: During the period of COVID-19, the Chinese government implemented a series of actions to prevent the spread of the virus. It is noticed that these preventive actions have generated positive effects on air pollution in Wuhan and Beijing. And, due to the differences in city functions, geographic locations, meteorological conditions, and preventive action details between the two cities, noticeable difference is observed on how they reduced air pollution. This unfortunate incident has become a social sample for studying the industrial and livelihood activities impact on air pollution, otherwise would be highly impossible. This paper starts from observing data from NASA's real-time fine particulate matter (PM2.5) and NO2, and comparing the air pollution in this special time domain with previous years. It is discovered that both PM2.5 and NO2 have been reduced in Wuhan, while only NO2 has significant reduction in Beijing, during the COVID-19 responses. This suggests that the human activity suppression by the COVID-19 control yields different effects on different pollutants and in different cities. Possible reasons for such effects are analysed by considering the public health control levels as well as the pollutant migration, industrial activities, and the weather conditions.

Novel SARS-CoV-2, a bat based virus originated in Wuhan, China that caused a global pandemic in December, 2019 belongs to the Betacorona virus family and contains single stranded genome of ~29Kbp. The host cell invasion of SARS-CoV-2 is facilitated by interaction of C-Terminal Domain (CTD) of Spike (S) protein of virus and host ACE2 receptor in the presence of TMPRSS seine protease secreted by the host cell. In this study the mutation hotspots of S-protein will be identified and the impact of such mutation in the binding affinity will be studied. Additionally, the lead molecule which can bind to the mutated protein also will be identified. Multiple sequence alignment of the spike protein sequence of SARS-CoV-2 shows the number of single amino acid mutation hotspots such as L5F, R214L, R408I, G476S, V483A, H519Q, A520S, T572I, D614G and H655Y. Among these mutations D614G has 57.5% occurrence and G476S, V483A has 7.5% occurrence. The mutated proteins were modelled based on wild type homolog and docked to ACE2 receptor. When the mutated S protein is docked, the ∆G (binding free energy) value is very minimal in mutated protein showed the stability of variants. By the drug repurposing method, 1000 FDA approved drugs were virtually screened for its binding to RBD of S1 domain. Among these drugs Digitoxin, Gliquidone and Zorubicin Hcl binds to spike proteins with higher docking score (lesser than -8.5 Kcal/mol) to both wild type and mutants.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

The risk of lung exposure to silica nanoparticles (SiNPs) and related lung inflammatory injury is increasing with the wide application of SiNPs in a variety of industries. A growing body of research has revealed that cyclooxygenase (COX)-2/ prostaglandin E2 (PGE2) up-regulated by SiNPs toxicity has a role during pulmonary inflammation. The detailed mechanisms underlying SiNPs-induced COX-2 expression and PGE2 synthesis remain unknown. The present study aims to dissect the molecular components involved in COX-2/PGE2 up-regulated by SiNPs in human pulmonary alveolar epithelial cells (HPAEpiCs) which are one of the major targets while SiNPs are inhaled. In the present study, we demonstrated that SiNPs induced COX-2 expression and PGE2 release, which were inhibited by pretreatment with a reactive oxygen species (ROS) scavenger (edaravone) or the inhibitors of proline-rich tyrosine kinase 2 (Pyk2, PF-431396), epidermal growth factor receptor (EGFR, AG1478), phosphatidylinositol 3‑kinase (PI3K, LY294002), protein kinase B (Akt, Akt inhibitor VIII), p38 mitogen-activated protein kinase (MAPK) (p38 MAPK inhibitor VIII), c-Jun N-terminal kinases (JNK)1/2 (SP600125), Forkhead Box O1 (FoxO1, AS1842856), and activator protein 1 (AP-1, Tanshinone IIA). In addition, we also found that SiNPs induced ROS-dependent Pyk2, EGFR, Akt, p38 MAPK, and JNK1/2 activation in these cells. These signaling pathways induced by SiNPs could further cause c-Jun and FoxO1 activation and translocation from the cytosol to the nucleus. AP-1 and FoxO1 activation could increase COX-2 and PGE2 levels induced by SiNPs. Finally, the COX-2/PGE2 axis might promote the inflammatory responses in HPAEpiCs. In conclusion, we suggested that SiNPs induced COX-2 expression accompanied by PGE2 synthesis mediated via ROS/Pyk2/EGFR/PI3K/Akt/p38 MAPK- and JNK1/2-dependent FoxO1 and AP-1 activation in HPAEpiCs.

Two conundrums have puzzled COVID-19 investigators: 1) morbidity and mortality is rare among Infants and young children and 2) rates of morbidity and mortality exhibit very large variances across nations, locals and even within cities. These differences correlate with rates of Haemophilus influenzae type B (Hib) and pneumococcal vaccination, which are almost universal among infants and vary widely by geography among adults and the elderly. The higher the rate of vaccination, the lower the COVID-19 morbidity and mortality. Vaccination rates with other vaccines, including BCG and poliovirus, do not correlate with COVID-19 risks. Notably, both Hib and pneumoccoci are common co-infections with influenza and coronaviruses and are associated with more severe disease and risk of death. Whether the vaccines simply protect against COVID-19 complications, directly protect against COVID-19 infection by inducing cross-reactive immunity, or are markers for some other types of protection such as availability of better healthcare, is not yet known. What is known is that improving coverage rates of Hib and pneumococcal vaccination has significantly lowered severe morbidity and mortality in influenza epidemics and might have similar efficacy for mitigating coronavirus outbreaks. If infants and children are valid indicators, the beneficial effects might be very significant. The possibility that anti-viral proteins in milk (e.g., lactoferrin) protect against COVID-19 is also explored.

β-cyclodextrin (CD) derivatives containing aromatic triazole ring were studied as potential carriers of drugs containing an anthraquinone moiety in the structure: anthraquinone-2-sulfonic acid (AQ2S), anthraquinone-2-carboxylic acid (AQ2CA) and a common anthracycline, daunorubicin (DNR). UV-Vis and voltammetry measurements were carried out to determine the solubilities and stability constants of the complexes formed and revealed the unique properties of the chosen CDs as effective pH dependent drug complexing agents. The stability constants of the drug complexes with the CDs containing triazole: βCDLip and βCDGAL were significantly larger than with the native βCD. The AQ2CA and AQ2S drugs are ill-soluble and their solubilities increased as the result of complex formation with βCDLip and βCDGAL ligands. AQ2CA, AQ2S were negatively charged at pH 7.4 and therefore they were less prone to form inclusion complex with the hydrophobic CD cavity than at pH 3 (characteristic of gastric juices) when they were protonated. βCDTriazole and βCDGAL ligands were found to form weaker inclusion complexes with the positively charged drug DNR at acidic pH (pH 5.5) than in the neutral medium (pH 7.4) when the drug dissociates to the neutral, uncharged form. This pH dependence is favorable for anti-tumor applications.

Exercise affects various organs. However, its effects on nutrient digestion and absorption in the intestinal tract are not well understood. A few studies have reported that exercise training in-creases the expression of carbohydrate digestion and absorption molecules. Exercise was also shown to increase the concentration of blood glucagon like peptide-2(GLP-2), which regulates carbohydrate digestion and absorption in small intestinal epithelium. Therefore, we investigated the effects of exercise on intestinal digestion and absorption molecules and the levels of GLP-2. 6-wk-old of male mice were divided into 2 groups; sedentary (SED) and low-intensity exercise (LEx). LEx mice were required to run on a treadmill (12.5 m/min, 60 min), whereas SED mice rested. All mice were euthanized 1 h after exercise or rest and plasma, jejunum, ileum, and colon were sampled. Samples were analyzed using EIA and immunoblotting. The levels of plasma GLP-2 and the expression of the GLP-2 receptor, sucrase-isomaltase (SI), and glucose transporter (GLUT2) in the jejunum were increased in LEx group. We showed that acute low-intensity exer-cise affects the intestinal carbohydrate digestion and absorption molecules via GLP-2. Our results suggest that exercise might provide new benefits to the small intestine for people with intestinal frailty.

The role of the Renin-Angiotensin-Aldosterone System (RAAS) in Corona Virus Disease 2019 (COVID-19) infection has become a controversial topic of discussion. RAAS inhibitors, such as Angiotensin Converting Enzyme (ACE) inhibitors and Angiotensin II receptor blockers (ARBs), which are used to treat cardiovascular diseases, have been implicated in potentially increasing cell surface levels of ACE2. ACE2 is the host receptor for COVID-19 that was discovered in Wuhan, China in December 2019. Since December, COVID-19 has transmitted rapidly across the world and has become a global pandemic. COVID-19 is similar to the Middle East respiratory syndrome coronavirus (MERS-CoV) with the first case reported in Saudi Arabia in September 2012. COVID-19, also known as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is also similar to SARS-CoV, which first infected humans in the Guangdong province of southern China in 2002, and caused an epidemic between November 2002 and July 2003. Both SARS-CoV and COVID-19 use ACE2 to enter host cells. ACE2 is primarily expressed in the mouth, lung, heart, esophagus, kidney, bladder, and intestines, and is a component of RAAS, which serves to maintain vascular tone and blood volume. Inhibition or activation of other components of RAAS has been shown to directly increase or decrease the expression and/or activity of ACE2. Furthermore, RAAS-targeting therapeutics, such as ACE inhibitors and ARBs, have also been shown to regulate the expression and/or activity of ACE2, albeit in animal models. Although these changes in ACE2 have been demonstrated only in animal models, there is no evidence that administration of RAAS-targeting therapeutics to humans for the treatment of hypertension, diabetes, and other cardiovascular diseases (e.g., myocardial infarction and heart failure) causes changes in ACE2 expression. Nor is there clinical evidence that RAAS-targeting therapeutics augment COVID-19 infection, morbidity, or mortality. However, clinical evidence does suggest that ACE2 expression may protect against respiratory distress caused by a variety of noxious agents. This review attempts to provide a balanced overview of the potential role of RAAS in regulating ACE2, and the role of ACE2 during COVID-19 infection. Evidence is provided to show that the expression of ACE2 may mediate both positive and negative outcomes, depending on the timing of ACE2 expression.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The devastating impact of the ongoing coronavirus disease 2019 (COVID-19) on public health, caused by the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has made fighting of the COVID-19 pandemic is a top priority in medical research and pharmaceutical development. Surveillance of SARS-CoV-2 mutations is essential for the comprehension of SARS-CoV-2 variant diversity and their impact on virulence and pathogenicity. The SARS-CoV-2 open reading frame 10 (ORF10) protein interacts with multiple human proteins CUL2, ELOB, ELOC, MAP7D1, PPT1, RBX1, THTPA, TIMM8B, and ZYG11B expressed in the lung tissues. Mutations and co-mutations in the emerging SARS-CoV-2 ORF10 variants are expected to impact the severity of the virus and its associated consequences. In this article, We highlight 128 single mutations and 35 co-mutations in the unique SARS-CoV-2 ORF10 variants in this article. The possible predicted effects of these mutations and co-mutations on the secondary structure of ORF10 variants and host protein interactomes are presented. The findings highlight the possible effects of mutations and co-mutations on the emerging 140 ORF10 unique variants from secondary structure and intrinsic protein disorder perspectives.

We introduce a magnetic bead-based sample preparation scheme for enabling a Raman spectroscopic differentiation of severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) positive and negative samples. The beads were functionalized with the angiotensin-converting enzyme 2 (ACE2) receptor protein, which is used as recognition element to selectively enrich SARS-CoV-2 on the surface of the magnetic beads. Subsequent Raman measurements directly enable discriminating SARS-CoV-2 positive and negative samples. The proposed approach is applicable for other virus species, too, when the specific recognition element is exchanged. Series of Raman spectra were measured on three types of samples, namely SARS-CoV-2, Influenza A H1N1 virus and a negative control. For each sample type, eight independent replicates were considered. All spectra are dominated by the magnetic bead substrate and no obvious differences between sample types are apparent. In order to address the subtle differences in the spectra, we calculated different correlation coefficients, namely the Pearson coefficient and the Normalized Cross Correlation coefficient. By comparing the correlation with the negative control differentiating between SARS-CoV-2 and Influenza A virus is possible. This study provides a first step towards the detection and potential classification of different viruses with the use of conventional Raman spectroscopy.

Background: COVID-19 made its debut as a pandemic in 2020; since then, more than 607 million cases and at least 6.5 million deaths have been reported worldwide. While the burden of disease has been described, the long-term effects or chronic sequelae are still being described. Objective: To describe the findings of a current systematic review of the long-term effects related to post-COVID-19 sequelae. Design: A systematic review was carried out in which cohort studies, case series, clinical case reports were included, and the PubMed, Scielo, SCOPUS and Web of Science databases were ex-tracted. Information published 2020 to June 1, 2022, was sought. Results: We reviewed 300 manuscripts during the first step of the literature review process. Then 260 abstracts were analyzed. In the end, we included 32 manuscripts: 9 for pulmonary, 6 for cardiac, 2 for renal, 9 for neurological and psychiatric, and 8 for cutaneous sequelae. Conclusion: Studies show that the most common sequelae are those linked to the lungs, followed by skin, cutaneous and psychiatric alterations. Women report a higher incidence of the sequelae, as well as those with comorbidities and severer COVID-19 history. The COVID-19 pandemic has not only caused death and disease since its apparition but has also sickened millions of people around the globe who potentially suffer from serious illnesses that will continue to add to the list of health problems and further burden healthcare systems around the world.

Over the course of the pandemic due to the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), multiple new clinical manifestations, as the consequence of the tropism of the virus, have been recognized. That includes now the neurological manifestations and conditions, such as headache, encephalitis, as well as olfactory and taste disorders. We present a series of ten cases of RT-PCR confirmed SARS-CoV-2 infected patients diagnosed with viral-associated olfactory and taste loss from four different countries.

