Health-Related Quality of Life (HRQoL) encompasses the comprehensive evaluation of an indi-vidual's health and well-being across multiple dimensions. Mindfulness, recognized as a scientifi-cally supported strategy for anxiety management, plays a role in enhancing both physical and mental health. The Gut-Brain Axis (GBA) serves as the bidirectional communication link between the gastrointestinal system and the central nervous system. This study aims to explore the associa-tion between Mindfulness and factors influencing the GBA in both healthy individuals and those with Inflammatory Bowel Diseases (IBD). A cross-sectional investigation involved 338 adults, in-cluding 50 IBD patients, utilizing validated Greek scales for Mindfulness (MAAS-15), Mediterra-nean Diet (14-MEDAS), and HRQoL (EQ-5D-5L). The questionnaire gathered demographic, an-thropometric, and lifestyle data. Among healthy participants, EQ-5D-5L showed a moderate cor-relation with the MAAS-15 scale (r=0.389, p

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

Objectives: To explore the effect of breakthrough cancer pain (BTcP) treatment on quality of sleep and other aspects of the health-related quality of life (HRQoL) in patients with cancer pain. Methods: In an observational, multicenter, cohort study, cancer patients from palliative care units, oncology departments, and pain clinics and affected by BTcP were included. Enrolled patients were assessed at the four visits: T0 (baseline), T7, T14, and T28. Well-controlled chronic background pain during the whole study period was mandatory. BTcP was treated through transmucosal fentanyl. Three questionnaires were used to measure the HRQoL: EORTC QLQ-C15-PAL, Pittsburgh Sleep Quality Index (PSQI), and the Edmonton Symptom Assessment System (ESAS). Results: In 154 patients, the HRQoL showed a significant improvement for all physical and emotional characteristics in the EORTC QLQ-C15-PAL, except for nausea and vomiting (Linear p-value = 0.1) and dyspnoea (Linear p-value =0.05). The ESAS and PSQI questionnaires confirmed these positive results (p<0.0001 and p=0.002, respectively). Conclusions: This prospective investigation by an Italian expert group, has confirmed that careful management of BTcP induces a paramount improvement on the HRQoL. Because in cancer patients there is a high prevalence of BTcP and this severe acute pain has deleterious consequences, this information can have an important clinical significance

The purpose of this work was to evaluate the suitability of recent US Food and Drug Administration (US-FDA) approved and marketed oral liquid, powder, or granule products for children in North America, to identify the next group of Active Pharmaceutical Ingredients (APIs) that have high potential for development as commercially available FDA-approved finished liquid dosage forms , and to propose lists of compounded nonsterile preparations (CNSPs) that should developed as commercially available FDA-approved finished liquid dosage forms as well as those that pharmacists should continue to compound extemporaneously. Through this identification and categorization process, the pharmaceutical industry, government, and the professions are encouraged to continue to work together to improve the likelihood that patients will receive high quality standardized extemporaneous CNSPs and US-FDA-approved products.

Assisted reproductive technology has been developed significantly throughout the past few years, particularly diagnosing and treating male infertility. Many studies have been performed showing that Intracytoplasmic Sperm Injection (ICSI) is a successful method to attain clinical pregnancy and live birth through impaired spermatozoa characteristics or low sperm count, such as severe oligospermia. Severe oligospermia indicates low sperm count, which in some cases leads to azoospermia. Severe oligospermia can be caused by several factors such as genetics or medication. In search of efficient treatment for couples with Severe oligospermia, numerous retrospective and prospective researches have reported high pregnancy and live birth rates through testicular sperm for men with severe oligospermia and cryptozoospermia with or without high sperm DNA damage. The research showed that the use of testicular sperm in combination with ICSI yielded a high pregnancy rate and live births over another source of sperm, such as ejaculated sperms. Moreover, the use of ICSI in severe oligospermia has shown successful fertilization and pregnancy.

Mastocytosis is characterized by pathological accumulation of mast cells (MC) in various organs. In these patients, MC may degranulate and thereby contribute to clinical symptoms, especially when a concomitant allergy is present. However, MC activation can not only be induced by high-affinity receptors for IgE, but also by anaphylatoxins, neuropeptides, IgG immune complexes, complement-components, drugs, products of bacteria or parasites, as well as physical factors such as heat, cold, vibration, stress, sun, or physical effort. Symptoms due to mediators released by activated MC may develop in adults suffering from systemic mastocytosis, but also evolve in children who usually have cutaneous mastocytosis (CM). Clinically, CM is otherwise characterized by typical brown, maculopapular skin lesions or mastocytoma associated with a positive Darier’s sign. Pruritus and flushing are common and blistering may also be recorded, especially in diffuse CM (DCM). Pediatric patients with mastocytosis may also have gastrointestinal, respiratory, and neurologic complaints. Although anaphylaxis is not a typical finding, pediatric patients with massive skin involvement and high tryptase levels have a relatively high risk to develop anaphylaxis. This paper reviews MC mediator-related symptoms and anaphylaxis in children with mastocytosis, with special emphasis on risk factors, triggers, and management.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Aging induces numerous physiological alterations, with immunosenescence emerging as a pivotal factor. This phenomenon has attracted both researchers and clinicians, prompting pro-found questions about its implications for health and disease. Among the contributing factors, one intriguing actor in this complex interplay is human cytomegalovirus (CMV), a member of the herpesvirus family. Latent CMV infection exerts a profound influence on the aging immune system, potentially contributing to age-related diseases. This review delves into the intricate relationship between immunosenescence and CMV, revealing how chronic viral infection im-pacts the aging immune landscape. We explore the mechanisms through which CMV can im-pact both the composition and functionality of immune cell populations and induce shifts in in-flammatory profiles with aging. Moreover, we examine potential role of CMV in such pathol-ogies as cardiovascular diseases, cancer, neurodegenerative disorders, COVID-19, and Long COVID. This review underlines the importance of understanding the complex interplay be-tween immunosenescence and CMV. It offers insights into the pathophysiology of aging and age-associated diseases, as well as COVID-19 outcomes among the elderly. By unraveling the connections between immunosenescence and CMV, we gain a deeper understanding of aging's remarkable journey and the profound role that viral infections play in transforming the human immune system.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

