Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

Exposure to extreme heat is a known risk factor that is associated with increased heat-related illness (HRI) outcomes. The relevance of heat wave definitions could change across the health conditions and geographies due to the heterogenous climate profile. This study compared the sensitivity of 28 heat wave definitions associated with HRI emergency department visits over five summer seasons (2011-2016), stratified by two physiographic regions (Coastal and Piedmont) in North Carolina. The HRI rate ratios associated with heat waves were estimated using the generalized linear regression framework assuming a negative binomial distribution. We compared the Akaike Information Criterion (AIC) values across the heat wave definitions to identify an optimal heat wave definition. In the Coastal region, heat wave definition based on daily maximum temperature with a threshold >90^th percentile for two or more consecutive days had the optimal model fit. In the Piedmont region, heat wave definition based on the daily minimum temperature with a threshold value >90^th percentile for two or more consecutive days was optimal. Additionally, we observed that the optimal heat wave definitions from this study captured moderate and frequent heat episodes than the national weather service (NWS) heat products that worked best for extreme heat episodes. This study compared the HRI morbidity risk associated with epidemiologic-based heat wave definitions and with NWS heat products. Our findings could be used for public health education and suggest recalibrating NWS heat products.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Digital machine intelligence has evolved from its inception in the form of computation of numbers to AI, which is centered around performing cognitive tasks that humans can perform, such as predictive reasoning or complex calculations. The state of the art includes tasks that are easily described by a list of formal, mathematical rules or a sequence of event-driven actions such as modeling, simulation, business workflows, interaction with devices, etc., and also tasks that are easy to do “intuitively”, but are hard to describe formally or as a sequence of event-driven actions such as recognizing spoken words or faces. While these tasks are impressive, they fall short in applying common sense reasoning to new situations, filling in information gaps, or understanding and applying unspoken rules or norms. Human intelligence uses both associative memory and event-driven transaction history to make sense of what they are observing fast enough to do something about it while they are still observing it. In addition to this cognitive ability, all bio-logical systems exhibit autopoiesis and self-regulation. In this paper, we demonstrate how machine intelligence can be enhanced to include both associative memory and event-driven transaction history to create a new class of knowledge-based assistants to augment human intelligence. The digital assistants use global knowledge derived from the Large Language Models to bridge the knowledge gap between various participants interacting with each other. We use the general theory of information and schema-based knowledge representation to create the memory and history of various transactions involved in the interactions.

It is argued that all physical knowledge ultimately stems from observation and that the simplest possible observation is that an event has happened at a certain space-time location . Considering historic experiments, which had been groundbreaking in the evolution of our modern ideas of matter on the atomic, nuclear and elementary particle scales, it is shown that such experiments produce as outputs macroscopically observable events which represent binary decisions with regard to simple alternatives and which accumulate in the course of time into spatio-temporal patterns whose forms allow decisions to be taken concerning conceivable alternatives of explanation. Working towards elucidating the physical and information-theoretic characteristics of those elementary pieces of information we arrive at the conclusion that - unlike the events of relativity which are mere 4-tuples of spacetime coordinates - the events of observation are pieces of information endowed with the properties of physical action, spacetime extension, and Lorentz invariance. Another important aspect is that such events are produced at the expense of irreversibly dissipating energy which can be stated in Landauer diction in the form that more energy needs to be spent in the erasure of events than had previously been invested in their initiation.

Background: no reports have examined the profile of drug-induced dysphagia in detail. The goal of this study was to investigate if there are any differences in the profiles of drug-induced dysphagia. Methods: This study used the Japanese Adverse Drug Event Report (JADER) database. Further, reported odds ratios (RORs) were used to analyze data on adverse drug events from 2004 to 2021. The top ten drugs with the most drug-induced dysphagia occurrences were used as target drugs. The association between RORs and drug-induced dysphagia caused by the target drugs was evaluated, and the age distribution and time of onset of drug-induced dysphagia for each drug were compared. RORs were the primary endpoint. Moreover, age and time of onset of drug-induced dysphagia were secondary outcomes. Results: In total, 756,965 reports were analyzed. All the target drugs were associated with drug-induced dysphagia. Among them, cevimeline was a novel finding, as no dysphagia was observed during the clinical trial. For most drugs, the onset of drug-induced dysphagia was occurring within approximately 25 days of administration. However, even after long-term use, paroxetine and milnacipran were associated with drug-induced dysphagia. Conclusion: The onset profile of drug-induced dysphagia may differ from one drug to the next.