An experiment was carried out at Nabogram Khamarbari, near the Manannogor, Sadar Upazila, Noakhali District, Noakhali-3814, Bangladesh during the period from 12th January 2018 to 17th April 2018, with two varieties of tomatillo (Physalis ixocarpa Brot.) SAU tomatillo-1 and SAU tomatillo-2. It was laid out in RCBD method having three replications and was conducted to observe the influence of staking and non-staking on tomatillo cultivation in coastal areas. For the study, growth indicating characters like no. of leaves plant^-1, size of leaf plant^-1, height of each plant, no. of branches plant^-1 and yield attributing parameters such as days to first flowering, days to 50% flowering, no. of fruits branch^-1, fruit weight and yield were obtained from the plants with the treatments of staking and non-staking. A wide variation was observed between two varieties of tomatillo with the effect of these treatments. According to the results highest no. of leaves branch^-1, maximum size of leaves branch^-1, tallest height of each plant, uppermost no. of branches plant^-1, highest no. of fruits branch^-1, maximum weight of each fruit and yield were obtained in the staking treatment over the non-staking treatment of SAU tomatillo-1 and in case of SAU tomatillo-2, with the same parameters the result indicated significantly upper in the staking treatment over non-staking treatment. Considering the two varieties of tomatillo, the outcome were significantly superior with staking treatment for the similar parameters. The findings of the experiment indicated that the best yield (21 tha¹) and highest financial benefit could be obtained by SAU tomatillo-1 and the best tomatillo production in saline soil of coastal areas is possible by cultivating SAU tomatillo-1.

Home Security Systems are very important features of modern residential and office setups. This system is used to keep home safe from harmful gases, fire and intruders. It must be affordable, reliable and effective. In this paper, a GSM based home security system has been designed and implemented. The system consists of a GSM Module, MQ-2 smoke detector, Ultrasonic sonar sensor, LM35 temperature sensor, Arduino Uno and relay module. The MQ-2 smoke detector is used to detect harmful gases i.e. LPG, CH4, CO, Alcohol, Smoke or Propane. Any of the harmful gases stated above is detected it will warn the owner by activating the buzzer and displaying a warning message on the LCD display. It will also send a SMS to the owner. Our system can also measure temperate and if the temperature is increased above a certain range it will compensate it by activating Air Conditioner through the relay module. The system will also send a SMS to the owner. It can also detect intruders using Ultrasonic sensor and warn us through buzzer, SMS and displaying message on the LCD. Our system is reliable as it has very fast response and cost effective and it has been developed using our own technologies.

Background: COVID-19 caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has become a recurrent endemic disease affecting the whole world. Since November 2021, Omicron and its subvariants are dominating. In order to prevent severe courses of disease, vaccines are needed to boost and maintain antibody levels capable of neutralizing Omicron. Recently we produced and characterized a SARS-CoV-2 vaccine based on a recombinant fusion protein consisting of hepatitis B virus (HBV)-derived PreS and two SARS-CoV-2 wild-type RBDs. Objectives: To develop a PreS-RBD vaccine which induces high levels of Omicron-specific neutralizing antibodies. Methods: We designed, produced, characterized and compared strain-specific (wild-type: W-PreS-W; Omicron: O-PreS-O), bivalent (mix of W-PreS-W and O-PreS-O) and chimeric (i.e., W-PreS-O) SARS-CoV-2 protein subunit vaccines. Immunogens were characterized in vitro by protein chemical methods, mass-spectrometry, circular dichroism in combination with thermal denaturation and immunological methods. In addition, BALB/c mice were immunized with aluminum hydroxide-adsorbed proteins and aluminum hydroxide alone (i.e., placebo) to study specific antibody and cytokine responses, safety and Omicron neutralization. Results: Defined and pure immunogens could be produced in large amounts as secreted and folded proteins in mammalian cells. Antibodies induced after vaccination with different doses of strain-specific, bivalent and chimeric PreS-RBD fusion proteins reacted with wild-type and Omicron RBD in a dose-dependent manner and resulted in a mixed Th1/Th2 immune response. Interestingly, RBD-specific IgG levels induced by the different vaccines were comparable but the W-PreS-O-induced virus neutralization titers against Omicron (median VNT50: 5000) were 7- and 2-fold higher than the W-PreS-W- and O-PreS-O-specific ones, respectively and 6-fold higher than those of the bivalent vaccine. Conclusion: Among the tested immunogens, the chimeric PreS-RBD subunit vaccine, W-PreS-O, induced the highest neutralizing antibody titers against Omicron. Thus, W-PreS-O seems to be a highly promising COVID-19 vaccine candidate for further preclinical and clinical evaluation.

Introduction: Type 2 Diabetes mellitus (T2DM) is a common disease burdened with significant morbidity and mortality. Despite the substantial number of new available drug treatments, adherence to therapy and adverse drug reactions (ADRs) are the major constrain in the management of this disease. We evaluated the use, the adherence and the dsaftey of antidiabetic drugs in patients with T2DM. Methods: we performed an observational, retrospective, multicenter study on medical records of outpatients referred to general practitioners. Drug adherence was measured in agreement to the European Society for Patient Adherence, Compliance and Persistence Medication Adherence Reporting Guideline. ADRs were evaluated using the Naranjo probability scale. Collected data were analyzed using the Statistical Package for the Social Sciences. Results: During the study we evaluated 12,170 medical records of 7 general practitioners. The most prescribed drug was metformin alone (28.4%) or with other oral antidiabetics (19.6%) and then insulin (n: 354; men 190, women 164). Enrolled patients were stratified as high (35%), medium (41%) and low (24%) adherence. Logistic regression showed an association between T2DM less than or equal to 5 years and low adherence (P = 0.023). During the study we recorded 26 ADRs that was correlated with sex (women) and insulin treatment. Conclusion: this real-life study shows that patients with T2DM have high adherence probably related dto a low number of ADRs

Abstract: Abnormal growth of oligodendrocyte precursor cells (OPCs) importantly contributes to the progression of glioblastoma tumors. Hence, molecules that block OPC growth may be of therapeutic importance in treating gliomas. 2-methoxyestradiol (2ME), an endogenous tubulin interacting metabolite of estradiol is effective against multiple proliferative disorders. Based on its anti-carcinogenic and anti-angiogenic actions it is undergoing phase II clinical trials. We hy-pothesize that 2ME may prevent glioma growth by targeting OPC growth. Here we tested this hypothesis by assessing the impact of 2ME on growth of OPC cell line “Oli-neu” and dissected the underlying mechanism(s). Treatment with 2ME inhibited OPC growth in a concentra-tion-dependent manner and accompanied with significant upregulation in expression of p21 and p27, negative cell cycle regulators. Moreover, treatment with 2ME altered OPC morphology from multi-arm processes to rounded cells. At concentrations of 1uM and greater 2ME induced apoptosis with increased expression of caspase 3, PARP and caspase-7 fragments, externalized phosphatidylserine staining / apopercentage and increased mitochondrial activity. Flow-cytometry and microscopic analysis demonstrated that 2ME triggers endoreduplication in a concentration-dependent fashion. Importantly, 2ME induced cyclin E, JNK1/2 and p53 expres-sion as well as OPC cell fusion, key mechanisms driving endoreduplication or whole-genome duplication. Importantly, inhibition of p53 with pfithrin-α rescued 2ME-induced endoreduplica-tion. The pro-apoptotic and endoreduplication actions of 2ME were accompanied with upregula-tion of survivin, cyclin A, Cyclin B, Cyclin D2, ppRB. Taken together our findings provide evi-dence that 2ME not only inhibits OPC growth and triggers apoptosis, but also activates OPCs in a survival - fight or flight mode leading to endoreduplication. This inherent survival character-istic of OPCs may, in part be responsible for drug resistance in gliomas as observed for many tubulin interacting drugs. Importantly, the fate of OPCs after 2ME treatment may depend on cell-cycle status of the individual cells. Combining tubulin-interfering molecules with drugs, such as pfithrin-α, that inhibit endoreduplication may help inhibit OPC/glioma growth and lim-it drug resistance.

G‐quadruplexes (G4) are structures formed at the ends of the telomere, these are rich in guanines and were stabilized by molecules that bind to specific sites. TMPyP4 and Thymoquinone (TQ) are small molecules that bind to the G4, they have drawn attention because of their role as telomerase inhibitors. The aim of this study was to evaluate the effects of telomerase inhibitors on cellular proliferation, senescence, and death. Two cell lines LC‐HK2 (NSCLC) and RPE‐1 were treated with TMPyP4 (5μM) and TQ (10μM). Both inhibitors were effective in decreasing telomerase activity. TMPyP4 increased the percentage of cells with membrane damage associated with cell death and decreased the frequency of cells in the S‐phase. TMPyP4 changed the cell adhesion ability and modified the pattern of focal adhesion. TQ acted in a dose‐dependent manner, increasing the frequency of senescent cells, and inducing cell cycle arrest in the G1. In conclusion, the effects of both drugs on LC-HK2 and RPE-1 cell lines were different although both are telomerase inhibitors, because TMPyP4 decreased proteins of cell adhesion and TQ induces a decrease in cell viability.

Abstract: DNA fragmentation factors 40 and 45 (DFF40 and DFF45) and B-cell lymphoma 2 (Bcl-2) expression were evaluated in the normal human endometrium and myometrium. DFF40, DFF45, and Bcl-2 expression was assessed via immunohistochemistry in the proliferative, secretory, and atrophic endometrium and myometrium collected postmenopausally and premenopausally during the proliferative and secretory phases of the menstrual cycle. The endometrium showed significantly higher DFF40 and DFF45 expression than that in the uterine myometrium; compared to the stroma, endometrial glands showed the highest expression in pre- and postmenopausal specimens. Glandular expression of DFF45 was dependent on the menstrual cycle, reaching its highest level in the secretory endometrium. The glandular expression of DFF40 and DFF45 was significantly lower in postmenopausal specimens than that in premenopausal tissue. No cycle-dependent changes were reported for stromal or myometrial DFF40 or DFF45 expression. Compared to the endometrial stroma and myometrium, Bcl-2 showed the highest expression in the glandular proliferative endometrium and the lowest expression in the stromal secretory endometrium and myometrium during the secretory phase of the cycle. DFF45 and Bcl-2 showed menstrual cycle-dependent expression, which was limited to the glandular layer of the endometrium.

Several methods can be used to evaluate antibody avidity, one of which is the modified ELISA, in which a chaotropic agent is added to disrupt the binding between the antigen and the antibody. Although the avidity index provides relevant information about the functionality of antibodies, it does not allow us to characterize which antigens the antibodies are strongly bound to. To this end, we adapted the Immunoblot and Dot-Blot techniques by adding potassium thiocyanate (KSCN) after incubating nitrocellulose membranes with serum from mice immunized with Neisseria meningitidis outer membrane vesicles (OMVs) or serum from mice immunized with recombinant receptor-binding domain (RBD) of SARS-CoV-2, with different adjuvants for each antigen. In terms of results, when standardizing the incubation time of sera with KSCN, we observed that 5 minutes was the ideal time for both assays, however, when using different dilutions of serum from mice immunized with RBD, there was an influence on the strength of antigen-antibody binding. For the N. meningitidis assay, the antibodies maintained high avidity for the antigens present in the OMVs, PorA, NadA, and Opa, especially in the presence of the aluminum hydroxide adjuvant. The research showed that standardizing the Immunoblot and Dot-Blot in the same assay optimizes time and resources, allowing qualitative analysis for two different antigens, and resulting in more robust information for immunization studies against these pathogens.

Exacerbated inflammatory responses are a hallmark of severe coronavirus disease 2019 (COVID-19). Zileuton (Zi) is a selective inhibitor of 5-lipoxygenase, an enzyme involved in the production of several inflammatory/pro-resolving lipid mediators. Herein, we investigated the effect of Zi treatment in a severe acute respiratory syndrome (SARS) model. Mouse hepatitis virus (MHV)3-infected mice treated with Zi significantly improved the clinical score, weight loss, cardiopulmonary function, and survival rates compared with infected untreated animals. The protection observed in Zi-treated mice was associated with a lower inflammatory score, reduced dendritic cell-producing tumor necrosis factor (TNF), and increased neutrophil-producing interleukin (IL)-10 in the lungs 3 days after infection (dpi). At 5 dpi, the lungs of treated mice showed an increase in Th2-, Treg CD4+-, and Treg CD8+-producing IL-10 and reduced Th1 infiltrating cells. Furthermore, similar results were found upon Zi treatment after SARS-CoV2 infection in transgenic mice expressing the human angiotensin I-converting enzyme 2 (ACE2) receptor driven by the cytokeratin-18 (K18) gene promoter (K18-hACE2), significantly improving the clinical score, weight loss, and lung inflammatory score compared with untreated animals. Our data suggest that Zi protects against developing severe lung disease during SARS induced by betacoronavirus without affecting the host’s capacity to deal with infection.

International law faces numerous challenges in the 21st century, ranging from the traditional issues of sovereignty to emerging threats like cyber warfare and climate change. This article explores the evolving landscape of international law, discussing both the challenges it faces and the prospects for its future. By examining the role of international organizations, the impact of technological advancements, and the growing influence of non-state actors, this article provides a comprehensive overview of the current state of international law and offers insights into how it can adapt to meet the demands of an increasingly interconnected world.

Introduction: This study aims to investigate the activity of the remdesivir-nirmatrelvir combination against Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) and to report a case of Coronavirus Disease 2019 (COVID-19) cured with this combination. Methods: A Vero E6 cell-based infection assay was used to investigate the in vitro activity of the remdesivir-nirmatrelvir combination. The SARS-CoV-2 strains tested were 20A.EU1, BA.1 and BA.5. After incubation, a viability assay was performed. The supernatants were collected and used for viral titration. The Highest Single Agent (HSA) reference model was calculated. An HSA score >10 is considered synergic. Results: Remdesivir and nirmatrelvir showed synergistic activity at 48 and 72 h with an HSA score of 52.8 and 28.6, respectively (p<0.0001). This data has been confirmed performing supernatant titration and against the omicron variants: the combination reduced the viral titer better than the more active compound alone. An immunocompromised patient with prolonged and critical COVID-19 was successfully treated with remdesivir, nirmatrelvir/ritonavir, tixagevimab/cilgavimab, and dexamethasone, with an excellent clinical-radiological response. However, she required further off-label prolonged therapy with nirmatrelvir/ritonavir up to the negativization. Conclusion: Remdesivir-nirmatrelvir combination has synergic activity in vitro. This combination may have a role in immunosuppressed patients with severe COVID-19 and prolonged viral shedding.

