In the framework of the FireStorm project, four portable weather stations were installed in the Lousã/Estrela mountain range. Given that the Portuguese Institute for Sea and Atmosphere’s sur-face network has two weather stations installed in this region, the new data allows an improved monitoring of the vertical variability of near-surface variables in this mountainous region. As most of the wildfires in mainland Portugal affect areas with complex terrain with elevations below 1200 m and major fires continue to burn overnight, it is also relevant to monitor the vertical changes of meteorological variables in the nighttime period, as these may exhibit large variability. This study provides the first assessment of the available data, with focus on the summer seasons of 2021 and 2022. The results highlight the large variability that was observed in the region and suggest that the risk of extreme fire behaviour in the nighttime period may be underestimated.

Fire behavior of natural rubber latex foam under different thickness conditions(d=1,2and 5cm)were explored though a little of experiments by using the self-built small scale experimental platform. It can be shown that the flame spread law of thermally thin and thermally thickness are different. Natural rubber latex foam with thickness of 2cm show higher fire risk, which value of flame spread rate, maximum flame height, maximum mass loss rate and maximum temperature is 0.00293m/s, 851.875mm, 1.83g/s, 948K,repectively.That may because the thickness of residue formed of thermally thick materials is larger than the thin one, obstructing the contact of the natural rubber latex foam with fresh air .In addition, a special phenomenon is noticed that during the second stage, the bottom unburned zone located in the four edges(thermally thin material) and middle player(thermally thick material).

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

Aging is a major risk factor for the higher incidence and prevalence of chronic conditions, such as cancer, cardiovascular and metabolic diseases, and neurodegenerative diseases. Closely linked with the onset of all these age-related diseases is immunosenescence, a condition defined as progressive reconfiguration of the immune functions leading to an increased susceptibility to infectious diseases, poorer response to vaccination, increased prevalence of cancer, rheumatoid arthritis, and other chronic diseases characterized by a pro-inflammatory state named inflammaging. Given that immunosenescence frames age-related diseases, it is natural to ask how these illnesses are related under the context of innate and adaptative components of the immune system. Knowledge processing by Formal Concept Analysis (FCA) of age-related diseases framed in an immunosenescence multivalued context shows that a hierarchy among these diseases emerges with a subconcept-superconcept nested structure, with two clusters, first made of metabolic diseases, cancer, and cardiovascular diseases. Second metabolic and neurodegenerative diseases and rheumatoid arthritis. Metabolic diseases seem to be a pivot illness and they must be a primary target given their global incidence and prevalence and their cost-effective treatments like regular physical activity, weight loss, healthy diet, stopping smoking, and reducing or managing stress. Another implication of the ontological analysis of age-related diseases is about the nature of immunosenescence, suggesting that initial symptoms of age-related diseases are mainly related to innate immune mechanisms, and developing of severe symptoms of age-related diseases like cancer, cardiovascular or neurodegenerative diseases depends on the activation of acquired immunity processes.

Akebia trifoliata is an economically important self-incompatible fruit tree in the family Lardiza-balaceae. Asexual propagation is the main strategy used to maintain excellent agronomic traits. However, the generation of adventitious roots during asexual propagation is very difficult. To study the important role of the WUSCHEL-related homeobox (WOX) transcription factor in fruit and adventitious root growth and development, we characterized this transcription factor family in the whole genome of A. trifoliata. A total of 10 AktWOXs were identified, with the fol-lowing characteristics: length (657~11328 bp), exon number (2~5), isoelectric point (5.65~9.03), amino acid number (176~361 AA), and molecular weight (20.500~40.173 kDa). 10 AktWOXs were classified into modern (6), intermediate (2), and ancient clades (2) and that all AktWOXs had undergone strong purifying selection during evolution. The expression profile of AktWOXs dur-ing A. trifoliata fruit development and adventitious root formation indicated that AktWOXs are widely involved in the development of the three fruit tissues, flesh, seeds and rind, and play an important role in the regulation of adventitious root development. Overall, this is the first study to identify and characterize the WOX family in A. trifoliata and will be helpful for further re-search on A. trifoliata fruit development and adventitious root formation.

Assessment of renal function is critical to diagnose and manage renal age-related decline, disease (KD), and failure, which are prevalent in the elderly population. Glomerular filtration rate (GFR) is widely used as an indicator of kidney function, but its direct measurement is challenging, as are its age and gender caveats. This makes difficult the differential diagnosis, between age-related physiological decline and KD and/or failure. Currently, the inflammation-based modified Glasgow prognostic score (mGPS) is emerging as promising biomarker of several inflammatory acute/chronic diseases. In this study, the large variability of eGFR with age and gender was evaluated, as the association of eGFR values with mGPS levels. A population of 57449 adult participants (age ≥18 years) was enrolled. Appropriate circulating biomarkers were measured to detect eGFR and mGPS values. The data obtained demonstrated a significant decrease of eGFR in men vs. women across the four selected age classes (18-40, 40-60, 60-80, 80-100 years), eGFR classes were significantly associated with mGPS (p<0.001), as age-classes and gender with mGPS categories. Accordingly, the percentage of people having a mGPS score= 2 significantly increased across the eGFR classes: with a 11% in the G1/eGFR class to achieve the 44% in G5/eGFR. Thus, the combination of mGPS with eGFR could represent the best benchmark risk model for differentiating age-related renal decline from a very KD, and for a better identification of different degrees of KD severity.

