This study focuses on one of the most famous open problems in mathematics, namely the Collatz conjecture. The Collatz conjecture or 3x + 1 Problem is perhaps today's most enigmatic unsolved mathematical problem. It is named after Lothar Collatz, who rst proposed it in 1937. It may be stated as as follow: Take any positive integer n. If n is even then divide it by 2, else do \triple plus one" and get 3n + 1. The conjecture is that this process will eventually reach the number 1, regardless of which positive integer is chosen initially. In this paper, we present a simple proof for the Collatz conjecture.

Aiming at the limitations of single-functionality, limited applicability, and complex designs prevalent in current metasurfaces, we propose a terahertz multifunctional and multiband tunable metasurface utilizing a VO2-metal hybrid structure. This metasurface structure comprises a top VO2-metal resonance layer, a middle polyimide dielectric layer, and a gold film reflective layer at the bottom. This metasurface exhibits multifunctionality, operating independently of polarization and incident angle. The varying conductivity states of the VO2 layers, enable the metasurface to achieve various terahertz functionalities, including single-band absorption, broadband THz absorption, and multiband perfect polarization conversion for linear (LP) and circularly polarized (CP) incident waves. Finally, we believe that the functional adaptability of the proposed metasurface expands the repertoire of options available for future terahertz device designs.

In 2018, the author identified a previously unknown/unreported association between dexrazoxane and poly(ADP-ribose) (PAR). Interestingly, PAR is a close structural analogue of the polyadenine nucleotide polymer, polyadenosine monophosphate (poly(A)). In this report, subsequent in silico modelling of the interaction between dexrazoxane and poly(A) reveals some notable differences from the previously reported interaction between dexrazoxane and PAR. Significantly, the supramolecular self-assembly of dexrazoxane and poly(A) is distinguished by vertically-orientated nonelectrostatic forces comparable to the stabilizing interactions between stacked bases within DNA. Notably, the vertical separation of 3.4 Å between each stack is consistent with solvent entropy as a dominant driving force in stabilising the interaction. Additionally, concomitant conformational analysis by the author reveals the existence of low energy planar conformers of dexrazoxane. This analysis enables an explanation for the considerable discrepancies and conflicts that exist within the reported pharmacokinetic data for dexrazoxane. Exploring the significance of the interaction between dexrazoxane and poly(A), the author illustrates that survival, translation and replication of the severe acute respiratory syndrome virus 2 (SARS-CoV-2) is absolutely dependent upon the mature and unhindered poly(A) tail of the SARS-CoV-2 genome. The proposition herein, that dexrazoxane, as a chameleonic agent sequesters the poly(A) tail of the SARS-CoV-2 genome by the catalysis of a supramolecular hybrid assembly establishes SARS-CoV-2 infected cells as deep compartments for the accumulation of dexrazoxane. Taken together, dexrazoxane or its demethylated analogue, represent a novel treatment to kill the SARS-CoV-2 virus by irreversible destabilization of the SARS-CoV-2 poly(A) tail.

The growth of state transfers to equalize regional development disparities affects the stability of the state's financial system. The research aims at determining how the mechanism of horizontal alignment of fiscal imbalances between local budgets affects the stability of financial system of Ukraine. To assess the asymmetry of the alignment formula, we use a quasi-experimental strategy of analyzing potential scenarios, we calculate base grants (for recipient municipalities) and reverse grants (for donor municipalities) for 1439 municipalities in Ukraine. Then we conduct counterfactual experiments, where we change the calculation subject, the number of budgets in calculation and the calculation period. Under different calculation scenarios, we determine whether the alignment mechanism has positive or negative affect on the stability of the public finance system based on the criterion of non-accumulation of budgetary debt. We establish that the current system of horizontal fiscal alignment in Ukraine overstates the fiscal capacity of communities, artificially inflating the indicators of the performance of the imbalance alignment system reform and distorting the overall picture of public finance stability. The alignment system, designed to mitigate unevenness in socio-economic community development, actually exacerbates it. The mechanism for calculating community fiscal capacity, which underlies horizontal financial alignment, requires an improved approach to determining the calculation subject and further reform.

The rapid increase in the number of mobile phone base stations (MPBS) has raised global concerns about the potential adverse health effects of exposure to radiofrequency electromagnetic fields (RF-EMF). The application of machine learning techniques can enable healthcare professionals and policymakers to proactively address concerns surrounding RF-EMF exposure near MPBS. In this study, we investigated the potential of machine learning models to predict health symptoms associated with RF-EMF exposure in individuals residing near MPBS.We utilized support vector machine (SVM) and random forest (RF) algorithms, incorporating 11 predictors related to participants' living conditions. A total of 699 adults participated in the study, and model performance was assessed using sensitivity, specificity, accuracy, and the area under the receiver operating characteristic curve (AUC). The SVM-based model demonstrated strong performance, achieving accuracies of 85.3%, 82%, 84%, 82.4%, and 65.1% for headache, sleep disturbance, dizziness, vertigo, and fatigue, respectively. The corresponding AUC values were 0.99, 0.98, 0.920, 0.89, and 0.81. Compared to the RF model and a previously developed model, the SVM-based model exhibited higher sensitivity, particularly for fatigue, with sensitivities of 70.0%, 83.4%, 85.3%, 73.0%, and 69.0% for these five health symptoms. Particularly for predicting fatigue, sensitivity and AUC were significantly improved (70% vs 8% and 11.1% for SVM, MLPNN, and RF, respectively, and 0.81 vs 0.62 and 0.64, for SVM, MLPNN, and RF, respectively). These findings suggest that machine learning methods, specifically SVM, hold promise in effectively managing health symptoms in individuals residing near or planning to settle in the vicinity of MPBS.

Background: The outbreak of the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) resulted in the global COVID-19 pandemic. The urgency for an effective SARS-CoV-2 vaccine has led to the development of a first series of vaccines at unprecedented speed. The discovery of SARS-CoV-2 spike-glycoprotein mutants, however, and consequentially the potential to escape vaccine-induced protection and increased infectivity, demonstrates the persisting importance of monitoring SARS-CoV-2 mutations to enable early detection and tracking of genomic variants of concern. Results: We developed the CoVigator tool with three components: 1) a knowledge base that collects new SARS-CoV-2 genomic data, processes it and stores its results; 2) a comprehensive variant calling pipeline; 3) an interactive dashboard highlighting the most relevant findings. The knowledge base routinely downloads and processes virus genome assemblies or raw sequenc-ing data from the COVID-19 Data Portal (C19DP) and the European Nucleotide Archive (ENA), respectively. The results of the variant calling pipeline are visualized through the dashboard in the form of tables and customizable graphs, making it a versatile tool for tracking SARS-CoV-2 variants. We put a special emphasis on the identification of intrahost mutations and make available to the community what is, to the best of our knowledge, the largest dataset on SARS-CoV-2 intrahost mutations. In the spirit of open data, all CoVigator results are available for download. The CoVigator dashboard is accessible via covigator.tron-mainz.de. Conclusion: With increasing demand worldwide in genome surveillance for tracking the spread of SARS-CoV-2, CoVigator will be a valuable resource of up-to-date list of mutations, which can be incorporated into global efforts to sustainably prevent or treat infections.

The ecological background condition of the semi-arid steppe region (SASR) is extremely fragile. It is recognized that the development of coal and electricity power is a kind of strong human interference behavior for regional landscape ecology. Landscape ecological classification (LEC) is the premise of landscape ecology research of the mining area. The current research on the SASR and grassland LEC of coal-power base is relatively less, but still remains uncertainty concerning how to stratify and classify urban mining landscapes into units of ecological significance at spatial scales appropriate for management. This study is based on hierarchy theory, scale theory, landscape process, the patch-corridor-matrix model, the network, the theory of multiple planning integration and the principle of remote sensing. According to the comprehensive principle, principles of the combining of structure and function, principle of the combining human-ominated and natural landscape, principle of emphasis, and principle of combining qualitative analysis with quantitative research of LEC in large-scale coal-power base(LSCPB). On the basis of occurrence method land classification, fully consider the ecological attributes of the land, integration pattern, processes and function theory of the landscape ecology, the LEC system of the LSCPB in the SASR has been constructed by using top-down decomposition classification method. Empirical research of the Victory and Mindong No.1 mining areas of Shenhua Group shows that the classification system constructed in this paper can meet the requirements of LEC and fully reflect the status of landscape ecology of LSCPB in SASR. This study can provide theoretical guidance for the landscape ecology of LSCPB, while also supporting a theoretical reference for the LEC research.

The efficacy of weed management depends on the correct control timing according to the seedling emergence dynamics. Since soil temperature and soil moisture are two main factors that determine weed germination, the hydrothermal time model can be used to predict their emergence. The aim of this study was to estimate the base temperature (Tb) and base water potential (Ψb) for germination of Chenopodium album, Amaranthus retroflexus, Setaria pumila and Panicum capillare collected from fields in continental Croatia and then to compare these values with those of Italian populations embedded in the AlertInf model. Germination tests were performed at seven constant temperatures (ranging from 4 to 27°C) and eight water potentials (0.00 to - 1.00 MPa). Estimated Tb and Ψb were 3.4°C, -1.38 MPa for C. album, 13.9°C, -0.36 MPa for A. retroflexus, 6.6°C, -0.71 MPa for S. pumila and 11.0°C, -0.87 MPa for P. capillare, respectively. According to the criterion of overlap of the 95% confidence intervals, only Tb of C. album, and Ψb of A. retroflexus were similar between Croatian and Italian populations. Further field experiments should be conducted in the Croatian field to monitor weed emergence patterns of C. album and to calibrate the AlerInf equation parameters.

Over the years, sustainability, impact on the environment, as well as the operation expenditure have been a major concern to the deployment of mobile cellular base stations worldwide. This is because the mobile cellular base stations are known to consume a high percentage of power within the mobile cellular network. Such energy consumption contributes to the emission of Greenhouse Gases (GHG) through the use of conventional diesel generating a set. As a result, the mobile cellular operators are faced with the dilemma of minimising the power consumption, GHG emission, and the operation cost, while improving the Quality of Service of the networks. In attempting to find a solution, this study presents the feasibility and simulation of a solar photovoltaic (PV) with battery hybrid power system (HPS) as a predominant source of power for a specific mobile cellular base station site situated in Soshanguve area of the city of Pretoria, South Africa. It also presents the technical development, showed the environmental advantage and cost benefits of using a solar PV-battery HPS to power a base station site of a 24 hrs daily load of 241.10 kWh/d and the peak load of 20.31 kW as compared to using the HPS of solar PV-diesel generating set-battery. The solar resource pattern for the city of Pretoria was collected from The National Aeronautics and Space Administration and modelled statistically. Thus, the statistical modelling done using solar radiation resource exposure characteristic patterns of Pretoria, South Africa, revealed an average annual daily solar radiation of 5.4645 Wh/m2/d and 0.605 clearness index. The simulation and the design were done using the Hybrid Optimization Model for Electric Renewables and Matlab/Simulink software. The simulation finding shows that the HPS of solar PV-battery combination has about 59.62 % saving on Net Present Cost, Levelized Cost of Energy, and 80.87% saving on Operating cost as against conventional BS powered with Gen Set-Battery.

The endocannabinoid system has been found to be pervasive in mammalian species. It has also been described in invertebrate species primitive as the Hydra. Insects apparently are devoid of this otherwise ubiquitous system that provides homeostatic balance to the nervous and immune systems, as well as many other organ systems. The endocannabinoid system (ECS) has been defined to consist of three parts: 1. Endogenous ligands, 2. G-protein coupled receptors (GPCRs), and 3. Enzymes to degrade and recycle the ligands. Two endogenous molecules have been identified as ligands in the ECS to date. These are the endocannabinoids: Anandamide (arachidonoyl ethanolamide) and 2-AG (2-arachidonoyl glycerol). Two G-coupled protein receptors have been described as part of this system, with other putative GPC being considered. Coincidentally, the phytochemicals produced in large quantities by the Cannabis sativa L plant, and in lesser amounts by other plants, can interact with this system as ligands. These plant-based cannabinoids are termed, phytocannabinoids. The precise determination of the distribution of cannabinoid receptors in animal species is an ongoing project, with the canine cannabinoid receptor distribution currently receiving the most interest in non-human animals.

The gastrointestinal (GI) tract is innervated by the enteric nervous system (ENS), an extensive neuronal network that traverses along its walls. Due to local reflex circuits, the ENS is capable of functioning with and without input from the central nervous system. The functions of the ENS range from the propulsion of food to nutrient handling, blood flow regulation and immunological defense. Records of it first being studied emerged in the early 19th century when the submucosal and myenteric plexuses were discovered. This was followed by extensive research and further delineation of its development, anatomy, and function during the next two centuries. The morbidity and mortality associated with the underdevelopment, infection or inflammation of the ENS highlights its importance and the need for us to completely understand its normal function. This review will provide a general overview of the ENS to date and connect specific GI disorders such as short bowel syndrome with neuronal pathophysiology. Exciting opportunities in which the ENS could be used as a therapeutic target for common GI diseases will also be highlighted, as the further unlocking of such mechanisms could open the door to more therapy-related advances, and ultimately change our approach to GI disorders.

