Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

We have suggested earlier a new sustainable method for permafrost thermal stabilization that combines passive screening of solar radiation and precipitation with active solar-powered cooling of the near-surface soil layer thus preventing heat penetration in depth. Feasibility of this method has been shown by calculations, but needed experimental proof. In this article, we are presenting the results of soil temperature measurements obtained at the experimental implementation of this method outside of the permafrost area which actually meant higher thermal loads than in Polar Regions. We have shown that near-surface soil layer is kept frozen during the whole summer, even at air temperatures exceeding +30°C. Therefore, the method has been experimentally proven to be capable of sustaining soil frozen even in more extreme conditions than expected in permafrost areas. In addition to usual building and structure thermal stabilization, the method could be used to prevent the development of thermokarst, gas emission craters, and landslides; greenhouse gases, chemical, and biological pollution from the upper thawing layers at least in the area of human activities; protection against coastal erosion; and permafrost restoration after wildfires. Using commercially widely available components, the technology can be scaled up for virtually any size objects.

The design complexity of the new generation of civil aero-engines results in higher demands on engines’ components, higher component temperature, higher heat generation, and, finally, critical thermal management issues. This paper will propose a methodological approach to create physics-based models for heat loads developed by sources as well as a systematic sensitivity analysis to identify the effects of design parameters on the thermal behaviour of civil aero-engines. The ranges and levels of heat loads generated by heat sources (e.g., accessory gearbox, bearing, pumps, etc.) and heat absorption capacity of heat sinks (e.g., engine fuel, oil, and air) are discussed systematically. The practical research challenges for thermal management system design and development for the new and next generation of turbofan engines will then be addressed through a sensitivity analysis of the heat load values as well as the heat sinks flow rates. The potential solutions for thermal performance enhancements of propulsion systems will be proposed and discussed accordingly.

Regeneratively cooled scramjet has already been successfully verified as propulsion device for hypersonic vehicle. As a result, dynamic process of flow and heat transfer in cooling channel is commonly occurred which may bring hazard and control difficulties for scramjet. To study transient flow and heat transfer process in cooling channel, a dynamic numerical model is established. Dynamic characteristics of flow and heat transfer under different conditions are calculated and discussed, which includes change of inlet fuel mass flow, heat flux and pressure working conditions. Results show that stable time of cooling channel outlet fuel temperature is related to the change rate of inlet mass flow and heat flux. The stable time of outlet fuel temperature under heat flux decreasing working conditions are about 12.5 s. The initial response of working pressure fluctuation will lead to fuel temperature fluctuation, which has little effect on wall temperature.

Background: Musculoskeletal pain is a non-negligible multifaceted condition affecting more than 30% of the global population. Superficial heat therapy (HT) through increasing tissues temperatures plays a role in increasing local metabolism and function and relieving pain. Knee pain and sports represent two relevant fields of superficial HT application. Methods: In the present paper a panel of experts performed a narrative review of the literature regarding the role of superficial HT in the management of knee pain and sport activities. Results: According to the reviewed literature, HT represents a therapeutic option in the management of musculoskeletal pain due to three main effects: pain relief, promotion of healing and return to normal function and activity. Moreover, HT plays a role in sport activities both before and after exercise. Before performing sports, HT helps in preparing muscles for performance. After performing sports, it is capable to promote recovery and healing pathways. Combining and sequencing superficial heat and cold therapy represent an interesting topic of study. Overall, application of heat wraps for superficial HT can be considered safe. Conclusions: Despite being an ancient method, HT shows to be a potentially beneficial and safe option in the management of several conditions including KP and sports. The key in the application of superficial HT is a multimodal and multidisciplinary approach.

This paper proposes a simulation technique for investigating the battery thermal management system based direct refrigerant cooling (BTMS-DRC). It employs finite element method for a combined-conduction-convection heat transfer to predict the module temperature and to prove the temperature uniformity. The refrigerant side cooling is based on the two-phase flow evaporation which is represented by the convection heat transfer (flow evaporation) under a certain refrigerant saturation temperature. The battery heat generation is modeled as the constant heat flux. The main module is modeled as the conduction heat transfer. The real BTMS-DRC is constructed for experimentation with the test bench which is based on the dual-evaporators vapour compression refrigeration system. The simulated result is validated with the experimental results to ensure the correction of the modelling. The simulation also investigates the impact of the heat generation, convection heat transfer coefficient, refrigerant saturation temperature, and thermal conductivity on the module temperature and temperature uniformity. It is found that the simulated results agree well with the experimental results. The errors are around 2.9 - 7.2% throughout the specified working conditions. Overall, the proposed technique can be used as a design tool for further developing the BTMS-DRC.