The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

Age-related macular degeneration (AMD) is a common ocular disease characterized by the de-generation of the central area of the retina in elderly population. Progression and response to treatment is influenced by genetic and non-genetic factors. Proteomics is a powerful tool to study, at the molecular level, the mechanisms underlaying the progression of the diseases, to identify new therapeutical targets and to establish biomarkers to monitor progression and treatment ef-fectiveness. In this work we pursue to systematically review the use of proteomic-based ap-proaches for the study of the molecular mechanisms underlying the development of AMD, as well as the progression of the disease and the on-treatment patient monitoring. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) reporting guidelines were followed. Proteomic approaches have identified key players on the onset of the disease, such as proteins involved in lipid metabolism and oxidative stress, but also in the progression to advanced stages, including factors related to extracellular matrix integrity and angiogenesis. Although an-ti-vascular endothelial growth factor (anti-VEGF)-based therapy has been crucial in the treatment of neovascular AMD it is necessary to get deeper into the underlying disease mechanisms to move forward to next-generation therapies of the later-stage forms of this multifactorial disease.

The COVID-19 pandemic has had a significant impact on all facets of life and has exacerbated many challenges faced by people living with tuberculosis (TB). This study aimed to assess the health-related quality of life (HRQoL) of TB patients in Guinea during the COVID-19 pandemic. A mixed-methods study was conducted using two validated psychometric tools to assess HRQoL and qualitative interviews among TB patients enrolled in treatment at three centers in Conakry, Guinea. Multinomial logistic regression was used to identify factors associated with the deterioration of HRQoL. We included 439 participants in the study, among whom 44% and 31% experienced pain and anxiety, respectively. We found that an increase in the number of household members and the distance from participants’ residence to the health centre were significantly associated with lower HRQoL. Qualitative interviews highlighted nutritional and financial concerns which were exacerbated during COVID-19 pandemic and beliefs that the Guinean Government’s assistance plan was insufficient. This study supports the implementation of specific relief plans for TB patients which includes nutritional and psychological support, especially those whose movements are limited by travel restrictions, impeding access to TB care, reducing work opportunities and exacerbating financial needs and stress.

Antibiotics have been used in various fields such as livestock farm and fish farm as well as hospital in order to treat diseases caused by bacteria. However, the antibiotics that are not completely decomposed, but remains as residue and discharge to aquatic environment, can cause an imbalance in the gut flora of host, as well as regulate abnormal host gene regulatory system. We investigated the effects of chronic exposure with the low concentrations of erythromycin and ampicillin on gut microbiome and immune and stress-related gene expression using Korea native ricefish (Oryzias latipes). As a result of microbiome analysis, the proportion of Proteobacteria was increased in the ricefish when exposed to erythromycin and ampicillin chronically, whereas the proportion of other bacterial phyla decreased. In addition, the immune and stress-related genes were significantly influenced in the ricefish under the chronic antibiotics exposure. These results show that the internal microbial flora and the host gene expression are susceptible even in the low concentration of chronic antibiotic existing environments. This study provides the importance of the appropriate use of antibiotics dose to maintain the sustainable and healthy aquaculture industry and water ecosystem.

The importance of diet and the gut-brain axis for brain health and cognitive function is increasingly acknowledged. Dietary interventions are tested for their potential to prevent and/or treat brain disorders. Intermittent fasting (IF), the abstinence or strong limitation of calories for 12 to 48 hours, alternated with periods of regular food intake, has shown promising results on neurobiological health in animal models. In this review article, we discuss the potential benefits of IF on cognitive function and the possible effects on the prevention and progress of brain-related disorders in animals and humans. We do so by summarizing the effects of IF which - through metabolic, cellular and circadian mechanisms - lead to anatomical and functional changes in the brain. Our review shows that there is no clear evidence of a positive short-term effect of IF on cognition in healthy subjects. Clinical studies show benefits of IF for epilepsy, Alzheimer’s disease and multiple sclerosis on disease symptoms and progress. Findings from animal studies show mechanisms by which Parkinson’s disease, ischaemic stroke, autism spectrum disorder and mood- and anxiety disorders could benefit from IF. Future research should disentangle whether positive effects of IF hold true regardless of age or the presence of obesity. Also, variations in fasting patterns, total caloric intake and intake of specific nutrients may be relevant components of IF success. Longitudinal studies and Randomized Clinical Trials (RCTs) will provide a window into the long-term effects of IF on the development and progress of brain-related diseases.