Understanding tumor attachments and management of feeding arteries are very important factors to achieve safe resection of skull base meningioma. We examined the distributions and frequencies of feeding arteries in skull base meningioma by cerebral angiography, and also assessed relationships to tumor attachment for skull base meningioma. We enrolled patients with skull base meningioma who underwent MRI and cerebral digital subtraction angiography (DSA), from September 2015 to October 2022. Subjects comprised 115 patients (32 males, 83 females; mean age, 52.7 years) with 117 meningiomas showing tumor attachments around the “cavernous sinus to upper part of the clivus” (Area 1), “lower part of the clivus to foramen magnum” (Area 2), and “tentorium around the petrous bone” (Area 3). We examined feeding arteries based on cerebral angiography and counted the number of related feeding arteries. Particularly frequent arteries, such as the dorsal meningeal artery (DMA), ascending pharyngeal artery (APA), tentorial artery (TA), and petrosal branch (PB) of the middle meningeal artery (MMA) were analyzed for associations of tumor attachment to Areas 1–3. DMA, APA, TA, and PB are very frequent feeding arteries among skull base meningiomas. In some cases, the artery of the foramen rotundum, posterior ethmoidal artery, recurrent meningeal artery, posterior meningeal artery, etc., supply blood to the skull base meningioma. Meningiomas with DMA as a feeding artery correlated strongly with tumor attachment to Area 1 (p<0.001). Meningiomas with APA correlated strongly with tumor attachment to Area 2 (p<0.001). Meningiomas with TA correlated strongly with tumor attachment to Area 3 (p<0.001). PB correlated with Area 3 (p<0.05). Visualization of these arteries suggests tumor attachments to the correlated areas. An accurate anatomical understanding of tumor attachment and feeding arteries is essential to determine appropriate surgical strategies for skull base meningioma. Pre-operative DSA can provide further understanding of the feeding arteries and attachments of skull base meningioma.

The role of the Renin-Angiotensin-Aldosterone System (RAAS) in Corona Virus Disease 2019 (COVID-19) infection has become a controversial topic of discussion. RAAS inhibitors, such as Angiotensin Converting Enzyme (ACE) inhibitors and Angiotensin II receptor blockers (ARBs), which are used to treat cardiovascular diseases, have been implicated in potentially increasing cell surface levels of ACE2. ACE2 is the host receptor for COVID-19 that was discovered in Wuhan, China in December 2019. Since December, COVID-19 has transmitted rapidly across the world and has become a global pandemic. COVID-19 is similar to the Middle East respiratory syndrome coronavirus (MERS-CoV) with the first case reported in Saudi Arabia in September 2012. COVID-19, also known as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is also similar to SARS-CoV, which first infected humans in the Guangdong province of southern China in 2002, and caused an epidemic between November 2002 and July 2003. Both SARS-CoV and COVID-19 use ACE2 to enter host cells. ACE2 is primarily expressed in the mouth, lung, heart, esophagus, kidney, bladder, and intestines, and is a component of RAAS, which serves to maintain vascular tone and blood volume. Inhibition or activation of other components of RAAS has been shown to directly increase or decrease the expression and/or activity of ACE2. Furthermore, RAAS-targeting therapeutics, such as ACE inhibitors and ARBs, have also been shown to regulate the expression and/or activity of ACE2, albeit in animal models. Although these changes in ACE2 have been demonstrated only in animal models, there is no evidence that administration of RAAS-targeting therapeutics to humans for the treatment of hypertension, diabetes, and other cardiovascular diseases (e.g., myocardial infarction and heart failure) causes changes in ACE2 expression. Nor is there clinical evidence that RAAS-targeting therapeutics augment COVID-19 infection, morbidity, or mortality. However, clinical evidence does suggest that ACE2 expression may protect against respiratory distress caused by a variety of noxious agents. This review attempts to provide a balanced overview of the potential role of RAAS in regulating ACE2, and the role of ACE2 during COVID-19 infection. Evidence is provided to show that the expression of ACE2 may mediate both positive and negative outcomes, depending on the timing of ACE2 expression.

Cannabis has long been used for its medicinal and psychoactive properties. With the relatively new adoption of formal medicinal cannabis regulations worldwide, the study of cannabinoids, both endogenous and exogenous, has similarly flourished in more recent decades. In particular, research investigating the role of cannabinoids in regeneration and neurodevelopment has yielded promising results in vertebrate models. However, regeneration-competent vertebrates are few, whereas a myriad of invertebrate species have been established as superb models for regeneration. As such, this review aims to provide a comprehensive summary of the endocannabinoid system, with a focus on current advances in the area of endocannabinoid system contributions to invertebrate neurodevelopment and regeneration.

Despite the remarkable success of SARS CoV-2 vaccines, the rise of variants, some of which are more resistant to the effects of vaccination, highlights the potential need for additional COVID-19 vaccines. We used the Multiple Antigen Presenting System (MAPS) technology, in which proteins are presented on a polysaccharide polymer to induce antibody, Th1, Th17 and CD8+ T cell responses, to engineer a novel vaccine targeting SARS CoV-2. This vaccine contains a fragment of the spike (S) protein receptor-binding domain (RBD) sequence of the original D614G strain and was used to immunize nonhuman primates (NHP) for assessment of immunological responses and protection against SARS CoV-2 challenge. The SARS CoV-2 MAPS vaccine generated robust neutralizing antibodies as well as Th1, Th17 and cytotoxic CD8 T-cell responses in NHPs. Furthermore, MAPS-immunized NHPs had significantly lower viral loads in the nasopharynx and lung compared to control animals. Taken together, these findings support the use of the MAPS platform to make a SARS CoV-2 vaccine. The nature of the platform also could enable its use for the inclusion of different variants in a single vaccine.

Knowing the “point of view” of the immune system is essential to understand the characteristic of a pandemic, such as that generated by the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV)-2, responsible for the Coronavirus Disease (COVID)-19. In this review, we will discuss the general host/pathogen interactions dictating protective immune response or immunopathology, addressing the role of immunity or immunopathology in influencing the clinical infection outcome, and debate the potential immunoprophylactic and immunotherapy strategies required to fight the virus infection.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

The primary objective of this research was to assess the energy consumption of the gas treatment units at Bonny NLNG Refinery, the first Gas Refinery in Rivers State, Nigeria, while utilizing semi-lean amine. To achieve this goal, a simulation of the units was conducted using the advanced software package Aspen Hysys (V.8.3). The simulation was designed to accurately represent the dynamic behavior of the refinery's gas treatment units, allowing for a comprehensive analysis of their energy usage. The research aimed to quantify the energy consumption of the gas treatment units and identify opportunities for energy optimization. By utilizing semi-lean amine, which is known to improve energy efficiency, the study sought to evaluate the potential energy savings that could be achieved in the refinery's operations. The simulation model incorporated the specific design and operational parameters of the gas treatment units at Bonny NLNG Refinery, including the gas flow rate, lean amine concentration, absorber pressure, stripping temperature, amine circulation rate, and acid gas removal efficiency. By considering these parameters, the simulation accurately represented the dynamic behavior of the gas treatment units, enabling a detailed analysis of their energy consumption. Through the simulation, various scenarios and operational conditions were evaluated to determine the optimal set of parameters that minimized energy consumption. The research also examined the trade-offs between energy consumption, acid gas removal efficiency, and other performance indicators, such as amine circulation rate and regeneration efficiency. The findings of this research have significant implications for the energy efficiency and sustainability of gas treatment operations at Bonny NLNG Refinery. By identifying opportunities for energy optimization and providing recommendations for the utilization of semi-lean amine, the study contributes to the development of more efficient and environmentally friendly gas treatment processes. Overall, this research combines advanced simulation techniques with a comprehensive analysis of energy consumption to provide valuable insights into the energy efficiency of gas treatment units at Bonny NLNG Refinery, enabling informed decision-making and potential improvements in energy utilization. By utilizing the percentage-based unit simulation approach, a detailed examination of the energy consumption patterns was obtained. This analysis provides valuable insights into the operational efficiency and determination of potential energy-saving opportunities within the gas treatment units. This study specifically focuses on the integration of an absorption column split stream (stream flow) and a flash unit as a potential means to reduce the energy consumption of gas treatment devices. The integration of these units aims to optimize the overall energy efficiency of the gas treatment process by recovering and utilizing waste heat and reducing energy losses. The absorption column split stream allows for the diversion of a portion of the gas stream to a flash unit before entering the absorber. The flash unit operates at a lower pressure, which facilitates the release of entrained hydrocarbons and reduces the overall energy requirements for gas treatment. By separating and recovering the hydrocarbons in the flash unit, energy losses associated with their absorption and subsequent regeneration are minimized. Through the simulation, the study analyzes the energy consumption patterns of the gas treatment units with and without the integration of the absorption column split stream and flash unit. Comparative assessments are conducted to evaluate the energy savings and overall operational efficiency achieved through this integration. The findings of this research will provide valuable insights into the potential energy-saving opportunities offered by the integration of the absorption column split stream and flash unit in gas treatment devices. It will help refine the design and operation of gas treatment units, enabling more energy-efficient processes in the gas refining industry. By optimizing energy consumption in gas treatment units, the study contributes to the industry's goals of reducing greenhouse gas emissions and improving sustainability. The integration of the absorption column split stream and flash unit offers a promising approach to enhance energy efficiency, reduce operational costs, and minimize environmental impact. Overall, this research underscores the importance of exploring innovative solutions, such as the integration of different process units, to achieve energy savings in gas treatment operations. Through a comprehensive analysis of energy consumption patterns, this study aims to provide practical recommendations for optimizing energy efficiency in gas treatment units, fostering a more sustainable and efficient gas refining industry.The research specifically explores the impact of integrating the absorption column split stream and flash unit when dealing with sour gas streams containing carbon dioxide concentrations of less than mole ℅, while utilizing MDEA fluid as the solvent. Through comprehensive analysis and simulation using advanced software tools, the study demonstrates that by incorporating the absorption column split stream and flash unit, a significant reduction in device energy consumption of up to 10% can be achieved. The integration of the absorption column split stream and flash unit offers promising opportunities to enhance the energy efficiency of gas treatment devices. By diverting a portion of the gas stream to the flash unit, the separation of hydrocarbons and the subsequent release of entrained hydrocarbons at lower pressure significantly reduce the overall energy requirements for gas treatment. The comprehensive analysis and simulation conducted in the research provide concrete evidence of the energy-saving potential of this integration. By quantifying the energy consumption patterns and comparing scenarios with and without integration, the study establishes the effectiveness of the approach and its impact on operational efficiency. The findings of the research highlight the importance of considering the specific gas composition and utilizing appropriate solvents, such as MDEA, for optimizing energy efficiency. The integration of the absorption column split stream and flash unit not only reduces energy consumption but also offers the potential for cost savings and environmental benefits. Overall, the research demonstrates that by incorporating the absorption column split stream

ABSTRACT"In the realm of the industrial complex, a pressing concern lies in optimizing resource utilization and enhancing energy efficiency. This critical issue finds strong support from a variety of government programs, strategies, and regulatory documents. To effectively tackle this challenge and revolutionize petrochemical production, it is imperative to establish and develop innovative mechanisms. One such mechanism involves harnessing the power of automation and advanced Industry 4.0 technologies to streamline production processes. By doing so, we can unlock the full potential of these systems, driving operational efficiency, conserving valuable reserves, and propelling innovation within the petrochemical industry."The article delves into an in-depth analysis of the prominent trends in the application of the "Industry 4.0" concept within the petrochemical industry. It sheds light on the various factors that impact the efficiency of organizing production systems. Additionally, the article identifies the primary avenues that drive the advancement and enhancement of production organization practices. Moreover, the article explores the fundamental tools employed for process improvements and highlights the significance of process automation in petrochemical plants. By examining these key aspects, it aims to provide valuable insights and recommendations for leveraging Industry 4.0 technologies to optimize production processes in the petrochemical industry..The study focuses on examining and evaluating various systems and technologies that contribute to the optimization of production processes within the petrochemical industry. Specifically, it delves into the implementation and benefits of the just-in-time system, the 5S system for workplace rationalization, as well as different information systems including ERP systems and CALS-technologies. By exploring these systems and technologies, the article aims to identify the advantages of automating production processes within the petrochemical complex. This analysis will unveil the potential benefits such as improved efficiency, reduced waste, enhanced productivity, streamlined operations, and increased overall competitiveness. Through this research, we aim to shed light on the value of these automation solutions and their impact on driving the petrochemical industry towards greater success.

This research was conducted on the Maribaya Timur school community in Lembang Subdistrict, West Bandung Regency, Indonesia, which is an active community in the area that is threatened by the potential for earthquake disasters due to the active Lembang fault. Disaster risk reduction efforts are pursued through increasing school-based preparedness that involves members of the school community, surrounding communities and various institutions that are associated with reducing the risk of school-based earthquake. Increasing preparedness against earthquakes focuses more on aspects of capacity building of school communities in reducing disaster risk, while aspects of vulnerability and threats have not been the focus of disaster risk reduction. The steps taken refer to the element of preparedness by aligning with the conditions, needs and potential that exist in the school community. Theoretically, if the school community has preparedness to face an earthquake disaster, the risk of earthquake disaster in the school community will be reduced so that it can minimize losses, victims and suffering that will be caused by the earthquake disaster.

SARS-CoV-2, the virus that causes theCOVID-19 disease, has been demonstrated to cause immune suppression in certain individuals. This can manifest as a reduced ability for the host's immune system to effectively control the infection. Studies have reported that patients with COVID-19 can exhibit a decline in white blood cell counts, including natural killer cells and T cells, which are integral components of the immune system's response to viral pathogens. These cells play critical roles in the immune response to viral infections, and their depletion can make it harder for the body to mount an effective defense against the virus. Additionally, the virus can also directly infect immune cells, further compromising their ability to function. Some individuals with severe COVID-19 pneumonia may develop a "cytokine storm," an overactive immune response that may result in tissue damage and organ malfunction. The underlying mechanisms of immune suppression in SARS-CoV-2 are not entirely comprehended at this time, and ongoing research is being conducted to gain a more comprehensive understanding. Research has shown that severe SARS-CoV-2 infection promotes the synthesis of IgG4 antibodies. In this work, we propose the hypothesis that the IgG4 antibody produced by B cells in response to infection by SARS-CoV2 generates immunological tolerance that prevents its elimination, and leads to persistence and chronic infection. In sum, we believe that this constitutes another immune evasion mechanism that bears striking similarities to that developed by cancer cells to evade immune surveillance.