Geothermal energy is likely to be a significant contributor in achieving sustainable energy goals and net-zero emissions targets. Within geothermal power plants, heat exchangers play a critical role in harnessing this renewable energy source. However, these heat exchangers encounter significant challenges when exposed to geothermal fluids, including erosion, corrosion, and scaling, which adversely affects their performance and longevity. The current review focuses on surface engineering techniques, particularly coatings, as a highly effective and economically viable solution to address these challenges in geothermal heat exchangers. The review begins by providing an overview of geothermal energy, its significance in the context of sustainability and the important role played by heat exchangers in geothermal power generation, followed by the challenges and their impact on heat exchangers. The subsequent section focuses on surface engineering by coatings and its types employed to enhance the performance of heat exchangers. In the final part, the reader is presented with an overview of the challenges associated with the application of coatings in geothermal heat exchangers and potential future directions in this field. This review offers a detailed understanding of the critical role coatings play in improving the efficiency and service life of heat exchangers in geothermal power plants.

Is HSP-27 an emerging marker of good prognosis in septic shock patients – a pilot study Objective To estimate the value of serum changes of C-reactive protein, procalcitonin, presepsin, heat shock protein 27 (HSP27) and neutrophil to lymphocyte ratio in assessing the prognosis in patients with septic shock (SS) treated in intensive care unit. Methods The SS was diagnosed and treated in accordance with the guidelines of the Surviving Sepsis Campaign. 37 selected adult patients with SS were included. Serum concentrations of biomarkers were measured at admission and daily for 4 consecutive days (time points T0,T1, T2, T3 and T4 respectively). The mortality rate was determined 28 days after admission. Patients were divided into survivor and non-survivor groups according to their mortality. The differences between the levels of biomarkers at the T0 and T4 time points were analyzed. Results The mean value of the SOFA score on admission was 11.7 ± 2.7, and the APACHE II scale 29.9 ± 6.85. Nine patients died. Univariate logistic analysis revealed that changes between T0 and T4 time points of presepsin, procalcytonin, and HSP27 were associated with prognosis. A multivariate Cox analysis showed that an increase in HSP27 on T4 was the only independent predictor of good prognosis in SS patients. The area under the receiver operating characteristics curve for HSP27 was 0.785. Kaplan–Meier analysis showed that the mortality was lower (p=0.014) in patients who had an increase in HSP27 on T4 compared to those whose serum HSP27 did not increase on T4. Conclusions The increase of HSP27 level on the 4th day predicts favorable outcome in SS patients.

The heritage of ancient buildings is an important part of the world's history and culture, which has an extremely rich historical-cultural value and artistic research value. Beijing has a large number of palace ancient buildings, and because of the age of their construction, many of them have problems of varying degrees of peeling and mold on the inner surfaces of the envelope. To solve the problems of the damp and moldy interior of palace buildings, a mathematical model of indoor heat and moisture transfer was established based on a wooden palace ancient building in Beijing. Through the indoor mold distribution validation model, the effects of outdoor humidity, soil moisture, wall humidity, and other factors on the indoor heat and moisture transfer of ancient buildings were simulated and analyzed by using the control variables method. The results showed that the molds were distributed at the indoor corners and floors, and the simulation of indoor humidity match the measured humidity. Thus, the simulation results were consistent with the actual situation. The variable trend of the relative humidity of the indoor environment with the outdoor humidity is inconsistent from plane to plane, i.e. it increases or remains constant with the increase of the outdoor humidity. The indoor ambient relative humidity increased with increasing the wall humidity. And the indoor average temperature is 23.3 ℃ and indoor relative humidity ranged between 90.9 % to 92.44 %. Soil moisture and wall humidity were the main factors affecting the indoor environmental relative humidity.