Exercise facilitates weight control, partly through effects on appetite regulation. Single bouts of exercise induce a short-term energy deficit without stimulating compensatory effects on appetite, whilst limited evidence suggests that exercise training may modify subjective and homeostatic mediators of appetite in directions associated with enhanced meal-induced satiety. However, large variability in responses exists between individuals. This article reviews the evidence relating to how adiposity, sex and habitual physical activity modulate exercise-induced appetite, energy intake and appetite-related hormone responses. The balance of evidence suggests that adiposity and sex do not modify appetite or energy intake responses to acute or chronic exercise interventions, but individuals with higher habitual physical activity levels may better adjust energy intake in response to energy balance perturbations. The effect of these individual characteristics and behaviours on appetite-related hormone responses to exercise remains equivocal. These findings support the continued promotion of exercise as a strategy for inducing short-term energy deficits irrespective of adiposity and sex, as well as the ability of exercise to positively influence energy balance over the longer term. Future well-controlled studies are required to further ascertain potential mediators of appetite responses to exercise.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Sleep-related eating disorder (SRED) is a non-REM parasomnia with potentially significant negative effects on general health (dangerous activities during night eating episodes, obesity, or metabolic syndrome, for example). Although the history of SRED encompasses more than six decades, public awareness and even the awareness of the mental health specialists of this disorder is very limited, a phenomenon that hinders the development of research in this field. Therefore, an updated review, based on a narrative methodology, explored the available evidence for SRED found in four electronic databases (PubMed, Cochrane Collaboration, Google Scholar, and Clarivate/Web of Science). A number of 94 primary and secondary reports were retrieved, investigating aspects regarding the risk factors, epidemiology, clinical data and differential diagnosis, epidemiology, structured evaluation, and treatment of SRED. Based on the results of these reports, Z-drugs, but also certain benzodiazepines, antidepressants, antipsychotics, and psychostimulants may trigger the onset of SRED. Psychiatric and neurologic disorders have also been associated with SRED, either as risk factors or comorbid conditions. Cerebral glucose metabolism dysfunctions, neurotransmitter dysfunctions, and genetic factors have been invoked as pathogenetic contributors. Structured assessment of SRED is possible, but there is a dearth of instruments dedicated to this purpose. Data on the prevalence and treatment of SRED exist, but good-quality epidemiological studies and clinical trials are still missing. In conclusion, future research is expected to address the shortcomings of SRED exploration by creating the conditions for better quality and larger group clinical research. The need for such investigation is granted by the importance of this pathology and its negative functional consequences.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The human polyamines spermine and spermidine are essential for cell function, and their properties have been extensively studied. However, research results of experiments conducted without understanding the properties of polyamines have been evaluated and published by reviewers who appear to have little knowledge of the properties of polyamines. It is sad that some studies repeat what was done more than half a century ago before polyamines were characterized. First, I explain the basic properties of polyamines that researchers need to know. Then, the relationship between changes in polyamine levels in the body and age- and lifestyle-related diseases is discussed. In addition, the epigenetic mechanism of action of polyamines in relation to healthy longevity and, conversely, age- and lifestyle-related diseases and the progression of senescence are discussed. Spermine, which increases with a polyamine-rich diet, acts to suppress aberrant gene methylation and proinflammatory status associated with aging. Meanwhile, chronic inflammation associated with aging induces the enzyme activity of spermine oxidase, which breaks down spermine and produces acrolein, resulting in reduced spermine levels. Acrolein, a toxic aldehyde that increases with age- and lifestyle-related diseases, is thought to accelerate these diseases.

We report the first correction by Prime editing of a mutation in the RYR1 gene, paving the way to gene therapies for RYR1-related myopathies. The RYR1 gene codes for a calcium channel named Ryanodine receptor 1, which is expressed in skeletal muscle fibers. The failure of this channel causes muscle weakness in patients, which degenerates into motor disabilities. Currently, there are no effective treatments for these diseases, which are mainly caused by point mutations. Prime editing allows the modification of precise nucleotides in the DNA. Our results showed a 59% correction rate of the T4709M mutation in the RYR1 gene in human myoblasts by RNA delivery of the Prime editing components. It is to be noted that the T4709M is recessive, and thus, persons having a heterozygous mutation are healthy. These results are the first demonstration that it is possible to correct mutations in the RYR1 gene.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Nebulized thrombolysis offers locally targeted therapy with potentially lower bleeding risk than systemic administration for coronavirus disease 2019 (COVID-19) respiratory failure. In a proof-of-concept safety study, adult patients with COVID-19-induced respiratory failure and a <300mmHg PaO2/FiO2 (P/F) ratio, requiring invasive mechanical ventilation (IMV) or non-invasive respiratory support (NIRS) received nebulized rt-PA in two cohorts (C1 and C2), alongside standard of care during the first two UK COVID-19 waves. Matched historical controls (MHC; n=18) were used in C1. Safety co-primary endpoints were treatment-related bleeds and fibrinogen reduction to <1.0–1.5 g/L. A dose escalation strategy for improved efficacy with the least safety concerns was determined in C1 for use in C2; patients were stratified by ventilation type to receive 40–60 mg rt-PA per day for ≤14 days. Nine patients in C1 (IMV, 6/9; NIRS, 3/9) and 26 in C2 (IMV, 12/26; NIRS, 14/26) received nebulized rt-PA for a mean (SD) of 6.7 (4.6) and 9.1(4.6) days, respectively. Four bleeding events (one severe and three mild) in three patients were considered treatment-related. No significant fibrinogen reductions were reported. Greater improvement in mean P/F ratio from baseline to end of study was observed in C1 compared with MHC [C1; 154 to 299 vs MHC; 154 to 212). In C2, there was no difference in the baseline P/F ratio of NIRS and IMV patients. However, a larger improvement in P/F ratio was observed in NIRS patients [NIRS; 126 to 240 vs IMV; 120 to 188) and they required fewer treatment days (NIRS; 7.86 vs IMV; 10.5). Nebulized rt-PA appears to be well-tolerated, showing a trend of improved oxygenation and faster recovery in patients with acute COVID-19-induced respiratory failure requiring respiratory support; this effect was more pronounced in the NIRS group. Further investigation is required to study the potential of this novel treatment approach.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Machine Learning (ML) approaches have been fruitfully applied to several classification problems of neurophysiological activity. Considering the relevance of emotion in human cognition and behaviour, ML found an important application field in emotion identification based on neurophysiological activity. Nonetheless, the literature results present a high variability depending on the neuronal activity measurement, the signal features and the classifier type. The present work aims to provide new methodological insight on ML applied to emotion identification based on electrophysiological brain activity. For this reason, we recorded EEG activity while emotional stimuli, high and low arousal (auditory and visual) were provided to a group of healthy participants. Our target signal to classify was the pre-stimulus onset brain activity. Classification performance of three different classifiers (LDA, SVM and kNN) was compared using both spectral and temporal features. Furthermore, we also contrasted the classifiers performance with static and dynamic (time evolving) features. The results show a clear increased in classification accuracy with temporal dynamic features. In particular, the SVM classifiers with temporal features showed the best accuracy (63.8 %) in classifying high vs. low arousal auditory stimuli.

The frequency of selected polymorphisms, one in each gene coding for proteins with antioxidative properties (CAT, SOD2, GPX1, NQO1) was compared between patients suffering from pain-related temporomandibular disorders (TMDp;n=85) and control subjects (CTR;n=85). According to the Oral Behaviours Checklist score participants were divided into high-frequency parafunction (HFP;n=98) and low-frequency parafunction (LFP;n=72) groups. In addition, we have investigated the association of selected polymorphisms with participants' psychological (anxiety, depression) and psychosomatic (hypervigilance, somatosensory amplification) characteristics. Polymorphisms rs1001179, rs4880, rs1050450, rs689452 were genotyped using the genomic DNA extracted from buccal mucosa swabs and real-time TaqMan genotyping assays. No differences in genotype distribution between TMDp patients and control subjects were found. Still, TMDp patients who were homozygous for minor allele A, related to the GPX1 polymorphism rs1050450 reported significantly more waking-state oral behaviours compared to GA+GG genotype carriers (score: 30 vs. 23, p=0.019). Frequency of genotype AA for rs1050450 polymorphism was higher in HFP compared to LFP participants (14.3% vs. 4.2%, p =0.030). Most important predictors of waking-state oral behaviours were depression, anxiety, AA genotype (rs1050450) and female sex. Explored genetic factors were not found to be significant risk factors for either TMDp or sleep-related oral behaviours. The association of waking-state oral behaviours with selected gene polymorphisms additionally supports previous assumptions that the daytime bruxism is more closely linked to various stress manifestations, which might also be reflected through the variability related to cellular antioxidative activity.