This study presents an in–depth analysis and strategic planning techniques for approaching a situation or achieving progress related to information technology services of Nueva Ecija University of Science and Technology, particularly the San Isidro Campus. As an educational organization and one in the region excellence providers in education, the University has so much vital information to manage and services to offer to provide the student's needs through the Management Information System department, application of IT services as a competing instrument to combat tedious tasks such as online admission, grade release, enrollment information, and online learning, university announcement, and possible students’ internship. The objective of this study is to determine the influence of information technology in day–to–day activities of the organization and strategy applied to streamline processes more conveniently. The researchers develop a conceptual model that would analyze the IT services' impact by identifying its strengths, weaknesses, opportunities, and threats and cleverly act on it using the TOWS Matrix in generating strategic decisions. The overall results were beneficial to the University and MIS as a basis for formulating competitive strategies and integrating it in an extended development plan.

Music and language are hypothesized to share neural resources, particularly at the level of syntax processing. Recent reports suggest that attention modulates this sharing of neural resources, but the time-course of the effects of attention, and the degree to which attention operates similarly on music and language, are yet unclear. In this EEG study we manipulate the syntactic structure of simultaneously presented musical chord progressions and garden-path sentences in a modified rapid serial visual presentation paradigm, while varying top-down attentional demands to the two modalities. The Early Right Anterior Negativity (ERAN) was observed in response to both attended and unattended musical syntax violations. In contrast, an N400 was only observed in response to attended linguistic syntax violations, and a P3 only in response to attended musical syntax violations. Results show that top-down allocation of attention indeed affects the processing of syntax in both music and language, with different neural resources acting upon the two modalities particularly at later stages of cognitive processing. However, the processing of musical syntax at an earlier stage of the perceptual-cognitive pathway, as indexed by the ERAN, is partially automatic, and is strongly indicative of separate neural resources for music and language.

IgE-mediated wheat allergy is a gluten-related disorder. Wheat is one of the five most common food allergens in children. However, the natural history of IgE-mediated wheat allergy has seldom been described in the research literature. This study presents the current state of knowledge about the IgE-mediated wheat allergy in children.

Annually, the oak forests of the Zagros Mountain chains, in western Iran and northeastern Iraq, face recurring challenges posed by forest fires, particularly in the Kurdo-Zagrosian forests situated in western Iran and northeastern Iraq. Assessing fire susceptibility relies significantly on vegetation condition. Integrating in situ data, Remote Sensing (RS) data, alongside the integration of Geographical Information Systems (GIS), presents a cost-effective and precise approach to capturing environmental conditions before, during, and after fire events, minimizing the need for extensive fieldwork. This study refines and applies the Zagros Grass Index (ZGI), a local vegetation index tailored to discern between grass-covered surfaces from tree canopies in Zagros forests, identifying the grass masses as the most flammable fuel type. Utilizing Moderate Resolution Imaging Spectroradiometer (MODIS) Normalized Difference Vegetation Index (NDVI) product as input, from 2013 to 2022, the ZGI aims to mitigate the influence of tree canopies, isolating NDVI values solely attributable to grass cover. By incorporating phenological characteristics of forest trees and grass species, the ZGI outperforms NDVI in mapping grass-covered areas that are crucial for fire susceptibility assessment in the study region. Results demonstrate a strong overlap between ZGI-based maps and recorded fire occurrences, validating the efficacy of the index in fire susceptibility estimation.

Findings primarily drawn from literature review and interviews with professional resource persons suggest that although the RMG industry of Bangladesh has made substantial progress in correcting structural risks within factory buildings, fire still remains an unresolved issue posing unceasing threat to safety. These findings are significant for all stakeholders within the global supply chain network of Bangladesh, concerned with improving sustainability of the RMG industry and seeking to outline the responsibilities for each group of actors towards preventing building disasters. Both Tazreen Fashion fire incident and the Rana Plaza building collapse served as ‘critical junctures’ in rapid transfer of physical technology to enhance structural safety and streamline production planning within the RMG manufacturing factories within Bangladesh. However, the transfer of social technology within the supply chain network of a developing nation in areas such as development of organisational safety culture or promoting workplace ethics, requires long-term planning and prolonged practices. The paper thus concludes that in developing countries, transfer of physical technology is more readily achievable than the adoption of social technology.