It is already well known that infants and children infected with COVID-19 develop mild to mod-erate forms of the disease, with fever and oropharyngeal congestion being the most common symptoms. Nevertheless, there are cases in which the patients accuse respiratory symptoms. These cases need lung evaluation, which can be done using lung ultrasound (LUS), because it is a non-irradiating and repeatable imaging technique. 19 children with COVID-19 pneumonia were eval-uated using LUS. The LUS score (LUSS) for each patient varied between 1 to 8 points from a max-imum of 36 points. The arithmetic mean was 4.47 ± 2.36 (S.D), while 95% CI for the Arithmetic mean was 3.33 to 5.61. The lung changes were correlated with their biomarkers, specifically in-flammatory markers. The correlation between LUSS and LDH, D-dimers and IL-6 was a strong positive one with r=0.66 (p=0.01, 95% CI 0.147 to 0.896) between the LUSS and LDH level at symptomatic infants and children (with cough present) and r=0.66 (p=0.01, 95% CI 0.140 to 0.895) between LUSS and D-dimers level at symptomatic infants and children (with cough pre-sent). The results suggest that LUS could be a good imaging technique that can be used both in ini-tial evaluation of children with respiratory diseases, and, also in their follow-up, correlated with symptoms and biomarkers.

SARS-CoV-2 Omicron variants contain many mutations in its spike receptor binding domain, the target of all authorized monoclonal antibodies (mAbs). Determining the extent to which Omicron variants reduced mAb susceptibility is critical to preventing and treating COVID-19. We systematically reviewed PubMed and three preprint servers, last updated February 22, 2022, of the in vitro activity of authorized mAbs against the Omicron variants. Thirty-three studies were eligible including 33 containing Omicron BA.1 susceptibility data and five that also contained Omicron BA.2 susceptibility data. The first two authorized mAb combinations, bamlanivimab/etesevimab and casirivimab/imdevimab, were inactive against the Omicron BA.1 and BA.2 variants. In 24 studies, sotrovimab (third authorized mAb) displayed a median 4.1-fold (IQR: 2.4-7.6) reduced activity against Omicron BA.1 and, in four studies, a median 26-fold (IQR:16-35) reduced activity against Omicron BA.2. In 18 studies, cilgavimab and tixagevimab independently displayed median reductions in activity of >300-fold against Omicron BA.1, while in ten studies, the cilgavimab/tixagevimab combination (fourth authorized mAb preparation) displayed a median 63-fold (IQR: 26-145) reduced activity against Omicron BA.1. In two studies, cilgavimab was approximately 100-fold more susceptible to BA.2 than to BA.1. In two studies, bebtelovimab, the most recently authorized mAb, was fully active against both the Omicron variants. Disparate results between assays were common as evidenced by a median 42-fold range (IQR: 25-625) in IC50 between assays for the eight authorized individual mAbs and three authorized mAb combinations. Highly disparate results between published assays indicates a need for improved mAb susceptibility test standardization or inter-assay calibration.

The urgent need for effective, safe and equitably accessible vaccines to tackle the ongoing spread of COVID-19 led researchers to generate vaccine candidates targeting varieties of immunogens of SARS-CoV-2. Because of its crucial role in mediating binding and entry to host cell and its proven safety profile, the subunit 1 (S1) of the spike protein represents an attractive immunogen for vaccine development. Here, we developed and assessed the immunogenicity of a DNA vaccine encoding the SARS-CoV-2 S1. Following in vitro confirmation and characterization, the humoral and cellular immune responses of our vaccine candidate (pVAX-S1) was evaluated in BALB/c mice using two different doses, 25 µg and 50 µg. Our data showed high levels of SARS-CoV-2 specific IgG and neutralizing antibodies in mice immunized with three doses of pVAX-S1. Analysis of the induced IgG subclasses showed a Th1-polarized immune response as demonstrated by the significant elevation of spike-specific IgG2a and IgG2b compared to IgG1. Furthermore, we found that immunization of mice with three doses of 50 µg of pVAX-S1 could elicit significant memory CD4+ and CD8+ T cell responses. Taken together, our data indicates that pVAX-S1 is immunogenic and safe in mice and is worthy of further preclinical and clinical evaluation.

There is a relatively high risk of virus transmission in dental procedures and oropharyngeal examinations. We investigated the effects of mouthwashes on covid-19 viral load reduction during dental practices and oro-pharyngeal assessments. We performed a systematic search in PubMed, EMBASE, Scopus, Web of Science, Cochrane library for relevant studies up to February 2021. Papers evaluating patients with covid-19 infection (patients) who rinse mouthwashes (intervention) compared to patients who don’t rinse them (comparison) for reducing covid-19 viral load or reducing cross-infection of covid-19 (outcome) in the randomized and non-randomized clinical trial and quasi-experimental studies (study) were included due to PICOS question. Three independent authors conducted literature screening and data extraction. We extracted the most relevant data and we evaluated the risk of bias from the included studies. Out of 344 potentially eligible articles, six studies were included in this systematic review. Regarding viral load and negative cycle threshold (ct) values, 1% PVP_I and Listerine mouthwash were effective. 0.12% CHX mouthwash was effective 0-2 hours post rinsing, but it was not effective after 2 hours. A mixture solution of 0.2% Chlorhexidine gluconate and 6% Hydrogen peroxide was effective on day 5 of intervention. Gargling 1% hydrogen peroxide, 0.075% Cetylpiridinum Chloride (CPC), 0.5%PVP-I and 0.2% CHX mouthwashes was not effective on SARS-COV-2. It cannot be guaranteed that rinsing a specific kind of mouthwash prevents cross-infection of covid-19; however, the viral load of SARS-COV-2 in saliva will be decreased after rinsing mouthwashes containing 1%PVP-I and Listerine.

Part of philosophy is to subject assertions to critical scrutiny, clarifying exactly what the assertion is saying, its implications, and thus its direct plausibility. The goal is to ensure clarity, logical consistency, and rational argumentation in order to arrive at reasoned conclusions. A common problem is that arguments have missing implied premises that, unless explicitly stated, are mistakenly assumed to be true. Here we subject conclusions made regarding the SARS-CoV-2 pandemic to critical scrutiny, revealing their implied premises so that these premises can be explicitly examined and refuted. Specifically, we refute the conclusions that “no one is protected until everyone is protected” and “population lockdowns are required to protect those at high risk of adverse outcomes.” In the end, we argue for the conclusion that “an Emergency Management principles based response to the pandemic, compared to population-wide lockdowns, offers a way to prevent more adverse outcomes from COVID-19, better prevent overwhelmed healthcare, and prevent most of the collateral damage to the wellbeing of the population that has resulted from the lockdowns.”

Based on comprehensible non-parametric methods, estimates of crucial parameters that characterise the COVID-19 pandemic with a focus on the German epidemic are presented. Where appropriate, the estimates for Germany are compared with the results for seven other countries (FR, IT, US, UK, ES, CH, BR) to get an idea of the breadth of applicability and a relational understanding. Thereby, only prevalence data of daily reported new counts of diagnosed cases and fatalities provided by the Johns Hopkins University are used. Drawing on uncertain a priori knowledge is avoided. Specifically, we present estimates resulting from delay-time correlations for the duration from diagnosis to death being 13 days for Germany and Switzerland. The delay-time correlation applied to time series from other countries exhibit less pronounced peaks suggesting high variabilities for the corresponding time-to-death durations. With respect to the German data, the two time series of new cases and fatalities exhibit a strong coherence within the frequency range of interest, which backs our findings. Furthermore, based on the knowledge of this time lag between diagnoses and deaths, properly delayed asymptotic as well as instantaneous fatality-case ratios are calculated having superiority compared to the commonly published case-fatality rate. The temporal median of the instantaneous fatality-case ratio with proper delay of 13-days between cases and deaths for Germany turns out to be 0.02. Time courses of asymptotic fatality-case ratios are presented for other countries which substantially differ during the first half of the pandemic, however, converge to a narrow range with standard deviation 0.57% and mean 2.4%. Additionally, the time courses of instantaneous fatality-case ratios with optimal delay for the 8 exemplarily chosen countries are calculated and compared by means of the temporal medians. Similarly to the asymptotic fatality-case ratios, the differences are much smaller than expected from mass media reports. The basic reproduction number, R₀, for Germany is estimated to be between 2.4 and 3.4. The uncertainty stems from uncertain knowledge of the generation time. A delay autocorrelation shows resonances at about 4 days and 7 days, where the latter resonance is at least partially attributable to the sampling process with weekly periodicity. The calculation of the basic reproduction number is based on an evaluation of cumulative numbers of cases yielding time-dependent doubling times as an intermediate step. This allows to infer to the reproduction number during the early phase of onset of the epidemic. In a second approach, the instantaneous reproduction number is derived from the incident (counts of new) cases and allows, in contrast to the first version, to infer to the temporal behaviour of the reproduction number during the later epidemic course. The time course of the reproduction number is compared to an alternative control measure given by the per capita growth, which largely confirms the conclusions drawn from the reproduction number. To conclude, by avoiding complicated parametric models we provide insights into basic features of the COVID-19 epidemic in an utmost transparent and comprehensible way. The perhaps most striking insight is that the fatality-case ratios do not differ between countries as much as previously suspected.

COVID-19 manifests regarding extreme acute respiratory conditions caused by a novel beta coronavirus (SARS-CoV-2) which is reported to be the seventh coronavirus to infect humans. Like other SARS-CoVs it has a large positive-stranded RNA genome. But specific furin site in the spike protein, mutation prone and phylogenetically mess Orf1ab separates SARS-CoV-2 from other RNA viruses. Since, the outbreak (February - March 2020) which originated in China, researchers, scientists, and medical professionals are inspecting all possible facts from every possible aspect including its replication, detection, and prevention strategies. This led to the prompt identification of its basic biology, genome characterization, structural based functional information of proteins, and strategies to prevent its spread. Due to the rapid mutation rate, the functional characterization of a few proteins is still lagging. This review summarizes the recent updates on the basic molecular biology of SARS-CoV-2 and prevention strategies undertaken worldwide to tackle COVID-19. This recent information can be implemented for the development and designing of therapeutics against SARS-CoV-2.

SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) is a novel virus of the family Coronaviridae. The virus causes the infectious disease COVID-19. The biology of coronaviruses has been studied for many years. However, bioinformatics tools designed explicitly for SARS-CoV-2 have only recently been developed as a rapid reaction to the need for fast detection, understanding, and treatment of COVID-19. To control the ongoing COVID-19 pandemic, it is of utmost importance to get insight into the evolution and pathogenesis of the virus. In this review, we cover bioinformatics workflows and tools for the routine detection of SARS-CoV-2 infection, the reliable analysis of sequencing data, the tracking of the COVID-19 pandemic and evaluation of containment measures, the study of coronavirus evolution, the discovery of potential drug targets and development of therapeutic strategies. For each tool, we briefly describe its use case and how it advances research specifically for SARS-CoV-2. All tools are freely available online, either through web applications or public code repositories.

COVID19 is a current pandemic disease due to the novel coronavirus SARS-CoV-2. The scientific community mounted a strong response by accelerating research and innovation, and rapidly setting the basis to the understanding of molecular determinants of the disease for the development of targeted therapeutic interventions. The replication of the viral genome within the infected cells is a key step of SARS-CoV2 life cycle. It is a complex process involving the action of several viral and host proteins in order to perform RNA polymerization, proofreading and final capping. This review provides an update of structural and functional data on key actors of the replicatory machinery of SARS-CoV-2, filling the gaps in the current availability of structural data using homology modelling. Moreover, learning from similar viruses, we collect literature data to reconstruct the pattern of interactions among protein actors of the SARS-CoV-2 RNA polymerase machinery. In this pattern, an important role is played by co-factors, like Nsp8 and Nsp10, not only as allosteric activators but also as molecular connectors holding the entire machinery together to enhance the efficiency of RNA replication.

After the increasing number of SARS-CoV-2 infections all over the world, researchers and clinicians are struggling to find a vaccine or innovative therapeutic strategies to treat this viral infection. The SARS-CoV infection that occurred in 2002, MERS and other more common infectious diseases such as HCV, led to the discovery of many RNA-based drugs. Among them, siRNAs and antisense LNAs have been demonstrated to have effective antiviral effects both in animal models and humans. Owing to the high genomic homology of SARS-CoV-2 and SARS-CoV (80-82%) the use of these molecules could be employed successfully also to target this emerging coronavirus. Trying to translate this approach to treat COVID-19, we analyzed the common structural features of viral 5’UTR regions that can be targeted by non-coding RNAs and we also identified miRNAs binding sites suitable for designing RNA-based drugs to be employed successfully against SARS-CoV-2.

The Corona Virus Disease 2019 (COVID-19) outbreak is becoming pandemic with the highest mortality in people with associated comorbidities. These RNA viruses containing four structural proteins usually use spike protein to enter the host cell. It has been demonstrated that Angiotensin Converting Enzyme 2 (ACE2) ,as a part of renin-angiotensin-aldosterone system (RAAS), acts as a host receptor for the virus which is the main target of therapeutic approaches. However, medications acting on RAAS can lead to serious complications especially in people with diabetes and hypertension. To avoid this, other potential treatment modalities should be used in COVID-19 patients with associated comorbidities.

Common genetic variants of the fat mass and obesity associated (FTO) gene are strongly associated with obesity and type 2 diabetes. FTO is ubiquitously expressed, but appears to have tissue-specific roles. Earlier studies have focused on the role of hypothlamic FTO in the regulation of metabolism. However, it appears that FTO plays a role in the regulation of metabolism in a tissue-specific manner. Recent studies suggest that expression of hepatic FTO is regulated by metabolic signals such as nutrients and hormones and altered FTO levels in liver affects glucose and lipid metabolism. This review outlines recent findings on hepatic FTO in the regulation of metabolism, with particular focus on hepatic glucose and lipid metabolism. It is proposed that abnormal activity of hepatic signaling pathways involving FTO links metabolic impairments such as obesity, type 2 diabetes and nonalcoholic fatty liver disease (NAFLD). Therefore, a better understanding of these pathways may lead to therapeutic approaches to treat these metabolic diseases by targeting hepatic FTO. The overall goal of this review is to place FTO within the context of hepatic regulation of metabolism.

Porcine parvovirus (PPV) 1 is a major causative pathogen of reproductive failure, and porcine circovirus (PCV) 2 is an etiological pathogen causing PCV-associated and PCV diseases worldwide. PPV2–6 and PCV3 were recently identified as newly emerging viruses with unknown pathogeneses. However, little is known of PPV1–6 and PCV3 effects or their co-infections with PCV2. In this study, we examined 926 samples (272 aborted pig fetuses and 654 pig lung tissues) from domestic pig farms for the presence of PPV1–6 or PCV3 and for PCV2 co-infection with these seven viruses. The prevalence of PPV and PCV was significantly greater in lung tissue samples than aborted pig fetus samples. PPV3–6 were detected for the first time in Korean domestic pigs. Co-infection rates with PCV2 and other viruses were significantly higher in abattoir samples than that in aborted pig fetus samples. Concurrent infections are more common than single infection in pig population and nu-merous infectious pathogens such as PPV and PCV2 can impact the respiratory diseases. Fur-thermore, Korean PPV1 strain (PPV1-82) was identical to the virulent PPV-27a strain in this respect. Our results describe, for the first time the prevalence of PPV1–6 and PCV3 infections and their co-infection rates with PCV2 in Korean domestic pigs.