Home Security Systems are very important features of modern residential and office setups. This system is used to keep home safe from harmful gases, fire and intruders. It must be affordable, reliable and effective. In this paper, a GSM based home security system has been designed and implemented. The system consists of a GSM Module, MQ-2 smoke detector, Ultrasonic sonar sensor, LM35 temperature sensor, Arduino Uno and relay module. The MQ-2 smoke detector is used to detect harmful gases i.e. LPG, CH₄, CO, Alcohol, Smoke or Propane. Any of the harmful gases stated above is detected it will warn the owner by activating the buzzer and displaying a warning message on the LCD display. It will also send a SMS to the owner. Our system can also measure temperate and if the temperature is increased above a certain range it will compensate it by activating Air Conditioner through the relay module. The system will also send a SMS to the owner. It can also detect intruders using Ultrasonic sensor and warn us through buzzer, SMS and displaying message on the LCD. Our system is reliable as it has very fast response and cost effective and it has been developed using our own technologies.

Abstract: Severe land degradation is the principal environmental problem in Ethiopian highlands in the form of soil erosion, and soil fertility loss, which is caused by human intervention for food, shelter, and energy demands. Soil erosion contributes to the loss of precious soil and water resources which are the basis of agricultural production and provide numerous other eco-system services. The Ethiopian highlands are one of the most degraded regions in the world. To combat such problems, the government of Ethiopia has been implementing massive soil and water conservation works at the watershed scale since 2010 to conserve soil and water resources. Mount Yewel is one of the highlands in Northeastern Ethiopia where intensive soil and water conserva-tion has been implemented. Despite the massive investment in soil and water conservation measures, most of the rivers in the highlands of Ethiopia carry huge amounts of sediment with high flood risks in the wet season and streams are dried up in the dry period. Nonetheless, the impact of soil and water conservation measures on flood reduction and dry season flow en-hancement has not yet been quantified and evaluated. This research was then conducted on paired micro-catchments of Mount Yewel with the main objective of evaluating the impact of soil and water conservation measures on base flow modification. Stream flow and rainfall data were col-lected from 22/11/2020 to 8/11/2022 on paired micro-catchments of Mount Yewel at their outlets and centers respectively. Base flow separation was done from the stream hydrograph using Sp. Hydro base flow separation tool and SPSS Ver.21 statistical software were employed for data analysis. Flow duration curves (FDC) for both watersheds were developed to compare the stream flow patterns between treated and untreated micro-catchments of Mount Yewel. The FDC indi-cated that the base flow from treated micro-catchment is higher and sustained in the dry season while it is low and unsustained in untreated micro-catchment. From statistical analysis, there is a significant (P

Abstract: Due to sever land degradation throughout Ethiopia, the government has been implementing massive soil and water conservation works at the watershed scale since 2010 to conserve soil and water resources. However, most of the rivers in Ethiopia carry huge amount of sediment in rainy season and streams dried up in the dry period. Planned research was conducted on two paired micro-catchments Mt.Yewel with the main objective of evaluating the impact of soil and water conservation measures on base flow modification. Stream flow and rainfall data were collected from 22/11/2020 to 8/11/2022 on both micro-catchments at their outlets and center respectively. Base flow separation was done using Sp. Hydro base flow separation tool and SPSS Ver.21 statistical software was employed for data analysis. Flow duration curve (FDC) for both watersheds were developed. The FDC indicated that the base flow from treated micro-catchment ishigher and sustained in the dry season while it is low and un-sustained in untreated micro-catchment. From statistical analysis, there is a significant difference in base flow enhancement between the treated and untreated micro-catchment (P<0.001). Hence, catchment treatment contributed to improve groundwater recharge and sustain base flow in the dry season by reduce surface runoff during rainy season.

Organometallic drug development is still in its early stage, but recent studies show that organometallics having iron as the central atom have the possibility of becoming good drug candidates because iron is an important micro-nutrient, and it is compatible with many biological systems, including the human body. Being an eco-friendly Lewis acid, iron can accept the lone pair of electrons from imino(sp2)-nitrogen, and the resultant iron-imine complexes with iron as a central atom have the possibility of interacting with several proteins and enzymes in humans. Iron-imine complexes have demonstrated significant potential as anticancer, bactericidal, fungicidal, and other medicinal activities in recent years. This article systematically discusses major synthetic methods and pharmacological potentials of iron-imine complexes having in vitro activity to significantly affect clinical performance from 2016 to date. In a nutshell, this manuscript offers a simplistic view of iron complexes in medicinal inorganic chemistry: for instance, iron is presented as an "eco-friendly non-toxic" metal (as opposed to platinum) that will lead to non-toxic pharmaceuticals. The abundant literature on iron chelators shows that many iron complexes, particularly if redox-active in cells, can be quite cytotoxic, which can be beneficial for future targeted therapies. While we made every effort to include all the related papers, any omission is purely unintentional.

MoS2 lithium-based grease is suitable for lubrication protection between bearings at high temperatures and loads due to its excellent tribological properties. However, there is little research on the influence of different addition methods of MoS2 additive on the tribology and corrosion properties of lithium grease. In this work, vegetable oil with low toxicity, high biodegradation rate, and low cost was selected as the base oil, lithium 12-hydroxystearate as the thickener, and MoS2 as the additive. The effects of different adding modes of MoS2 on the tribology and corrosion properties of lithium grease were studied. The experimental results showed that adding 0.01wt% MoS2 before thickening was more conducive to improving the tribological properties of lithium grease. The average friction coefficient was 0.034, and the average spot diameter was reduced by 0.16mm. After grinding and adding 0.01wt% MoS2, the corrosion inhibition efficiency of the steel sheet was as high as 96.97%. The main reason was that the longer stirring and grinding were conducive to the uniform distribution of MoS2 in the grease, and the protective film formed by MoS2 and GCr15-bearing steel improved the lubrication performance and corrosion inhibition performance of the friction system.

A problem involving the government's inspection of coins in Lower Slobbovia is discussed in the \emph{American Mathematical Monthly}. It is desirable to classify and correct counterfeit coins by utilizing the fewest possible measures. However, previous article only proves the existence of the solution, which does not give a practical solution to the problem. This note provides effective methods to achieve the identification of coiners using dirac delta function and singularity function. Moreover, unit-order construction of continuum mappings and discretization of unique basis vectors with semi-expansion are established in S-base space.

Multiplex genome editing may induce genotoxicity and chromosomal rearrangements due to double-strand DNA breaks at multiple loci simultaneously induced by programmable nucleases, including CRISPR/Cas9. However, recently developed base-editing systems can directly substitute target sequences without double-strand breaks. Thus, the base-editing system is expected to be a safer method for multiplex genome-editing platforms for livestock. Target-AID is a base editing system composed of PmCDA1, a cytidine deaminase from sea lampreys, fused to Cas9 nickase. It can be used to substitute cytosine for thymine in 3-5 base editing windows, 18 bases upstream of the protospacer-adjacent motif site. In the current study, we demonstrated Target-AID-mediated base editing in porcine cells for the first time. We targeted multiple loci in the porcine genome using the Target-AID system and successfully induced target-specific base substitutions with up to 63.15% efficiency. This system can be used for the further production of various genome-engineered pigs.

A random variable X that is base b Benford will not in general be base c Benford when c is not equal to b. This paper builds on two of my earlier papers and is an attempt to cast some light on the issue of base dependence. Following some introductory material, the “Benford spectrum” of a positive random variable is introduced and known analytic results about Benford spectra are summarized. Some standard machinery for a “Benford analysis” is introduced and combined with my method of “seed functions” to yield tools to analyze the base c Benford properties of a base b Benford random variable. Examples are generated by applying these general methods to several families of Benford random variables. Berger and Hill's concept of “base-invariant significant digits” is discussed. Some potential extensions are sketched.

Coronavirus disease 2019 (COVID-19) was initially characterized as a respiratory illness. Neurological manifestations were reported mostly in severely affected patients. Routes for brain infection and the presence of virus particles in situ have not been well described, raising controversy about how the virus causes neurological symptoms. Here, we report the autopsy findings of a 1-year old infant with COVID-19. In addition to pneumonitis and multiple organ damage related to thrombosis, SARS-CoV-2 infected the choroid plexus, ventricles, and cerebral cortex. This is the first evidence of SARS-CoV-2 detection in an infant post-mortem brain.

This study developed a system dynamics model to understand the spread of coronavirus disease (COVID-19) in Japan. The model is built on the generic SEIR (Susceptible, Exposed, Infected, and Recovered) framework adopted by Ghaffarzadegan and Rahmandad (2020) to build a system dynamics model for the spread of COVID-19 in Iran. Japan seems to be successful in containing the spread compared with other countries, and its first peak has passed. However, because this also leaves a large population still susceptible to the virus, it could cause a second and potentially higher peak of infection after the state of emergency aimed at reducing contact rate is lifted. As the government has proposed the “New Lifestyle,” it is critical to behave cautiously so as not to be infected. While the model focuses on the SEIR structure, the reflection of other sub-structures such as economy and hospital capacity that have tradeoffs with reducing contact rate should be beneficial. However, before extending the model, it is also critical to conduct estimates using confidence intervals rather than point estimates to better reflect uncertainties.

The availability of current land cover and land use (LCLU) information for monitoring the status of land resources has considerable value in ensuring sustainable land use planning. Similarly, the need to provide updated information on the extent of LCLU change in West Africa has become apparent, given the increasing demand for land resources driven by the rapid population growth in the sub-region. SERVIR West Africa, a regional consortium jointly supported by USAID and NASA to foster the use of geospatial and earth observation data and science for decision-making on critical environmental and food security challenges, in collaboration with the Food and Agriculture Organization of the United Nations (FAO), is building technical capacity in the sub-region to develop and implement harmonized regional land cover classification system for LULC change monitoring in West Africa, based on the Land Cover Meta Language (LCML-ISO 19144-2). This article focuses on the process, potential opportunities, outputs of this collaboration, exemplary use cases, and recommendations for the next steps.

Humans are often exposed to various environmental contaminants, among which phthalates are prevalent due to their extensive use as plasticizers in various consumer goods. Di(2-ethylhexyl) phthalate (DEHP), a widely used phthalate, is recognized as an endocrine disruptor chemical (EDC). DEHP is reported to affect various organs. Few studies have addressed the effects of phthalates on bone. However, the effects of DEHP on the bone forming cells (osteoblasts) are obscure. The present study was peformed to determine the cytotoxic effects of DEHP on human osteoblasts in vitro and to delineate the mechansims. In this study, we exposed the human osteo-blastic cell line MG-63 to various concentrations of DEHP (1, 25, 50 and 100 µM) for 24, 48 and 72 h. Cell viability was assessed by MTT assay. Total RNA and protein were collected after 48 h treatment with 1 and 100 µM DEHP and determined for the mRNA and/or protein expression of alkaline phosphatase (ALP), sex steroid receptors (androgen and estrogen receptors), receptor activator of nuclear factor kappa-Β ligand (RANKL), runt-related transcription factor 2 (RUNX2) and peroxisome proliferator-activated receptor alpha (PPARα). The mRNA expression was stud-ied by real-time RT-PCR analysis and the protein expression was determined by western blot analysis. Statistical analyses were done by one-way analysis of variance (ANOVA) followed by the Students–Newman–Keuls (SNK) test. The exposure of MG-63 cells to DEHP caused a signifi-cant decrease in osteoblast viability in all the treatment groups and at all the time points stud-ied. Interestingly, DEHP exposure decreased the mRNA expression of ALP, a bone formation marker. DEHP had differential effects on estrogen receptor alpha (ERα) mRNA and protein ex-pression. However, DEHP treatment downregulated the mRNA and protein expression of ERβ, and androgen receptor (AR). Surprisingly, DEHP downregulated the RANKL mRNA expression. DEHP decreased the protein expression of RUNX2, the key transcription factor and master regu-lator of bone formation. Furthermore, DEHP increased the PPARα protein expression in the os-teoblasts. Importantly, DEHP increased the reactive oxygen species (ROS) molecules and thus oxidative stress in osteoblasts, as observed by increased hydrogen peroxide, hydroxyl radical levels and lipid peroxidation. On the other hand, it decreased the enzymatic and non-enzymatic antioxidant levels namely catalase, superoxide dismutase, glutathione peroxidase activity and reduced glutathione. Our study demonstrated that in vitro exposure to DEHP reduces the osteo-blast viability possibly through alterations in the oxidant-antioxidant system and modulation of the key genes involved in bone formation, highlighting the cytotoxic effects of DEHP on bone forming cells.

During the COVID-19 pandemic, immunosuppressed patients showed prolonged SARS-CoV-2 infections, with several studies reporting the accumulation of mutations in the viral genome. The weakened immune system present in these individuals, along with the effect of antiviral thera-pies, are thought to create a favourable environment for intra-host viral evolution and have been linked to the emergence of new viral variants, which strongly challenged the containment measures and some therapeutic treatments. To assess whether an impaired immunity could lead to an increased instability of viral genomes, longitudinal nasopharyngeal swabs were collected from eight immunocompromised patients and fourteen non-immunocompromised subjects, all undergoing SARS-CoV-2 infection. Intra-host viral evolution was compared between the two groups through deep sequencing, exploiting a probe-based enrichment method to minimize the possibility of artefactual mutations commonly generated in amplicon-based methods, which heavily rely on PCR amplification. Although, as expected, immunocompromised patients expe-rienced significantly longer infections, the acquisition of novel intra-host viral mutations was similar between the two groups. Moreover, a thorough analysis of viral quasispecies showed that the variability of viral populations in the two groups is comparable not only at the consensus level, but also when considering low frequency mutations. This study suggests that a compro-mised immune system alone does not affect SARS-CoV-2 within-host genomic variability.