Chaparral shrublands are the dominant wildland vegetation type in southern California and the most extensive ecosystem in the state. Disturbance by wildfire and climate change have created a dynamic landscape in which biomass mapping is key in tracking the ability of chaparral shrub-lands to sequester carbon. Despite this importance, most national and regional scale estimates do not account for shrubland biomass. Employing plot data from several sources, we built a random forest model to predict above ground live biomass in southern California using remote sensing data (Landsat NDVI) and a suite of geophysical variables. By substituting the NDVI and precipi-tation predictors for any given year we were able to apply the model to each year from 2000-2019. Using a total of 980 field plots, our model had a k-fold cross validation R2 of 0.51 and a RMSE of 3.9. Validation by vegetation type ranged from R2 = 0.17 (RMSE=9.7) for Sierran mixed conifer to R2 = 0.91 (RMSE = 2.3) for sagebrush. Our estimates showed an improvement in accuracy over a two other biomass estimates that included shrublands, with an R2 = 0.82 (RMSE = 4.7) compared to R2 = 0.068 (RMSE = 6.7) for a global biomass estimate and R2 = 0.29 (RMSE = 5.9) for a regional biomass estimate. Given the importance of accurate biomass estimates for resource managers we calculated the mean year 2010 shrubland biomass for the four national forests which ranged from 3.5 kg/m2 (Los Padres) to 2.3 kg/m2 (Angeles and Cleveland). Finally, we compared our estimates to field-measured biomass from the literature summarized by shrubland vegetation type and age class. Our model provides a transparent and repeatable method to generate biomass measure-ments in any year, thereby providing data to track biomass recovery after management actions or disturbances such as fire.

Wildfire is the main disturbance in forested ecosystems of southern Europe and is due to complex interactions between climate-weather, fuels and people. Warmer and drier conditions projected in this region are expected to profoundly affect wildfires, which will impact ecosystems and humans. We review the scientific literature addressing the assessment of climate change impacts on wildfires in southern Europe, with a twofold objective: (i) report the trends in wildfire danger and activity projected under warming climate in southern Europe and (ii) discuss the limitations of wildfire projections under the specific biogeographical context of southern Europe.We identified 22 projection studies that examined future wildfire danger or wildfire activity at local, regional or continental scale. Under the scenario with the highest greenhouse gas emissions, we found that projections studies estimate an increase in future fire danger and burnt areas varying, on average, from 2 to 4 % and from 15 to 25 % per decade, respectively. Fire-prone area expansion to the north and to Mediterranean mountains is a concern, while climate-induced burnt area increase might be limited by fuel availability in the most arid areas. While all studies agreed on the direction of changes, further comparisons on the magnitude of increase remained challenging because of heterogeneous methodological choices between projections studies (climate models, projection period, spatial scale and fire metrics). We then described three main sources of uncertainty that may affect the reliability of wildfire projections: climate projections, climate-fire models, and the influences of fuel load/structure and human related factors on the climate-fire relationships. We finally suggest research directions to address some of these issues for the purpose of refining fire danger and fire activity projections in southern Europe.

Although migraine belongs to the main causes of disability worldwide the mechanisms of its pathogenesis are poorly known, which is among the reasons that this disease is underdiagnosed and undertreated. As migraine diagnosis is based on the subjective assessment of symptoms, there is a need to establish objective markers of its occurrence and severity. Tryptophan (TRP) metabolism has been associated with the pathogenesis of neurological and psychiatric disorders. In the present work, we investigated an association between migraine and the urine concentration of TRP and its metabolites 5-hydroxyindoleacetic acid (5-HIAA), kynurenine (KYN), kynurenic acid (KYNA) and quinolinic acid (QA) in 21 low-frequency episodic migraine patients and 32 controls. Migraine patients displayed lower urinary levels of 5-HIAA and KYNA, but KYN and QA were enhanced as compared with the controls. Consequently, the patients were characterized by different values of the 5-HIAA/TRP, KYN/TRP, KYNA/KYN, and KYNA/QA ratios. Furthermore, urinary concentration of 5-HIAA was negatively correlated with Migraine Disability Assessment score, monthly migraine, and monthly headache days. A negative correlation between Patient Health Questionnaire 9 scores assessing depression. In conclusion, the urinary 5-HIAA level may be an easy-to-determine marker of migraine occurrence and severity and may contribute to the identification of migraine patients with depression.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

Exposure to extreme heat is a known risk factor that is associated with increased heat-related illness (HRI) outcomes. The relevance of heat wave definitions could change across the health conditions and geographies due to the heterogenous climate profile. This study compared the sensitivity of 28 heat wave definitions associated with HRI emergency department visits over five summer seasons (2011-2016), stratified by two physiographic regions (Coastal and Piedmont) in North Carolina. The HRI rate ratios associated with heat waves were estimated using the generalized linear regression framework assuming a negative binomial distribution. We compared the Akaike Information Criterion (AIC) values across the heat wave definitions to identify an optimal heat wave definition. In the Coastal region, heat wave definition based on daily maximum temperature with a threshold >90^th percentile for two or more consecutive days had the optimal model fit. In the Piedmont region, heat wave definition based on the daily minimum temperature with a threshold value >90^th percentile for two or more consecutive days was optimal. Additionally, we observed that the optimal heat wave definitions from this study captured moderate and frequent heat episodes than the national weather service (NWS) heat products that worked best for extreme heat episodes. This study compared the HRI morbidity risk associated with epidemiologic-based heat wave definitions and with NWS heat products. Our findings could be used for public health education and suggest recalibrating NWS heat products.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Tularemia is a zoonotic disease caused by {\it Francisella tularensis} bacteria, a gram-negative coccobacillus-shaped bacterium. There are multiple transmission routes of the infection to humans such as consumption of contaminated food or water, handling of infected animals or bites from {\it haematophagous} arthropods (such as ticks, deer flies, or mosquitoes). In this study we focus on transmission via the bites of ticks and developed a deterministic model of ordinary and impulsive differential equations to gain insight in the differential effect of prescribed fire on {\it Demacenta variablis} and {\it Amblyomma americanum} ticks and the prevalence of tularemina. We found that prescribed fire differentially reduce the number of the two ticks with {\it A. americanum} reduced the least compare to {\it D. variablis} subsequently leading to differential increase of tularemia new infected cases in humans and rodents. Our result further indicates that the spatial arrangement of burn against unburn areas may not matter as either arrangement led to fewer ticks and reduction in tularemia transmission when prescribed fire was implemented. The results of this study provide important new understandings of the intricate effect of prescribed fire on tick species, and the dynamics of the tick-borne disease, tularemia disease in this study.