Abstract: Commercialization of extra virgin olive oil (EVOO) requires a best before date recom-mended at up to 24 months after bottling, stored under specific conditions. Thus, it is expected that the product retains its chemical properties and preserves its ‘extra virgin’ category. However, in-adequate storage conditions could alter the properties of EVOO. In this study, Arbequina EVOO was exposed to five storage conditions for up to one year to study the effects on the quality of the oil and the compounds responsible for flavor. Every 15 or 30 days, samples from each storage condition were analyzed determining physicochemical parameters, the profiles of phenols, volatile compounds, α-tocopherol and antioxidant capacity. Principal component analysis was utilized to better elucidate the relationships between composition of EVOOs and the storage conditions. EVOOs stored at -23 and 23 °C in darkness and 23 °C with light, differed from the oils stored at 30 and 40 °C in darkness. The former were associated with higher quantity of non-oxidized phenolic compounds and the latter with higher elenolic acid, oxidized oleuropein and ligstroside derivatives, which also increased with storage time. E-2-Nonenal (detected at trace levels in fresh oil) was selected as a marker of the degradation of Arbequina EVOO quality over time, with significant linear regressions identified for the storage conditions at 30 and 40 °C. Therefore, early oxidation in EVOO could be monitored by measuring E2-Nonenal levels.

Wetlands benefits can be summarized but are not limited to their ability to store floodwaters and improve water quality, providing habitats for wildlife and supporting biodiversity, as well as aesthetic values. Over the past few decades, remote sensing and geographical information technologies has proven to be a useful and frequent applications in monitoring and mapping wetlands. Combining both optical and microwave satellite data can give significant information about the biophysical characteristics of wetlands and wetlands` vegetation. Also, fusing data from different sensors, such as radar and optical remote sensing data, can increase the wetland classification accuracy. In this paper we investigate the ability of fusion two fine spatial resolution satellite data, Sentinel-2 and the Synthetic Aperture Radar Satellite, Sentinel-1, for mapping wetlands. As a study area in this paper, Balikdami wetland located in the Anatolian part of Turkey has been selected. Both Sentinel-1 and Sentinel-2 images require pre-processing before their use. After the pre-processing, several vegetation indices calculated from the Sentinel-2 bands were included in the data set. Furthermore, an object-based classification was performed. For the accuracy assessment of the obtained results, number of random points were added over the study area. In addition, the results were compared with data from Unmanned Aerial Vehicle collected on the same data of the overpass of the Sentinel-2, and three days before the overpass of Sentinel-1 satellite. The accuracy assessment showed that the results significant and satisfying in the wetland classification using both multispectral and microwave data. The statistical results of the fusion of the optical and radar data showed high wetland mapping accuracy, with an overall classification accuracy of approximately 90% in the object-based classification. Compared with the high resolution UAV data, the classification results give promising results for mapping and monitoring not just wetlands, but also the sub-classes of the study area. For future research, multi-temporal image use and terrain data collection are recommended.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

Since severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was first reported in Wuhan, China in December 2019, it has spread rapidly, and many coronavirus disease (COVID-19) cases have occurred in Gwangju, South Korea. Viral mutations following the COVID-19 epidemic have increased interest in the characteristics of epidemics in this region, and pathogen genetic analysis is required for infection control and prevention. In this study, SARS-CoV-2 whole-genome analysis was performed on samples from patients with COVID-19 in Gwangju from 2020 to 2022 to identify the trends in COVID-19 prevalence and to analyze the phylogenetic tree of dominant variants. B.41 and B.1.497 prevailed in 2020, the early stage of the COVID-19 outbreak; then, B.1.619.1 mainly occurred until June 2021. B.1.617.2, classified as sublineage AY.69 and AY.122, occurred continuously from July to December 2021. Since strict measures to strengthen national quarantine management had been implemented in South Korea until this time, mutations phylogenetic analysis was also able to infer the epidemiological relationship between infection transmission routes. Since the first identification of the Omicron variant in late December 2021, the spread of infection has been very rapid, and weekly whole-genome analysis of specimens has enabled us to monitor new Omicron sublineage occurring in Gwangju. Our study suggests that conducting reginal surveillance in addition to nation-level genomic surveillance will enable more rapid and detailed variant surveillance, which will be helpful in the overall prevention and management of infectious diseases.

(1) Background: The prevalence of SARS-CoV-2 infection among healthcare workers (HCWs) in Poland is not exactly known. This study aims to present secondary epidemiological data identifying the scale of the spread of novel coronavirus infection in selected professional groups of HCWs in Poland. (2) Methods: The secondary epidemiological data included both the number of infections and the number and percentages of deaths in individual occupational groups, which occurred throughout the observation period, both in the country and in individual voivodeships. (3) Results: The prevalence of SARS-CoV-2 infections among HCWs was 16.48%. The highest percentage of infected concerned laboratory scientists (21.62%) and paramedics (18%). The highest frequency of infections among HCWs occurred in the province of Zachodnio-Pomorskie (18.9%). Due to COVID-19, 558 healthcare workers died during the analysed period, mostly nurses (n=236) and doctors (n=200). The results regarding the vaccination coverage of HCWs against COVID-19 indicate the highest percentage of vaccinated were among doctors (83.63%) and the smallest among physiotherapists (38.2%). (4) Conclusions: In general, the percentage of infections was high in Poland during the pandemic (16.48%). Significant territorial differences were observed in the frequency of infections, deaths, and percentage of vaccinated workers in individual voivodeships.

Genomic surveillance represents an important strategy for understanding evolutionary mechanisms, transmission profile, and infectivity of different SARS-CoV-2 variants. We assessed the epidemiological profile of 366 individuals who tested positive for SARS-CoV-2 from 29 municipalities in Rondônia between December 2021 to March 2022. Samples were collected, RNA was ex-tracted and screened using RT-qPCR for Alpha, Beta, Gamma, Delta and Omicron VOCs and viral quantification was performed. Sequences were analyzed for phylogeny, mutations and lineages. Of the samples analyzed, 93.71% were positive for the Omicron variant and 6.28% were positive for the Delta variant. The symptoms observed were cough, sore throat, and fever, with a mean duration of 5 days; no hospitalizations or deaths were reported. We noted that among the positive individuals, 51% had been immunized with two doses, 22% received three doses, 13% received one dose, and 13% were not immunized. Just 242 samples were amenable to analysis for alignment and phylogenetic characterization; corresponding to variants BA.1 and BA.1.1; a total of 120 mutations were identified, 36% of which were found in the S gene. In conclusion, there was a high frequency of mutations in the SARS-CoV-2 genome, but no record of clinical severity, demonstrating the positive effect of vaccination.

The outbreak of recently identified 2019 novel coronavirus (2019-nCOV) infection has become a world-wide health threat. Currently, more information is needed for further understanding the transmission, clinical characteristics, and infection control procedures of 2019-nCOV. Recently, the role of the eye in transmitting 2019-nCOV has been intensively discussed. Previous investigations about other high infectious human COVs, that is, severe acute respiratory syndrome coronavirus (SARS-CoV) and the Middle East respiratory syndrome coronavirus (MERS-CoV), may provide helpful information. In this review, we describe the genomics and morphology of human CoVs, the epidemiology, systemic and ophthalmic manifestations, mechanisms of human CoVs infection, and infection control procedures. The role of the eye in the transmission of SARS-CoV and 2019-nCOV is discussed. Although the conjunctiva is directly exposed to extraocular pathogens, and the mucosa of ocular surface and upper respiratory tract is connected by nasolacrimal duct and share same entry receptors for some respiratory viruses. The eye is rarely involved in human CoVs infection, conjunctivitis is quite rare in patients with SARS-CoV and 2019-nCoV infection, and COV RNA positive rate by RT-PCR test in tears and conjunctival secretions from patients with SARS-CoV and 2019-nCoV infection is also very low, which imply that the eye is neither a preferred organ of human COVs infection, nor is a preferred gateway of entry for human COVs to infect respiratory tract. However, pathogens exposed to the ocular surface might be transported to nasal and nasopharyngeal mucosa by constant tear rinsing through lacrimal duct, and then cause respiratory tract infection. Considering close doctor-patient contact is quite common in ophthalmic practice which are apt to transmit human COVs by droplets and fomites, hand hygiene and personal protection are still highly recommended for health care workers to avoid hospital-related viral transmission during ophthalmic practice.

Digital Elevation Models (DEMs) are essential in watershed delineation, but the sensitivity of simulated runoff to DEM resolution is poorly understood. This study investigates the impact of DEM resolution on topological attributes and simulated runoff in the Mahabad Dam watershed, Iran. To delineate the watershed, DEMs with 12.5 m, 30 m, and 90 m resolutions were acquired from the ALOS PALSAR, Space Shuttle Radar Topography Mission (SRTM), and ASTER global DEM data source, respectively. Watershed and streamlines were delineated in ArcGIS, with hydrologic analyses performed using the Soil and Water Assessment Tool (SWAT). Sensitivity analysis on parameters contributing to runoff was done using Sequential Uncertainties Fitting Ver-2 (SUFI-2) Algorithm, in SWAT Calibration and Uncertainty Procedures (SWAT-CUP) software. Results showed the watershed area, reach lengths, and elevations in the watershed varied due to DEM resolutions. Higher amounts of runoff were generated when DEMs with finer resolutions were implemented. The 12.5 m DEM generated 3.48% and 0.42% more runoff compared with 90 m and 30 m DEMs, respectively. SWAT-CUP results showed the sensitivity of parameters contributing to runoff changes under different DEM resolutions. Regardless of DEM resolution, surface properties, available water capacity, and moisture levels in the soil are the most sensitive parameters. As the distribution of slope changes in different DEM resolutions, surface parameters are most affected. The findings indicate to reduce computation time and speed up computation procedures, researchers may use DEMs with coarser resolutions at the expense of minor decreases in accuracy.

Coronavirus Disease 2019 (COVID-19), caused by SARS-CoV-2 (Severe Acute Respiratory Syndrome - Coronavirus-2) of the family Coronaviridae, appeared in Wuhan, Hubei province, China being its epicenter in December 2019. This disease was declared as posing Public Health International Emergency by World Health Organization on January 30, 2020, attained the status of a very high-risk category on February 29, and now having a pandemic status (March 11, 2020). COVID-19 has presently spread to more than 195 countries/territories while killing nearly 19,600 humans out of cumulative confirmed cases accounting to more than 430,000 within a short period of just a few weeks. The majority of deaths have been reported in Italy and China. Researchers worldwide are pacing with high efforts to counter the spread of this virus and to design effective vaccines and therapeutics/drugs. Few of the studies have shown the potential of animal-human interface and zoonotic links in the origin of SARS-CoV-2. Exploring the possible zoonosis and revealing the factors responsible for its initial transmission from animals to humans will pave ways to design and implement effective preventive and control strategies to counter COVID-19. The present review presents an overview of COVID-19 and the causative virus SARS-CoV-2, with particular emphasis on the role of animals and their jumping the cross-species barriers, experiences learned from SARS- and MERS-CoVs, zoonotic links, and spillover events, transmission to humans and rapid spread., highlighting in very brief the preventive and control measures along with a few of the recent research developments to counter this pandemic virus/disease.

Currently SARS-CoV-2 is spreading around the world as an Omicron strain. Recently, the Omicron variants (BQ.1 and BQ.1.1) were identified as novel Variants of Concern. UpToDate, there is little information about the Omicron Variants BQ.1 and BQ.1.1. The widely altered Omicron variants are spread globally, providing a high risk of infection surges with devastating consequences in some areas. The Omicron type of SARS-CoV-2 has a harm risk of reinfection, according to early reported findings. COVID-19 Variants particularly, BQ.1 and BQ.1.1 have gained global attention and caused a worldwide sensation since their discovery. Therefore, this communication discusses the present status of COVID-19 Variants BQ.1 and BQ.1.1, and their consequences.

Although RNA modifications were discovered decades ago, the identification of enzymes that write, read, and erase RNA modifications enabled their functional study and spawned the field of epitranscriptomics. Coupling that knowledge to new methods has enabled the precise pinpointing of epitranscriptomic modifications across the transcriptome plus the elucidation of their functional consequences. PCIF1 (Phosphorylated CTD Interacting Factor 1) was shown to add N6, 2’-O-dimethyladenosine (m⁶Am) marks at the first nucleotide after the 5’ N7-methylguanosine (m⁷G) cap. In this review, we discuss the epitranscriptomic regulation of mRNA in general, and focus on m⁷G cap-adjacent m⁶Am in particular. m⁶Am positions can now be distinguished from N6-methyladenosine (m⁶A) using new techniques leveraging PCIF1-knockout cells. Although m⁶Am modification sites can be detected precisely, conflicting data have been published regarding how cap-adjacent m⁶Am marks affect their host mRNA. Discrepancies in the data mean that the effects of cap-adjacent m⁶Am on mRNA stability, decapping, and translation continue to be debated. Finally, while PCIF1 is predominantly nuclear, a subset of results suggest a possible cytoplasmic role as well. Taken together, these contradictory results which employed different methodologies and cell lines means that further experiments are required to determine the ultimate biological function(s) of m⁷G cap-adjacent m⁶Am.

It is common knowledge that increasing CO₂ concentration plays a major role in enhancement of the greenhouse effect and contributes to global warming. The purpose of this study is to complement the conventional and established theory that increased CO₂ concentration due to human emissions causes an increase of temperature, by considering the reverse causality. Since increased temperature causes an increase in CO₂ concentration, the relationship of atmospheric CO₂ and temperature may qualify as belonging to the category of “hen-or-egg” problems, where it is not always clear which of two interrelated events is the cause and which the effect. We examine the relationship of global temperature and atmospheric carbon dioxide concentration at the monthly time step, covering the time interval 1980–2019, in which reliable instrumental measurements are available. While both causality directions exist, the results of our study support the hypothesis that the dominant direction is T → CO₂. Changes in CO₂ follow changes in T by about six months on a monthly scale, or about one year on an annual scale. We attempt to interpret this mechanism by involving biochemical reactions, as at higher temperatures soil respiration, and hence CO₂ emission, are increasing.