Age-related macular degeneration (AMD) is an eye disease and the most common cause of vision loss in the Western World. In its advanced stage, AMD occurs in two clinically distinguished forms: dry and wet, but only wet AMD is treatable. However, the treatment based on repeated injections with vascular endothelial growth factor A (VEGFA) antagonists may at best stop the disease progression and prevent or delay vision loss but without an improvement of visual dysfunction. Moreover, it is a serious mental and financial burden for patients and may be linked with some complications. The recent first success of intravitreal gene therapy with ADVM-022, which transformed retinal cells to continuous production of aflibercept, a VEGF antagonist, after a single injection, has opened a revolutionary perspective in wet AMD treatment. Promising results obtained so far in other ongoing clinical trials support this perspective. In this narrative/hypothesis review, we present basic information on wet AMD pathogenesis and treatment, the idea of gene therapy in retinal diseases, update evidence on completed and ongoing clinical trials with gene therapy for wet AMD, and perspectives on the road to the clinic of “one and done” therapy for wet AMD to replace a lifetime of injections. Gene editing targeting the VEGFA gene is also presented as another gene therapy strategy to improve wet AMD management.

The concept of ecosystem services (ESs) provides a valuable approach to communicate societies' dependence on natural ecosystems, assisting in the evaluation of measures to protect vegetation in watersheds that promote water-related ESs. Vegetation cover and land use are important factors related to the capacity of ecosystems to provide soil loss regulation and sediment retention services, which are highly relevant for sediment management in watersheds draining into reservoirs with multiple water uses. This study aims to assess the relationship between potential changes in land use and land cover and the sediment retention service provided by riparian vegetation in a watershed draining into a hydroelectric reservoir in the Brazilian Cerrado. Sediment load was selected as a physical variable that affects different water uses in reservoirs, with these uses being dependent on the quality or quantity of stored water. Scenarios were analyzed to represent landscape reconfigurations from a baseline condition in order to account for the recovery of riparian vegetation by the agricultural sector, as foreseen in the Brazilian Forest Code. To map and quantify variations in annual sediment retention, the InVEST model was used, which allows estimating an integrated response of the drainage basin to large-scale land use changes over time and space. The results show that for the drainage basin of the Corumbá IV Hydroelectric Power Plant (HPP), the recovery of riparian areas occupied by annual crops has the potential to generate greater benefits to water use in the reservoir. In the studied catchment area, 14% of the total vegetation deficit in riparian areas is occupied by crops, while 86% is occupied by pastures. This highlights the buffering role of riparian vegetation as an effective practice for managing sediment flows originating from sheet erosion in agricultural landscapes. The methodology employed in this study allows for the quantification and mapping of the effects of soil and water conservation measures in river basins. This enables the prioritization of sectoral efforts for the restoration of native vegetation, considering the highest returns in benefits perceived by water users affected by sediment input in reservoirs. The study's results reinforce the importance of conserving vegetation in riparian areas and their surroundings for sediment retention, highlighting the role of these areas as assets in providing water-related ecosystem services.

The objective of this study was aimed to study the sensory processes of the “human-computer interaction” model when classifying visual images with an incomplete set of signs based on the analysis of early, middle, late and slow components of event-related potentials (ERPs). 26 healthy subjects (men) aged 20-22 years were investigated. ERPs in 19 monopolar sites according to the 10/20 system were recorded. Discriminant and factor analysis were applied. The component N450 is the most specialized indicator of the perception of unrecognizable (oddball) visual images. The amplitude of the ultra-late components N750 and N900 is also higher under conditions of presentation of the oddball image, regardless of the location of the registration points. The results of the study are discussed in the light of the paradigm of the P300 wave application in brain-computer interface systems, as well as with the peculiarities in brain pathology. Promising directions for the development of studies of the “Brain Computer Interface” (BCI) P300 systems are to increase the throughput of information flows. To extend the application of the P300 ERPs to multiple modalities, the underlying physiological mechanisms and responses of the brain for a particular sensory system and mental function must be carefully examined.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Introduction: The primary objective of researchers in the biology of ageing is to gain a comprehensive understanding of the ageing process while developing practical solutions that can enhance the quality of life for older individuals. This involves a continuous effort to bridge the gap between fundamental biological research and its real-world applications. Purpose: In this narrative review, we attempt to link research findings concerning the hormetic relationship between neurons and germ cells, and translate these findings into clinically relevant concepts. Methods: We conducted a literature search using PubMed, Embase, PLOS, Digital Commons Network, Google Scholar and Cochrane Library from 2000 to 2023, analyzing studies dealing with the relationship between hormetic, cognitive, and reproductive aspects of human ageing. Results: The process of hormesis serves as a bridge between the biology of neuron-germ cell interactions on one hand, and the clinical relevance of these interactions on the other. Details concerning these processes are discussed here, emphasizing new research which strengthens the overall concept. Conclusions: This review presents a scientifically and clinically relevant argument, claiming that maintaining a cognitively active lifestyle may decrease age-related degeneration, and improve overall health in ageing.

Lipofuscin accumulates with age as intracellular fluorescent granules originating from incomplete lysosomal digestion of phagocytosed and autophagocytosed material. The purpose of this review is to provide an update on the current understanding of the role of oxidative stress and/or lysosomal dysfunction in lipofuscin accumulation and its consequences, particularly for retinal pigment epithelium (RPE). Next, the fluorescence of lipofuscin, spectral changes induced by oxidation, and its contribution to retinal fluorescence are discussed. This is followed by reviewing recent developments in fluorescence imaging of the retina, and the current evidence on the prognostic value of retinal fluorescence for the progression of age-related macular degeneration (AMD), the major blinding disease affecting elderly people in developed countries. The evidence of lipofuscin oxidation in vivo, and the evidence of increased oxidative damage in AMD retina ex vivo lead to the conclusion that imaging of spectral characteristics of lipofuscin fluorescence may serve as a useful biomarker of oxidative damage which can be helpful in assessing the efficacy of potential antioxidant therapies in retinal degenerations associated with accumulation of lipofuscin and increased oxidative stress. Finally, amendments to currently used fluorescence imaging instruments are suggested, to be more sensitive and specific for imaging spectral char-acteristics of lipofuscin fluorescence.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

A practical method is presented to estimate rare earth elements (REE) concentrations in magmatic vapour phase (MVP) in equilibrium with water-saturated granitic melts based on empirical fluid-melt partition coefficients of REE (k_P^REE). The values of k_P^REEcan be calculated from a set of new polynomial equations linking to the chlorine molality (m_Cl^v) of the MVP associated with granitic melts, which are established via a statistical analysis on the existing experimental dataset. These equations may be applied to the entire pressure range (0.1 to 10.0 kb) within the continental crust, suggesting that light REEs behave differently in magmatic fluids, i.e. either being fluid compatible with higher m_Cl^v or fluid incompatible with lower m_Cl^v values. In contrast, heavy REEs are exclusively fluid incompatible and partition favourably into granitic melts. Consequently, magmatic fluids tend to be rich in LREE relative to HREE, leading to REE fractionation during the evolution of magmatic hydrothermal systems. Maximum k_P^REEvalue for each element is predicted and presented in a REE distribution diagram constrained by the threshold of m_Cl^v. REE contents of the granitic melt is approximated by whole-rock analysis, so that REE concentrations in the associated MVP would be estimated from the value of k_P^REE given chemical equilibrium retains. Two examples are provided respectively, to show the use of this method as a REE tracer to fingerprint the source of ore-fluids responsible for the Lake George intrusion-related Au-Sb deposit in New Brunswick (Canada), and for the Bakircay Cu-Au (-Mo) porphyry systems in northern Turkey.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