Abstract: Wildfires in forest ecosystems exert substantial ecological, economic, and social impacts. The effectiveness of fire management hinges on precise pre‐fire risk assessments to inform mitigation efforts. This study aims to investigate the relationship between predictions from pre‐fire risk assessments and outcomes observed through post‐fire burn severity analyses. In this study, forest fire risk was assessed with the Fuzzy Analytical Hierarchy Process, in which fire behavior factors were used as input. The degree of burn was determined using the Random Forest method using 11519 training points and 400 test points on Sentinel‐2 satellite images in three different classes. According to the results obtained from 266 selected test points located within the forest boundaries, all primary factors showed an increased effect in areas with high burn severity. Climate, in particular, emerged as the most influential factor, accounting for 52% of the overall impact. However, in cases of high fire severity, climate proved to be the most effective risk factor, ac‐counting for 67%. It followed by topography with 50% accuracy at high fire intensity. In the risk assessment is based on the FAHP method, climate was assigned the highest weight value among other factors with 32.2%. Topography emerged as the second most effective risk factor with 27 %. To evaluate the results more comprehensively both visually and statistically, two regions with different stand canopy characteristics were selected within the study area. While high burn severity had the highest accuracy in Case 1 area, moderate burn severity had the highest in Case 2 area. During the days when the fire continued, the direction of spread was obtained from MODIS images. In this way, the fire severity depending on the direction of fire progression was also interpreted. Through an analysis of various case studies and existing literature, the research underscores both the strengths and limitations inherent in predicting forest fire behavior‐based pre‐fire risk assessments. Furthermore, it emphasizes the necessity of continuous improvement to increase the success of forest fire management.

Photoelectric smoke detectors are the most cost-effective devices for very early fire alarms. However, due to different light intensity response values for different fire smoke and interference from interferential aerosols, they have a high false alarm rate, which limits their popularity in Chinese homes. To address these issues, an embedded spatial-temporal convolutional neural network (EST-CNN) model is proposed for real fire smokes identification and aerosols (fire smokes and interferential aerosol) classification. EST-CNN consists of three modules including information fusion, scattering feature extraction, and aerosol classification. Moreover, a two dimensional spatial-temporal scattering (2D-TS) matrix is designed to fuse the scattered light intensities in different channels and adjacent time slices, which is the output of the information fusion module and the input of the scattering feature extraction module. EST-CNN is trained and tested with experimental data measured on the established fire test platform using the developed dual-wavelength dual-angle photoelectric smoke detector. The optimal network parameters are selected through extensive experiments resulting in an average classification accuracy of 95.6% for different aerosols with only 66 kB network parameters. The experimental results demonstrate the feasibility of the designed EST-CNN model to be directly installed in existing commercial photoelectric smoke detectors to realize aerosol classification.

Ensuring fire safety is an important condition for the successful operation of industrial enterprises. It is necessary to detect the threat of fire before ignition. An indicator of danger is the appearance of gas, which occurs as a result of unauthorized heating of equipment. Gas sensors make it possible to detect the appearance of gases characteristic of the decomposition of materials at the stage of smouldering and pyrolysis, which cause a change in the composition of the atmosphere. This paper presents a mathematical method for the rational placement of gas analyzers for premises of potentially hazardous industries. It is the rational placement of gas sensors, which ensures safety, taking into account economic feasibility that determines the effectiveness of their use. For the first time, the analysis of gas accumulation during the movement of the flow from the source to the ceil-ing, then propagation to the location of the sensors, is used for the first time to select the placement of gas sensors. Depending on the permissible values of the gas volume, the placement and number of gas sensors are selected. The calculation of the conditions for the rational placement of gas sen-sors for the most common indicators, such as carbon monoxide and hydrogen at different sizes and heights of rooms, is carried out. The method of calculating the location of gas analyzers makes it possible to diagnose and predict fire hazard at technological facilities on the basis of gas control, and compare the obtained values with the maximum permissible values. This method provides cal-culation of the coordinates of the gas source from the coordinates of the triggered sensors. Knowing the coordinates of all sensors, the coordinates of the sensors that gave the alarm, and the formula for determining the volume of the gas cloud under these sensors, it is possible to assess the localization of the source of dangerous gas in the protected room. This increases the efficiency of the fire safety system. The method makes it possible to control the layout of sensors depending on the volume of protected premises, types of production, the creation of new sensors, changes in the composition of hazardous gas in different technological conditions.