Objective: On March 11, 2020 the WHO declared that COVID-19 is pandemic. Among the risk factors for many infectious diseases, a role of the ABO blood group system is reported in the literature. We argue whether it is necessary to investigate the relationship between ABO blood groups and susceptibility to SARS-CoV-2 infection and if we should consider some blood groups as potential risk factors for COVID-19. Results: Based on the scientific evidence reported in this letter, we believe that further studies are needed to investigate how the ABO polymorphism influences the host susceptibility, individual response and clinical risk for SARS-CoV-2 infection.

In this paper we first provide a primer on SARS-CoV-2 and Covid-19 delineating the etiopathogenesis, epidemiology, clinical manifestations and the natural history of the disease. We then trace the evolution of the Covid-19 pandemic highlighting the characteristics of the epidemic in China where the pandemic originated, select countries of Europe which peaked during April, and Brazil, US and India where the pandemic has taken serious turns recently. We also project some possible trajectories for the mega cities of India based on the demographic characteristics of these cities in comparison to New York city. This is an updated version of the article from mid-April published online.

COVID-19 disease outbreak was started in the December, 2019 in the Wuhan city of China which is also known as the largest transportation hub of China. During the spring festival of China the situation become epidemic. Soon, the virus is imported to many regions including the low income countries. Till now, 234073 infected reported cases of the COVID-19 in the world with the total of 9840 deaths (March 20, 2020). The common symptoms of the COVID-19 are the cough, high fever, sore throat, fatigue and breathlessness. The disease is found to be mild in most of the people, some of cases reported to the pneumonia also with multi organ dysfunction and acute ARDS (acute respiratory distress syndrome). It is found that the incubation period for the infection is 2-14 days which is usually 4 days in maximum of cases. India has reported 283 cases of COVID-19 infections till now with 4 deaths. India is still at stage 2 on local transmission as per WHO report 60. WHO reported 60 clearly stated that there is no community transmission occurred in India yet which can be prevented by the avoiding mass gathering and proper screening of the people. Govt. of India has taken many initiatives to minimize the spread of COVID-19 infection in the country. The infection rate of the COVID-19 in India remains low related to population size of the country. It is because of fast government action to quarantine the suspected people and shut down all its borders. There is a great slowdown in the global economy due to COVID-19 attack which is likely to costs around $1 trillion. The spread of COVID-19 infection can be reduced by minimizing the H-H transmissions. Still there is need of Anti-n-CoV drug development which can replace the supporting therapies for the treatment of infection.

Distribution systems can form islands when faults occur. Each island represents a subsection with variable boundaries subject to the location of a fault(s) in the system. A subsection with variable boundaries is referred to as island in this paper. For operation in autonomous mode, it is imperative to detect the island configurations and stabilize these subsections. This paper presents a novel scheme for the detection of islanding boundaries and stabilizing the system during autonomous operation. In the first stage, a boundary detection method is proposed to detect the configuration of the island. In the second stage a dynamic voltage sensitivity factor (DVSF) is proposed to assess the dynamic performance of the system. In the third stage, a wide area load shedding program is adopted based on DVSF to shed the load in weak busbars and stabilize the system. The proposed scheme is validated and tested on a generic 18-bus system using a combination of EMTDC/PSCAD and MATLAB softwares.

The combination of freeze-dried aronia, red ginseng, ultraviolet-irradiated shiitake mushroom and natokinase (AGM; 3.4: 4.1: 2.4: 0.1) was examined to evaluate its effects on insulin resistance, insulin secretion and gut microbiome in a non-obese type 2 diabetic animal model. Pancreatectomized (Px) rats were provided high fat diets supplemented with either of 1) 0.5 g AGM (AGM-L), 2) 1 g AGM (AGM-H), 3) 1 g dextrin (control), or 4) 1g dextrin with 120 mg metformin (positive-control) per kg body weight for 12 weeks. AGM (1 g) contained 6.22 mg cyanidin-3-galactose, 2.5 mg ginsenoside Rg3 and 0.6 mg β-glucan. Px rats had decreased bone mineral density in the lumbar spine and femur and lean body mass in the hip and leg compared to the normal-control and AGM-L and AGM-H prevented the decrease. Visceral fat mass was lower in the control group than the normal-control group and its decrease was smaller by AGM-L and AGM-H. HOMA-IR was lower in descending order of the control, positive-control, AGM-L, AGM-H and normal-control groups. Glucose tolerance was deteriorated in the control group and it was improved by AGM-L and AGM-H more than in the positive-control group. Glucose tolerance is associated with insulin resistance and insulin secretion. Insulin tolerance indicated insulin resistance was highly impaired in diabetic rats, but it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Insulin secretion capacity, measured by hyperglycemic clamp, was much lower in the control group than the normal-control group and it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Diabetes modulated the composition of gut microbiome and AMG prevented the modulation of gut microbiome. In conclusion, AGM improved glucose metabolism by potentiating insulin secretion and reducing insulin resistance in insulin deficient type 2 diabetic rats. The improvement of diabetic status alleviated body composition changes and prevented changes of gut microbiome composition.

Manzamines are complex polycyclic marine-derived β-carboline alkaloids with reported anticancer, immunostimulatory, anti-inflammatory, antibacterial, antiviral, antimalarial, neuritogenic, hyperlipidemia and atherosclerosis suppression bioactivities, putatively associated with inhibition of glycogen synthase kinase-3, cyclin-dependent kinase 5, and vacuolar ATPases. We hypothesized that additional and yet undiscovered molecular targets might be associated with Manzamine A (MZA) reported pharmacological properties. We report herein for the first time to our knowledge that MZA inhibited a 90kDa ribosomal protein kinase S6 (RSK1) when screened against a panel of 30 protein kinases. Furthermore in vitro RSK kinase assays demonstrated a 10-fold selectivity in potency of MZA against RSK1 versus RSK2. MZA’s differential binding and selectivity toward the two isoforms is also supported by computational docking experiments. Specifically, the RSK1-MZA (N- and C-termini) complexes appear to have stronger interactions and preferable energetics contrary to the RSK2-MZA ones. In addition, our computational strategy suggests that MZA binds to the N-terminal kinase domain of RSK1 rather than the C-terminal domain. RSK is a vertebrate family of cytosolic serine-threonine kinases that act downstream of the ras-ERK1/2 (extracellular-signal-regulated kinase 1/2) pathway, which phosphorylates substrates shown to regulate several cellular processes including growth, survival and proliferation. Consequently, our findings have lead us to hypothesize that MZA and the 80 currently known manzamine-type alkaloids isolated from several sponge genera, may have novel pharmacological properties.

The coronavirus disease 2019 (COVID-19) is now a global pandemic caused by the new severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Unlike other known coronaviruses, such as the Middle East respiratory syndrome coronavirus (MERS-CoV), SARS-CoV-2 reveals new clinical, immunological, and pathologic features. The lymphocyte depletion, macrophage and neutrophil hyperactivation, cytokine dysregulation, thrombophilia, delayed antiviral response, and immune exhaustion are key immunological findings linked to the clinical progression of this disease. Understanding and identifying the underlying immunological basis of COVID-19 is crucial to designing effective therapies. Here, we provide an overview of immunopathogenesis driven by SARS-CoV-2 after its interactions with the immune system.

Less aligned emphasis has been given to naming the 2019 novel coronavirus and pandemic disease. Global profusion of squab names has found their ways in daily communication, and our survey promises to articulate that many of them may have contributed to backlash against Chinese people. Here, based on brief critical reviews on the naming of coronavirus and human coronaviruses, we scrutinize a clear sense of pros and cons of previous multifarious names and punctuate heuristic introspection of naming practices. Our findings suggest that full-fledged official names are duly contribute to the resilience of healthy collective usages in current infodemic scenario.

The anti-inflammatory effect of ginsenoside Rh2 (GRh2) is one of the most important ginsenosides. The purpose of this study is to identify the anti-inflammatory and antioxidant effects of GRh2 after LPS challenge lung injury animal model. GRh2 reduced LPS-induced NO, TNF-α, IL-1, IL-4, IL-6 and IL-10 productions in lung tissues. GRh2 treatment decreased the histological alterations in the lung tissues and BALF protein content and total cells number also diminished in LPS-induced lung injury mice. Moreover, GRh2 blocked iNOS, COX-2, the phosphorylation of IκB-α, ERK, JNK, p38, Raf-1 and MEK protein expression which is corresponded to the growth of HO-1, Nrf-2, catalase, SOD and GPx expressions in LPS-induce lung injury. An experimental study has suggested that GRh2 has provided with anti-inflammatory effects in vivo, and its potential therapeutic efficacy in major anterior segment lung diseases.

: Intermittent fasting has drawn significant interest in the clinical research community due to its potential to address metabolic complications such as obesity and type 2 diabetes mellitus. Various intermittent fasting regimens include alternate-day fasting (24 hours of fasting followed by 24 hours of eating), time-restricted fasting (fasting for 14 hours and eating within a 10-hour window), and the 5:2 diet (fasting for two days and eating normally for the other five days). Intermittent fasting is associated with a reduced risk of type 2 diabetes mellitus-related complications and can slow their progression. The increasing global prevalence of type 2 diabetes mellitus highlights the importance of early management. Since prediabetes is a precursor to type 2 diabetes mellitus, understanding its progression is essential. However, the long-term effects of intermittent fasting on prediabetes are not yet well understood. Therefore, this review aims to comprehensively compile existing knowledge on the therapeutic effects of intermittent fasting in managing type 2 diabetes mellitus and prediabetes.

Vaccination has proven highly effective against severe acute res-piratory syndrome coronavirus 2 (SARS-CoV-2), but the long-term immunogenicity and the functional preserved im-mune responses of vaccines are needed to inform evolving evi-dence-based guidelines for boosting schedules. We enrolled 205 healthcare workers into a cohort study; all had received three doses of BBIBP-CorV (China Sinopharm Bio-Beijing Company) inactivated vaccine. We assessed SARS-CoV-2 specific binding antibodies, neutralizing antibody, and peripheral T and B cell responses. We demonstrated that more robust antibody re-sponses to SARS-CoV-2 were elicited by booster immunization compared to primary vaccination. Neutralizing antibody titers to SARS-CoV-2 Omicron variant were also efficiently elevated post homologous vaccine booster despite in a lower titer compared to the prototype stain. In addition to S specific humoral and cellular immunity, BBIBP-CorV also induced N-specific antibody and ef-fector T cell responses. The third-dose vaccination led to further expansion of critical polyfunctional T cell responses, likely an essential element for vaccine protection. In particular, a func-tional role for Tfh cell subsets in immunity was suggested by the correlation between both CD4+Tfh and CD8+Tfh with total anti-body, IgG, B cell responses and neutralizing antibodies. Our study details the humoral and cellular responses generated by the BBIBP-CorV booster vaccination in a seven-month follow up study. There is a clear immunologic boosting value of homolo-gous inactivated SARS-CoV-2 vaccine boosters, a consideration for future vaccine strategies.

Robot Operating System 2 (ROS 2) is a robotic software that uses a set of Quality of Service (QoS) policies to manage the quality of robot data transmissions in a network, such as the RELIABLE and KEEP_LAST options. In ROS 2 node communication, the RELIABLE connection guarantees that all message data can be properly sent from the publisher to the subscriber. However, strict reliability is not guaranteed if the RELIABLE connection uses the KEEP_LAST option to transmit the robot data in the publish-subscribe communication. This study aims to analyze the efficiency of local cache, cache control, and QoS balancing optimization to improve ROS 2 node communication when using the RELIABLE and KEEP_LAST options to transmit multi-robot data in Aggregated Robot Processing (ARP) architecture. Our idea in local cache and cache control is to streamline the sensor data output before processing it when the sensor device produces the data with the same value in a row. Furthermore, QoS balancing optimization aims to balance the DEPTH and DEADLINE QoS configuration to determine the rates and buffer size in ROS 2 node communication. This study shows that combining local cache and QoS balancing optimization improves multi-robot data transmission and cooperation in ARP architecture.

Despite offering free-of-charge COVID-19 vaccines starting July 2021, Guatemala has one of the lowest vaccination rates in Latin America. During September 28, 2021 to April 11, 2022, we conducted a cross-sectional survey of community members adapting a CDC questionnaire to evaluate COVID-19 vaccine access and hesitancy. Of 233 participants ≥12 years, 127 (55%) received >1 dose of COVID-19 and 4 (2%) reported prior COVID-19 illness. Persons ≥12 years old unvaccinated (n=106) were more likely to be female (73% vs 41%, p<0.001) and homemakers (69% vs 24%, p<0.01) compared with vaccinated participants (n=127). Among those ≥18 years, the main reported motivation for vaccination among vaccinated participants was to protect the health of family/friends (101/117, 86%); 40 (55%) unvaccinated persons reported little/no confidence in public health institutions recommending COVID-19 vaccination. Community- and/or home-based vaccination programs, including vaccination of families through the workplace, may better reach female homemakers and reduce inequities and hesitancy.

Background: Dynapenia and non-alcoholic fatty liver disease (NAFLD) are common, especially in the middle and advanced-age diabetic male population. We aimed to examine the clinical features, NAFLD severity, and parameters associated with the presence of dynapenia in type 2 diabetes mellitus (T2DM) cases. Material and Methods: One hundred thirty-five male patients diagnosed with T2DM between 45 and 65 years of age were included. Patients were staged by ultrasonography according to NAFLD status. Results: There were significant differences in muscle strength, upper arm circumference, calf circumference, and up-and-go test scores between the NAFLD groups (p<0.001 for all). The frequency of dynapenia was lower, and arm and calf circumferences were higher in patients without NAFLD. The muscle strength, upper arm circumference, calf circumference, and up-and-go test scores were significantly lower in the dynapenic group compared to the non-dynapenic group (p<0.005 for all). The prevalence of dynapenia increased along with the increase in NAFLD stages (p<0.001). Conclusions: We detected a significant association between NAFLD and dynapenia in middle-aged men with T2DM. As muscle strength decreases, the amount of fat in the liver increases, and as the fat in the liver increases, muscle strength decreases.