Demand for development of the convergence industry, research studies on electrical conductivity, thermal characteristics, semiconductors, motors, and batteries using special materials have come to the fore. Meanwhile, molybdenum (Mo) exhibits relatively small inorganic qualities, and the thermal conductivity rate is applied to various fields. In this study, in-depth characteristics were considered regarding the concentration of thermal characteristics, IR car terminal characteristics, and IR ve-hicles. This study calculated each phase temperature of the molybdenum sputtered specimens in the steady state according to the heat transfer theory. When the molybdenum-sputtered fabric’s metal layer pointed to the outside air, the heat transfer rate (Q) was high at 5748.3W, In contrast, if the molybdenum sputtered film’s metal layer of the pointed toward the heat source, the heat transfer rate (Q) was low at 187.1W. As a result of measuring the IR transmittance, the infrared transmit-tance of the molybdenum sputtering-treated sample was significantly reduced compared to the untreated sample. In the case of untreated samples, the transmittance ranged from 92.7 to 42.0%. When only the cross part was treated with molybdenum sputtering and the molybdenum surface was directed toward the IR irradiator, the IR transmittance was 66.8~0.7%. It is believed that the molybdenum sputtering polyamide samples produced in this study can be applied to multifunc-tional military wear, biosignal detection sensors, semiconductor products, batteries, etc., by utilizing excellent electrical properties, stealth functions, IR blocking properties, and lightness for infrared thermal imaging detectors.

Neonicotinoids (NEOs) have become the most widely used insecticides in the world since the mid-1990s. According to Chinese dietary habits, rice and water are usually heated before being consumed, but the information about the alteration through the heat treatment process is very limited. In this study, the parents of NEOs (p-NEOs) accounted for >99% of the total NEOs mass (∑NEOs) in both uncooked (median: 66.8 ng/g) and cooked (median: 41.4 ng/g) rice samples from Guangdong Province, China, while the metabolites of NEOs (m-NEOs) involved in this study accounted for less than 1%. We aimed to reveal the concentration changes of NEOs through heat treatment process, thus, several groups of rice and water samples from Guangdong were cooked and boiled, respectively. Significant (p < 0.05) reductions in acetamiprid, imidacloprid (IMI), thiacloprid, and thiamethoxam (THM) have been observed after the heat treatment of the rice samples. In water samples, the concentrations of THM and dinotefuran decreased significantly (p < 0.05) after the heat treatment. These results indicate the degradation of p-NEOs and m-NEOs during the heat treatment process. However, the concentrations of IMI increased significantly in tap water samples (p < 0.05) after heat treatment process, which might be caused by the potential IMI precursors in those industrial pesticide products. The concentrations of NEOs in rice and water can be shifted by the heat treatment process, so this process should be considered in relevant human exposure studies.

Thin-wall heat pipe is an efficient heat transfer component, which has been widely used in the field of heat dissipation of high-power electronic equipment in recent years. In this study, the orange peel morphology defect of thin-wall heat pipes after bending deformation was analyzed both for the macro 3D profile and for the micro-formation mechanism. The results show that after high temperature sintering treatment, the matrix grains of heat pipe are coarsened seriously and formed a strong Goss texture, while a certain annealing twins with the unique Copper orientation are retained. The distribution of Schmid factor value subjected to the uniaxial stress indicate the inhomogeneity of intergranular deformation exist among the annealing twins and matrix grains. The annealing twin exhibit a “hard-oriented” component during the deformation; thus, it plays a role as barrier and hinder the slipping of dislocation. As the strain accumulates, part of the annealing twins may protrude from the surface of heat pipe, forming a large-scale fluctuation of the surface as the so called the “orange peel” morphology. The 3D profile shows the bulged twins mostly perpendicular to the drawing direction, with about 200-300μm in width and 10-20μm in height.