CO2 is widely used in the prevention and control of coal spontaneous combustion. In this manuscript, three low-rank coals with different metamorphic degrees were selected as the research objects. The temperature-programmed experiments, in-situ infrared cooling experiments, simulation of competitive adsorption of CO2 and O2 in coal pores, and simulation study of CO2 inhibition of coal oxygen composite reaction were used to obtain the role and effect of CO2 in preventing oxygen adsorption in coal at low-temperature oxidation stage. It is concluded that CO2 can displace the O2 near the pore wall to physically prevent the adsorption of O2. Through the change law of heating rate and kinetic analysis, it is found that CO2 can increase its activation energy by 5.3%-108.3% during the slow heating stage of coal, and reduce its heating rate. At around 120°C, coal loses the protective effect of CO2. From the changes of functional groups, it can be seen that when coal is cooled in CO2 atmosphere, mainly pyrolysis and condensation reactions occur due to the lack of O2. In addition, CO2 can also inhibit the chain reaction of coal's chemical adsorption of oxygen. This work provides a theoretical basis for CO2 prevention and control of coal spontaneous combustion.

Physical distancing and wearing a face mask are key interventions to prevent COVID-19. While this remains difficult to practice for millions of firefighters in fire engines responding to emergencies, the delayed forthcoming of evidence on the physical effectiveness of such safety interventions in this setting presents a major problem. In this field experimental study, we provided initial evidence to close this gap. We examined total aerosol burden in the cabin of a fire engine whilst manipulating crew size, natural ventilation, use of FFP2 respirators and use of SCBA full-face masks during 15-minute driving periods. At the same time, we controlled for crew activity and speaking, vehicle speed, cabin air temperature, pressure and humidity. Limiting the crew size, using FFP2 respirators and not donning SCBA full-face masks was associated with a reduction of the arithmetic mean of total aerosol burden of up to 49%. Natural ventilation as tested in this study was associated with both an increase and a decrease of total aerosol burden. This study provided initial evidence on the physical effectiveness of safety interventions in fire engines to reduce potential airborne transmission of SARS-CoV-2 through aerosols. More research about the physical and clinical effectiveness of such safety interventions is needed.

This paper proposes an Integrated Fire Management (IFM) framework that can be used to support communities and resource managers in finding effective and efficient approaches to prevent damaging fires, as well as maintain desirable fire regimes in Kenya. Designing and implementing an IFM approach in Kenya calls for a systematic understanding of the various uses of fire and the underlying perceptions and traditional ecological knowledge of the local people. The here proposed IFM framework allows an evaluation of the risks posed by fires, while balancing them with their beneficial ecological and economic effects, and thus developing effective fire management approaches. A case study of the proposed IFM framework was conducted in Gathiuru Forest that is part of the larger Mt. Kenya Forest Ecosystem. Focus group discussions were held with key resource persons, primary and secondary data on socio-economic activities were studied, fire and weather records were analyzed and the current fire management plans were consulted. Questionnaires were used to assess how the IFM is implemented in the Gathiuru Forest Station. The results show that the proposed IFM framework is scalable and can be applied in places with fire-dependent ecosystems as well as in places with fire-sensitive ecosystems in Kenya. The effectiveness is dependent on the active participation, formulation and implementation of the IFM activities by the main stakeholder groups (Kenya Forest Service (KFS), Kenya Wildlife Service (KWS), and the Community Forest Associations (CFA)). The proposed IFM framework helps in implementing cost-effective approaches to prevent damaging fires and maintain desirable fire regimes in Kenya.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Background: We studied Riveaux Road Fire, which was ignited by multiple lightning strikes in January 2019 and burnt more than 637.19 km² in southern Tasmania, Australia. Aims: We focused on fire weather, such as identification of dynamic wind and vegetation type, in a valley of the study area. Methods: We employed two methods: numerical weather model vertical sounding (NWMVS) and the use of a fire simulator, to quantify and examine the contribution of dynamic winds to fire behaviour. The NWMVSs allow rapid diagnosis of changes in wind, temperature, dew point temperature and cloud coverage. Prototype 2 is a fire simulator based on the specification of Australian Fire Danger Rating System (AFDRS). Key results: We found fires to be guided by terrain-forced channelling primarily and by downslope wind conditionally in the valleys. In addition, the fire intensity periodically changed with the magnitude of surface wind, in buttongrass moorland, in which the fire often smoulders, during the fire period according to the satellite image. Conclusions and Implications: Therefore, there should be caution for not only terrain and dynamic wind but also vegetation type during fire spread in rugged terrain.