The Severe acute respiratory syndrome-Corona virus-2 (SARS-CoV-2) which is responsible for recurring pandemics takes advantage of host-cell processes including the glycosylation pathway. The heavily glycosylated spike protein assists viruses in attachment and penetration. The N-glycans of N-terminal domain N165 and N234 play a significant role in conformational dynamics of the receptor-binding domain (RBD) with angiotensin-converting enzyme 2 (ACE2). In addition, the deletion of N-glycan sites N331 and N334 have been associated with reduced infectivity. This signifies the importance of targeting the N-glycans making them unavailable for interacting with the ACE2 receptor, ultimately leading to reduced infectivity. These glycans can be specifically targeted and can be used for designing SARS specific drugs or neutralizing molecules. In the current study, lectins Griffithsin, Cyanovirin-N, Cyanovirin homolog, and BanLec H84T were used to target the spike protein's N-glycans. Molecular docking programs AutoDock Vina and HADDOCK were used to study lectin-glycan interactions. The interactions look convincible in accordance with the lowest interaction energies best-fit approach but the characteristic feature (scoring functions) of the docking programs are questionable concerning Lectin-Glycan interactions exist in nature. There is a high need of the hour for developing specific algorithms for docking glycans with a preferential selection of terminal residues.

Background: CoronaVirus Disease 2019 (COVID-19) is the main discussed topic world-wide in 2020 and at the beginning of the Italian epidemic, scientists tried to understand the virus diffusion and the epidemic curve of positive cases with controversial findings and numbers. Objectives: In this paper, a data analytics study on the diffusion of COVID-19 in Lombardy Region and Campania Region is developed in order to identify the driver that sparked the second wave in Italy Methods: Starting from all the available official data collected about the diffusion of COVID-19, we analyzed google mobility data, school data and infection data for two big regions in Italy: Lombardy Region and Campania Region, which adopted two different approaches in opening and closing schools. To reinforce our findings, we also extended the analysis to the Emilia Romagna Region. Results: The paper aims at showing how different policies adopted in school opening / closing may have on the impact on the COVID-19 spread. Conclusions: The paper shows that a clear correlation exists between the school contagion and the subsequent temporal overall contagion in a geographical area.

We report on the design, characterization and validation of a spherical irradiation system for inactivating SARS-CoV-2, based on UV-C 275 nm LEDs. The system is designed to maximize ir-radiation intensity and uniformity, and can be used for irradiating a volume of 18 liters. To this aim: (i) several commercially available LEDs have been acquired and analyzed; (ii) a complete optical study has been carried out in order to optimize the efficacy of the system. (iii) The re-sulting prototype has been characterized optically, and tested for the inactivation of SARS-CoV-2 for different exposure times, doses and surface types. Results indicate that a 99.9% inactivation can be reached after 1 minute of treatment with a dose of 83.1 J/m2.

Profiling technologies, such as proteomics, allow the simultaneous measurement and comparison of thousands of plant components without prior knowledge of their identity. The combination of these non-targeted methods facilitates a more comprehensive approach than targeted methods and thus provides additional opportunities to identify genotypic changes resulting from genetic modification, including new allergens or toxins. The purpose of this study was to investigate unintended changes in GM Bt maize grown in South Africa. In the present study, we used bi-dimensional gel electrophoresis based on fluorescence staining, coupled with mass spectrometry in order to compare the proteome of the field-grown transgenic hybrid (MON810) and its near-isogenic counterpart. Proteomic data showed that energy metabolism and redox homeostasis were unequally modulated in GM Bt and non-GM maize variety samples. In addition, a potential allergenic protein – pathogenesis related protein -1 has been identified in our sample set. These finding highlight the suitability of unbiased profiling approaches to complement current GMO risk assessment practices worldwide.

Immunosuppressed individuals, such as people living with HIV (PLWH), remain vulnerable to severe COVID-19. We analyzed the persistence of specific SARS-CoV-2 humoral and cellular immune responses in a retrospective, cross-sectional study in PLWH on antiretroviral therapy. Among 104 participants, 70.2% had anti-S IgG antibodies and 55.8% had significant neutralizing activity against the Omicron variant in a surrogate virus neutralization test. Only 38.5% were vaccinated (8.76 ± 4.1 months prior), all displaying anti-S IgG, 75% with neutralizing antibodies and anti-S IgA. 29.8% had no SARS-CoV-2 serologic markers and displayed significantly lower CD4 counts and HIV viral load. Severe immunosuppression (present in 12.5% of participants) was linked to lower levels of detectable anti-S IgG (0.0003), anti-S IgA (p &lt; 0.0001) and lack of neutralizing activity against Omicron variant (p &lt; 0.0001). T-cell responses were present in 86.7% of tested participants, even in those lacking serological markers. In PLWH without severe immunosuppression, neutralizing antibodies and T-cell responses persisted for up to 9 months post-infection or vaccination. Advanced immunosuppression led to diminished humoral immunity, but retained cellular immune.

Matrix metalloproteinases (MMPs) are critical enzymes involved in a variety of cellular processes. MMPs are well known for their ability to degrade the extracellular matrix (ECM) and their extracellular role in cell migration. Recently, more research has been conducted on investigating novel subcellular localizations of MMPs and their intracellular roles at the respective locations. In this review article, we focus on the subcellular localization and novel intracellular roles of two MMPs closely related: membrane-type-1 matrix metalloproteinase (MT1-MMP) and matrix metalloproteinase-2 (MMP-2). Although MT1-MMP is commonly known to localize on the cell surface, the protease also localizes to the cytoplasm, caveolae, Golgi, cytoskeleton, centrosome, and nucleus. At these subcellular locations, MT1-MMP functions in cell migration, macrophage metabolism, invadopodia development, spindle formation and genes expression, respectively. Similar to MT1-MMP, MMP-2 localizes to the caveolae, mitochondria, cytoskeleton, nucleus and nucleolus, and functions in calcium regulation, contractile dysfunction, genes expression and ribosomal RNA transcription. Our particular interest lies in the role MMP-2 and MT1-MMP serve within the nucleus, as it may provide critical insights into cancer epigenetics and tumor migration and invasion. We suggest that targeting nuclear MT1-MMP or MMP-2 to reduce or halt cell proliferation and migration may lead to the development of new therapies in cancer and other diseases.

This tutorial is organized into three major sections—viruses, vaccines and the race for a Covid-19 vaccine. The goal is to provide enough background on viruses, history of vaccines, and the science of vaccinology founded on the principles of immunity. The hope is that this will enable us to understand the challenges, methods and prospects for developing a safe and effective vaccine against SARS-CoV-2. Many important viruses such as smallpox, HIV, HCV and SARS-CoV-2 which is responsible for causing the Coronavirus disease 2019 (Covid-19) are presented in detail, which is then followed by a description of different vaccine development methods and strategies. The tutorial then discusses different candidate SARS-CoV-2 vaccines and provides specific details of many of the prospective vaccines on the leader-board which are undergoing clinical trials. The tutorial concludes with a realistic projection for a safe and effective vaccine against SARS-CoV-2 based on the historical scientific record.

It is proposed that both human creativity and human consciousness are (unintended) consequences of the human brain’s extraordinary energy efficiency. The topics of creativity and consciousness are treated separately, though have a common sub-structure. It is argued that creativity arises from a synergy between two cognitive modes of the human brain (which broadly coincide with Kahneman’s Systems 1 and 2). In the first, available energy is spread across a relatively large network of neurons. As such, the amount of energy per active neuron is so small that the operation of such neurons is susceptible to thermal (ultimately quantum decoherent) noise. In the second, available energy is focussed on a small enough subset of neurons to guarantee a deterministic operation. An illustration of how this synergy can lead to creativity with implications for computing in silicon are discussed. Starting with a discussion of the concept of free will, the notion of consciousness is defined in terms of an awareness of what are perceived to be nearby counterfactual worlds in state space. It is argued that such awareness arises from an interplay between our memories on the one hand, and quantum physical mechanisms (where, unlike in classical physics, nearby counterfactual worlds play an indispensable dynamical role) in the ion channels of neural networks. As with the brain’s susceptibility to noise, it is argued that in situations where quantum physics plays a role in the brain, it does so for reasons of energy efficiency. As an illustration of this definition of consciousness, a novel proposal is outlined as to why quantum entanglement appears so counter-intuitive.

The conserved cyanobacterial protein PipX is part of a complex interaction network with regulators involved in essential processes that include metabolic homeostasis or ribosome assembly. Because PipX interactions depend on the relative levels of their different partners and of the effector molecules binding to them, in vivo studies are required to understand the physiological significance and contribution of environmental factors to regulation of PipX complexes. Here we have used the NanoBiT complementation system to analyse regulation of complex formation in Synechococcus elongatus between PipX and each of its two best characterized partners, PII and NtcA. Our results confirm previous in vitro analysis on regulation of PipX-PII and PipX-NtcA complexes by 2-oxoglutarate and on regulation of PipX-PII by the ATP/ADP ratio, showing the disruption of PipX-NtcA complexes by increased levels of ADP-bound PII in Synechococcus elongatus. The demonstration of a positive role of PII on PipX-NtcA complexes under the initial response to nitrogen starvation or the impact of a PipX point mutation on the activity of PipX-PII and PipX-NtcA reporters are further indications of the sensitivity of the system. This study reveals additional regulatory complexities in the PipX interaction network, opening the way to future research in cyanobacteria.

Purpose of this article is to project from the point of view of the scientific data concerning PAF and as a new approach by involving PAF, in order to contribute to clarification and proposal a possible mechanism of action of the coronavirus SARS-CoV-2 and to give a possible explanation for its observed side effects-complications of Covid-19 disease. The article is not intended to suggest any specific drugs, but clarifying the mechanism is the first step in illuminating the direction of prescribing the targets of medication that may be appropriate for the prevention, treatment, and cure of Covid-19 disease. More specifically, the purpose of this article is to provide unequivocal evidence indicating that: 1 It would not be unexpected for PAFR to participate in the entry of coronavirus SARS-CoV-2 into the cell. 2 There is interdependence and relationship of the receptors ACER and PAFR, which means the involvement of PAF in the processes related to coronavirus SARS-CoV-2 as well as to its effects exercised by the coronavirus SARS-CoV-2. 3 The receptors ACER, PAFR and TLRs are also involved in inflammation as well as in virus binding to stabilize and enter into the cell, and so they are "communicating vessels" with PAF being " a missing link" 4 Consequently there is a correlations of COVID-19 disease manifestations and biological characteristics with those caused by PAF, which shows the involvement of PAF in COVID-19 disease.

Severe acute respiratory syndrome coronavirus 2 infects many people, but many infected individuals do not develop symptoms. COVID-19 is an inflammatory disease that affects a portion of individuals infected with the virus, and it is associated with liver injury and other complications leading to hospitalization, critical illness, and death. Remdesivir is an antiviral agent used for treatment of hospitalized patients with COVID-19 to improve time to recovery, reduce duration of mechanical ventilation, decrease the need for supplemental oxygen, and decrease the risk of mortality. Remdesivir-associated hepatotoxicity has been observed as increased transaminases more than 5 times the upper limit of normal in hospitalized patients with COVID-19 but causality has not been proven. It is generally difficult to distinguish between remdesivir-associated hepatotoxicity and COVID-19-induced hepatotoxicity. The purpose of this review is to evaluate the evidence for remdesivir-associated hepatotoxicity. Current evidence suggests that elevated liver enzymes in hospitalized COVID-19 patients are more likely to be due to the infection than remdesivir and that a 5-day course of remdesivir seems to be safe in regards to hepatotoxicity.

The Hunga Tonga-Hunga Ha’apai underwater volcano (20.57°S, 175.38°W) violently erupted on 15 January 2022. The volcanic plume evolution during its initial stages is delineated by using Constellation Observing System for Meteorology, Ionosphere, and Climate (COSMIC)-2 radio occultation (RO) measurements. The bending angle (BA) anomaly over the Tonga volcanic plume (within 200 km from the eruption center) at 5:17 UTC on 15 January shows a prominent peak at higher stratospheric heights. The top of the BA anomaly revealed that negative to positive change occurred at ~38 km indicating the first height where the RO line-of-sight encounters the volcanic plume. The BA anomaly further revealed an increase of ~50% at ~36 km and confirms the volcanic plume reached above ~36 km. Further, the evolution of BA perturbations within 24 hours after the initial explosion is also discussed. From collocated RO profiles with the volcanic plume, we find a clear descending of the peak altitude of the BA perturbation from ~36 km to ~30 km within 24 hours after the initial eruption. The results from the study will provide some insights into advancing our understanding of volcanic cloud dynamics and their implementation in volcanic plume modeling.

Novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants of concern (VOC) are constantly threatening global public health. With no end date, the pandemic still persists with the emergence of novel variants that threaten the effectiveness of diagnostic tests and vaccines. Mutations in the Spike surface protein of the virus are regularly observed in the new variants, potentializing the emergence of novel viruses with different tropism from the current ones, which may change the severity and symptoms of the disease. Growing evidence has shown that mutations are being selected in favor of variants that are more capable of evading the action of neutralizing antibodies. In this context, the most important factor guiding the evolution of SARS-CoV-2 is its interaction with the host’s immune system. Thus, as current vaccines cannot block the transmission of the virus, measures complementary to vaccination, such as the use of masks, hand hygiene, and keeping environments ventilated remain essential to delay the emergence of new variants. Importantly, in addition to the involvement of the immune system in the evolution of the virus, we highlight several chemical parameters that influence the molecular interactions between viruses and host cells during invasion and are also critical tools making novel variants more transmissible. In this review, we dissect the impacts of the Spike mutations on biological parameters such as (1) increase of Spike binding affinity to hACE2; (2) bound time for the receptor to be cleaved by the proteases; (3) how mutations associate with increase of RBD up-conformation state in the Spike ectodomain; (4) expansion of uncleaved Spike protein in the virion particles; (5) increment of Spike concentration per virion particles; and (6) evasion of the immune system. These factors play key roles in the fast spreading of SARS-CoV-2 variants of concern, including the Omicron.