Age-related macular degeneration (AMD) is a common ocular disease characterized by the de-generation of the central area of the retina in elderly population. Progression and response to treatment is influenced by genetic and non-genetic factors. Proteomics is a powerful tool to study, at the molecular level, the mechanisms underlaying the progression of the diseases, to identify new therapeutical targets and to establish biomarkers to monitor progression and treatment ef-fectiveness. In this work we pursue to systematically review the use of proteomic-based ap-proaches for the study of the molecular mechanisms underlying the development of AMD, as well as the progression of the disease and the on-treatment patient monitoring. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) reporting guidelines were followed. Proteomic approaches have identified key players on the onset of the disease, such as proteins involved in lipid metabolism and oxidative stress, but also in the progression to advanced stages, including factors related to extracellular matrix integrity and angiogenesis. Although an-ti-vascular endothelial growth factor (anti-VEGF)-based therapy has been crucial in the treatment of neovascular AMD it is necessary to get deeper into the underlying disease mechanisms to move forward to next-generation therapies of the later-stage forms of this multifactorial disease.

Music and language are hypothesized to share neural resources, particularly at the level of syntax processing. Recent reports suggest that attention modulates this sharing of neural resources, but the time-course of the effects of attention, and the degree to which attention operates similarly on music and language, are yet unclear. In this EEG study we manipulate the syntactic structure of simultaneously presented musical chord progressions and garden-path sentences in a modified rapid serial visual presentation paradigm, while varying top-down attentional demands to the two modalities. The Early Right Anterior Negativity (ERAN) was observed in response to both attended and unattended musical syntax violations. In contrast, an N400 was only observed in response to attended linguistic syntax violations, and a P3 only in response to attended musical syntax violations. Results show that top-down allocation of attention indeed affects the processing of syntax in both music and language, with different neural resources acting upon the two modalities particularly at later stages of cognitive processing. However, the processing of musical syntax at an earlier stage of the perceptual-cognitive pathway, as indexed by the ERAN, is partially automatic, and is strongly indicative of separate neural resources for music and language.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Age-related macular degeneration (AMD) is a complex multifactorial disease and the primary cause of legal and irreversible blindness among individuals aged >=65 years in developed countries. Globally, it affects 30-50 million individuals, with an estimated increase of approximately 200 million by 2020 and approximately 300 million by 2040. Currently, the neovascular form may be able to be treated with the use of anti-VEGF drugs, while no effective treatments are available for the dry form. Many observational studies, such as AREDS-1 and AREDS 2, have shown a potential role of micronutrient supplementation in lowering the risk of progression of the early stages of AMD. Recently, low-grade inflammation, sustained by dysbiosis and a leaky gut, has been shown to contribute to the development of AMD. Given the ascertained influence of the gut microbiota in systemic low-grade inflammation and its potential modulation by macro- and micro-nutrients, a potential role of diet in AMD has been proposed. This review discusses the role of the gut microbiota in the development of AMD. Using PubMed, Web of Science and Scopus, we searched for recent scientific evidence discussing the impact of dietary habits (high fat and high glucose or fructose diets), micronutrients (vitamins C, E, and D, zinc, beta-carotene, lutein and zeaxanthin) and omega-3 fatty acids on the modulation of the gut microbiota and their relationship with AMD risk and progression.

Healthy life style is associated with decreased risk of chronic kidney disease (CKD) and mortality in the general population. However, there is no definitive evidence on the benefits of physical activity and other health-related behaviors in the early-stage CKD. This study aimed to explore the association between health-related behaviors and end-stage renal disease (ESRD) and mortality in the early stages of CKD. The National Health Insurance Service (NHIS) database from January 1st, 2009 to December 31st, 2016 was used to screen 83,470 subjects with early stage CKD. Cox proportional hazard regression analysis was used to evaluate the association between health-related behaviors and ESRD and death. Kaplan-Meier curves for mortality and ESRD were plotted according to the physical activity, smoking status and alcohol consumption pattern. Risk of death decreased significantly in subjects who engaged in sufficient physical activity (adjusted Hazard Ratio (HR) 0.73; 95% CI: 0.64-0.83; p < 0.001). Risk of ESRD and death increased significantly in the current smoker with adjusted HR of 1.44 (95% CI: 1.06-1.95; p < 0.02) and 1.61 (95% CI: 1.44-1.80; p < 0.001) respectively. Therefore, systematic interventions to encourage physical activity and smoking cessation need to be actively considered in the early stages of CKD.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Chronic degeneration of the Retinal Pigment Epithelium (RPE) is a precursor to pathological changes in the outer retina. The RPE monolayer, which lies beneath the neuroretina, daily internalises and digests large volumes of spent photoreceptor outer segments. Impaired cargo handling and processing in the endocytic/phagosome and autophagy pathways leads to the accumulation of lipofuscin and N-retinylidene-N-retinylethanolamine aggregates and chemically-modified compounds such as malondialdehyde and 4-hydroxynonenal within RPE. These contribute to increased proteolytic and oxidative stress, resulting in irreversible damage to post-mitotic RPE cells and development of blinding conditions such as Age-related Macular Degeneration, Stargardt disease and Choroideremia. Here, we review how impaired cargo handling in the RPE results in their dysfunction, discuss new findings from our laboratory and consider how newly discovered roles for lysosomes and the autophagy pathway could provide insights into retinopathies. Studies of these dynamic, molecular events have also been spurred on by recent advances in optics and imaging technology. Mechanisms underpinning lysosomal impairment in other degenerative conditions including storage disorders, a-synuclein pathologies and Alzheimer’s disease are also discussed. Collectively, these findings help transcend conventional understanding of these intracellular compartments as simple waste disposal bags to bring about a paradigm shift in the way lysosomes are perceived.