Project managers should balance a variety of resource elements in building projects while taking into account many major concerns, including time, cost, quality, risk, and the environment. This study presents a framework for resource trade-offs in project scheduling based on the Building Information Modeling (BIM) methodology and metaheuristic algorithms. First, a new metaheuristic algorithm called Fire Hawk Optimizer (FHO) is used. Using project management software and the BIM process, a 3D model of the construction is created. In order to maximize quality while minimizing time, cost, risk, and CO2 in the project under consideration, an optimization problem is created, and the FHO's capability for solving it is assessed. A predefined stopping condition is taken into account while doing 30 independent optimization runs to obtain the statistical metrics, such as the mean, standard deviation, and the required number of objective function evaluations. The results show that the FHO algorithm is capable of producing competitive and exceptional outcomes when it comes to trade-off various resource options in projects.

For traffic management under sudden disaster in high-density areas, the first and foremost step is to prevent traffic congestion in the disaster-affected area by traffic flow control, as to provide enough and flexible traffic capacity for emergency evacuation and emergency rescue. Catastrophe border identification is the foundation and the key to traffic congestion prediction under sudden disaster. This paper uses a mathematical model to study the regional traffic flow in the high-density area under sudden fire disaster based on the Cusp Catastrophe Theory (CCT). The catastrophe border is identified by fitting the CCT-based regional traffic flow model to explore the stable traffic flow changing to the instable state, as to provide a theoretical basis for traffic flow manage and control in disaster-affected areas, and to prevent the traffic flow being caught into disorder and congestion. Based on VISSIM simulator data by building simulation scenarios with and without sudden fire disaster in a Sudoku traffic network, the catastrophe border is identified as 439pcu/lane/h, 529pcu/lane/h, 377pcu/lane/h at 5s, 10s, 15s data collection interval respectively. The corresponding relative precision, which compares to the method of Capacity Assessment Approach (CAA), is 89.1%, 92.7% and 76.5% respectively. It means that 10s data collection interval would be the suitable data collection interval in catastrophe border identification and regional traffic flow control in high-density area under sudden fire disaster.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Wildfires are important natural drivers of forest stands dynamics, strongly influencing on their natural regeneration and ecosystem services. This paper presents a comprehensive analysis of spatiotemporal burnt area (BA) patterns over the period 2000–2022 in the Middle Volga region of the Russian Federation on the base of remote sensing time series, considering the impact of cli-matic factors on forest fires. The temporal trends were assessed with the Mann-Kendall nonpara-metric statistical test and Theil-Sen’s slope estimator using the LandTrendr algorithm on the Google Earth Platform (GEE). The accuracy assessment indicated a high overall accuracy (> 84%) and F-score value (> 82%) for forest burnt area detection as evaluated against 581 test sites of ref-erence data. The results revealed that the fire occurrences in the region were mainly irregular with the highest frequency of 7.3 over a 22-year period. The total forest BA was about 280 thousand ha, which equals to 1.7% of the land surface area or 4.0% of the total forested area under study in the Middle Volga region. The coniferous forest stands are the most fire-prone ecosystems accounting for 59.0 % of the total BA; deciduous stands accounts for 25.1%; and insignificant fire occurrences were registered in young forests and shrub lands. On a seasonal scale, temperature generally has a greater impact on the BA than precipitation and wind speed.

In the present work we have studied the short-term edaphic recovery of a burned pine forest of Pinus pinaster Aiton in Cerro del Castillo (Sierra de Guadarrama, Central Spain) in which a hydrological-forestry restoration was being carried out after the fire occurred in July 2022. For this purpose, variations in physicochemical properties (conductivity, relative humidity, organic matter and pH) and collembolan communities were analyzed by comparing the soils of a natural pine forest and a burned pine forest during the 24 weeks after the fire in 3 different samplings. With the data obtained, a series of diversity indices were calculated and statistical analyses such as ANOVA, hierarchical classification and principal component analysis were developed, with the aim of understanding in greater depth the recovery of collembolan populations, the changes in these physicochemical variables and the relationships between both parameters. This study shows how the fire reduced the amount of organic matter and water, and increased soil pH and conductivity, affecting edaphic fauna populations. In the short term, there was an increase in relative humidity and a decrease in electrical conductivity. The edaphic fauna communities of the burned pine forest increased their diversity and equity without reaching the values of the natural pine forest. At the specific level, however, the springtail populations matched the richness and even reached a very slightly higher Shanon-Wiener diversity index than that the natural pine forest populations in just 24 weeks. Finally, it was observed that the samples from the burned pine forest with recovered collembolan populations had the closest physicochemical parameters to those of the natural pine forest.