COVID-19 is a pandemic with no cure. There is an urgent need for low-cost interventions. Macroclimate work through affecting microclimate. In many situations, man-made microclimate, such as air conditioning, may override the effect of natural macroclimate in determining SARS-CoV-2 pathogenicity. Ambient temperature (AT) has been roughly associated to SARS-CoV-2 transmission. To translate into a feasible practice in controlling COVID-19 pandemic, in-depth and implementable knowledge of AT role in SARS-CoV-2 transmission should be unveiled. This study aimed to determine if there is a ‘safe’ temperature that is comfortable to human beings while significantly inhibitory for SARS-CoV-2 pathogenicity. Data on monthly new deaths or new cases per million population (MDPM or MCPM) and monthly cumulated days with more cases than the previous day (DI) from March 2 to June 30, 2020 were collected from all 118 countries with population over five million. Monthly average AT negatively correlated with the transmission parameters. A significant decrease in transmission was observed when AT reached above 20 ºC. Monthly average (not average high) AT of countries with MDPM <2, MCPM<10, or DI<=7 was found to be between 24.54 and 26.89 ºC (25.18 ºC on average) with average standard error of 4.81. Thus, average AT <20, 20-25, >25 ºC were considered as high, medium, and low risk AT. Furthermore, MDPM in countries with AT <20 ºC were 80.93, 50.23, 13.52, and 5.05 times of those in countries with AT >25 ºC in March, April, May, and June, respectively. MDPM low-risk rates (<2) in countries with AT >25 ºC were 100, 83.33, 52.73, and 52.46%, respectively. In countries with AT <20 ºC, the trends were opposite. Setting indoor temperature to 25 ºC could decrease the need of social distancing for containing SARS-CoV-2 transmission. Ventilation and sanitizing the air with ultraviolet light in nonbusiness hours may be additionally effective. Cooling indoor temperature too low may be a reason of COVID-19 outbreak in some high AT countries. Authorities and the general population can evaluate COVID-19 risk level and manipulate microclimate to reduce the risk anywhere anytime based on local day average AT.

Indigenous forests cover 24% of New Zealand and provide valuable ecosystem services. However, a national map of forest types, that is, physiognomic types, which would benefit conservation management, does not currently exist at an appropriate level of detail. While traditional forest classification approaches from remote sensing data are based on spectral information alone, the joint use of space-based optical imagery and structural information from synthetic aperture radar (SAR) and canopy metrics from air-borne Light Detection and Ranging (LiDAR) facilitates more detailed and accurate classifications of forest structure. We present a support vector machine (SVM) classification using data from ESA’s Sentinel-1 and 2 missions, ALOS PALSAR, and airborne LiDAR to produce a regional map of physiognomic types of indigenous forest in New Zealand. A five-fold cross-validation of ground data showed that the highest classification accuracy of 80.9% is achieved for bands 2, 3, 4, 5, 8, 11, and 12 from Sentinel-2, the ratio of bands VH and VV from Sentinel-1, HH from PALSAR, and mean canopy height and 97th percentile canopy height from LiDAR. The classification based on the optical bands alone was 73.1% accurate and the addition of structural metrics from SAR and LiDAR increased accuracy by 7.8%. The classification accuracy is sufficient for many management applications for indigenous forest in New Zealand, including biodiversity management, carbon inventory, pest control, ungulate management, and disease management. National application of the method will be possible in several years, once national LiDAR coverage is achieved, and a national canopy height model is available.

Accurate fuel mapping plays a crucial role in fire detection and management strategies. This paper presents a method for discriminating between wildfire fuel types by exploiting together remote sensing data and Convolutional Neural Networks (CNN). Specially, a CNN-based classification approach that leverages Sentinel-2 imagery is exploited to accurately classify fuel types into seven preliminary main classes (conifers, broadleaf, shrubs, grass, bare soil, urban areas, and water bodies) with an high accuracy of 0.99$\%$. To further refine the fuel mapping results, subclasses were generated from the seven principals by using biomass and bioclimatic maps. These additional maps provide complementary information about vegetation density and climatic conditions, respectively. By incorporating this information, we align our fuel type classification with the widely used Scott/Burgan fuel classification system. This refinement step allows for a more detailed and comprehensive assessment of fuel types, enhancing the accuracy and effectiveness of fire management efforts, which can be utilized by fire management agencies, policymakers, and researchers for improved fire behavior prediction and mitigation practices. The proposed approach presents a valuable tool for enhancing fire management, contributing to more effective wildfire prevention and mitigation efforts.

We provide a summary of various epidemiological parameters related to COVID-19 such as incubation period, serial interval and other parameters. Understanding these parameters is important for developing prevention strategies. SARS-CoV-2 can be transmitted by droplets and close contact, but there is evidence of airborne transmission. Aerosol-generating procedures have been identified as one of the specific risk factors for healthcare workers. Super-spreading events refer to situations where a small number of individuals cause the majority of infections. The basic reproductive number (R0) and the spread parameter (k) are used to characterise the transmissibility of the disease. Estimated values for R0 range from 2 to 3 and the estimated value for k is 0.1.The duration of infectiousness depends on viral load and shedding. Viral load varies according to factors such as clinical spectrum, type of variant and vaccination status. The relationship between viral load and infectivity is not fully understood.With regard to the frequency of symptoms and signs of COVID-19, fever, cough, fatigue and dyspnoea are common. The prevalence of olfactory and gustatory dysfunction (OGD) varies between studies and countries. Age and comorbidities are factors associated with olfactory dysfunction.Estimates of the proportion of asymptomatic patients range from 6% to 96%. Asymptomatic transmission is considered likely and is important for control measures.We reviewed the quantitative semiology of COVID-19 is reported on sensitivity, specificity and likelihood ratios of signs.Finally, we also review risk factors for COVID-19 (including health care workers), co-infections, and epidemiology of variants..

SARS-CoV-2 pandemic caused an increase in Intensive Care Unit (ICU) hospitalizations with rise in morbidity and mortality; nevertheless, there is still little evidence of pandemic impact on antibiotic resistance in ICU. Retrospective monocentric epidemiological study. All microorganisms isolated from all patients admitted to E.O. Galliera ICU from January 2018 to December 2022 were included. Antibiotic resistance (AR) profiles were evaluated. Aim of the study was to describe and analyze the impact of SARS-CoV-2 pandemic on ICU microorganisms resistance patterns. 1,771 microorganisms identified, 221 (12.47%) had resistant pattern (Resistant Organisms; ROs) isolated from 1,679 patients during 12,030 hospitalization days. The majority of ROs were Gram-negative (79.66% 2018, 77.29% 2019, 61.83% 2020, 62.56% 2021, 60.75% 2022), but increase of Gram-positive microorganisms was observed (20.34% to 39.25% between 2018-2022). Prevalence of AR was: 19.44% 2018, 11.54% 2019, 38.04% 2020, 34.15% 2021, 39.29% 2022 for Gram-positives; 19.86%, 13.56%, 18.12%, 12.41%, 12.31% for Gram-negatives. Incidence of Ros showed COVID-related rise in 2020-2021, followed by a lowering trend since 2021, with new rise in 2022. Possible explanations are antibiotic overtreatment and drop of containing measures. Interesting finding is the cumulative lowering trend of carbapenem resistant K. pneumoniae and P. aeruginosa probably due to different patient features.

The recent global emergence of the SARS-CoV-2 pandemic has accelerated research in several areas of science whose valuable outputs and findings can help to address future health challenges in the event of emerging infectious agents. We performed a multifocus shotgun analysis to compare differences in bacterial spectrum and viral presence through culture-independent RNA sequencing. We compared the microbiome of healthy people versus those with varying degrees of COVID-19 severity. We observed a significant increase in the diversity of microbial species in patients with COVID-19 regardless of disease severity. Some bacterial phyla, such as Actinobacteria, are significantly more abundant in healthy people than in infected people, whereas Bacteroides are less abundant in the latter. Infected people, regardless of severity and symptoms, have the same proportional representation of Firmicutes, Proteobacteria, Actinobacteria, Bacteroidetes, and Fusobacteriales the same. In addition to SARS-CoV-2 and numerous phage groups, we identified sequences of clinically significant viruses such as Human Herpes Virus 1, Human Mastadenovirus D, Molluscum Contagiosum Virus, and Rhinovirus A in several samples. Analyses were performed retrospectively, therefore, in the case of SARS-CoV-2 various WHO variants such as Alpha (B.1.1.7), Delta (B.1.617.2), Omicron (B.1.1.529), and 20C strains are represented. Additionally, the presence of specific virus strains has a certain effect on the distribution of individual microbial taxa.

The Mont-Saint-Michel is known worldwide for its unique combination of the natural site and the Medieval abbey at the top of the rocky islet. But the Mont is also located within an estuarine complex, which is considerably silting up. For two decades, large-scale works were planned to prevent the Mont from being surrounded by the expanding salt meadows. The construction of a new dam over the Couesnon River, the digging of two new channels, and the destruction of the causeway were the main operations carried out between 2007 and 2015. The remote sensing approach is fully suitable for evaluating the real impact of the engineering project in both time and space, particularly the expected large-scale hydrosedimentary effects, for reestablishing the maritime landscape around the Mont. Sentinel-2 satellite data have been used for the period from 2015 to 2023. Aster data were used for the previous period covering 2000 to 2017. Aerial photographs and an ALOS scene have been also used. The remote sensing approach is based on time-series images. It allows identifying local or regional consequences and temporary or permanent effects. The migration of the different channels (especially for the new west and east Couesnon river courses) and the erosion-progradation balance of the vegetation through space and time are the main features to study. Between 2007 and 2023, the erosion of the salt meadows is significant to the south-west of the Mont (− 150 ha) but more limited to the south-east (− 65 ha). The erosion effect is limited to the immediate environment because the vegetation fringe of the uppermost tidal flat along the main dike is slightly increasing (+ 35 ha) to the west and to the east (+ 40 ha). During the same period, the sedimentation considerably increased to the north-east of the Bay, between the Bec d’Andaine, the Grouin du Sud and Tombelaine islet, which seems now facing the same silting-up problem. At this stage, the remote-sensing survey indicates mixed results for the engineering project.

Among cross-sectional imaging modalities, computed tomography (CT) is more available and faster; however, magnetic resonance (MR) performs better in terms of sensitivity and specificity, due to its higher contrast resolution. The appearance of peritoneal deposits on CT and MR depends mainly on the primary tumour histology: in case of unknown primary tumour (3-5% of cases), their behaviour at imaging may provide insights on the tumour origin. The time-point of tumour evolution, previous or ongoing treatments and the peritoneal spaces where they occur, also play an important role in determining the appearance of peritoneal deposits. Thus, knowledge of peritoneal anatomy and fluid circulation is mandatory in detection and characterization of peritoneal deposits. Several benign and malignant conditions may show similar imaging features that overlap those of PC, making the differential diagnosis challenging. Clinical history, laboratory findings and previous imaging examinations must be considered to achieve the correct diagnosis.

The COVID-19 pandemic has had a major impact on health systems around the globe and Romania is no exception. The impact on healthcare expense for pregnant women has been considerable, especially in COVID-only tertiary centers, where specialized care is being provided .The aim of this study is to analyze the impact of SARS-CoV-2 infection on healthcare costs, in particular by managing cases in COVID-only maternity. Material and Methods: The objective of the study was to analyze if the model adopted by the health system consisting in complete separation of delivering obstetrical care for covid and non-covid patients was efficient. We conducted an observational study in which we compared a group of pregnant women infected with SARS-CoV-2 (study group) with a control group in which we included uninfected pregnant women. The patients were recruited from Bucur Maternity Hospital, declared a COVID-only center in march 2020. We compared the two groups in terms of expenses over the entire period of hospitalization, i.e. expense on hospitalization, medicines, medical supplies, and medical investigations.

The COVID-19 pandemic has highlighted the importance and urgent need of rapid and accurate diagnostic tests for detection and screening of this infection. In our proposal, a biosensor based on the ELISA immunoassay was developed for monitoring antibodies against SARS-CoV-2 in human serum samples. The SARS-CoV-2 nucleocapsid protein (N-protein) was selected as a specific receptor for the detection of SARS-CoV-2 nucleocapsid immunoglobulin G. Thus, the N-protein was immobilized on surface of screen-printed carbon electrode (SPCE) modified with carboxylated graphene (CG). The IgG-SARS-CoV-2 nucleocapsid concentration was quantified using a secondary antibody labelled with horseradish peroxidase (HRP) (anti-IgG-HRP) catalyzed by 3,3’,5,5’-tetramethylbenzidine (TMB) mediator by chronoamperometry. A linear response was obtained in the range of 1:1000-1:200 v/v in phosphate buffer solution (PBS) and the limit of detection calculated was of 1:4947 v/v. The chronoamperometric method showed electrical signals directly proportional to antibody concentrations due to Ag-Ab specific and stable binding reaction.

Background: The isoflurane minimum alveolar concentration (MAC) was measured in rats chronically treated with WIN 55,212-2. Methods: The isoflurane MAC was determined in 24 male rats from the end expiratory samples at time of tail clamping under the following conditions: without treatment (MACISO), in rats treated for 21 days with WIN 55,212-2 (MACISO+WIN55) and other group 8 days after stopping treatment for 21 days with WIN 55,212-2 (MACISO+WIN55+8D). Results: The MACISO was 1.32 ± 0.06. In the MACISO+WIN55 group the MAC increase to 1.69 ± 0.09 (28%). After 8 days stopping treatment, MAC did not decrease significantly 1.67 ± 0.07 (26%). Conclusions: The administration for 21 days of WIN 55,212-2 increases the MAC of isoflurane in rats; this effect does not disappear after 8 days of discontinuing treatment with the synthetic cannabinoid.

Prevention practices have been extensively used to contain the spread of the SARS-CoV-2 virus. These include social distancing, wearing masks, disinfection of hands, and sanitization of contact surfaces. However, the excessive usage of chemical disinfectants pose long term adverse effects to human health and the environment. Development of effective and environmentally friendly biocides, or virucidal agents, will help mitigate the ill effects of chemical disinfectants. Enzymes are potential candidates for the preparation of biocides against bacteria and viruses. Exploration of the virucidal activity of commercial enzymes, will highlight prospective, readily available sources for research on enzyme based biocides. In this study, the virucidal effect of some com-mercial enzyme preparations has been investigated against the SARS-CoV-2 virus. Vida Defense (2000 µg/ml), Excellacor (1500 µg/ml), and SEBkinase (3000 µg/ml) reduced SARS-CoV-2 viral ti-ters by ≥1 log CCID50 (≥90%). ImmunoSEB (6000µg/ml) and Peptizyme SP (500µg/ml) reduced the SARS-CoV-2 viral titers by 0.8 log CCID50 (84.2%). The study indicates that enzyme prepara-tions offer the potential to be explored further for an anti-viral biocide against SARS‐CoV‐2 for reducing the risk of COVID‐19 transmission. However, further studies are mandated to improve efficacy and establish safety.