Area covered: These drugs, particularly calcineurin inhibitors, have very narrow therapeutic windows, i.e., they have numerous drug-related side effects. Herein, we focus on the most frequent immunosuppressive drug-related side effects that we encounter in kidney-transplant recipients: namely nephrotoxicity, post-transplant diabetes mellitus, leukopenia, anemia, dyslipidemia, mouth ulcers, hypertension, and viral reactivations (cytomegalovirus and BK virus). However, other therapies that are used after kidney transplantation, e.g., valcancyclovir, may also contribute to adverse events such as leukopenia. For each side-effect, we suggest how it can be prevented and how to treat it when present.

We investigate the effect of geopolitical risk on the returns of the Information Technology, Communication Services, and Consumer Staples sector firms within the S&P 500 index. We use the event study methodology and perform more than 17,000 regressions to provide empirical evidence at the sector level that geopolitical risk leads to different responses across these 3 sectors. The response of the Information Technology sector is negative for all event windows under study, except the one spanning 10 days prior to the geopolitical event and 10 days after. The Communication Services sector has positive returns as a result of geopolitical events for all event windows, except the one from the geopolitical event date and 5 days after. The Consumer Staples sector shows a negative impact on geopolitical risk for all event windows except the one from the geopolitical event date and 5 days after, demonstrating a negative correlation to the Communication Services sector.

During the night between 9 and 10 September 2017, multiple flash floods associated to a heavy-precipitation event affected the town of Livorno, located in Tuscany, Italy. Accumulated precipitation exceeding 200 mm in two hours, associated with a return period higher than 200 years, caused all the largest streams of the Livorno municipality to flood several areas of the town. We used the limited-area Weather Research and Forecasting (WRF) model, in a convection-permitting setup, to reconstruct the extreme event leading to the flash floods. We evaluated possible forecasting improvements emerging from the assimilation of local ground stations and X- and S-band radar data into the WRF, using the configuration operational at the meteorological center of Tuscany region (LaMMA) at the time of the event. Simulations were verified against weather station observations, through an innovative method aimed at disentangling the positioning and intensity errors of precipitation forecasts. By providing more accurate descriptions of the low-level flow and a better assessment of the atmospheric water vapour, the results demonstrate that assimilating radar data improved the quantitative precipitation forecasts.

In this note, I analyze the data generated by M. Fodje's (2013) simulation programs "epr-simple" and "epr-clocked". They were written in Python and published on Github. Inspection of the program descriptions shows that they make use of the detection-loophole and the coincidence-loophole respectively. I evaluate them with appropriate modified Bell-CHSH type inequalities: the Larsson detection-loophole adjusted CHSH, and the Larsson-Gill coincidence-loophole adjusted CHSH (NB: its correctness is conjecture, we do not have proof). The experimental efficiencies turn out to be approximately eta = 81% (close to optimal) and gamma = 55% (far from optimal). The observed values of CHSH are, as they should be, within the appropriately adjusted bounds. Fodjes' detection-loophole model turns out to be very, very close to Pearle's famous 1970 model, so the efficiency is close to optimal. The model has the same defect as Pearle's: the joint detection rates exhibit signaling. Fodje's coincidence-loophole model is actually a clever modification of his detection-loophole model. Because of this, however, it cannot lead to optimal efficiency.

This paper proposes a novel approach, based on the adaptive rate processing and analysis, for the isolated speech recognition. The idea is to smartly combine the event-driven signal acquisition and windowing along with adaptive rate processing, analysis and classification for realizing an effective isolated speech recognition. The incoming speech signal is digitized with an event-driven A/D converter (EDADC). The output of EDADC is windowed with an activity selection process. These windows are later on resampled uniformly with an adaptive rate interpolator. The resampled windows are de-noised with an adaptive rate filter and their spectrum are computed with an adaptive resolution short time Fourier transform (ARSTFT). Later on, the magnitude, Delta and Delta-Delta spectral coefficients are extracted. The Dynamic Time Warping (DTW) technique is employed to compare these extracted features with the reference templates. The comparison outcomes are used to make the classification decision. The system functionality is tested for a case study and results are presented. An 8.2 times reduction in acquired number of samples is achieved by the devised approach as compared to the classical one. It aptitudes a significant computational gain and power consumption reduction of the proposed system over the counter classical ones. An average subject dependent isolated speech recognition accuracy of 96.8% is achieved. It shows that the proposed approach is a potential candidate for the automatic speech recognition applications like rehabilitation centers, smart call centers, smart homes, etc.