A quantum Otto engine with a single ion harmonic oscillator as its working substance is studied for an adiabatic operation at high and low temperature limits. Using the universal optimization method, the heat engine is effectively optimized and found to yield better working conditions in some ranges of temperature ratios. Accordingly, the figure of merit, ψ, is found to be greater than unity in the range: 0&lt;β2β1≤0.12; showing that the heat engine performs better in the optimized condition than in the maximum power working condition. ψ is determined to be less than one in the range 0.12≤β2β1≤0.35 under the same temperature limit ; depicting that the maximum power working condition is preferred to the optimized working condition. On the other hand, in the low temperature limit, the figure of merit, ψ, is found to be greater than unity in the range 3.7&lt;ω1ω2≤18; revealing that optimized working condition is better than the maximum power working condition for the heat engine. In the same temperature limit, ψ is found to be less than one in the range 0≤ω1ω2≤3.7; showing that maximum power working condition is preferred to the optimized one. For the model of heat engine studied, in some ranges of temperature ratio, it is found to work better in the optimized condition, whereas in the other ranges it performs better under the maximum power working condition. So, it is possible to switch the engine between the two conditions depending on one’s need.

The study of the influence of the nanoparticle volume fraction and aspect ratio of microchannels on the fluid flow and heat transfer characteristics of nanofluids in microchannels is important in the optimal design of heat dissipation systems with high heat flux. In this work, the computational fluid dynamics method was adopted to simulate the flow and heat transfer characteristics of two types of water–Al2O3 nanofluids with two different volume fractions and five types of microchannel heat sinks with different aspect ratios. Results showed that increasing the nanoparticle volume fraction reduced the average temperature of the liquid–solid heat transfer surface and thereby improved the heat transfer capacity of the nanofluids. Meanwhile, the increase of the nanoparticle volume fraction led to a considerable increase in the pumping power of the system. Changing the aspect ratio of the microchannel effectively improved the heat transfer capacity of the heat sink. Moreover, increasing the aspect ratio effectively reduced the average temperature of the heating surface of the heat sink without significantly increasing the flow resistance loss. When the aspect ratio exceeded 30, the heat transfer coefficient did not increase with the increase of the aspect ratio. The results of this work may offer guiding significance for the optimal design of high heat flux microchannel heat sinks.

The mechanical engineering requires heat treatment after rough machining to reach the mechanical strength, but the heat treatment can induce workpiece deformation, so that the workpiece cannot be reworked. In this study, the plasma was integrated with a lathe, and the on line heat treatment was performed to achieve the mechanical strength and hardness, so as to reduce the machining process and handling. However, for on line heat treatment, it is important to study the machine and plasma parameters of the lathe and plasma, and the research method is used eventually to optimize the process, reduce the machining cost and machining error. The variable factors in surface on line real-time heat treatment are revolution, feed rate and current, the objective function is the hardness of mechanical properties. In the screening experiment, the interaction of factors was discussed using full factorial experiment. The Central Composite Design was combined with the Lack-of-Fit test for optimization experiment, the R2 coefficient was used to determine whether the regression model is appropriate. The optimum parameters were derived from the contour diagram and response surface diagram. The experimental results show that the significant factors include revolution, feed rate and current, the optimum parameters include revolution 168rpm, feed rate 0.068mm/rev and current 86A. The experimental results of optimum parameters show that the surface hardness is increased from 306HLD to 806HLD, the surface hardening effect is enhanced by 163%, so the on line real-time heat treatment equipment has a best hardening effect.

Photosynthesis is a pivotal process that determines the synthesis of carbohydrates required for sustaining growth under normal or stress situation. Stress exposure reduces the photosynthetic potential owing to the excess synthesis of reactive oxygen species that disturb the proper functioning of photosynthetic apparatus. This decreased photosynthesis is associated with disturbances in carbohydrate metabolism resulting in reduced growth under stress. We evaluated the importance of melatonin in reducing heat stress-induced severity in wheat plants (Triticum aestivum L.). The plants were subjected to 25 ˚C (optimum temperature) or 40 ˚C (heat stress) for 15 days at 6 hours time duration and then developed the plants for 30 days. Heat stress led to oxidative stress with increased production of TBARS and H2O2 content and reduced accrual of total soluble sugars, starch and carbohydrate metabolism enzymes which are reflected in reduced photosynthesis. Application of melatonin not only reduced oxidative stress through lowering TBARS and H2O2 content, through augmenting the activity of antioxidative enzymes but also increased the photosynthesis in plant and carbohydrate metabolism that is needed to provide energy and carbon skeleton to the developing plant under stress. However, the increase in these parameters with melatonin was mediated via hydrogen sulfide (H2S), as the inhibition of H2S by hypotaurine (HT; H2S inhibitor) reversed the ameliorative effect of melatonin. This suggests a crosstalk of melatonin and H2S in protecting heat stress-induced photosynthetic inhibition via regulation of carbohydrate metabolism.