When the formation flying consists of satellites that are independent from each other and forms a virtual synthetic aperture telescope that replaces a single large telescope with all of its optical elements it is required mutual coordination between the satellites with high accuracy in order to achieve good optical observations. In this paper we consider the problem of developing a control system for a tetrahedral satellite formation flying representing a synthetic aperture telescope in the geostationary orbit for high resolution monitoring of fire in the forest area in infrared spectrum. Synthesizing the image with good quality requires to keep the configuration of formation with µm-class accuracy. Study of dynamics of passive uncontrolled motion of formation flying showed a significant deviation of the configuration from the required shape with a high frequency due to the action of gravitational forces. To keep the configuration in the required form with µm accuracy the analysis of efficiency of various controllers was carried out in the process of numerical simulation. The simulation results made it possible to highlight the features of using various approaches to the development of control system for the satellite formation flying representing a synthetic aperture telescope.

This research examines the fire resistance of geopolymer composites (GCs), formulated using alka-li-activated metakaolin and aluminum powder. The production method involves spray-coating carbon steel plates with fresh GCs, followed by a 28-day curing period at room temperature. Sub-sequently, fire performance and aging tests are conducted to evaluate fire resistance. The study investigates GC properties, including apparent density, bending strength, compression strength, thermal conductivity, porosity, and production cost. Morphological changes before and after fire and aging tests are analyzed using scanning electron microscopy (SEM). Results demonstrate GC foams' outstanding thermal insulation, providing up to 75 minutes of fire resistance with a 6 mm coating, reducing temperatures by 300 °C compared to uncoated steel. GCs exhibit a density of 670 kg/m³, thermal conductivity of 0.166 W/m·K, 68% porosity, and cost efficiency at 250 dollars per cubic meter. This study underscores the potential of foamed geopolymer coatings for effective and economical surface protection.

Building fires are preventable incidents that have proven to be both deadly and costly. Addressing their root causes will lead to safer neighbourhoods for families and businesses to live and operate in. Multiple studies have established the effect of residents’ socioeconomic compositions on an area’s building fire rates; however, the existing model based on the classical stepwise regression procedure has several limitations. This paper aims to construct a more accurate predictive model of building fire rates based on a set of explanatory socioeconomic variables. In building the socioeconomic model, a backward elimination by Robust Final Predictor Error (RFPE) criterion is proposed to enhance the forecasting capability of the model. The proposed method has been implemented on the census data and the fire incident data of the South East Queensland region in Australia. A cross-validation was then conducted to assess the model’s accuracy. In addition, comparative analyses of other elimination criteria, such as p-value, adjusted R-squared, Akaike’s Information Criterion (AIC), Bayesian Information Criterion (BIC) and predicted residual error sum of squared (PRESS), were conducted. The cross-validation analyses demonstrate that the proposed criterion is a more accurate predictive model based on a couple of goodness-of-fit measures. All in all, the RFPE equation was found to be a suitable criterion for the backward elimination procedure in the socioeconomic modelling of building fires.

Climate and land-use changes have been contributing to increase the occurrence of extreme wild-fires, shifting fire regimes and driving desertification, particularly in Mediterranean-climate regions. However, few studies have researched the effects of land-use change on fire regimes and carbon storage at the broad national scale. To address this gap, we used spatially explicit data from annual burned areas in mainland Portugal to build a typology of fire regimes based on the accumulated burned area and its temporal concentration (Gini index) between 1984 and 2019, which was combined with 2018 carbon stock data (above- and below-ground), and a landscape typology re-sulting from cluster analysis over land-use composition, diversity and configuration, to explore relationships between landscape types and the two major ecosystem services at stake: wildfire reduction and carbon stock. Cross tabulations, logistic and linear regressions were performed on these data and results revealed a strong relationship between landscapes dominated by maritime pine and eucalypt forest plantations and high-hazardous fire regime but hold the highest carbon stock. Shrubland-mixed landscapes were associated with lower carbon stocks but less hazardous fire regimes. Specialized agricultural landscapes, as well as mixed native forests and mixed agro-forestry landscapes, were the least associated with wildfires. In the case of agricultural landscapes however, this good wildfire performance is achieved at the cost of the poorest carbon stock, de-noting land degradation, whereas native forests and agroforestry landscapes strike the best trade-off between carbon stock and fire regime. Our findings support how nature-based solutions promoting wildfire mitigation and carbon stock ecosystem services may prevent and revert land degradation harming Mediterranean regions.

Global warming is increasing the frequency and intensity of compound drought-heat events (CDHEs), potentially leading to larger and more extreme fire seasons in mesic forests. Wildfire activity in subtropical China, under the influence of monsoonal rainfall, was historically limited to dry winters and rare in rainy summers. Here we seek to test that this area is on the brink of a major change in its fire regime characterized by larger fire seasons, extending into the summer, leading to increases in burned area. We analyze fire activity in Chongqing Municipality (46,890 km2), an important area in subtropical China hosting the Three Gorges Reservoir Area. We observed significant increases in summer forest fires under anomalous dry-hot summer conditions, where total burned area was 3-6 higher than the historical annual mean (largely confined to the winter season). Vapor pressure deficit, an indicator of hot and dry conditions, was a strong predictor of fire activity, with major wildfires occurring on days where VPD was higher than 3.5kPa. Results indicate that major wildfire activity may occur in the area as a result of climate change, unless strong fire prevention policies are implemented.