Conditions under which compositions of component systems form a well-defined system-of-systems here are formulated at a fundamental level. Statement of what defines a well-defined composition and sufficient conditions guaranteeing such a result offers insight into exemplars that can be found in special cases such as differential equation and discrete event systems. For any given global state of a composition, two requirements can be stated informally as: 1) the system can leave this state, i.e., there is at least one trajectory defined that starts from the state, and 2) the trajectory evolves over time without getting stuck at a point in time. Considered for every global state, these conditions determine whether the resultant is a well-defined system and if so, whether it is non-deterministic or deterministic. We formulate these questions within the framework of iterative specifications for mathematical system models that are shown to be behaviorally equivalent to the Discrete Event System Specification (DEVS) formalism. This formalization supports definitions and proofs of the afore-mentioned conditions. Implications are drawn at the fundamental level of existence where the emergence of a system from an assemblage of components can be characterized. We focus on systems with feedback coupling where existence and uniqueness of solutions is problematic.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Sleep-disordered breathing affects the growth and development, mental aspect, and learning ability of affected children. Postoperative scarring causes anteroposterior and vertical develop-mental disorders of the maxilla. Obstructive apnea is likely to occur due to the influence on the maxillofacial and airway morphology. In this study, we investigated the sleep-respiratory dynamics of school-aged children with unilateral cleft lip and palate by performing a simple over-night sleep study, maxillofacial morphology and airway analysis using lateral cranial radiographs, and model analysis. Children with unilateral cleft lip and palate showed a significantly higher respiratory event index (REI) than normal children; the maxilla was located in the posterior position in terms of maxillofacial morphology, and airway morphology showed narrow values for all distance measurement items. Moreover, the width and length of the dental arch and the width of the alveolar base arch were significantly smaller. Furthermore, there was a negative correlation between REI and SNA, ANB, REI, and alveolar base arch width. Children with unilateral cleft lip and palate are more likely than normal children to develop sleep-disordered breathing due to in-creased airway resistance caused by undergrowth of the maxilla and narrowing of the upper airway and oral volume.

This work proposes a methodological approach applied to ephemeral gravel-bed streams to verify the change in the magnitude and frequency of hydrological events affecting the morphological dynamics and sediment budget in this type of channel. For the case study the Azohía Rambla, located in southeastern Spain, was chosen, emphasizing the research on two reference riverbed sections (RCRs): an upper one, with a predominance of erosion, and a middle one, where processes of incision, transport, and deposition converge. First, this approach focuses on relationships between peak discharges and sediment budgets during the period 2018 to 2022. For this purpose, water level measurements from pressure sensors, a One-Dimensional Hydrodynamic model, and findings from comparative analyses of high-resolution differential digital elevation models (HRDEM of Difference - HRDoD) based on SfM-MVS and LiDAR datasets were used. In a second phase the GeoWEPP model was applied to the period 1996-2022 in order to simulate runoff and sediment yield at the event scale for the watersheds draining into both RCRs. During the calibration phase a sensitivity analysis was carried out to detect the most influential parameters in the model and to confirm its capacity to simulate peak flow and sediment delivery in the area described above. Values of NS (Nash-Sutcliffe efficiency) and PBIAS (percent bias) equal to 0.86 and 7.81%, respectively, were found in the calibration period, while these indices were 0.81 and -4.1% in the validation period. Finally, different event class patterns (ECPs) were established for the monitoring period (2018-2022), according to flow stage and morphological channel adjustments (overtopping, bankfull and sub-bankfull, and half-sub-bankfull), and then retrospectively extrapolated to stages of the prior simulated period (1996-2018) from their typical sequences (PECPs). The results revealed a significant increase in the number of events and PECPs leading to lower bed incision rates and higher vertical accretion, which denotes a progressive increase in bed armoring and bank erosion processes.

Heart rate variability (HRV) is commonly intended as the variation in the heart rate (HR) and it is evaluated in the time and frequency domains with various well known methods. In the present paper, we first consider an abstract model in which the HR is the instantaneous frequency of an otherwise periodic signal such as the electrocardiogram (ECG). Thus the ECG is assumed as a frequency modulated signal, or carrier signal, where HRV or HRVt is a supposed time-domain signal which is frequency modulating the carrier ECG signal around its average frequency. Hence we describe an algorithm able to frequency demodulate the ECG signal to extract a continuous signal HRVt with possibly enough time resolution to analyse fast time-domain variations in the instantaneous HR. After exhaustive testing of the method on simulated frequency modulated sinusoidal signals, we have applied the procedure on actual ECG tracings. The purpose of the work is to eventually use the heart as a kind of biological sensor of the fast activity of the autonomous nervous system (ANS) to study the ANS ultra-short-term event-evoked responses. A few preliminary, not clinical, real examples are also given.