Malaria is one of the leading causes of illnesses and deaths in Africa at large and Nigeria in particular, especially amongst pregnant women and children under the age of five years. Our research revealed that though the government has deployed so many intervention systems to contend with this death-causing vector—the mosquitoes, malaria related deaths (MRDs) have continued to increase. This is because people have not sufficiently adopted those intervention systems to protect themselves. Further enquiries into the ineffective compliance of the people to the intervention systems revealed that the interventions are passive in nature. Based on these, we set up three measurable research outcomes to enable us to determine the appropriateness of persuasive technology in solving the malaria problem. We technically avoided a one-size-fits-all design approach and adopted Participatory System Design (PSD) and User-Centered Design (UCD) approaches in our system design methodologies. Well-structured questionnaires were used to extract information from the participants. The data obtained from the research survey was used in modeling the intervention system. The research was conducted in three phases: baseline, development and deployment of an intervention system—the Malaria Prevention and Control Support System (MPCSS), and an evaluation study to determine the performance of the intervention system. The research led to the following achievements: (1) encouraged an increase in the number of people who participated in malaria prevention and control activities by lowering the rate of malaria cases from 96.9% to 68.5% and increasing ownership of mosquito nets from 54% to 85.5%; (2) demonstrated that persuasive technology could be used to increase public awareness and knowledge of a given subject as noted in our evaluation result; and (3) demonstrated that persuasive technology is a veritable active intervention to combat malaria.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Building on the job demands-resources (JD-R) and the allostatic load (AL) models, in this study we investigated the role of smart working (SW) in the longitudinal association between workload/job autonomy (JA) and a possible biomarker of work-related stress (WRS) in the hair, namely the cortisol to dehydroepiandrosterone sulphate (DHEA(S)) ratio, during the COVID-19 pandemic. Overall, 124 workers completed a self-report questionnaire (i.e., psychological data) at Time 1 (T1) and collected a strand of hair (i.e., biological data) three months later (Time 2, T2). Results from moderated multiple regression analysis showed that smart working at T1 was negatively associated with hair cortisol/DHEA(S) ratio at T2. Additionally, the interaction between workload and SW was significant, with workload at T1 being positively associated with hair cortisol/DHEA(S) ratio at T2 among smart workers. Overall, this study indicates that SW can be conceived as a double-edged sword, with both positive and negative consequences on employee well-being. Furthermore, our findings suggest that hair cortisol/DHEA(S) ratio is a promising biomarker of WRS. Practical implications that organizations and practitioners can adopt to promote organizational well-being are discussed.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Treatment with the anti-CGRP antibody fremanezumab is successful in the prevention of chronic migraine. In preclinical rat experiments, fremanezumab has been shown to reduce calcitonin gene-related peptide (CGRP) release from trigeminal tissues and the aversive behaviour to noxious facial stimuli, which are characteristic pathophysiological changes accompanying severe primary headaches. To further decipher the effects of fremanezumab underlying these antinociceptive effects in rats, immunohistochemistry and ELISA techniques were used to analyse the content and concentration of CGRP in the trigeminal ganglion as well as the ratio of trigeminal ganglion neurons immunoreactive to CGRP and CGRP receptor components 1-10 days after subcutaneous injection of fremanezumab (30 mg/kg) compared to an isotype control antibody. After fremanezumab treatment, the fraction of trigeminal ganglion neurons immunoreactive to CGRP and the CGRP receptor components calcitonin receptor-like receptor (CLR) and receptor activity modifying protein 1 (RAMP1) was significantly lowered compared to the control. The content and concentration of CGRP in trigeminal ganglia were not significantly changed. A long-lasting reduction of CGRP receptors expressed in trigeminal afferents may contribute to the attenuation of CGRP signalling and antinociceptive effects of monoclonal anti-CGRP antibodies in rats.

Device-mediated, non-invasive drug delivery across the blood-brain barrier (BBB) represents a significant advancement in treating neurological diseases. The BBB is a tightly packed layer of endothelial cells that shields the brain from harmful substances in the blood, allowing necessary nutrients to pass through. It is a highly selective barrier, which poses a challenge to delivering therapeutic agents into the brain. Several non-invasive techniques and devices have been proposed or investigated to enhance drug delivery across the BBB. This paper presents the current state of the art and case studies that address the pharmacology, technology, delivery systems, regulatory approval, ethical concerns, and future possibilities.

Climate change related increases in frequency and intensity of heatwaves affect viticulture, leading to losses in yield and grape quality. We assessed whether canopy architecture manipulation mitigates the effects of summer stress in a Mediterranean vineyard. Muscat of Alexandria grapevines were monitored during 2019-2020. Two canopy shoot positioning treatments were applied: Vertical shoot positioning (VSP); and Modulated shoot positioning (MSP), the west side upper foliage released to promote partial shoot leaning, shading the clusters. Clusters were sampled at pea size (PS), veraison (VER) and full maturation (FM). Measurements included rachis anatomy and hydraulic conductance, and aquaporins (AQP) and stress-related genes expression in cluster tissues. Results show significant seasonal and interannual differences in Kh and vascular anatomy. At VER, Krachis , Krachis+pedicels, and xylem diameter decreased but were unaffected by treatments. The Phloem/Xylem ratio was either increased (2019) or reduced (2020) in MSP, compared to VSP. Most AQP were down-regulated at FM in pedicels, and up-regulated at VER in pulp. A potential maturation shift in MSP was observed, confirmed by the up-regulation of several stress-related genes in all tissues. The study pinpoints the role of canopy architecture in berry water relations and stress response during ripening.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

Background: The link between nocturia and aging male symptoms (AMS) has not been scientifically established. This study aimed to measure the degree of severity of AMS that impact on the health-related quality-of-life (HRQoL) in adult males living with nocturia, and to determine the predictive values of nocturnal factors on AMS. Methods: It is an extended analysis of new data collected by using the Hong Kong Traditional AMS (HK-AMS) scale and Cantonese version of the Pittsburgh Sleep Quality Index (PSQI) in a recently published cross-sectional population-based survey. Results: Of the 781 respondents that have completed the set of questionnaires, 68% and 61% of men living with nocturia reported clinically significant (at moderate-to-severe levels) somato-vegetative and sexual AMS, whereas the prevalence and severity were increased with advancing nighttime voiding frequency. The nocturia-specific QoL (NQoL) score and nocturnal frequency were found to be significant predictive factors for composite, somato-vegetative and sexual AMS, in addition to age, global OSQI score, and certain metabolic diseases. Conclusions: Current findings suggested the inclusion of nocturia when measuring the male-specific HRQoL related to aging.

Introduction Headache is a common public health problem, but its burden could be avoided by raising headache awareness and the appropriate use of acute medication and prophylactic medication. Few reports on raising headache awareness in the general public have been reported, and there are no reports on headache awareness campaigns through social networking services (SNS), or social media, in Japan. We prospectively performed a headache awareness campaign from March 2022 through 2 SNS, targeting nurse and wind instrumental musicians, because they are with high headache prevalence. Methods Through the 2 SNS, the article and video were distributed, respectively. The article and video described the 6 important topics for the general public about headaches, which were described in the Clinical Practice Guideline for Headache Disorders 2021. Just after reading or watching them as e-learning, we performed online questionnaire sheets to investigate the awareness of the 6 topics through the 2 SNS. The awareness of the 6 topics before and after the campaign was evaluated. Results In the SNS nurse-senka, we obtained 1191 responses. Women comprised 94.4%, and the median (range) age was 45 (20 to 71) years old. Headache sufferers were 63.8%, but only 35.1% had consulted doctors. In the SNS Creatone, we got the response from 134 professional musicians, with 77.3% of women. The largest number of respondents were in their 20s (range 18-60 years old). Headache sufferers were 87.9%. Of them, 36.4% had consulted doctors, 24.2% were medication-overuse headache. The ratios of individuals who were aware of the 6 topics significantly increased from 15.2%-47.0% to 80.4-98.7% after the online questionnaire in both SNS (p < 0.001, all). Conclusions We conducted this headache awareness campaign through e-learning and an online survey via 2 SNS. The ratios of individuals who were aware of the 6 topics about headaches significantly increased 1 month after e-learning. Our results suggest that e-learning and online survey can improve headache awareness. The materials in this campaign can be installed into smartphone applications and further spread on SNS, leading to strong influence. With rapid digital transformations such as online telemedicine and artificial intelligence diagnosis, raising awareness will be more efficient and effective and should be important.