This research was devoted to study the effect of the tacticity of PMMA on the surface physicochemical properties such as the London dispersive component of the surface energy of the polymer, the polar and dispersive free energies, the Lewis’s acid-base surface parameters, and the Lewis acid and base surface energies of atactic, isotactic and syndiotactic PMMAs as a function of the temperature. Inverse gas chromatography (IGC) at infinite dilution was used to determine the surface thermodynamic properties of PMMA at different tacticities. The experimental values of the net retention time and volume of model organic molecules adsorbed on the atactic, isotactic and syndiotactic PMMAs, were obtained by IGC technique at infinite dilution. The London dispersion interaction energy was used for the separation of the polar and dispersive energy of the different n-alkanes and polar solvents adsorbed on the different PMMA surfaces. The London dispersive surface energy γ_s^d (T) of PMMAs was determined by applying the Hamieh thermal model that took into account the effect of the temperature on the surface area of adsorbed molecules. The obtained results showed non-linear variations of γ_s^d (T) of atactic, isotactic, and syndiotactic PMMAs with three maxima characterizing the three transition temperatures of PMMAs, T_g, T_g and T_(liq-liq) with a shift of these temperatures with the isotactic and syndiotactic PMMAs. It was showed that the polar interaction free energy ∆G_a^p (T) also showed the presence of the three above transition temperatures of the polymers. The study showed an important non-linearity variation of the different acid-base parameters in the various polymer surfaces proving the highest effect of the temperature and the tacticity on these parameters. The determination of the enthalpic and entropic Lewis’s acid-base parameters showed an amphoteric character for the different PMMAs. The basicity of the atactic PMMA was about four times larger than its acidity outside the neighborhood of the transition temperatures of the polymer. Whereas, the isotactic PMMA was about 2 to 2.5 times more basic than acid, while the syndiotactic PMMA exhibited the highest basicity by showing a surface 5 to 8 times more basic than acid. However, the Lewis acid-base parameters strongly depended on the temperature and sudden variations of these surface parameters were observed around the transition temperatures largely depending on the PMMA tacticity. The determination of the polar acid and base surface energies of the three PMMAs led to the same previous transition temperatures with an important effect of the tacticity of PMMA on the values of these acid-base surface energies.

An outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) occurred in China towards the end of 2019, and has spread rapidly ever since. Previous studies showed that some virus could affect the reproductive system and cause long-term complications. Recent studies exploring the source of SARS-CoV-2 using genomic sequencing have revealed that SARS-CoV-2 enters the host cells via the angiotensin-converting enzyme II (ACE2), the receptor that recognizes SARS-CoV. To investigate the expression of ACE2 and to explore the potential risk of infection in the reproductive system, we performed a thorough bioinformatic analysis on data from public databases involving RNA expression, protein expression, and single-cell RNA expression studies. The analyzed data showed high levels of ACE2 mRNA and protein expression in the testis and spermatids and equal levels of ACE2 expression in the uterus and lung. Comprehensive single-cell analysis identified ACE2 expression in the lung, testis, spermatids, and uterus. In conclusion, this study revealed the potential risk associated with the SARS-CoV-2 infection in the reproductive system and predicted that long-term complications might have a significant impact on the prevention and management of COVID-19, the disease caused upon infection with SARS-CoV-2.

Home Security Systems are very important features of modern residential and office setups. This system is used to keep home safe from harmful gases, fire and intruders. It must be affordable, reliable and effective. In this paper, a GSM based home security system has been designed and implemented. The system consists of a GSM Module, MQ-2 smoke detector, Ultrasonic sonar sensor, LM35 temperature sensor, Arduino Uno and relay module. The MQ-2 smoke detector is used to detect harmful gases i.e. LPG, CH4, CO, Alcohol, Smoke or Propane. Any of the harmful gases stated above is detected it will warn the owner by activating the buzzer and displaying a warning message on the LCD display. It will also send a SMS to the owner. Our system can also measure temperate and if the temperature is increased above a certain range it will compensate it by activating Air Conditioner through the relay module. The system will also send a SMS to the owner. It can also detect intruders using Ultrasonic sensor and warn us through buzzer, SMS and displaying message on the LCD. Our system is reliable as it has very fast response and cost effective and it has been developed using our own technologies.

The present study produced and characterised chitosan, chitosan nanoparticle, chitosan n – benzaldehyde Schiff base, chitosan nanoparticle n – benzaldehyde Schiff base, Fe(III) chitosan n – benzaldehyde Schiff base and Fe(III) chitosan nanoparticle n – benzaldehyde Schiff base for biomedical application as antimicrobial agents. The materials were characterized with Fourier Transform Infrared spectroscopy, X-ray Diffractogram and biologically evaluated using disc diffusion method with three gram-positive bacteria. The FTIR absorption peaks were shifted to a lower wave number than the micro materials from which it was modified. These clearly indicate the linkage between phosphate, ammonium ion, Schiff base and Fe(III) metal. The diffracted peaks of Fe(III) chitosan nanoparticle n – benzaldehyde Schiff base were new peaks at 2θ = 24o and 42o when compare to the peak of Fe(III) chitosan n – benzaldehyde Schiff base of 2θ = 22.5o and 34o. The difference in peak shift were attributed to the ionic bonding of the complexation of Fe(III) with the blending of benzaldehyde to chitosan – Tpp backbone structure. Fe(III) chitosan nanoparticle Schiff base has more antimicrobial activity against same bacteria and fungi tested than Fe(III) chitosan n – benzaldehyde Schiff base, chitosan n – benzaldehyde Schiff base and chitosan. The antimicrobial activities of the synthesised six materials shown that the materials have high activities than the above – mentioned standard drugs.

A series of novel indole Schiff base derivatives (2a–2t) containing a 1,3,4-thiadiazole scaffold modified with a thioether group were synthesized, and their structures were confirmed using FT-IR, ¹H NMR, ¹³C NMR, andHR-MS. In addition, the antifungal activity of synthesized indole derivatives was investigated against Fusarium graminearum (F. graminearum), Fusarium oxysporum (F. oxysporum), Fusarium moniliforme (F. moniliforme), Curvularia lunata (C. lunata), and Phytophthora parasitica var. nicotiana (P. p. var. nicotianae) using the mycelium growth rate method. Among the synthesized indole derivatives, compound 2j showed the highest inhibition rates of 100%, 95.7%, 89%, and 76.5% at a concentration of 500 μg/mL against F. graminearum, F. oxysporum, F. moniliforme, and P. p. var. nicotianae, respectively. Similarly, compounds 2j and 2q exhibited higher inhibition rates of 81.9% and 83.7% at a concentration of 500 μg/mL against C. lunata. In addition, compound 2j has been recognized as a potential compound for further investigation in the field of fungicides.

Single-stand selective monofunctional uracil DNA glycosylase 1 (SMUG1) works to remove uracil and certain oxidized bases from DNA during base excision repair (BER). This review provides a historical characterization of SMUG1 and 5-hydroxymethyl-2'-deoxyuridine (5-hmdU) one important substrate of this enzyme. Biochemical and structural analyses provide remarkable insight into the mechanism of this glycosylase revealing SMUG1 has a unique helical wedge which influences damage recognition during repair. Rodent studies suggest that, while SMUG1 shares substrate specificity with another uracil glycosylase UNG2, loss of SMUG1 can have unique cellular phenotypes. This review highlights the multiple roles SMUG1 may play in preserving genome stability, and how the loss of SMUG1 activity may promote cancer. Finally, we discuss recent studies indicating SMUG1 has moonlighting functions beyond BER, playing a critical role in RNA processing including the RNA component of telomerase.

Abstract Thyroid diseases have a complex and multifactorial aetiology. Despite the numerous studies on the signals referable to the malignant transition, still remain elusive the molecular mechanisms concerning the role of oxidative stress. Based on its strong oxidative power, H2O2 could be responsible for the high level of oxidative DNA damage observed in cancerous thyroid tissue and hyper-activation of mitogen-activated protein kinase (MAPK), and PI3K/Akt, that mediate ErbB signaling. Increased levels of 8-oxoG DNA adducts have been detected in the early stages of thyroid cancer. These DNA lesions are efficiently recognized and removed by the base excision repair (BER) pathway initiated by 8-oxoG glycosylase1 (OGG1). This study investigated the relationship between the EGFR and OGG1-BER pathways and their mutual regulation following oxidative stress stimulus by H2O2 in human thyrocytes. We clarified the modulation of ErbB receptors and their downstream pathways (PI3K / Akt and MAPK / ERK) under oxidative stress (from H2O2) at the level of gene and protein expression, according to the mechanism defined in a non-pathological cell system, Nthy-ori 3-1. Later, on the basis of the obtained results of gene expression cluster analysis in normal cells, we assessed the dysregulation of the relationships in a model of papillary thyroid cancer with RET/TPC rearrangement (TPC-1). Our observations demonstrated that a H2O2 stress may induce a physiological cross-regulation between ErbB and OGG1-BER pathways in normal thyroid cells (while this is dysregulated in the TPC-1 cells. Gene expression data also delineated that MUTYH gene could play a physiological role in cross-talk between ErbB and BER pathways and this function is instead lost in cancer cells. Overall our data about OGG1 protein expression suggest that the alternative splicing mechanisms may lead to different protein isoforms, physiologically regulated in response to ErbB modulation, and that these could be dysregulated in the progression of thyroid malignancies with RET/TPC rearrangement.

Most human genetic disease arises from point mutations. These genetic diseases can theoretically be corrected by gene therapy but clinic practice is still far from mature. Nearly half of the pathogenic single-nucleotide polymorphisms (SNPs) are caused by G:C>A:T or T:A>C:G base changes. The best current methods to repair these changes are by base editing without footprint using recently developed CRISPR-Cas9 technology by David Liu’s lab. These base editing methods have been confirmed with precision and efficiency in cultured mammalian cells, but it is barely confirmed and the efficiency is still very low. Animal models are important in dissecting pathogenic mechanism for human genetic diseases and efficacy testing of base correction in vivo. Cytidine base editor BE4 is a newly developed version of cytidine base editing system that converts cytidine (C) to uridine (U) in cultured mammalian cells but has not been proven in vivo. In this study, we have tested this system in cells to inactivate GFP gene and in mice by introducing single-base substitution that leads to a stop codon in tyrosinase gene. High percentage albino coat-colored mice were obtained from black coat-colored donor zygotes after pronuclei microinjection. Sequencing results showed that expected base changes were obtained with high precision and efficiency (56.25%). There are no off-targeting events identified in predicted off-target sites. Results confirm BE4 system can work in vivo with high precision and efficacy, and has great potentials in clinic to repair human genetic mutations.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

In this paper, a solenoid based linearly movable armature system is designed using robust control theory in order to improve the performance of the system. Reference track method is the best performance analysis for position control systems. Among the robust controllers, H infinity mixed-sensitivity and Mixed H 2 /H∞ with Regional Pole Placement Controllers are used to improve the performance of the system. Comparison of the proposed controllers for tracking a reference displacement signals (step and sine wave) and a promising simulation result have been obtained.

We report a small footprint cost-effective isothermal rapid DNA amplification system, with integrated microfluidics for automated sample analysis and detection of SARS-CoV-2 in human and environmental samples. Our system measures low-level fluorescent signal in real-time during amplification, while maintaining the desired assay temperature, on a low power, portable system footprint. A unique soft microfluidic chip design was implemented to mitigate thermocapillary effects and facilitate optical alignment for automated image capture and signal analysis. The system-on-board prototype coupled with the LAMP primers designed by BioCoS, is sensitive enough to detect viral loads of SARS-CoV-2 in a broad concentration range corresponding to a threshold cycle range of 16 to 39. Clinical specimens were tested at Kingston Health Sciences using a clinically validated PCR assay and variants were determined using whole genome sequencing.

Coronavirus Disease-19 (COVID-19) is caused by the infection of severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2). The virus enters host cells through receptor-mediated endocytosis of angiotensin-converting enzyme-2 (ACE2), leading to systemic inflammation, also known as a “cytokine storm,” and neuroinflammation. COVID-19’s upstream regulator, interferon-gamma (IFNG), is downregulated upon the infection of SARS-CoV-2, which leads to the downregulation of ACE2. The neuroinflammation signaling pathway (NISP) can lead to neurodegenerative diseases, such as Parkinson's disease (PD), which is characterized by the formation of Lewy Bodies made of α-Synuclein protein encoded by synuclein alpha (SNCA). This study presents the pathways involved in the downregulation of ACE2 following SARS-CoV-2 infection and its effect on PD progression. Through QIAGEN’s Ingenuity Pathway Analysis, the study identifies the NISP as a top-five canonical pathway/signaling pathway and SNCA as a top-five upstream regulator. Core Analysis was also conducted on the associated molecules between COVID-19 and SNCA to construct a network connectivity map. The Molecule Activity Predictor tool was used to simulate the infection of SARS-CoV-2 by downregulating IFNG, which leads to the predicted activation of SNCA, and subsequently PD, through a dataset of intermediary molecules. Downstream Effect analysis was further used to quantify the downregulation of ACE2 on SNCA activation.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In order to comprehensively evaluate the employee satisfaction of mine occupational health and safety management system, an analytic method based on fuzzy analytic hierarchy process and 2- tuple linguistic model was established. Firstly, based on the establishment of 5 first- grade indicators and 20 second- grade ones, the weight of each indicator is calculated and validated by method of FAHP and root mean square model. Secondly, a path based on the time-ordered Weighted Averaging Operator (T-OWA) model is constructed. Finally, the model is validated by empirical analysis. The results demonstrate that the employee satisfaction of the mine occupational health and safety management system is of the “general” rank. The method including the comprehensive evaluation of employee satisfaction and the quantitative analysis of language evaluation information ensures the authenticity of the language evaluation information.

in this article, an ultra-wideband traveling wave antenna with antipodal topology is proposed. The proposed design is realized on an economical substrate with minimum thickness. The proposed design offers an ultra-wide bandwidth of 26 to 40 GHz, translating to 42%. The dimensions of the antenna are 20mm x10mm x 0.5mm indicating an electrically compact structure. The proposed antenna offers high front to back ratio of at least 10dB across the bandwidth of operation. The forward gain of the antenna varies from 4 to 7dBi in the afore-mentioned band. The pattern integrity is maintained throughout the band. The antenna is fabricated using the commercial photolithography process. A mutli-step topology of the antennas is also proposed for wide angular coverage. The coverage is greater than 150º with mutual coupling less than 25dB. These performance metrics is achieved with a very small footprint. Simulated and experimental results are presented in this paper.