Quadrotor drones have rapidly gained interest recently. Numerous studies are underway for the commercial use of autonomous drones, and especially the distribution businesses are taking serious reviews on drone delivery services. However, there are still many concerns about urban drone operations. The risk of failures and accidents makes it difficult to provide drone-based services in the real world with ease. There have been many studies that introduced supplementary methods to handle drone failures and emergencies. However, we discovered the limitation of the existing methods. The majority of approaches were improving PID-based control algorithms which is the dominant drone control method. This type of low-level approach lacks situation awareness and the ability to handle unexpected situations. This study introduces an event-based control methodology that takes a high-level diagnosing approach that can implement situation awareness via time-window. While leaving the low-level controller to involve in operating the drone for most of the time in normal situations, our controller operates at a higher level and detects unexpected behaviors and abnormal situations of the drone. We tested our method with real-time 3D computer simulation environments with Unreal Engine[15] and AirSim[31]. We were able to verify that our approach can provide enhanced double safety and better ensure safe drone operations. We hope our discovery to possibly contribute to the advance of real-world drone services in the near future.

In training a deep learning system to perform audio transcription, two practical problems may arise. Firstly, most datasets are weakly labelled, having only a list of events present in each recording without any temporal information for training. Secondly, deep neural networks need a very large amount of labelled training data to achieve good quality performance, yet in practice it is difficult to collect enough samples for most classes of interest. In this paper, we propose factorising the final task of audio transcription into multiple intermediate tasks in order to improve the training performance when dealing with this kind of low-resource datasets. We evaluate three data-efficient approaches of training a stacked convolutional and recurrent neural network for the intermediate tasks. Our results show that different methods of training have different advantages and disadvantages.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Abstract: rainfall is the main driver of soil erosion. With the daily rainfall, riverine flow discharge and sediment load in the upper Lianjiang River watershed from 1990 to 2020, extreme rainfall events were defined by the 95th percentile method and minimum event interval time (MIT), change trends and mutations of yearly rainfall, riverine flow discharge and sediment load were identified using the Mann-Kendall test, then the optimum lag response time and antecedent rainfall were investigated with the multiple linear regression. The results showed that (1) the sediment changed significantly and abruptly in 1995 due to the expansion of the garden land. (2) Compared with ordinary rainfall, extreme rainfall events explained more variations of riverine flow and sediment with a higher degree, and had a more significant effect on the lag time of runoff and sediment. (3) Garden land expansion in extreme rainfall scenarios resulted in longer lag times for runoff and sediment and decreased demand for antecedent rainfall with more pre-event time. Therefore, taking the rainfall event as a breakthrough, analyzing the antecedent rainfall and the lag response of riverine flow discharge and sediment load is conducive to revealing the response mechanism of riverine flow discharge and sediment load and improving the simulation accuracy of riverine flow and sediment under extreme rainfall condition, thus help for the soil erosion control under extreme rainfall.

The robust fusion estimation problem of a multi-sensor system with communication constraints, random packet drops, d-step state delays, and deterministic control inputs is investigated. The state augmentation method is used to transform the time delay system into a non-time delay system, and then a robust fusion estimation algorithm based on sensitivity penalty is proposed and the pseudo-cross-covariance matrix is updated. An event-triggered robust fusion estimator with state delay and deterministic control inputs is considered to make the model closer to reality while effectively reducing network congestion and lowering communication costs. Conditions are given to ensure that the estimation errors of the robust fusion estimator are uniform boundedness. Two sets of numerical simulations are provided to illustrate the effectiveness of the derived fusion estimator.