Demolished concrete and plastic waste are two increasingly aggravating problems. In this study, a novel method was proposed to simultaneously recycle concrete and plastic wastes by compacting concrete and plastic powders together under pressure and temperature. The influence of compression pressure and temperature as well as the mixture proportion on the bending strength of specimens was investigated. The results showed that pressure and temperature had a positive effect on the specimen strength; however, the molding temperature should not exceed the melting temperature of plastic. The proportion of plastic had a minimal effect on the bending strength of the specimen when plastic accounted for 25%–75% of the overall mass of the test piece.

The calculation of the isobaric heat capacities of the liquid and solid phase of molecules at 298.15 K is presented, applying a universal computer algorithm based on the atom-groups additivity method, using refined atom groups. The atom groups are defined as the molecules' constituting atoms and their immediate neighbourhood. In addition, the hydroxy group of alcohols are further subdivided to take account of the different intermolecular interactions of primary, secondary and tertiary alcohols. The evaluation of the groups' contributions has been carried out by means of a fast Gauss-Seidel fitting calculus using experimental data from literature. Plausibility has been tested immediately after each fitting calculation using a 10-fold cross-validation procedure. For the heat capacity of liquids, the respective goodness of fit of the direct (R2) and the cross-validation calculations (Q2) of 0.998 and 0.9975, and the respective standard deviations of 8.2 and 9.16 J/mol/K, together with a medium absolute percentage deviation (MAPD) of 2.69%, based on the experimental data of 1133 compounds, proves the excellent predictive applicability of the present method. The statistical values for the heat capacity of solids are only slightly inferior: for R2 and Q2, the respective values are 0.9915 and 0.9875, the respective standard deviations are 12.19 and 14.13 J/mol/K and the MAPD is 4.65%, based on 732 solids. The predicted heat capacities for a series of liquid and solid compounds has been directly compared to those received by a complementary method based on the "true" molecular volume [1] and their deviations elucidated.

Drying food involves complex physical atmospheric mechanisms with non-linear relations from the air-food interactions and those relations are strongly dependent on the moisture contents and the type of food. Such dependence makes it complex to design suitable dryers dedicated to a single drying process. To streamline the design of a novel compact food-drying machine, a heat pump dryer component design optimization algorithm was developed as a subprogram of a Computer Aided Engineering tool. The algorithm requires inputting food and air properties, the volume of the drying container and the technical specifications of the heat-pump off-the shelf components. The heat required to dehumidify the food supplied by the heat exchange process from condenser to evaporator, and the compressor’s requirements (refrigerant mass flow rate and operating pressures) are then calculated. Compressors can then be selected based in the volume and type of food to be dried. The algorithm is shown via a flow chart to guide the user through 3 different stages: Changes in drying air properties, Heat flow within dryer and Product moisture content. Example results of how different compressors are selected for different type of produces and quantities (Agaricus Blazei mushroom with 3 different moisture contents or fish from Thunnini tribe) conclude this article.

In this investigation steel P355NH has been successfully cladded with Inconel 625 through the method of explosive welding. Explosively welded bimetal clad-plate was subjected to the two separated post weld heat treatment processes: stress relief annealing (at 620oC for 90 minutes) and normalizing (at 910oC for 30 minutes). In order to analyze the microstructure of the joint in the as-welded state and to investigate the influence of the post weld heat treatment on it, the light and scanning electron microscope observations and microhardness analysis have been performed. The examination of the diffusion zone microstructure has been performed by using the scanning transmission electron microscope. It was stated that obtained joint has characteristic wavy-shape geometry with the presence of the melted zones and severe deformed grains of both joined materials. Strain hardening of the materials in joint zone was established with microhardness analysis. In both of the heat treatments the changes in the grain structure have been observed. The normalizing heat treatment has the most significant impact on the microstructure of the joint as well as the concentration of the chemical elements in the joint zone. It was reported that due to normalizing the diffusion zone has been formed together with precipitates in the joint zone. The analysis of the diffusion zone images leads to the conclusion that the diffusion of alloying elements from Inconel 625 to steel P355NH takes place along the grain boundaries with additional formation of the voids in this area. The precipitates in Inconel 625 in the joint zone are two type of carbides – chromium-rich and molybdenum-rich. Scanning transmission electron microscope observation of the grain microstructure in the diffusion zone shows that this area consists of equiaxed grains (from the side of Inconel 625 alloy) and columnar grains (from the side of steel P355NH).