Abstract. Leiomyoma is a benign tumour of smooth muscle cells classified into three groups: solid leiomyoma, angioleiomyoma and leiomyoblastoma. Angioleiomyoma arises from the tunica media of veins and arteries of vascular smooth muscle.Nasal cavity, paranasal sinus and oral cavity are the most frequent locations in Head and Neck region. Here we present the case of a tongue base angioleiomyoma with an emphasis on clinical data, pathologic findings and surgical approach. The patient complained about a one-month of globus sensation, dysphagia and hemoptysis without other systemic symptoms. Laryngoscopy revealed the presence of a 2 cm solitary submucosal mass located on the left tongue base covered with normal mucosa. The patient underwent direct laryngoscopy to perform a biopsy for the purpose of achieving the conclusive diagnosis. Treatment options were discussed, included surgical resection. Transoral robot-assisted resection was performed without complications. Clearly the description of our case does not want to have a purpose in terms of indications but wants to describe the possibility of considering TORS in the case of benign tumours of the tongue base, especially in cases like this where a standard technique can difficulty be achieved. Current literature review was provided and discussed.

In this paper, a circularly polarized broadband slot antenna is designed for base station applications. The antenna is built on a square-shaped FR4 Epoxy substrate that measures 60mm in length and 1mm in height with a relative permittivity of 4.4. The ground plane has a recessed slot, and the feeding mechanism employs an offset microstrip line. The slot enables circular polarization and optimal impedance matching, which are enhanced further by offset feeding and the addition of stubs to create a composite-shaped patch. With an impedance bandwidth of 106% (1.28 GHz-4.16 GHz) and an axial ratio bandwidth of 69% (1.71 GHz-3.51 GHz), the CP broadband slot antenna effectively covers popular mobile communication bands such as GSM 1800, GSM 1900, 3G/LTE 2100, 3G/LTE 2300, 4G/LTE 2500, and 2.4 GHz Wi-Fi bands. The maximum gain is simulated to be 3.5 dB.

Plasma-activated water (PAW) is an emerging and promising green technology in the agriculture sector during recent years. The aim of this study was to examine the influence of the spraying of PAW and amino acid fertilizer concentrations on the physiological, biochemical and phytochemical characteristics of German chamomile varieties under field conditions. Method: The experiment was performed during 2020–2021 as a factorial using a randomized complete block design with three replications, in an arid and warm region. The factors contained five fertilizer levels (0 (control), 1, 2, 3 ml·L−1 amino acid and PAW) and three German chamomile cultivars Bona, Bodegold, Lianka). Physiological, biochemical and phytochemical traits such as plant height, fresh and dried flower weight, chlorophyll a, b, carotenoids, CHN elements, C:N ratio, total protein, amino acid profile, essential oil yield, apigenin content and major secondary metabolites were examined. Results: The ANOVA indicated that the impact of the cultivar and fertilizer was significant on all physiological, biochemical and phytochemical studied parameters. The amino acid fertilizer and PAW enhanced physiological features, hydrogen, C:N ratio, essential oil yield, apigenin content and main phytochemical compositions like chamazulene and α-bisabolol, but it had no incremental effect on the carbon, nitrogen, and total protein percentage. Conclusion: Findings revealed that the application of foliar amino acid fertilizer and PAW treatments improves physiological, biochemical and phytochemical parameters in German chamomile cultivars under field conditions.

Quantitative measurements of performance parameters has the potential to increase consistency and enhance performance of the surfaces as well as to contribute to the safety of horses and riders. This study investigates how factors known to influence the performance of the surface, incorpo-ration of a drainage package, control of the moisture control, and introduction of a geotextile reinforcement, affect quantitative measurements of arena materials. The measurements are made by using affordable lightweight testing tools which are readily available or easily constructed. Sixteen boxes with arena materials at a consistent depth were tested with the Going Stick (GS), both penetration resistance and shear, the impact test device (ITD), and the rotational peak shear device (RPS). Volumetric moisture content (VMC %) was also tested with time-domain reflectometry (TDR). Results obtained using GS, RPS, ITD, and TDR indicate that the presence of the drainage package, moisture content, and geotextile addition were detected. Alterations due to combinations of treatments could also be detected by GS, ITD, and TDR. While the testing showed some limi-tations of these devices, the potential exists to utilize them for quality control of new installations as well as for the monitoring of maintenance of the surfaces.

Global population is predicted to approach 10 billion by 2050, an increase of over 2 billion from today. To meet the demands of growing, geographically and socio-economically diversified nations, we need to diversity and expand agricultural production. This expansion of agricultural productivity will need to occur under increasing biotic, and environmental constraints driven by climate change. Clustered regularly interspaced short palindromic repeats-site directed nucleases (CRISPR-SDN) and similar genome editing technologies will likely be key enablers to meet future agricultural needs. While the application of CRISPR-Cas9 mediated genome editing has led the way, the use of CRISPR-Cas12a is also increasing significantly for genome engineering of plants. The popularity of the CRISPR-Cas12a, the type V (class-II) system, is gaining momentum because of its versatility and simplified features. These include the use of a small guide RNA devoid of trans-activating crispr RNA (tracrRNA), targeting of T-rich regions of the genome where Cas9 is not suitable for use, RNA processing capability facilitating simpler multiplexing, and its ability to generate double strand breaks (DSB) with staggered ends. Many monocot and dicot species have been successfully edited using this Cas12a system and further research is ongoing to improve its efficiency in plants, including improving the temperature stability of the Cas12a enzyme, identifying new variants of Cas12a or synthetically producing Cas12a with flexible PAM sequences. In this review we provide a comparative survey of CRISPR-Cas12a and Cas9, and provide a perspective on applications of CRISPR-Cas12 in agriculture.

The article describes facile one-pot, hi-yielding reactions to synthesize substituted 3,4-dimethyl-1H-pyrrole-2-carboxamide (3a–m) and carbohydrazide analogues (5a–l) as potential antifungal and antimicrobial agents. The structural integrity and purity of the synthesized compounds were assigned based on appropriate spectroscopic techniques. Synthesized compounds were assessed in vitro for antifungal and antibacterial activity. The compound 5h, 5i and 5j were found to be the most potent against A. fumigatus, with MIC value of 0.031 mg/mL. The compound 5f bearing a 2,6-dichloro group on the phenyl ring was found to be the most active broad spectrum antibacterial agent with MIC value of 0.039 mg/mL. The mode of action of the most promising antifungal compounds (one representative from each series; 3j and 5h) was established by their molecular docking to the active site of sterol 14α-demethylase. Molecular docking studies revealed a highly spontaneous binding ability of the tested compounds in the access channel away from catalytic heme iron of the enzyme, which suggested that the tested compounds inhibit this enzyme and would avoid heme iron related deleterious side effects observed with existing antifungal compounds.

This paper constitutes an original and new methodology for the determination of the surface properties of carbon fibers in the two oxidized and untreated forms by inverse gas chromatography technique at infinite dilution based on the effect of the temperature on the surface area of the various organic molecules adsorbed on the carbon fibers. The studied thermal effect proved a large deviation of the classical methods or models relative to the new determination of the surface properties of carbon fibers, such as the dispersive component of their surface energy, the free surface energy, the free specific energy, the enthalpy and entropy of adsorption of molecules on the carbon fibers. The obtained specific enthalpy and entropy of adsorption for the polar solvents led to the determination of the Lewis’s acid-base constants of carbon fibers. Different molecular models and chromatographic methods were used to quantify the surface thermodynamic properties of carbon fibers and compared to the thermal model. The obtained results proved that the oxidized carbon fibers gave more specific interaction energy and greater acid-base constants than that of the untreated carbon fibers and thus highlighting the important role of the oxidization on the acid-base of fibers. The determination of the specific acid-base surface energy of the two carbon fibers showed greater values of the oxidized carbon fibers relative to the untreated carbon fibers. An important basic character was highlighted for the two studied carbon fibers, larger than the acidic character. It was observed that the Lewis’s acid-base constants of the oxidized carbon fibers are larger than that of the untreated fibers with more accentuated basic charterer. This result was confirmed by all molecular models and chromatographic methods.

(1) Background: Some evidence suggests that cannabidiol (CBD) has potential to help alleviate HIV symptoms due to its antioxidant and anti-inflammatory properties. Here we examined acute CBD effects on various behaviors and the endocannabinoid system in HIV Tat transgenic mice. (2) Methods: Tat transgenic mice (female/male) were injected with CBD (3,10,30 mg/kg) and assessed for antinociception, activity, coordination, anxiety, and recognition memory. Brains were taken to quantify endocannabinoids and related lipids. Additionally, CBD and metabolite 7-hydroxy-CBD were quantified in the plasma and cortex. (3) Results: Tat decreased striatal-related nociception and locomotion, with some sex-dependent effects on coordination. CBD had no effect on nociception and coordination, but increased locomotor activity. For anxiety, differential CBD effects were noted for sex, with decreasing anxiety-like behavior in males only. In the striatum and spinal cord, male sex was associated with lower 2-arachidonoylglycerol and with elevated concentrations of its proinflammatory metabolite arachidonic acid. CBD metabolism was altered by sex and Tat. (4) Conclusion: Findings indicate that acute CBD effects are not altered by HIV Tat, and CBD has minimal effects on behavior and the endocannabinoid system. Interestingly, sex-dependent alterations were noted for endocannabinoids and related lipids, which may be of relevance in view of potential CBD-based treatment options for people living with HIV.

Since the discovery of the Coronavirus disease 2019 (COVID-19) outbreak, a vast majority of studies have been carried out that confirmed the worst outcome of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection in people with preexisting health conditions, including diabetes, obesity, hypertension, cancer, and cardiovascular diseases. Likewise, diabetes itself is one of the leading causes of global public health concerns that impose a heavy global burden on public health as well as socio-economic development. Both diabetes and SARS-CoV-2 infection have their independent ability to induce the pathogenesis and severity of multi-system organ dysfunction, while the co-existence of these two culprits can accelerate the pathophysiology and magnify the severity of the diseases. However, the exact pathophysiology of multi-system organ failure in diabetic patients after SARS-CoV-2 infection is still obscure. This review summarized the organ-specific possible molecular mechanisms of SARS-CoV-2 and diabetes-induced pathophysiology of several diseases of multiple organs, including the lungs, heart, kidney, brain, eyes, gastrointestinal system, and bones, and subsequent manifestation of multi-system organ failure.

Western Anatolia comprises a vast amount of various volcanic successions spanning from Eocene to Upper Miocene periods. These units mainly display southward younging in broad sense and display large amounts of chemical variation that spanned from basalt to rhyolite. The southward younging of magmatism and chemical variations have been largely attributed to the retreat and roll-back of the Hellenic slab and the western escape of the Anatolian microplate. However, there is still a lack of high precision data to pinpoint the exact nature of the magmatism and lithospheric tectonics. In this contribution we investigated a poorly known region along the Western Anatolia along Manisa district called Karakılıçlı volcanic field. We investigated two different volcanic sections (Kalpakkaya and Çamlık hill) that display the best volcano-sedimentary features in terms of geochronology and geochemistry. Samples acquired from the bottom, middle and upper portions of these sections display Early-Middle Miocene ages of 17.64±0.20, 17.22±0.15, 16.16±0.17 and 16.36±0.13, 15.79±0.71 and 13.61±0.20 Ma respectively. The results indicate that the volcanism in the region generated by the melting of the mantle and/or lithospheric mantle by slab retreat and roll-back of the Hellenic slab and evolved in the shallow magma chambers/mushes by fractional crystallization, magma mixing and crustal assimilation.

The most important step for the installation of a wind farm is to know the wind regime in the region, since an error in estimating this wind speed causes an error proportional to the cube of power, resulting in financial losses for investors. Therefore, knowing the methods used for predicting wind speed becomes important and the knowledge of how research and studies in this area are going helps map the subject and outline strategies for developing research in strategic areas. For this purpose, the Scopus database was used considering some keywords, such as ("forecast" OR "prevision") AND "wind" AND ("turbine" OR "power" OR "energy" or "velocity" or "speed"), considering the period since 2019, and analyzing the data of the documents found using the Bibliometrix package. With the results found, it was possible to map researchers, institutions that are developing work in this area, in addition to the most cited articles, among other aspects analyzed.

In recent years, drones have been used in a wide range of fields such as agriculture, transportation of goods, and security. Drones equipped with communication facilities are expected to play an active role as base stations in areas where ground base stations are unavailable, such as disaster areas. In addition, asynchronous operation is being considered for local 5G in order to support all kinds of use cases. In asynchronous operation, cross-link interference between base stations is an issue. This paper attempts to reduce the interference caused by the drone network by introducing circularly polarized antennas. Numerical analyses are conducted to validate the effectiveness of the proposed system, where SIRs (Signal-to-Interference Ratio) are shown to be improved significantly as the numerical evaluation results.

Surgical ciliated cysts occur primarily in the maxilla after radical maxillary sinus surgery. We report a first case of a surgical ciliated cyst that developed in the infratemporal fossa 25 years after the patient sustained severe facial trauma. The patient complained of mandibular pain and limited mouth opening. The patient’s condition was completely resolved 5 months after marsupialization via Le Fort I osteotomy. Surgical morbidities can be minimized by proper diagnosis and less invasive surgery.

Suzuki cross-coupling reaction has developed one of the furthermost effectual approaches for the synthesis of biaryls or substituted aromatic moieties from aryl halides and arylboronic acids with a palladium-catalyst in the past two era’s. Herein, Pd-free layered double hydroxide containing nickel catalysts were prepared by co-precipitation method under ultrasonic irradiation and N2 atmosphere with different molar ratios of Ni: Mg: Al and coded as (1NiLDHs-Dr), (1.5NiLDHs-Dr) and (2NiLDHs-Dr). A series of reduced catalysts under 5%H2/N2 at different temperatures were coded as 1NiLDHs-R200, 1.5NiLDHs-R200 and 2NiLDHs-R200. As-synthesized 2NiLDHs-Dr was the superlative catalyst when coupling different aryl halides with different boronic acids derivatives. Deep investigation of all catalysts was done using different techniques such as inductively coupled plasma optical emission spectroscopy (ICP-OES), x-ray photoelectron spectroscopy (XPS), powder x-ray diffraction (XRD), thermogravimetric analyses (TGA), Fourier transfer infrared (FTIR), scanning electron microscope (SEM) connected with energy dispersive x-ray (EDX) and N2-physisorption at -196 ℃. The results attained verified that ɑ-Ni(OH)2 was fashioned for 2NiLDHs-Dr catalyst and the enclosure of nickel ions in the cationic sheet of layered structure were responsible for the fascinating catalytic efficacy rather than the basic nature of material. The Ni-containing LDHs catalysts encourage forthcoming studies in Pd-free catalyzed C-C coupling reactions.