We study in this work a dilute granular gas immersed in a thermal bath made of smaller particles with nonnegligible masses as compared with the granular ones. The kinetic theory for this system is developed and described by an Enskog--Fokker--Planck equation for the one-particle velocity distribution function. Granular particles are assumed to have inelastic and hard interactions, losing energy in collisions as accounted by a constant coefficient of normal restitution. The interaction with the thermal bath is based on a nonlinear drag force plus a white-noise stochastic force. To get explicit results of the temperature aging and steady states, Maxwellian and first Sonine approximations are developed. The latter takes into account the coupling of the excess kurtosis with the temperature. Theoretical predictions are compared with direct simulation Monte Carlo and event-driven molecular dynamics simulations. While good results for the granular temperature are obtained from the Maxwellian approximation, a much better agreement, especially as inelasticity and drag nonlinearity increase, is found when using the first Sonine approximation. The latter approximation is, additionally, crucial to account for memory effects like Mpemba and Kovacs-like ones.

Event-based vision is an emerging field of computer vision that offers unique properties such as asynchronous visual output, high temporal resolutions, and dependence on brightness changes to generate data. These properties can enable robust high-temporal-resolution object detection and tracking when combined with frame-based vision. In this paper, we present a hybrid, high-temporal-resolution, object detection and tracking approach, that combines learned and classical methods using synchronized images and event data. Off-the-shelf frame-based object detectors are used for initial object detection and classification. Then, event masks, generated per each detection, are used to enable inter-frame tracking at varying temporal resolutions using the event data. Detections are associated across time using a simple low-cost association metric. Moreover, we collect and label a traffic dataset using the hybrid sensor DAVIS 240c. This dataset is utilized for quantitative evaluation using state-of-the-art detection and tracking metrics. We provide ground truth bounding boxes and object IDs for each vehicle annotation. Further, we generate high-temporal-resolution ground truth data to analyze the tracking performance at different temporal rates. Our approach shows promising results with minimal performance deterioration at higher temporal resolutions (48 – 384 Hz) when compared with the baseline frame-based performance at 24 Hz.

The interaction between oceanographic, meteorological, and hydrological factors can result in an extreme flooding scenario in the low-lying coastal area, called compound flooding (CF) events. For instance, rainfall and storm surge (or high river discharge) can be driven by the same meteorological, tropical or extra-tropical cyclones, resulting in a CF phenomenon. The trivariate distributional framework can significantly explain compound events' statistical behaviour reducing the associated high-impact flood risk. Resolving heterogenous dependency of the multidimensional CF events by incorporating traditional 3-D symmetric or fully nested Archimedean copula is quite complex. The main challenge is to preserve all lower-level dependencies. An approach based on decomposing the full multivariate density into simple local building blocks via conditional independence called vine or pair-copulas is a much more comprehensive way of approximating the trivariate flood dependence structure. In this study, a parametric vine copula of a drawable (D-vine) structure is introduced in the trivariate modelling of flooding events with 46 years of observations of the west Coast of Canada. This trivariate framework searches dependency by combining the joint impact of annual maximum 24-hr rainfall and the highest storm surge and river discharge observed within the time ±1 day of the highest rainfall event. The D-vine structures are constructed in three alternative ways by permutation of the conditioning variables. The most appropriate D-vine structure is selected using the fitness test statistics and estimating trivariate joint and conditional joint return periods. The investigation confirms that the D-vine copula can effectively define the compound phenomenon's dependency. The failure probability (FP) method is also adopted in assessing the trivariate hydrologic risk. It is observed that hydrologic events defined in the trivariate case produce higher FP than in the bivariate (or univariate) case. It is also concluded that hydrologic risk increases (i) with an increase in the service design life of the hydraulic facilities and (ii) with a decrease in return periods.

M87 is a giant elliptical galaxy in the Virgo cluster of galaxies. The radio source has a core which coincides with the nucleus of the galaxy and a jet of emission which is detected from radio to X-ray bands. A supermassive black hole is assumed to be at the centre of M87 which sends out relativistic particles in the form jets along its axis of rotation. Relativistic particles accelerated in a magnetic field, give out synchrotron radiation. The centre is surrounded by an accretion disc, which is the closest that we can probe into a black hole. High resolution observations are needed to examine the nature of the radio emission closest to the centre of M87. An array of millimetre-band telescopes across the globe were used as an interferometer, called the Event Horizon Telescope, (EHT) to probe the nuclear region. The angular resolution of this interferometer array is 25 microarc sec, at a wavelength of 1.3mm and the data was carefully calibrated and imaged. The resulting image shows an asymmetric ring which is consistent with the predictions of strong gravitational lensing of synchrotron emission from hot plasma near the event horizon. In this paper, we review the results of the observations of the radio galaxy, M87, using the Event Horizon Telescope