A high proportion of dogs and cats are fearful during veterinary visits, which in some cases may escalate into aggression. Here, we discuss factors that contribute to negative emotions in a veterinary setting and how these can be addressed. The set-up of the waiting area (e.g. spatial dividers; elevated places for cat carriers), tailoring the examination and the treatment to the individual, considerate handling (minimal restraint when possible, avoiding leaning over or cornering animals) and offering high-value food or toys throughout the visit can promote security and, ideally, positive associations. Desensitisation and counterconditioning are highly recommended both to prevent and address existing negative emotions. Some negative experiences such as short-term pain from injections can be minimised by using tactile and cognitive distractions. Preemptive analgesia is recommended for known painful procedures. Recommendations for handling fearful animals to minimise aggressive responses are discussed. However, anxiolytics or sedation should be used whenever there is a risk of traumatising an animal or for safety reasons. Stress-reducing measures can decrease stress and fear in patients and consequently their owners – thus strengthening the relationship with the clients as well as increasing the professional satisfaction of veterinary staff.

High-grade gliomas are extremely fatal tumors, marked by severe hypoxia and therapeutic resistance. Autophagy is a cellular degradative process that can be activated by hypoxia, ultimately resulting in tumor advancement and chemo-resistance. Our study aimed to examine the link between autophagy markers expression in low (LGG) and high-grade gliomas (HGG). In 39 glioma cases, we assessed protein expression of autophagy markers LC3B, p62, and DRAM by immunohistochemistry (IHC) and mRNA expression of autophagy genes; PI3K, AKT, m-TOR, PTEN, ULK1, ULK2, UVRAG, Beclin 1 and VPS34 using RT-qPCR. Livak’s method was used to analyze the relative changes in gene expression and multi-variate Anova test and Spearman's correlation tests were performed for statistical significance. LC3B, p62, and DRAM expression were positive in 64.1%, 51.3%, and 28.2% of glioma cases respectively. The expression of LC3B and p62 was notably higher in HGG compared to LGG. VPS34 exhibited a significant differential expression and increased fold change and demonstrated strong positive correlations with Beclin1 (rs=0.768), UVRAG (rs=0.802), and ULK2 (rs=0.786) in HGG compared to LGG, thus highlighting the potential link between autophagy and glioma progression. We Provide preliminary data for functional analysis of autophagy using cell culture model and to identify potential targets for therapeutic interventions

Amphetamine is a psychostimulant drug with a high risk of toxicity and death when misused. Abuse of amphetamines is associated with an altered organic profile, which includes omega fatty acids. Low omega fatty acid levels are linked to mental disorders. Using the Comparative Toxicogenomic Database (CTD), we investigated the chemical profile of the brain in amphetamine-related fatalities and the possibility of neurotoxicity. We classified amphetamine cases as low (0-0.5 g/ml), medium (&gt;0.5 to 1.5 g/ml), and high (&gt;1.5 g/ml) based on amphetamine levels in brain samples. All three groups shared 1-octadecene, 1-tridecene, 2,4-di-tert-butylphenol, arachidonic acid, docosahexaenoic acid (DHA), eicosane, and oleylamide. We identified chemical-disease associations using the CTD tools and predict an association between docosahexaenoic and arachidonic acids and curated conditions like autistic disorder, disorders related to cocaine, Alzheimer's disease, and cognitive dysfunction. An amphetamine challenge may cause neurotoxicity in the human brain due to a decrease in omega-3 fatty acids and an increase in oxidative products. Therefore, in cases of amphetamine toxicity, supplement therapy may necessitate preventing omega-3 fatty acid deficiency.

C-reactive protein (CRP) and leukocytes are blood biomarkers involved in "Inflamm-Aging", which is a risk factor for the onset and progression of age-related diseases. Studies show that higher serum concentrations of these biomarkers are associated with functional disability, increased risk of low muscle strength, decreased muscle mass and mortality in the elderly. The objective was to estimate the predictive power and discriminating criteria of C-reactive protein and leukocyte concentrations for the risk of adverse health factors in the elderly within 30 days after hospital discharge (HD). Prospective cohort study using exploratory methods and blood biomarkers with 135 older adults admitted to medical and surgical clinics at a government hospital. The elderly were monitored at home after 30 days of HD for adverse health factors (rehospitalization, falls, amount of medication consumed, disability in basic and instrumental activities of daily living and mortality). CRP> 2.4; ≥ 0.7 and> 24.7 mg / dL and leukocytes ≥ 6.410; ≥ 8.690 and> 8.310 mm³ were discriminant for rehospitalization, falls and mortality within 30 days after HD, respectively. The cut-off points described may be used as a reference in the screening of hospitalized elderly vulnerable to adverse health events after hospital discharge.

Neuronal lesion or injury is a traditional approach to investigate neural circuit. Is any new neural pathway or new neurodegeneration related central nerve system injury? Spinal disc herniation can cause the spinal cord injury. However, the histological examination is still lack. It happened that a case of spinal disc herniation of a 10-year old dog was examined with NADPH diaphorase (N-d) histology. We did not find the N-d neurodegenerative aberrant in the tissue of the mid-rostral lumber segment besides the metamorphoses by the compression of the disc herniation. However, the severe neuropathological changes majorly occurred in the lumbosacral spinal cord. We found more diverse neurodegenerative alterations: the aging-related N-d body (ANB), megaloneurite and N-d homogeneous formazan globule in the lumbosacral spinal cord. We also found that a new circuit pathway (intermedial collateral pathway) showed by a megaloneurite between the lateral collateral pathway and the medial collateral pathway. The enormous notch caused by spinal disc herniation located at the mid-rostral lumber segments. The aging-related neurodegeneration occurred the specific lumbosacral segments. The homogeneous formazan globule was round or oval homogeneous N-d positivity which distributed in the gray matter and dorsal column. In the medulla oblongata, ANBs were revealed in the gracile nucleus, nucleus reticularis lateralis (ventrolateral spinal trigeminal nucleus) and middle of the spinal trigeminal nucleus.

Age-related Macular Degeneration (AMD) is the major cause of elders’ vision loss, early screening and treatment are the most efficient way to reduce the rate of blindness. AI-based methods based on ophthalmic images play great potential for AMD diagnosis. However, low levels of accuracy, robustness, and explainability are challenges for AI approaches applied in clinics. Thus, this study proposed a multi-type of data source fusion method and a multi-model fusion approach for AMD detection. Typical unsupervised (Hierarchical Clustering and K-Means), typical supervised (SVM, VGG-16, and ResNet) methods, and proposed methods (multi-source data fusion-based method and multi-model fusion-based approach) are compared based on Optical Coherence Tomography (OCT), Fundus Autofluorescence (FAF), regular color fundus photography (CFP) and Ultra-Wide field Fundus (UWF) images. Data preprocessing and enhancements of each type of data are discussed. A feature extraction based on unsupervised ML models, feature combination and normalization, and multi-layer perception (MLP) algorithm are involved in the proposed multi-source data fusion-based method. Supervised ML and DL models and a voting mechanism are involved in the multi-model fusion-based approach. Findings show that the proposed methods present a high performance of accuracy and robustness. A real-world UWF database is involved from Shenzhen Aier Hospital. Practical and theoretical contributions are delivered. A reference value for medical diagnosis based on multiple digital images is contributed.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Age-related macular degeneration (AMD) causes visual impairment in individuals >50 years of age. However, no study has investigated AMD using ultra-wide-field swept-source optical co-herence tomography (UWF SS-OCT). We aimed to evaluate central and peripheral choroidal thickness using UWF SS-OCT and compare AMD subtypes. We included 75 eyes of patients with typical AMD (tAMD), 56 with polypoidal choroidal vasculopathy (PCV), 29 with pachychoroid neovasculopathy (PNV), and 12 with retinal angiomatous proliferation (RAP). To compare cho-roidal thicknesses in the central and peripheral choroids, we established subfields of <3 mm, <9 mm, and 9–18 mm from the fovea. PNV patients were significantly younger than those with tAMD (P=0.01). The choroidal thicknesses of PNV were significantly greater than that of tAMD in all subfields (P<0.01) and choroidal thickness significantly correlated with age and axial length in all subfields (P<0.05). Even after adjusting for age and axial length, the choroidal thickness in PNV was significantly greater than that in tAMD (P<0.05). In addition, the ratio of the posterior < 9 mm to peripheral 9–18 mm choroidal thickness in PNV was significantly greater than that in tAMD (P<0.01). A thickened choroid in PNV was more pronounced in the posterior choroid than in the periphery.