5-(4-aminophenyl )-2-amino -1,3,4-thiadiazole was prepared by reaction of Thiosemicarbazide with 4-amino benzoic acid under reflux condition for 7 hours. The compound which has been synthesized successfully was subjected to addition reaction with 4-(Dimethylamino) benzaldehyde under reflux condition for 6 hours to synthesize Schiff bases. These compounds was characterized by using FTIR) and evaluated for their anticancer activity. The effect of (1, 3, 4-thiadiazole derivative) on the activity of malignant cells was studied by using different types of cell lines [Breast cancer, and human prostate cancer]. And was used the Electron microscope to show that the effect of the derivative on the cancer cells before and after 3 days of the injection time. It was found that the Schiff base of thiadiazole-1,3,4-(Dimethylamino)benzylidineamino]- [4-2-phenyl]amino was effective in reducing the size and density of malignant cells. That of 46.7 while in breast ) 145(DUprostate for growth inhibition produce of equal 85.9 µg/ml.

The poly lactic acid (PLA) is one of the most used bio-derived thermoplastic polymers in 3D and 4D printing applications. The determination of PLA surface properties is of capital importance in 3D/4D printing technology. (1) Background: The surface thermodynamic properties of PLA polymer were determined by using the inverse gas chromatography (IGC) technique at infinite dilution. The determination of the retention volume of polar and non-polar molecules adsorbed on the PLA particles filling the column allowed us to obtain the dispersive, polar, and Lewis’s acid-base surface properties at different temperatures from 40 °C to 100 °C. (2) Methods: the applied surface method was based on our recent model that used the London dispersion equation and the new chromatographic parameter function of the deformation polarizability and the harmonic mean of the ionization energies of the PLA polymer and organic molecules. (3) Results: The application of this new method led to the determination of the dispersive and polar free surface energy of adsorption of molecules on the polymeric material, as well as the glass transition and the Lewis acid-base constants. (4) Conclusions: four interval temperatures were distinguished showing four zones of the variations of the surface properties of PLA as a function of the temperature before and after the glass transition.

In post-COVID-19 syndrome, clinical presentation of the nerve fiber dysfunction plays an important role. The possibility of autoantigen cross-mimicry of coronavirus infection and the peripheral nervous system need to be investigated. The bioinformatic analysis was applied to search for possible common protein sequences located in the immunological epitopes. Among the autoantigens of the human nervous system, fibroblast growth factor receptor protein 3, myelin protein P0, myelin protein P2, sodium channel protein type 9, alpha protein subunit, plexin-D1 protein and ubiquitin-carboxyl-terminal hydrolase protein of the L1 isoenzyme were selected. The “Alignmentaj” program was created. The UniProt database, Protein Data Bank and AlphaFold databases were used. The analysis of protein sequence similarities of spike glycoproteins in human coronaviruses revealed common pentapeptides of the MERS-CoV-2 virus with the fibroblast growth factor receptor 3 and myelin protein P2. Among seasonal coronaviruses, common peptide sequences were identified in HCoV-HKU-1 virus with sodium channel protein type 9 subunit alpha and Plexin-D1, HCoV-OС43 with Plexin-D1, as well as HCoV-NL63 with Plexin-D1 and Ubiquitin carboxyl-terminal hydrolase isozyme L1. The data obtained make it possible to identify new potential targets for the development of autoimmune reactions that occur against the background of the activity of highly pathogenic and seasonal coronaviruses.

Smoking is a risk factor for respiratory infections and there is reasonable concern that it may affect COVID-19 susceptibility and severity. Recent studies have focused on the interaction between smoking (and nicotine) and ACE2 expression, suggesting that ACE2 up-regulation could contribute to enhanced viral cell entry. However, case series have shown that there is an unexpectedly low prevalence of smoking among hospitalized COVID-19 cases. Since early April, we were the first to hypothesize that dysfunction of the nicotinic cholinergic system (NCS) may be implicated in the pathophysiology of severe COVID-19. We recently reported that many of the clinical manifestations of severe COVID-19 could be explained by dysregulation of the NCS. In this study, we present an amino acid sequence in the receptor binding domain of the SARS-CoV-2 Spike glycoprotein which is homologous to a sequence of a snake venom toxin. We present the 3D structural location of this “toxin-like” sequence on the Spike Glycoprotein. These findings suggest that SARS-CoV-2 could potentially interact with acetylcholine receptors causing dysregulation of the NCS and the cholinergic anti-inflammatory pathway.

The goal of this paper is to contribute the perspective of a systems engineer to the effort to fight pandemics. The availability of low latency case data and effectiveness of social distancing suggest there is sufficient control for successful smoothing and targeting almost any desired level of low or high cases and immunity. This control proceeds from spontaneous public reaction to caseloads and news as well as government mediated recommendations and orders. We simulate multi-step and intermittent-with-feedback partial unlock of social distancing for rapidly-spreading moderate-mortality epidemics and pandemics similar to COVID-19. Optimized scenarios reduce total cases and therefore deaths typically 8% and up to 30% by controlling overshoot as groups cross the herd immunity threshold, or lower thresholds to manage medical resources and provide economic relief. We analyze overshoot and provide guidance on how to damp it. However, we find overshoot damping, whether from expert planning or natural public self-isolation, increases the likelihood of transition to an endemic disease. An SIR model is used to evaluate scenarios that are intended to function over a wide variety of parameters. The end result is not a case trajectory prediction, but a prediction of which strategies produce near-optimal results over a wide range of epidemiological and social parameters. Overshoot damping perversely increases the chance a pathogen will transition to an endemic disease, so we briefly describe the undershoot conditions that promote transition to endemic status.

Here we present an overview of speleothem δ18O records from South America, which mostly are available in the Speleothem Isotopes Synthesis and Analysis (SISAL_v1) database. South American tropical and subtropical δ18O time series are primarily interpreted as being driven by the amount effect and, consequently show the past history of the convection intensity of convergence zones such as the Intertropical Convergence Zone and the South America Monsoon System. We investigate past hydroclimate scenarios in South America related to the South American Monsoon System in three different time scales: Late Pleistocene, Holocene and the last two millennia. The precession driven insolation is the main driver of convective variability over the continent during the last 250 kyrs, including the Holocene period. However a dipole is observed between the west and east portions of the continent. Records located in the central region of Brazil appear to be weakly affected by insolation driven variability and more susceptible to the South Atlantic Convergence Zone. Cold episodic events in Northern Hemisphere increase the activity of the South American Monsoon System on all time scales, in turn increasing rainfall amounts in South America, as was documented during Heinrich events in the late Pleistocene and Bond events in the Holocene, as well as during the Little Ice Age.

Piezoelectric nanotransducers may offer key advantages in comparison with conventional piezoelectrics, including more choices for types of mechanical input, positions of the contacts, dimensionalities and shapes. However, since piezo-semiconductive nanostructures are generally much easier to fabricate and integrate into functional systems than insulating materials, modeling becomes significantly more intricate and the effects of free charges have been considered only in a few studies. The available reports are complicated by the absence of proper nomenclature and figures of merit. Besides, some analyses are incomplete. For instance, the local piezopotential and free charges within axially strained conical piezo-semiconductive nanowires have only been systematically investigated for very low doping (1016 cm-3) and under compression. Here we give the definitions for the enhancement, depletion, base and tip piezopotentials, their characteristic lengths and both the tip-to-base and the depletion-to-enhancement piezopotential-ratios. As an example, we use these definitions for analyzing the local piezopotential and free charges in n-type ZnO truncated conical nanostructures with different doping levels (intrinsic, 1016 cm-3, 1017 cm-3) for both axial compression and traction. The definitions and concepts presented here may offer insight for designing high performance piezosemiconductive nanotransducers.

Water reuse for irrigation is increasingly recognized as an essential and economical strategy in areas with water scarcity. A simple, low-cost, low-maintenance, and highly efficient Pond-In-Pond (PIP) treatment system can be used for wastewater reuse. PIP is a treatment technology in which two types of ponds -- anaerobic and aerobic -- are combined into a single pond and consist of a deeper inner section entirely submerged within the outer pond. Previous studies on PIPs and PIP-like systems have reinforced the potential for reuse through promising performance results with BOD removal over 80% and a reduction in land area requirements by approximately 40%. Yet, no prior efforts have been made to understand the performance mechanism of such systems. This study makes use of two, 2-D modeling tools in developing a fundamental understanding of PIP flow dynamics and the expected performance. The modeling results showed that the PIP configuration offers improved flow diversion along with reduced flow velocity. Additionally, the PIP retained approximately 17% more (p<0.05) particles than the traditional pond with most of the particles concentrated within the inner pond. Lower velocity and the higher solids retention in the PIP thus allowed for better treatment performance compared to traditional ponds. The findings from this study can be used as preliminary data for future in-depth investigations of the PIP system leading toward effective and optimal designs. This will help address the major societal concern of water scarcity with low-cost and effective wastewater treatment.

Due to the health crisis caused by SARS-CoV-2, the creation of a new vaccine platform based on mRNA was implemented. Globally, around 13.32 billion COVID-19 vaccine doses of diverse platforms have been given, and up to this date, 69.7% of the total population received at least one injection of a COVID-19 vaccine. Although these vaccines prevent hospitalization and severe forms of the disease, increasing evidence has shown they do not produce sterilizing immunity, allowing people to suffer frequent re-infections. Recent research has also raised concerns that mRNA vaccines could induce immune tolerance, which, added to that caused by the virus itself, could complicate the clinical course of a COVID-19 infection. Furthermore, recent investigations have found high IgG4 levels in people who were administered two or more injections of mRNA vaccines. It has been suggested that an increase in IgG4 levels could have a protecting role by preventing immune over-activation, similar to that occurring during successful allergen-specific immunotherapy by inhibiting IgE-induced effects. Altogether, evidence suggests that the reported increase in the IgG4 levels detected after repeated vaccination with the mRNA vaccines is not a protective mechanism; rather, it may be a part of the immune tolerance mechanism to the spike protein that could promote unopposed SARS-CoV2 infection and replication by suppressing natural antiviral responses. IgG4-induced suppression of the immune system due to repeated vaccination can also cause autoimmune diseases, promotes cancer growth, and autoimmune myocarditis in susceptible individuals.

The main functions of the automated systems rely on the advanced sensors for detection and perception of the environment around the vehicle. Radars and cameras are commonly utilized to detect the potential obstacles and vehicles ahead on the road. Nevertheless, cameras can generate spurious detections in the extreme weather conditions such as fog, rain, dust, snow, dark, and heavy sunlight in the sky. Due to limitations in vertical field view of the radars, single radars are not reliable to detect the height of the targets precisely. In this paper, a triple radar arrangement (long-range, medium-range, and short-range radars) based on sensor fusion technique is proposed to detect objects with different size in level 2 Advanced Driver-Assistance (ADAS) system. The typical objects including truck, pedestrians, and animals are detected in different scenarios. The developed model considered ISO 26262 and ISO/PAS 21448 to reasonably address insufficient robustness and inability of the sensors. The models of sensor and level 2 ADAS systems are developed using MATLAB toolbox and Simulink. Sensor detection performance is determined by running simulations with triple radar setup. Obtained results demonstrate that the proposed approach generates accurate detections of targets in all tested scenarios.

SARS-CoV-2 can trigger autoimmune central nervous system (CNS) diseases in genetically susceptible individuals, a mechanism poorly understood. Molecular mimicry (MM) has been identified in other viral diseases as potential triggers of autoimmune CNS events. This study investigated if MM is the process through which SARS-CoV-2 induce the breakdown of immune tolerance. The frequency of autoimmune CNS disorders was evaluated in a prospective cohort with patients admitted in the COVID-19 Intense Care Unity (ICU) in Rio de Janeiro. Then, an in silico analysis was performed to identify the conserved regions which share high identity between SARS-Cov-2 anti-gens and human proteins. The sequences with significant identity and antigenic properties were then assessed for their binding capacity to HLA subtypes. Of the 112 patients included, 3 were classified as having an autoimmune disorder. A total of eleven combinations had significant linear and three-dimensional overlap. NMDAR1, MOG and MPO were the self-antigens with more significant combinations, followed by GAD65. All sequences presented at least one epitope with strong or intermediate binding capacity to the HLA subtypes selected. This study underscores the possibility that CNS autoimmune attacks observed in COVID-19 patients, including those in our population, could be driven by MM in genetically predisposed individuals.

The aim of this work is research dedicated to the search for new bactericidal systems for use in cosmetic formulations, dermocosmetics, or the production of wound dressings. Over the last two decades chitosan due to its special biological activity, has become a highly indispensable biopolymer with very wide application possibilities. Literature reports on the antibacterial effects of chitosan are very diverse, but our research has shown that they can be successfully improved through chemical modification. Therefore, in this study, results on the synthesis of new Schiff bases chitosan – dCsSB-SFD and dCsSB-PCA obtained using two aldehydes: sodium 4-formylbenzene-1,3-disulfonate (SFD) and 2-pyridine carboxaldehyde (PCA) respectively. Chitosan derivatives synthesized in this way demonstrate stronger antimicrobial activity. Carrying out the procedure of grafting chitosan with a caproyl chain allowed obtaining compatible blends of chitosan derivatives with κ-carrageenan, which are stable hydrogels with a high swelling coefficient. Furthermore, covalently bounded PCL improved the solubility of obtained polymers in organic solvents. With this respect, the Schiff base-containing polymers obtained in this study, with special hydrogel and antimicrobial properties are very promising materials for the potential use as a controlled-release formulation of both, hydrophilic and hydrophobic drugs in cosmetic products for skin health.