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Background: Brief Resolved Unexplained Events (BRUEs), formerly known as Apparent Life-Threatening Events (ALTE), are concerning episodes of short duration (typically &lt; 1 min) characterized by a change in breathing, consciousness, muscle tone, and/or skin color. In some cases, SARS-CoV-2 infection has been associated with episodes of BRUEs in previously healthy children.This study aimed to compare the demographic, respiratory, perinatal, and infectious characteristics in children affected by BRUE before the COVID-19 pandemic and after the spread of SARS-CoV-2. Methods: We conducted a retrospective observational study covering January 2018 to March 2020 (pre-COVID-19) and April 2023 (during the ongoing COVID-19 pandemic). Collected variables included clinical information during pregnancy and neonatal details of children with BRUE. Results: The number of children in the pre-COVID-19 period was 186 (41%); after the emergence and spread of SARS-CoV-2, it was 268 (59%). The risk of infection at birth for children developing BRUE was higher during the pandemic. Children were less likely to have ongoing symptomatic infection during BRUE during the pandemic (coefficient B = 0.783; p=0.009). Respiratory symptoms during BRUE were more frequent during the pandemic (coefficient B = 0.654; p=0.052). Fever during BRUE was less likely during the pandemic (coefficient B = -0.465, p=0.046). Conclusions: The study suggests that the COVID-19 pandemic has significantly impacted children with BRUE, potentially due to changes in hygiene practices and maternal-fetal infections.

In 2011, by 1.3 mm wavelength VLBI radio wave observations of the SgrA*, Fish, V. L. et al showed that the emissions tightly related to the formation of a black hole shadow have a remarkably large time-varying feature within a region of less than 50 μas. The present paper suggests that the origin of the time variation in the observed emission is due to effects of the orbital motion of the existing super-massive black hole binary orbiting at SgrA* with a period of 2150±2.5 s. This suggestion is based on observations of decameter radio wave pulses from SgrA*. We show a good correlation between the time variation in the coherent flux density of the VLBI results and the time variation model of estimated emission intensities based on the periodic motion of the super-massive black hole binary by applying parameters deduced from the decameter radio wave pulse observation model (DRWP-Model). With further confirmation by Fourier analyses of the potential periodicity of the VLBI data that show the same periods of DRWP Model, we conclude that the time variation detected by the 1.3 mm wavelength radio wave VLBI is evidence of an existing super-massive black hole at Sgr A*.

In the design of multi-loop Networked Control Systems (NCSs) wherein each control system is characterized by heterogeneous dynamics and associated with certain set of timing specifications and constraints, appropriate metrics need to be employed for the synthesis of control and networking policies to efficiently respond to the requirements of each control loop. Majority of the design approaches for sampling, scheduling and control policies include either time-based or event-based metrics to perform pertinent actions in response to the changes of the parameters of interest. We specifically focus in this article on Age-of-Information (AoI) as a recently-developed time-based metric and threshold-based triggering function as a generic event-based metric. As the NCS model, we consider multiple heterogeneous stochastic linear control systems that close their feedback loops over a shared-resource communication network. We investigate the co-design across the NCS, and discuss the pros and cons with AoI and ET approaches in terms of asymptotic control performance measured by linear-quadratic Gaussian (LQG) cost functions. In particular, sampling and scheduling policies combining AoI and stochastic event-triggered metrics are proposed. It is argued that pure AoI functions that generate decision variables solely upon minimizing the average age irrespective of control systems dynamics may not be able to improve the overall NCS performance even compared with pure randomized policies. Our theoretical analyses are successfully validated through several simulation scenarios.

To understand functions of biomolecules such as proteins, not only structures but their conformational change and kinetics are important to be characterized but its atomistic details are hard to obtain both experimentally and computationally. We review our recent computational studies using novel enhanced sampling techniques for conformational sampling of biomolecules and calculations of their kinetics. For efficiently characterizing the free energy landscape of a biomolecule, we introduce the multiscale enhanced sampling method, which uses a combined system of atomistic and coarse-grained models. Based on the idea of Hamiltonian replica exchange, we can recover the statistical properties of the atomistic model without any biases. We next introduce the string method as a path search method to calculate the minimum free energy pathways along a multidimensional curve in high dimensional space. Finally we introduce novel methods to calculate kinetics of biomolecules based on the ideas of path sampling: One is the Onsager-Machlup action method, and the other is the weighted ensemble method. Some applications of above methods to biomolecular systems are also discussed and illustrated.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.