Tightly regulated and robust mitochondrial activities are critical for normal hearing. Previously, we demonstrated that Fus1 KO mice with mitochondrial dysfunction exhibit premature hearing loss. Molecular analysis of the cochlea revealed hyperactivation of the mTOR pathway, oxidative stress, altered mitochondrial morphology and quantity, suggesting compromised energy sensing and production. Here, we investigated whether pharmacological modulation of metabolic pathways using rapamycin (RAPA) or 2-deoxy-D-glucose (2-DG) supplementation can protect against hearing loss in female Fus1 KO mice. Additionally, we aimed to identify mitochondria- and Fus1-dependent molecular pathways and processes critical for hearing. We found that inhibiting mTOR or activating alternative mitochondrial energetic pathways to glycolysis protected hearing in the mice. Comparative gene expression analysis revealed dysregulation of critical biological processes in the KO cochlea, including mitochondrial metabolism, neural and immune responses, and cochlear hypothalamic–pituitary–adrenal axis signaling system. RAPA and 2-DG mostly normalized these processes, although some genes showed a drug-specific response or no response at all. Interestingly, both drugs resulted in a pronounced upregulation of critical hearing-related genes not altered in the non-treated KO cochlea, including cytoskeletal and motor proteins, and Ca2+-linked transporters and voltage-gated channels. These findings suggest that pharmacological modulation of mitochondrial metabolism and bioenergetics may restore and activate processes critical for hearing, thereby protecting against hearing loss

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

The Japanese Association for Acute Medicine Committee recently proposed a novel classification system for the severity of heat-related illnesses. The illnesses are simply classified into three stages based on symptoms and management or treatment. Stages I, II, and III broadly correspond to heat cramp and syncope, heat exhaustion, and heat stroke, respectively. Our objective was to examine whether this novel severity classification is useful in the diagnosis by healthcare professionals of patients with severe heat-related illness and organ failure. A nationwide surveillance study of heat-related illnesses was conducted between June 1 and September 30, 2012, at emergency departments in Japan. Among the 2130 patients who attended 102 emergency departments, the severity of their heat-related illness was recorded for 1799 patients, who were included in this study. In the patients with heat cramp and syncope or heat exhaustion (but not heat stroke), the blood test data (alanine aminotransferase, creatinine, blood urea nitrogen, and platelet counts) for those classified as stage III were significantly higher than those of patients classified as stage I or II. There were no deaths among the patients classified as stage I. This novel classification may avoid underestimating the severity of heat-related illness.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Healthcare workers' stress, burnout, and job dissatisfaction were exacerbated by the Covid-19 pandemic, whose mid-term negative effects are still present. The aim of this study was to investigate in healthcare workers the effect of the dimensions of burnout (Psychophysical exhaustion, Relational deterioration, and Professional inefficacy) on Career satisfaction. These relationships were evaluated by considering the direct and mediated effects of Disillusion. For these purposes, the Link Burnout Questionnaire (LBQ) and the Career Satisfaction Scale (Occupational Stress Indicator - OSI) were administered to 295 healthcare professionals working at three Italian public hospitals in Cagliari, Italy. The analyses were conducted using the Partial Least Square Structural Equation Model (PLS-SEM) method. Findings highlight that healthcare workers were in a condition of work distress, high risk of burnout, and career dissatisfaction. Also recognized was the direct negative effect of burnout dimensions on career satisfaction. Finally, the mediated negative effect of Disillusion in the relationship between burnout and career satisfaction was identified. This study emphasizes the relevance of the dimension of Disillusion, and its “bright side” Fulfilment, in healthcare workers, specifically referring to the disregarded relationship between burnout and career satisfaction.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Background: Appendicular skeletal muscle (or lean) mass (ALM) estimated using dual-energy X-ray absorptiometry (DXA) is considered to be a preferred method for sarcopenia studies. However, DXA is expensive, has limited portability, and requires radiation exposure. Bioelectrical impedance analysis (BIA) is inexpensive, easy to use, and portable; thus BIA might be useful in sarcopenia investigations. However, a large variety of models have been commercially supplied by different companies, and for most consumer products, the equations estimating ALM are not disclosed. It is therefore difficult to use these equations for research purposes. In particular, the BIA equation is often age-dependent, which leads to fundamental difficulty in examining age-related ALM loss. The aims of the current study were as follows: (1) to develop and validate an equation to estimate ALM using multi-frequency BIA (MF-BIA) based on theoretical models, and (2) to establish sarcopenia cutoff values using the equation for the Japanese population. Methods: We measured height (Ht), weight, and ALM obtained using DXA and a standing-posture 8-electrode MF-BIA (5, 50, 250 kHz) in 756 Japanese individuals aged 18 to 86-years-old (222 men and 301 women as developing equation group and 97 men and 136 women as a cross validation group). The traditional impedance index (Ht²/Z₅₀) and impedance ratio of high and low frequency (Z₂₅₀/Z₅) of hand to foot values were calculated. Multiple regression analyses were conducted with ALM as dependent variable in men and women separately. Results: We created the following equations: ALM = (0.6947 × (Ht²/Z₅₀)) + (−55.24 × (Z₂₅₀/Z₅)) + (−10,940 × (1/Z₅₀)) + 51.33 for men, and ALM = (0.6144 × (Ht²/Z₅₀)) + (−36.61 × (Z₂₅₀/Z₅)) + (−9332 × (1/Z₅₀)) + 37.91 for women. Additionally, we conducted measurements in 1624 men and 1368 women aged 18 to 40 years to establish sarcopenia cutoff values in the Japanese population. The mean values minus 2 standard deviations of the skeletal muscle mass index (ALM/Ht²) in these participants were 6.8 and 5.7 kg/m² in men and women, respectively. Conclusion: The current study established and validated a theoretical and age-independent equation using MF-BIA to estimate ALM and provided reasonable sarcopenia cutoff values.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