Background: Coronavirus disease (COVID-19) has caused more than 745,000 deaths worldwide. Vitamin D has been identified as a potential strategy to prevent or treat this disease. The purpose of the study was to measure vitamin D at hospital admission of COVID-19; Methods: We included critically ill patients with the polymerase chain reaction positive test for COVID-19, from March to April, 2020. Statistical significance was defined as P &lt; .05. All tests were 2-tailed; Results: A total of 35 patients (median age, 60 years; 26 [74.3%] male) were included. Vitamin D levels were categorized as deficient for 14 participants (40%). Vitamin D deficiency was associated with vitamin A (P= 0.003) and Zinc (P= 0.019) deficiency and lower levels of albumin (P= 0.026) and prealbumin (P= 0.009). Overall, none of the studied variables were associated with vitamin D status: mortality, intensive care unit (ICU) or hospital stay, necessity of vasoactive agents, intubation, prone position, C reactive protein (CRP), Dimer-D, Interleukin 6 levels (IL-6), ferritin levels, or bacterial superinfection; Conclusions: In this single-center, retrospective cohort study, deficient vitamin D status was found in 40% in COVID-19 critically ill patients. However, deficient vitamin D status was not associated with inflammation or outcome.

In regions lacking genomic data, analysis of sequences from the early stages of an outbreak can provide important insights into the diversity of pathogens present. Following the detection of the first imported case of COVID-19 in the Northern sector of Ghana on 13^th March 2020, we have now molecularly characterized and phylogenetically analysed sequences including three (3) complete genomes of the severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) isolated from nine (9) patients observed in Ghana. Eight (8) of these patients reported with a recent history of foreign travel and one (1) with no history of foreign travel. We performed high throughput sequencing for 9 samples following the determination of high concentration of viral RNA. In addition, we estimated the potential impact that long distance transportation of samples to testing centres may have on sequencing outcomes. Here, two samples that were closest in terms of viral RNA concentration but transported from sites which are over 400km apart were assessed. All sequences were compared to previous sequences from Ghana and representative sequences from regions where our patients had previously travelled. Complete genomes were obtained for three (3) sequences and with another near complete genome with a coverage of 95.6%. Sequences with coverage in excess of 80% were found to belong to three lineages namely A, B.1 and B.2. Our sequences clustered in two different clades with the majority falling within a clade composed of sequences from sub-Saharan Africa. Less RNA fragmentation was seen in sample KATH23 which was collected 9km compared with sample TTH6 which was collected and transported over a distance of 400km to the testing site. The clustering of several sequences from sub-Saharan Africa suggests regional circulation of the viruses in the subregion. Importantly, there may be the need to decentralize testing sites and build more capacity across Africa to boost the sequencing output of the subregion.

“Severe acute respiratory syndrome” (SARS) due to Coronavirus (SARS-CoV) infection is a known cause of death. Sometimes demise can occur unexpectedly in apparently previous healthy individual after a brief period of trivial flue-like symptoms. In this dobtfull cases the forensic pathologist could be requested to define cause of death occurred outside hospital. In this report the authors describe two thorough autopsied cases of SARS-CoV-2 related deaths occurred suddenly at home and not preceded by hospitalization, highlighting associated histopathologic patterns and correlating them to pathophysiology of viral infection.

The regulation of apoptosis depends upon the Bcl-2 protein family. The process of cell death and survival is highly complicated and regulated by various types of extrinsic as well as intrinsic network of biological system. Several enzymes and regulators play crucial role in cell death and survival cycle not only in healthy but also in pathological state particularly in cancer. In cancerous cells, various proto-oncogenes and anti-apoptotic proteins are activated and responsible for the cell survival and longevity. The mechanism of activation and inactivation of various proteins in cell survival is regulated by the process of phosphorylation (kinases) and dephosphorylation (phosphatases). The current review will summarize the dynamics of Bcl-2 phosphorylation and its role in apoptosis and cell survival.

OBJECTIVE: Recent worldwide outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causative agent of respiratory coronavirus disease 2019 (COVID-19), is a current, ongoing life-threatening crisis and international public health emergency. The early diagnosis and management of the disease remains a major challenge. In this review, we aim to summarize the updated epidemiology, causes, clinical manifestation and diagnosis, as well as prevention and control of the novel coronavirus SARS-CoV-2.MATERIALS AND METHODS: A broad search of the literature was performed in “PubMed” “Medline” “Web of knowledge”, and “Google Scholar” World Health Organization-WHO” using the keywords “severe acute respiratory syndrome coronavirus”, “2019-nCoV”, “COVID-19, “SARS”, “SARS-CoV-2” “Epidemiology” “Transmission” “Pathogenesis” “Clinical Characteristics”. We reviewed and documented the information obtained from literature on epidemiology, pathogenesis and clinical appearances of SARS-CoV-2 infection.RESULTS: The global cases of COVID-19 as of April 2, 2020 have risen to more than 900,000 and morbidity has reached more than 47,000. The incidence rate for COVID-19 has been predicted to be higher than the previous outbreaks of other coronavirus family members, including those of SARS-CoV and the Middle East Respiratory Syndrome Coronavirus (MERS-CoV). The main clinical presentation of SARS-CoV-2 infection ranges from asymptomatic stages to severe lower respiratory infection in the form of pneumonia. Most of the patients also presented with fever, cough, sore throat, headache, fatigue, myalgia and breathlessness.Individuals at higher risk for severe illness include elderly people and patients with a weakened immune system or that are suffering from a underlying chronic medical condition like hypertension, diabetes, cancer, respiratory illness or cardiovascular diseases.CONCLUSIONS: SARS-Cov-2 has emerged as a worldwide threat, currently affecting 170 countries and territories across the globe. There is still much to be understood regarding SARS-CoV-2 about its virology, epidemiology and clinical management strategies; this knowledge will be essential to both manage the current pandemic and to conceive comprehensive measures to prevent such outbreaks in the future.

Covid-19 has now become a public health concern worldwide. The infection primarily involves the respiratory tract. Hitherto, some Covid-19 pneumonia patients carry the viral nucleic acids, and the active virus was detected in stool specimens. The virus discharged with feces is a potential contagious source. In the present study, three Covid-19 respiratory tract infection patients showed no gastrointestinal symptoms, and two were positive for viral nucleic acids in anal swab specimens remained positive 6 and at least 14 days after virus turned negative in the respiratory tract, respectively (details of the patients were listed in Fig 1). Thus, for Covid-19-infected patients with or without gastrointestinal symptoms, viral nucleic acids in stool specimens or anal swab specimens should be focused on for testing in order to decide the isolation duration of the patient.

Type 2 diabetes mellitus (T2DM) is a polygenic metabolic disease described by hyperglycemia, which is caused by insulin resistance or reduced insulin secretion. Interaction between various genetic variants and environmental factors triggers T2DM. The main aim of this study was to find the risk associated with genetic variant (rs5210) of KCNJ11gene in the development of T2D in Indian Population. A total number of 300 cases of T2D and 100 control samples were studied to find the polymorphism in KCNJ11 through PCR-RFLP. The genotype and allele frequencies in T2DM cases were significantly different from the control population. We found a significant association of KCNJ11 (rs5210) gene polymorphism with T2DM in North Indian patients indicating the role of this variant in developing risk for T2DM.

Introduction: Type 2 diabetes (T2D) is a major driver of health care costs, thus treatments enabling T2D reversal may reduce expenditures. We examined the impact of a T2D continuous care intervention (CCI) on health care utilization. Previous research documented that CCI, including individualized nutrition supported by remote care, simultaneously reduced hemoglobin A1c and medication use and improved cardiovascular status after two years; however, the impact on utilization is unknown. Methods: This study used four years of data (two years pre-intervention, two years post-intervention) from the Indiana Network for Patient Care (INPC) health record. Two methods estimated the impact of CCI on utilization. First, an interrupted time series (ITS) including only CCI participants (n=193) compared post-intervention utilization to expected utilization had the pre-intervention trend persisted. Deviation from the trend was estimated non-parametrically for each 6-month interval after the implementation of CCI . Second, a 1:3 matched comparator group (n=579) was constructed and used for a difference-in-differences (DiD) analysis. The primary outcome was annualized outpatient encounters. Secondary outcomes included emergency encounters and hospitalizations. Results: In two years prior to intervention, CCI participants had a mean of 5.77 annualized encounters (5.62 outpatient, 0.04 hospitalizations, 0.11 emergency). The CCI group showed a reduction in outpatient utilization after intervention. In ITS analysis, 1.6 to 1.9 fewer annualized outpatient encounters occurred in each 6-month interval post-intervention relative to expected utilization based on pre-intervention trends (p<0.01 each 6-month period; 28-33% reduction). The DiD analysis suggested a larger reduction; 5 fewer annualized outpatient encounters in the quarter after intervention, diminishing to 2.5 fewer after 2 years (p<0.01 each quarter). The study was underpowered to draw conclusions about hospitalization and emergency encounters due to the limited number of CCI patients and the rarity of encounters. Conclusions: Outpatient encounters were significantly reduced for a T2D patient population up to 2 years after receiving an individualized intervention supporting nutrition and behavior change through remote care.

(1) Background: The aim of study was to investigate the salt consumption by children and adolescents from the Silesian Province (Poland), taking into account the region’s dietary traditions and number of years of school education. (2) Methods : 300 students aged 10–18 from different types of schools, were enrolled in the study and divided into groups in terms of: school, sex, the state of nutrition. The survey questionnaire about dietary habits, including the frequency and serving size with respect to 12 salty products was used. On the basis of the frequency and the amount of consumed products, as well as the data on salt content, the amount of total daily intake of salt was estimated.; (3) Results: The mean daily intake of salt by children and adolescents was 1.083 g ( 0.433 g of sodium); children aged 10–12 consumed the highest amount of salt (1.296 g/day) compared to pupils aged 13–15 (1.131 g of sodium) and adolescents aged 16–18 (0.863 g/day); (4) Conclusions: With age, as a result of various factors, the consumption of salt declines. The parents impact and the familial socio-environmental factors begin to wane, and other factors start to have influence, e.g. school education of healthy lifestyle, health behavior of peers.

Background: Mounting evidence supports the role of the endocannabinoid system in neurophysiology, includ-ing blood-brain barrier (BBB) function. Recent work has demonstrated that activation of endocannabinoid re-ceptors can mitigate insults to the BBB during neurological disorders, like traumatic brain injury, cortical spreading depression and stroke. As alterations to the BBB are associated with worsening clinical outcomes in these conditions, studies herein sought to examine the impact of endocannabinoid depletion on BBB integrity. Methods: Barrier integrity was investigated in vitro via bEnd.3 cell monolayers to assess endocannabinoid syn-thesis, barrier function, calcium influx, junctional protein expression, and proteome-wide changes. Results: In-hibition of 2-AG synthesis using DAGLα inhibition and siRNA inhibition of DAGLα led to loss of barrier in-tegrity via altered expression of VE-cadherin, which could be partially rescued by exogenous application of 2-AG. Moreover, the deleterious effects of DAGLα inhibition on BBB integrity showed both calcium and PKC (protein kinase C)-dependency. Conclusions: These data indicate that disruption of 2-AG homeostasis in brain endothelial cells, in the absence of insult, is sufficient to disrupt BBB integrity thus supporting the role of the endocannabinoid system in neurovascular disorders.

The Neurovascular Unit (NVU), comprised of glia (astrocytes, oligodendrocytes, microglia), neurons, pericytes and endothelial cells, is a dynamic interface ensuring physiological functioning of the central nervous system (CNS), that gets affected and contributes to the pathology of several neurodegenerative diseases. Neuroinflammation is a common feature of neurodegenerative diseases and is primarily related to the activation state of perivascular microglia and astrocytes, which constitute two of its major cellular components. Our studies focus on monitoring in real time the morphological changes of perivascular astrocytes and microglia, as well as their dynamic interactions with the brain vasculature, under physiological conditions and following systemic neuroinflammation triggering both microgliosis and astrogliosis. To this end, we performed 2-photon laser scanning microscopy (2P-LSM) for intravital imaging of the cortex of transgenic mice visualizing the dynamics of microglia and astroglia following neuroinflammation induced by systemic administration of the endotoxin lipopolysaccharide (LPS). Our results indicate that following neuroinflammation the end-feet of activated perivascular astrocytes lose their close proximity and physiological crosstalk with vasculature, an event that most possibly contributes to a loss of blood-brain-barrier (BBB) integrity. At the same time, microglial cells get activated with more frequent contacts of the blood vessels. These dynamic responses of perivascular astrocytes and microglial are peaking at 4 days following LPS administration, however they still persist at a lower level 8 days after LPS, revealing incomplete reversal of inflammation affecting the glial properties and interactions with the NVU.

Objective: To describe outcomes of patients with coronavirus disease 2019 (COVID-19) in the outpatient setting after early treatment with zinc, low dose hydroxychloroquine, and azithromycin (the triple therapy) dependent on risk stratification. Design: Retrospective case series study. Setting: General practice. Participants: 141 COVID-19 patients with laboratory confirmed severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections in the year 2020. Main Outcome Measures: Risk-stratified treatment decision, rate of hospitalization and all-cause death. Results: Of 335 positively PCR-tested COVID-19 patients, 127 were treated with the triple therapy. 104 of 127 met the defined risk stratification criteria and were included in the analysis. In addition, 37 treated and eligible patients who were confirmed by IgG tests were included in the treatment group (total N=141). 208 of the 335 patients did not meet the risk stratification criteria and were not treated. After 4 days (median, IQR 3-6, available for N=66/141) of onset of symptoms, 141 patients (median age 58 years, IQR 40-67; 73% male) got a prescription for the triple therapy for 5 days. Independent public reference data from 377 confirmed COVID-19 patients of the same community were used as untreated control. 4 of 141 treated patients (2.8%) were hospitalized, which was significantly less (p<0.001) compared with 58 of 377 untreated patients (15.4%) (odds ratio 0.16, 95% CI 0.06-0.5). Therefore, the odds of hospitalization of treated patients were 84% less than in the untreated group. One patient (0.7%) died in the treatment group versus 13 patients (3.5%) in the untreated group (odds ratio 0.2, 95% CI 0.03-1.5; p=0.16). There were no cardiac side effects. Conclusions: Risk stratification-based treatment of COVID-19 outpatients as early as possible after symptom onset with the used triple therapy, including the combination of zinc with low dose hydroxychloroquine, was associated with significantly less hospitalizations and 5 times less all-cause deaths.