Layered double hydroxides (LDHs) have emerged as promising catalysts for various acid-base catalytic reactions. Due to their unique structure and regulatable dual acid-base properties, they offer more environmentally friendly and sustainable alternatives to traditional liquid acid and base catalysts. This study introduces the structural composition, preparation methods, and acid-base catalytic properties of LDHs-based catalysts. Recent application progress of LDHs and rehydrated LDHs, LDHs-based metal nanocatalysts, and LDHs-based mixed metal oxide catalysts used as solid acid-base catalysts in acid-base green catalytic conversion is reviewed. The challenges and prospects of LDHs-based catalysts as green and sustainable catalysts are summarized and proposed.

Platinum group metals (PGMs) high-grade ore tonnage from Merensky reef keeps on depreciating forcing the metallurgical industry to explore beneficiating PGMs from upper group 2 (UG2) ore which has up to 60% content of chromite and from secondary sources. The PGMs are naturally associated with base metal sulphides and the efficacy of the PGMs extraction processes is dependent on the processing of PGMs-bearing base metal sulphides. These processes include concentrating PGMs-bearing base metal sulphides through flotation, oxidation, etc. prior the metal extraction processes. The evolving mineralogy of PGMs ores has necessitated the use of multiple reagents to enhance the efficiency of the concentration process. This has led to an increased amount of inor-ganic chemicals disposal to the environment and the processing of PGMs to be less economic. Bio-technology has been investigated as a potential low cost, ecologically safe substitute for many current minerals processing methods. The metabolites produced by microorganisms have been used for many years with great success in the leaching and flotation of metals from medium and low-grade sulphide minerals. The possible application of microorganism mainly Acidithiobacillus ferrooxidans (A. ferrooxidans) in the metallurgical processing of PGMs-bearing base metal sulphides is systematically reviewed in this paper. The main emphasis is on the use of A. ferrooxidans in bio-oxidation and bioleaching, as well as their potential to substitute inorganic reagents in the flo-tation of PGMs-bearing base metal sulphides from primary and secondary sources

A series of MgAl-layered double hydroxide (MgAl-HT), the calcined form at 500^oC (MgAlO_x) and the re-hydrated one at 25^oC (MgAl-HT-RH) were synthesized. Physicochemical properties of the catalysts were characterized by x-ray diffraction (XRD), scanning electron microscopy (SEM). Surface area of the as-synthesized, calcined and re-hydrated catalysts was determined by N₂ physisorption at -196^oC. CO₂-teperature programmed desorption (CO₂-TPD) was applied to determine the basic sites of catalysts. The catalytic test reaction was carried out using benzaldehyde and their derivatives with nitromethane and their derivatives. The Henry products (1-15) were obtained in a very good yield using MgAl-HT-RH catalyst either by conventional method at 90^oC in liquid phase, or under microwave irradiation method. The mesoporous structure and basic nature of re-hydrated solid catalyst were responsible for their superior catalytic efficiency. The robust nature was determined by using the same catalyst for five times, where the product % yield was almost unchanged significantly.

We are in amidst of COVID-19 pandemic. Since Dec 2019, severe acute respiratory corona virus (SAR-CoV-2) has infected more than half a billion people killing nearly 7 million people worldwide. Now the BA.5 variant of SARS-CoV-2 is causing mayhem and driving the global surge. Epidemiologist are aware of the fact that this virus is capable of escaping immunity and likely to infect the same person multiple times despite adequate vaccination status. Elderly people of age more than 60 years and those with underlying health conditions are considered as high-risk who are likely to suffer complications and death. While it is tempting to frame complications and mortality from COVID-19 as a simple matter of too much of a virulent virus in too weak of a host, much more is at play here. Framing the pathophysiology of COVID-19 in the context of the Chrousos and Gold model of the central stress response system can shed insight into its complex pathogenesis. Understanding the mechanisms by which pharmacologic modulation of the central stress response system via administration of clonidine and/or dexamethasone may offer an explanation as to why a viral pathogen can be well tolerated and cleared by one host while inflaming and killing another.

The determination of the specific surface free energy, specific properties and Lewis’s acid base of solid materials is of capital importance in many industrial processes such as adhesion, coatings, two dimensional films and adsorption phenomena. (1) Background: The physicochemical properties of many solid particles were characterized during the last forty years by using the retention time of injected well-known molecules into chromatographic column containing the solid substrates to be characterized. The obtained net retention time of the solvents adsorbed on the solid allowing the determination of the net retention volume directly correlated to the specific surface variables, dispersive, polar and acid-base properties. (2) Methods: Many chromatographic methods were used to quantify the values of the different specific surface variables of the solids. However, one found a large deviation between the different results. In this paper, one proposed a new method that quantify the specific free energy of adsorption as well as the Lewis’s acid-base constants of many solid surfaces. (3) Results: The new applied method allowed us to obtain the specific enthalpy and entropy of adsorption of polar model organic molecules on several solid substrates such as silica, alumina, MgO, ZnO, Zn, TiO2 and carbon fibers. (4) Conclusions: our new method based on the separation between the dispersive and polar free surface energy allowed to better characterize the solid materials.

Not only does this paper present a novel type-2 fuzzy system for identification and behavior prognostication of an experimental solar cell set and a wind turbine, but also it brings forward an exquisite technique to acquire an optimal number of membership functions and the corresponding rules. It proposes a seven-layered NCPRT2FS. For fuzzification in the first two layers, Gaussian type-2 fuzzy membership functions with uncertainty in the mean, are exploited. The third layer comprises rule definition and the forth one embeds fulfillment of type reduction. The three last remained layers are the ones in which resultant left–right firing points, two end-points and output all get assessed correspondingly. It should not be neglected off the nutshell that recurrent feedback at the fifth layer exerts delayed outputs ameliorating efficiency of the suggested NCPRT2FS. Later in the paper, a modern structural learning, established on type-2 fuzzy clustering, is held forth. An adaptively rated learning back-propagation algorithm is extended to adjust the parameters ensuring the convergence as well. Eventually, solar cell photo-voltaic and wind turbine are deemed as case studies. The experimental data are exploited and the consequent yields emerge so persuasive.

Dystrophin-deficient cardiomyopathy (DDC) is currently the leading cause of death in patients with dystrophinopathies. Targeting myocardial fibrosis (MF) has become a major therapeutic goal in order to prevent the occurrence of DDC. We aimed to review and summarize the current evidence about the role of the renin-angiotensin-aldosterone system (RAAS) in the development and perpetuation of MF in DCC. We conducted a comprehensive search of peer-reviewed English literature on PubMed about this subject. We found increasing preclinical evidence from studies in animal models during the last 20 years pointing out a central role of RAAS in the development of MF in DDC. Local tissue RAAS acts directly mainly through its main fibrotic component angiotensin II (ANG2) and its transducer receptor (AT1R) and downstream TGF-b pathway. Also, it modulates the actions of most of the remaining pro-fibrotic factors involved in DDC. Despite limited clinical evidence, RAAS blockade constitutes the most studied, available and promising therapeutic strategy against MF and DDC. Conclusion: Based on the evidence reviewed, it would be recommendable to start RAAS blockade therapy through angiotensin converter enzyme inhibitors (ACEI) or AT1R blockers (ARBs) alone or in combination with mineralocorticoid receptor antagonists (MRa) at the youngest age after the diagnosis of dystrophinopathies, in order to delay the occurrence or slow the progression of MF, even before the detection of any cardiovascular alteration.

Smartphone-based point-of-care testing (POCT) is rapidly emerging as an alternative to traditional screening and laboratory testing, particularly in resource-limited settings. In this proof-of-concept study, we present a smartphone- and cloud-based artificial intelligence quantitative analysis system (SCAISY) for relative quantification of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-specific IgG antibody lateral flow assays that enables rapid and accurate evaluation of test strips. By capturing an image with a smartphone camera, SCAISY quantitatively analyzes antibody levels and provides results to the user. We analyzed changes in antibody levels over time in over 248 individuals, including vaccine type, number of doses, and infection status, with a standard deviation of less than 10%. We also tracked antibody levels in six participants before and after SARS-CoV-2 infection. Finally, we examined the effects of lighting conditions, camera angle, and smartphone type to ensure consistency and reproducibility. This study suggests that SCAISY is a simple and powerful tool for real-time public health surveillance, enabling the acceleration of quantifying SARS-CoV-2-specific antibodies generated by either vaccination or infection and tracking of personal immunity levels.

This study presents a vibration control using actively tunable vibration absorbers (ATVA) to suppress vibration of a thin plate. The ATVA’s is made of a sandwich hollow structure embedded with the electrorheological fluid (ERF). ERF is considered to be one of the most important smart fluids and it is suitable to be embedded in a smart structure due to its controllable viscosity property. ERF’s apparent viscosity can be controlled in response to the electric field and the change is reversible in 10 microseconds. Therefore, the physical properties of the ERF-embedded smart structure, such as the stiffness and damping coefficients, can be changed in response to the applied electric field. A mathematical model is difficult to be obtained to describe the exact characteristics of the ERF embedded ATVA because of the nonlinearity of ERF’s viscosity. Therefore, a fuzzy modeling and experimental validations of ERF-based ATVA from stationary random vibrations of thin plates are presented in this study. Because Type-2 fuzzy sets generalize Type-1 fuzzy sets so that more modelling uncertainties can be handled, a semi-active vibration controller is proposed based on Type-2 fuzzy sets. To investigate the different performances by using different types of fuzzy controllers, the experimental measurements employing type-1 fuzzy and interval type-2 fuzzy controllers are implemented by the Compact RIO embedded system. The fuzzy modeling framework and solution methods presented in this work can be used for design, performance analysis, and optimization of ATVA from stationary random vibration of thin plates.

Adeno-associated viral (AAV) vectors can be used for gene delivery. AAV.CAP-Mac was recently developed; it can cross the blood-brain barrier and transduce cells throughout the CNS. However, some brain regions were not transduced in adult rhesus monkeys. Additionally, AAV vectors can only package 5 kb of DNA. Also, AAV vectors may be genotoxic and cytotoxic, especially at high doses. Finally, AAV vectors are very expensive to produce at sufficiently high titers for treatment. Off-the-shelf cell-based delivery systems wherein the cells can infiltrate the target tissue and be hyper-motile would be ideal. Also, mRNA-based gene editing would be a transient treatment, and thus be much safer.

The relationship between the structure characteristics and performances of coal based hydrogenation isomeric base oil (CTL) and metallocene catalyzed coal based polyalphaolefin (mPAO) base oil was clarified here. CTL and mPAO were compared with typical petroleum based and natural gas based commercial API Class III and IV base oils. Pressurized differential scanning calorimetry (PDSC), Rotary Bomb Oxidation Test (RBOT) and four-balls friction tester were used to evaluate the oxidation stability and lubrication performance of base oils under different working conditions. The sensitivity of different base oils to typical antioxidants and extreme pressure antiwear agents was compared. Specially, the composition and structure of CTL base oil are obviously different from GTL and mineral base oil. The coal-based CTL and mPAO base oils exhibit commendable viscosity-temperature properties, characteristics, coupled with low-temperature fluidity, fire safety, and minimal evaporation loss. The lubricating properties, oxidation stability and the sensitivity to extreme pressure antiwear agents of CTL are close to those of similar base oils. But the sensitivity of CTL to typical antioxidants is relatively poor. Besides, compared with commercial PAO base oil, mPAO has lower isomerization degree and fewer isomerization types. The oxidation stability and sensitivity to typical antioxidants of mPAO base oil are comparable with those of commercial PAO base oil, while its lubrication performance and sensitivity to typical extreme pressure antiwear agents are significantly better than those of commercial PAO base oil.

Recently, federated learning (FL) has been receiving great attention as an effective machine learning method to avoid the security issue in raw data collection as well as to distribute the computing load to edge devices. However, even though wireless communications is a essential part for implementing FL in edge networks, there have been a few works that analyze the effect of wireless networks on FL. In this paper, we investigate FL in small-cell networks where multiple base stations (BSs) and users are located according to homogeneous Poisson point process (PPP) with different densities. We comprehensively analyze the effects of geographic node deployment on the model aggregation in FL on the basis of stochastic geometry-based analysis. We derive the closed-form expressions of coverage probability with tractable approximations and discuss the minimum required BS density for achieving a target model aggregation rate in small-cell networks. Our analysis and simulation results provide insightful information for understanding the behaviors of FL in small-cell networks, and it can be exploited as a guideline for designing the network facilitating the wireless FL.

The functions of annexin A1 (ANXA1) that is expressed on membranes and in cytoplasmic granules have been fully described. Nonetheless, the role of this protein in protecting against DNA damage in the nucleus is still emerging and requires further investigation. Here, we investigated the involvement of ANXA1 in DNA damage response in placental cells. Placenta was collected from ANXA1 knockout mice (AnxA1-/-) and pregnant women with gestational diabetes mellitus (GDM). The placental morphology and ANXA1 expression, which are related to the modulation of cellular response markers in the presence of DNA damage, were analyzed. Total area of AnxA1-/- placenta was smaller because of reduced labyrinth zone, enhanced DNA damage, and impaired base excision repair (BER) enzymes, which resulted in the induction of apoptosis in the labyrinthine and junctional layers. The placentas from pregnant women with GDM showed reduced expression of AnxA1 in the villous compartment, increased DNA damage, apoptosis, and reduction of enzymes involved in the BER pathway. Our translational data provide valuable insights into the possible involvement of ANXA1 in the response of placental cells to oxidative DNA damage and represent advancement in investigations on the mechanisms involved in placental biology.

For the emerging autonomous swarm technology, from the perspective of systems science and systems engineering, there must be some novel elements and methods to aggregate multiple systems into a group, which distinguish with the general components with specific functions, and we expect to provide the presentation of their existence in the swarm development processes. The inspiration of our methodology origins from the integration of swarm ontology, multi-paradigm modeling, multi-agent system, cyber-physical system, etc. Therefore, we choose the model-driven technology as a framework to acquire an approach of model representation across the multiple levels of abstraction and composition. The autonomous strategic mechanism is defined and formed in parallel with ConOps analysis and systems design, so as to effectively solve the cognitive problem of emergence caused by the nonlinear causation among individual and whole behaviors. This approach highlights to use the MBSE processes and their artifacts to embed the meso mechanism to integrate the operational and the functional, and which means to connect the macro and micro aspects in formalism and so to become a whole with its expected goals, and then to verify and validate within a L-V-C simulation environment.