We take what we see, hear, smell and feel for the reality. However, as neuroscientists, we know that this reality, that is, our perceptual world, is in fact made up by the brain from the processing of the nerve impulses coming from receptors. Ancient Greeks used to think that this perceptual world, sometimes called our 3D movie (Chalmers), is emitted and has its own physical nature. Given how real the 3D movie looks to us, it is still difficult today to consider that all we would be dealing with would be patterns of brain activity The present study thus aimed at testing whether the perceptual world could have some physical existence in addition to that of the neural patterns responsible for it. To achieve that goal, we tried to see whether brains could be sensitive to the 3D movie of others. This, admittedly unusual, operational hypothesis was based on two assumptions. First, brains are sensitive to the 3D movie, as our experience includes reactions to our perceptual world. Second, the physicality at stake does not differ across individuals. We recorded the event-related brain potentials (ERPs) evoked by stimuli of the international affective picture system in pairs of closely-related participants. Most importantly, they could neither see the stimuli simultaneously presented to their partners nor their reactions to them. As in Bouten et al. (2015), around 400 ms after the onset of the stimuli, ERPs started being more positive in inconsistent conditions. Namely, when the two subjects of each pair were presented with the same stimulus whereas they were told it would be a different one and vice-versa (i.e., different-stimuli expected to be same). ERPs were less positive when the two subjects of a pair were presented with the same stimuli and were told they were the same and conversely (i.e., different-stimuli expected to be different). The same experiment was then run in pairs of strangers. No significant effect of consistency on ERPs was observed even though participants could, this time, see, in the very periphery of their visual field, the reactions of their partner to the stimuli. We thus use the results of both studies to support a new version of the emission theory of consciousness and to suggest that the sensitivity to the perceptual world of others may depend on their prior familiarity with it.

People must have particular personality traits and social resources, also known as health literacy, in order to access, comprehend, and use information to make decisions about their health. Patients' ability to engage in complex disease management and self-care is strongly related to their level of health literacy. It can help us stay healthy by preventing illness and effectively managing existing illnesses. People with low health literacy (LHL) may find it difficult to manage their condition and prevent illness, which may lead to increased use of healthcare services. Furthermore, LHL is associated with increased hospitalizations, increased use of emergency care, decreased use of preventative services, and a worsened ability to understand labels and health messages, a worsened state of health, higher mortality, and more expensive medical care.

Aging is accompanied by frontal lobe and non-dominant hemisphere recruitment that supports executive functioning, such as inhibitory control, which is crucial to all cognitive functions. Yet, the spatio-temporal sequence of processing underlying successful inhibition and how it changes with age is understudied. Thus, we assessed N200 (conflict monitoring) and P300 (response inhibition, performance evaluation) event-related potentials (ERPs) in young and healthy older adults during comparably performed successful stop-signal inhibition. We additionally interrogated the continuous spatio-temporal dynamics of N200- and P300-related activation within each group. Young adults had left hemisphere dominant N200, while older adults had overall larger amplitudes and right hemisphere dominance. N200 activation was biphasic in both groups but differed in scalp topography. P300 also differed, with larger right amplitudes in young, but bilateral amplitudes in old, with old larger than young in the left hemisphere. P300 was characterized by an early parieto-occipital peak in both groups, followed by a parietal slow wave only in older adults. A temporally similar but topographically different final wave followed in both groups that showed anterior recruitment in older adults. These findings illuminate differential age-related spatio-temporal recruitment patterns for conflict monitoring and response inhibition that are critically important for understanding age-related compensatory activation.

This study aims to develop a performance evaluation system that can facilitate performance evaluation at region, hospital, and department levels to enable better cost management for sustainable development. A multi-level system of performance evaluation informs a hierarchical assessment of cost management from regions to hospitals to departments using diagnosis-related group (DRGs). Various metrics are developed employing the variances between targets and actuals where targets are determined from two perspectives: benchmarking using external regional prices and change management using internal data. Targets for the latter are statistically based and specifically incorporate variability. The model is applied to two hospitals, twenty departments, nine DRGs and 1071 inpatients. The analyses indicate that the approach can provide a practical evaluation tool that allows for particular characteristics at multiple levels. The system provides macro-micro and external-internal perspectives in performance, enabling high-level variances to be decomposed thereby identifying sources of performance variability and financial impact.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

TomoBreast hypothesized that hypofractionated 15 fractions/3 weeks image-guided radiation therapy (H-IGRT) can reduce lung-heart toxicity, as compared with normofractionated 25-33 fractions/5-7 weeks conventional radiation therapy (CRT). 123 women with stage I-II operated breast cancer were randomized to receive CRT (N=64) or H-IGRT (N=59). The primary endpoint used a four-items measure of the time to 10% alteration in any of patient self-reported measure, physician clinical evaluation, echocardiography or lung function tests, analyzed by intention-to-treat without exclusion. Results found comparable survivals, but H-IGRT significantly reduced the toxicity measured by lung diffusion capacity and alveolar volume as compared with CRT, G1 in 53% (31/59) versus 72% (44/61) patients, P=0.006; G2, 29% versus 48%, P=0.020. H-IGRT significantly reduced the risk of composite cardio-pulmonary alteration at 5 years, 10.2% versus 26.7%, P=0.024. In conclusion, TomoBreast is a proof-of-concept that image-guided radiation-therapy can improve the overall balance of lung-heart outcomes in breast cancer adjuvant therapy. Furthermore, the significance of the findings supports the efficacy of a small trial size design, which can be critical when clinical research resources are limited.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

In this work, we analysed human isolates of nontyphoidal Salmonella enterica subsp. enterica (NTS), which were collected from salmonellosis cases in Armenia from 1996 to 2019. This disease became a leading food-borne bacterial infection in the region, with the younger age groups especially affected. The isolates were characterised by serotyping, Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) typing, and whole genome sequencing (WGS). The main serotypes were S. Typhimurium, S. Enteritidis, and S. Arizonae. ERIC-PCR indicated a high degree of clonality among S. Typhimurium strains, which were also multidrug-resistant and produced extended spectrum beta-lactamases. During the study period, the frequency of S. Typhimurium and S. Arizonae isolations were decreasing, but with the increase of S. Enteritidis and other NTS. A total of 42 NTS isolates were subjected to WGS and explored for virulence-related traits and the corresponding genetic elements. Some virulence and genetic factors were shared by all NTS serotypes, while the main differences were attributed to the serotype-specific diversity of virulence genes, SPIs, virulence plasmids, and phages. The results indicated the variability and dynamics in the epidemiology of salmonellosis and a high virulence potential of human NTS isolates circulating in the region.

This paper is referred to a top frontline research in life science, showing that in spite of the large variation of the physiological architecture and behavioral forms of the living systems, the fundamental structure of their informational system is basically the same, allowing the body growth/development by micro to macro-structuration processes, maintaining the same informational configuration and functions like the basic unit of life – the eukaryotic cell. Starting and based on the determination of the special/specific info-operability in living structures and the role of information in structuration and their functionality, there are discussed the informational functions of the eukaryotic/prokaryotic cells, the simplest units of life and is elaborated and presented the Informational Model of the Living Structures, showing that these structures operate on the basis of two main informational systems: one of them defined as the Programmed Informational System, composed by three components, assuring respectively the info-generation, maintenance and the proliferation/reproduction, and another one defined as the Operative Informational System, necessary for the continuous communication with the environment for adaptation, consisting in four main components referred to memory, decision, sentience and info-connection/info-selection. The revealed properties are compared with the Informational System of the Human Body, as a prototype of a living system on the top of the evolutionary scale, showing/demonstrating the compatibility of structuration and functions on the entire scale, from prokaryotic/eukaryotic unit cells to multicellular organisms – plants, animals and human, by means of a continuous adaptation process, which always follows the same line of micro to macro-structuration process based on the same Info-organization and functionality. These models are new and revolutionary in the information and life sciences