (52%). Contrary to expectations, seedlings were still at substantial risk of mortality ≥3 years after planting. Probably the plants survival rate and growth probably affected by altitude, soil water potential, light exposure, and wild animal presence in the surrounding. In steep slope sites, canopy shade, existing weed vegetation as well as wild animals such as apes is unlikely to enhance seedling survival after planting. Our results suggest that seedling mean growth increased with 0.008mm thickness and 0.41mm per day while 2.8mm thickness and 146.8mm tall increment recorded in 2560meter elevated high land or injibara with mean value of 18.5°C and rain fall is 1300mm.

Human milk is recommended for feeding preterm infant. Yet the potential impact of specific breast-milk lipid components on the initial growth rate of very-preterm infants has received scant attention. The current pilot study aims to determine whether breast-milk lipidome had any impact on the early growth pattern of preterm infants fed their own mother’s milk. A prospective monocentric observational birth cohort was established, enrolling 147 preterm infants, who received their own mother’s breast-milk throughout hospital stay. Among that cohort, infants who experienced slow (n=15) or fast (n=11) growth were selected, based on the change in their weight Z-score between birth and hospital discharge (-1.54± 0.42 and -0.48± 0.19 Z-score, respectively). Liquid chromatography-high resolution-mass spectrometry was used to obtain lipidomic signatures in breast-milk. Multivariate analyses made it possible to identify breast-milk lipid species that allowed clear-cut discrimination between the 2 infants’ groups. Validation of the selected biomarkers was performed by means of various multidimensional statistical techniques, false-discovery rate and ROC curve computation. Breast-milk associated with fast growth contained more medium chain-saturated fatty acid and -sphingomyelin, dihomo-γ-linolenic acid (DGLA)-containing phosphethanolamine, and less oleic acid-containing triglyceride and DGLA-oxylipin. Their predictive ability of preterm early-growth rate was validated in presence of confounding clinical factors.

Oil revenues and external debt might have stimulated economic growth in the oil exporting countries via investment in capital projects. The paper estimated economic growth on oil revenues and external debt after controlling public investment and population growth over the period 1970-2015. Following the confirmation of the order of integration, our analysis is based on autoregressive distributed lag bound testing to cointegration approach. The key findings are that oil revenues and public investment contributes to Nigeria’s economic growth. However, our findings also indicate that external debt and population growth retards growth. The study suggests that minimizing fiscal deficits and unnecessarily foreign loans by creating tax avenues through the development of the non-oil sectors would reduce the dependency syndrome on a single commodity (oil) in Nigeria.

A field experiment to assess the effect of mulch on growth (days to maturity, plant height, leaf length and leaf number) of Garlic (Allium Sativum L.) was conducted in 2015 - 2016 at Addis Ababa University Selale campus, on demonstration field to identify optimum plant growth using different mulches for Garlic tested independently. The experiment was designed using randomized complete block. The analyzed result using ANOVA shows significance difference among the treatments. Plots treated with black polyethylene mulch and grass mulch enhanced maturity by about 114 and 116 days, respectively, while garlic in control showed slightly delayed maturity of 125 days. Maximum plant height (66.5 cm) was recorded in the plants mulched by black polyethylene mulch followed by grass mulch which records 62.3 cm and 52.3 cm, respectively. A highly significant variation (p<0.05) in the leaf length was observed at the different mulch treatments. Significantly maximum leaf number (15.3) was recorded in plants mulched with black polyethylene followed by grass mulch with 14.0 leaf number. Thus, black polyethylene and grass mulch performs better than control treatment in growth parameter evaluation of garlic plants under fiche condition.

This cross-country four-year longitudinal study investigated the development of processing speed throughout primary school education. The analyses were conducted on data collected from 441 schoolchildren in Grades 1, 2, 3 and 4 (aged 6.42 to 11.85 years) in the Kyrgyzstan and Russia. Mixed effects growth modeling was applied to estimate average and individual growth trajectories for processing speed at two cross-country samples. Latent class growth modeling was conducted to identify different types of growth trajectories for processing speed and to compare the distribution of the types within the analyzed samples. According to the results, processing speed significantly increases across primary school years. The trajectory is characterized by nonlinear changes with more intensive growth between Grades 1 and 2, which later slows down until Grade 4. There were no significant cross-country differences in the initial score of processing speed or developmental changes in processing speed across primary school years. The development of processing speed is described by a model with three quadratic growth types but minimally differs. It is concluded that in both samples, the development of processing speed may be characterized by homogeneity, with the most intensive growth from Grade 1 to Grade 2 and subsequent linear improvement until Grade 4.