In winter sports, the equipment often comes into contact with snow or ice, and this contact generates a force that resists motion. In some sports, such as cross-country skiing, this resistive force can significantly affect the outcome of a race, as a small reduction in this force can give an athlete an advantage. Researchers have examined the contact between skis and snow in detail, and to fully understand this friction, the entire ski must be studied at various scales. At the macro scale, the entire geometry of the ski is considered and the apparent contact between the ski and the snow is considered and at the micro scale the contact between the snow and the ski base ski-base textures. In the present work, a method for characterising contact between the ski-base texture and virtual snow will be presented. Six different ski-base textures will be considered. Five of them are stone-ground ski bases, and three of them have linear longitudinal textures with a varying number of lines and peak-to-valley height, and the other two are factory-ground “universal” ski bases. The sixth ski base has been fabricated by a steel-scraping procedure. In general, the results show that a ski base texture with a higher Spk-value has less real contact area, and that the mutual differences can be large for surfaces with similar Sa-values. The average interfacial separation is, in general, correlated with the Sa-value, where a “rougher” surface exhibits a larger average interfacial separation. The results for the reciprocal average interfacial separation, which is related to the Couette type of viscous friction, were in line with the general consensus that a “rougher” texture performs better at high speed than a “smoother” one, and it was found that a texture with high Sa and Spk values resulted in a low reciprocal average interfacial separation and consequently low viscous friction. The reciprocal average interfacial separation was found to increase with increasing real contact area, indicating a correlation between the real area of contact and the Couette part of viscous friction.

Abiotic stresses, including drought, salinity, cold, heat, and heavy metals, extensively reduce global agricultural production. Approaches such as conventional breeding and transgenic breeding have been widely used to cope with these environmental stresses. The clustered regularly interspaced short palindromic repeat- Cas (CRISPR/Cas) based gene-editing tool has revolutionized due to its simplicity, accessibility, adaptability, flexibility, and wide applicability. This system has a great potential to build up crop varieties with enhanced tolerance against abiotic stresses. In this review, we summarize the most recent findings on understanding the mechanism of abiotic stress response in plants and the application of CRISPR/Cas mediated gene-editing system towards enhanced tolerance to drought, salinity, cold, heat, and heavy metals stresses. Furthermore, in this review, we highlighted the recent advancements in prime editing and base editing tools for crop improvement.

Using density functional theory (DFT) and the information-theoretic approach (ITA) quantities to appreciate the energetics and properties of biopolymers is still an unaccomplished and ongoing task. To this end, we studied the building blocks of nucleic acid base pairs and small peptides. For base pairs, we have dissected the relative importance of energetic components by using two energy partition schemes in DFT. Our results convincingly show that the exchange-correlation effect predominantly governs the molecular stability of base pairs while the electrostatic potential plays a minor but indispensable role, and the steric effect is trivial. Furthermore, we have revealed that simple density-based ITA functions are in good relationships with molecular polarizabilities for a series of 30 hydrogen-bonded base pairs and all 20 natural α-amino acids, 400 dipeptides, and 8000 tripeptides. Based on these lines, one can easily predict the molecular polarizabilities of larger peptides, even proteins as long as the total molecular wavefunction is available, rather than solving the computationally demanding coupled-perturbed Hartree-Fock (CPHF) equation or its DFT counterpart coupled-perturbed Kohn-Sham (CPKS) equation.

In the diagnosis of olfactory neuroblastoma (ONB), the presence of S-100–positive sustentacular cells surrounding the tumor is important; however, these are also present in normal nasal sinus epithelium. Although ONB often has a different final diagnosis, complete resection of the tumor has a good prognosis and minimally affects the patient's treatment plan. When the tumor extends around the internal carotid artery (ICA), complete resection is difficult due to the high risk of vascular injury; revascularization using a high-flow bypass can avoid this complication. In the present case, the tumor was located in the left sphenoid sinus and extended around the ICA. Preoperative biopsy tissue was positive for neuroendocrine markers and slightly positive for S-100 protein, leading to a diagnosis of ectopic ONB. High-flow bypass revascularization with trapping of the ICA allowed complete tumor resection. The postoperative histopathological diagnosis was neuroendocrine carcinoma, showing no S-100 protein–positive cells. There was no sign of recurrence two and a half years after surgery without additional treatment. This case demonstrates that the presence of S-100 protein–positive cells in ONB may be misleading. Although misdiagnosis of ectopic ONB should be anticipated, a complete resection of the tumor is an effective treatment strategy.

Laser shock peening as an innovative surface treatment technology can effectively improve the fatigue life, sur-face hardness, corrosion resistance, and residual compressive stress. Compared with the laser shock peening, the warm laser shock peening (WLSP) is a new surface treatment technology to improve materials’ surface performances, which takes advantage of thermal mechanical effects on stress strengthening and micro-structure strengthening, results in more stable distribution of the residual compressive stress under heating and cyclic loading process. In this paper, the microstructure of GH4169 nickel super-alloy processed by WLSP technology with differ-ent laser parameters were investigated. The proliferation and tangling of dislocations in GH4169 were observed and the dislocation density increased after WLSP treatment. The influences of different treatment by LSP and WLSP on the microhardness distribution of the surface and along cross-sectional depth were investi-gated. The microstructure evolution of the GH4169 alloy being shocked with WLSP were studied by TEM. The effect of temperature on the stability of high temperature microstructure and properties of GH4169 alloy WLP was investigated.

Through the half-unit circle area computation using the integration of the corresponding curve power series representation, we deduce a slow converging positive infinite series to $\pi$. However, by studying the remainder of that series we establish sufficiently close inequalities with equivalent lower and upper bound terms allowing us to estimate, more precisely, how the series approaches $\pi$. We use the obtained inequalities to compute up to four-digit denominator, what are in this sense, the best rational numbers that can replace $\pi$. It turns out that the well-known convergents of the continued fraction of $\pi$, $22/7$ and $355/113$ called, respectively, Yuel\"{u} and Mil\"{u} in China are the only ones found. Thus we apply a similar process to find rational estimations to $\pi+e$ where $e$ is taken as the power series of the exponential function evaluated at $1$. For rational numbers with denominators less than $2000$, the convergent $920/157$ of the continued fraction of $\pi+e$ turns out to be the only rational number of this type.

Vertical-channel organic dual-gate/base transistors would be highly interesting since vertical organic transistors are the fastest organic transistors demonstrated today. However, incorporating a dual gate/base structure into an ultra-short channel vertical architecture represents a substantial challenge. Here, we successfully realize a new device concept of vertical organic permeable dual-base transistors (OPDBTs), where either of both base electrodes can be used to change the on-currents and tune the threshold voltages. The optimized devices yield a high on-current density of 1.54 A cm^-2 and a large current gain of 9.2×10⁵, corresponding to a high transmission value of 99.998%. The detailed operation mechanisms are investigated by calibrated TCAD simulations with the Poole-Frenkel mobility model, Gaussian density of states and tunneling model. Finally, high-performance logic circuits, e.g. inverter, NAND/AND computation functions are demonstrated with one single OPDBT operating at supply voltages of < 2.0 V. We believe that OPDBTs offer a compact and technologically simple hardware platform with excellent application potential for vertical-channel organic transistors in complex logic circuits.

Background: Iranian traditional medicine is a holistic school of medicine with a long prolific history. It describes numerous concepts and the relationships between them. However, no unified terminology has been proposed for the concepts of this medicine up to the present time. Considering the extensive use of concepts in the numerous textbooks written by the scholars over centuries, comprehending the totality of the terminology is obviously a very challenging task. To resolve this issue and overcome the obstacles, and code the concepts in a reusable manner, constructing an ontology of the concepts of Iranian traditional medicine seems a necessity.Methods: Makhzan al-Advieh, an encyclopedia of materia medica compiled by Mohammad Hossein Aghili Khorasani, was selected as the resource to create an ontology of Mizaj. The steps followed to accomplish this task included (1) compiling the list of classes for Mizaj; (2) arranging the classes in taxonomy; (3) determining object properties and their cardinalities; (4) specifying annotation properties including codes, labels, synonyms, and definitions for each concept; (5) reviewing the fields pertaining to Mizaj of all monographs in Makhzan al-Advieh. The ontology was created using Protégé with adherence to the principles of ontology development provided by the Open Biological and Biomedical Ontology (OBO) foundry. Results: Mizaj ontology was constructed with a final inclusion of 105 classes, three object properties, and 1078 axioms in the Iranian Traditional Medicine General Ontology database, IrGO, freely available at http://jafarilab.com/irgo/. An indented tree view and an interactive graph view using WebVOWL were used to visualize the ontology. All classes were linked to their instances in the UNaProd database to create a knowledge-base of Mizaj. Conclusion: We constructed an ontology-based knowledge base of ITM concepts of Mizaj in the domain of materia medica to help offer a shared and common understanding of this concept, enable reuse of the knowledge, and make the assumptions explicit. Extending IrGO will bridge the gap between traditional and conventional schools of medicine and help guide future research on new treatment options.

Here we evaluate the chemistry of mineral soil solutions collected by suction lysimeters in a small mountain catchment that was affected by acidification-related spruce die-back. The aim was to obtain new insights into spatial patterns of nutrient partitioning during acidification recovery. This was achieved by comparing nutrient concentrations in soil solutions, collected along a V-shaped valley, with those in runoff. Five nests of suction lysimeters were installed in the 33-ha UDL catchment at different topographic positions (hilltops, slopes and valley). Following a 1-year equilibration, monthly samples of soil solutions were collected over a 2-year period. In the vicinity of each lysimeter nest, soil pits were excavated for a study of soil chemistry. Soil solutions were analyzed for SO42-, NO3-, DOC, NH4+, Na+, K+, Ca2+, Mg2+, and total dissolved Al concentrations, DOC and pH. For a P release estimation, ammonium oxalate extraction of soil samples was performed. Comparison of soil water data from this study with other European studies indicated that major environmentally relevant chemical species at UDL had concentrations similar to median concentrations across numerous previously acidified sites. CEC (≤ 58 meq kg-1) and BS (≤ 13 %), however, were significantly lower at UDL than at other European sites, documenting incomplete recovery from acidification. Spatial trends and seasonality in soil water chemistry support belowground inputs from mineral-stabilized legacy pollutants and soil nutrients. Seasonal variability of soil water sulfate and nitrate was significant. High nitrate in soil solutions during summer originated during the preceding dormant season, and high sulfate concentrations observed during the winter originating from recycled organic S during the summer. Higher concentrations of SO42-, NO3-, and base cations in runoff than in soil solutions may be explained by lateral surficial runoff leaching pollutants and nutrients from very shallow soil horizons. Nearly 30 years after peak acidification, solutions in mineral subsoil at UDL exhibited similar concentrations of SO42-, Ca2+ and Mg2+ as median values at the Pan-European International Co-operative Program (ICP) Forest sites, yet NO3- concentrations were an order of magnitude higher than the ICP sites. Calcium applied on soil surface by liming 32 to 11 years ago affected runoff more than soil solutions, suggesting contribution of both shallow soil water and groundwater to runoff.

Collisional mountain belts commonly develop intramontane basins from mechanical and isostatic subsidence during orogenic development. These frequently display a relict top surface, evidencing a change interval from basin infilling to erosion often via capture or overspill. Such surfaces provide markers that inform on orogenic growth patterns via climate and base level interplay. Here, we describe the top surface from the Sorbas Basin, a key intramontane basin within the Betic Cordillera (SE Spain). The surface is fragmentary comprising high elevation hilltops and discontinuous ridges developed onto the variably deformed final basin infill outcrop (Gochar Formation). We reconstruct surface configuration using DEM interpolation and apply ¹⁰Be/²⁶Al cosmonuclides to assess surface formation timing. The surface is a degraded Early Pleistocene erosional pediment developed via autogenic switching of alluvial fan streams under stable dryland climate and base level conditions. Base level lowering since the Middle Pleistocene focused headwards incision up interfan drainages, culminating in fan head capture and fan morphological preservation within the abandoned surface. Post abandonment erosion has lowered the basin surface by 31 m (average) and removed ~5.95 km³ of fill. Regional basin comparisons reveal a phase of Early Pleistocene surface formation, marking landscape stability following the most recent Pliocene-Early Pleistocene mountain building. Post-surface erosion rate quantification is low and in accordance with ¹⁰Be denudation rates typical of the low uplift Betic Cordillera.

Intermittently Scanned Continuous Glucose Monitoring (isCGM) devices are increasingly being used in patients with type 2 diabetes mellitus (T2DM) on insulin therapy for their benefits regarding disease management. Evidence of isCGM use in patients with T2DM treated with basal insulin or oral antidiabetic drugs is lacking. The aim of this study was to assess the efficacy and safety of isCGM in this population. This was an observational, retrospective, real-world study enrolling patients with T2DM who were starting with the use of isCGM. Data from medical records (i.e. demographics, clinical characteristics, laboratory assessments, and isCGM metrics) were collected over three time periods (baseline, 3 and 6 months). The endpoints were glycated haemoglobin (HbA1c) changes, and changes in isCGM metrics as defined by the International Consensus from baseline to a 3-month and a 6-month follow-up. Overall, 132 patients were included (69% male; mean age 68.2±11.0 years; mean disease duration 19.0±9.3 years; 80% on basal insulin ± oral drugs at baseline; mean baseline HbA1c 8.1%±1.3%). The estimated mean change in HbA1c from baseline was statistically significant at three (-0.4±1.0%; p=0.003) and at six months (-0.6±1.3%; p&lt;0.0001). No statistical differences were found in the mean change of the isCGM metrics. Intermittently Scanned Continuous Glucose Monitoring is effective and safe in improving glycaemic control in patients with type 2 diabetes treated with basal insulin or oral antidiabetic drugs.