The fatigue strength of the hot work steel depends on various factors, including the mechanical, properties and behavior and bulk and the surface under layer, the microstructural features as well as heat treatments. The influence of a series of heat treatments on the fatigue strength of H13 hot work steel was investigated. Different preheating, quenching and tempering treatments were applied to four sets of specimens and fatigue tests were conducted at room temperature using a rotating bending test machine. All heat treatments resulted in a certain improvement of the fatigue strength. Highest fatigue strength obtained by applying a double tempering heat treatment (first tempering at 550 °C for two hours and second tempering at 610 °C for two hours) after initial preheating and quenching. One tempering treatment (550 °C for two hours after preheating and quenching) did not significantly improve the fatigue strength.

Heating systems such as heat pump and combined heat and power cycle systems (CHP) are representing a key component in the future smart grid. Their capability to couple the electricity and heat sector promises a massive potential to the energy transition. Hence, these systems are continuously studied numerical and experimental to quantify their potential and develop optimal control methods. Although numerical simulations provide time and cost-effective solution for system development and optimization, they are exposed to several uncertainties. Hardware in the loop (HiL) system enables system validation and evaluation under different real-life dynamic constraints and boundary conditions. In this paper, a HiL system of heat pump testbed is presented. This system is used to present two case studies. In the first case, the conventional heat pump testbed operation method is compared to the HiL operation method. Energetic and dynamic analyses are performed to quantify the added value of the HiL and its necessity for dynamics analysis. The second case, the HiL testbed is used to validate the heat pump operation in a single family house participating in a local energy market. It enables not only the dynamics of the heat pump and the space heating circuit to be validated but also the building room temperature. The energetic analysis indicated a deviation of 2% and 5% for heat generation and electricity consumption of the heat pump, respectively. The model dynamics emphasized the model capability to present the dynamics of a real system with a temporal distortion of 3%.

In this work, we experimentally investigate mass and heat transport phenomena in a modular device while converting a solution salinity difference into a temperature difference. Operations occur under fixed total ambient pressure and without mechanical moving parts, thus realizing a fully static conversion. Provided that a constant salinity gradient can be imposed, the proposed device is able to generate a steady cooling capacity. Here, we purposely operate with environmentally benign and easily accessible sodium chloride water solutions only. A numerical model is finally elaborated, validated and used to explore a wider range of possible device configurations and operating conditions.

While the majority of previous studies assessing pain-related variables in psychopaths used electric shocks, little is known about the effectiveness of alternative pain-inducing methods to increase emotional responses such as fear and anxiety. A small sample of healthy undergraduate men (N = 15) was recruited to assess the effectiveness of a heat stimulus to induce pain in an immediate versus delayed punishment paradigm. Although pain catastrophizing, anxiety, and threat of pain did not increase throughout the experiment, participants experienced a significant increase of fear of pain and pain intensity, indicating that the heat stimulus was effective in inducing pain. Furthermore, subjects were slower in initiating the pain stimulus during the first five trials, but no time difference was found during the 15 remaining trials. No correlation was found between psychopathic traits and pain-related variables, with the exception of inconsistent results within the Fearless Dominance factor. Findings are discussed in terms of improvement for a larger scale study involving psychopathic individuals.

The urban heat island (UHI) and its intensity is one of the phenomena that are of determining importance for the comfort of living in cities and their sustainable development in the face of deepening climate change. The study is objectively difficult due to the large dynamics like land cover and the considerable diversity of land use patterns in urban areas. Various approaches and methods are used in research practice, based both on ground measurements and in the use of remote methods and satellite information. However, most of these approaches provide information with problematic spatial and temporal resolution, making them difficult to apply for sustainable urban planning purposes, which require adequate information provision. This paper presents the results of the application of thermal photogrammetry based on the use of unmanned aerial systems (UAS), combined with geographic information systems (GIS), in the study of surface urban heat island intensity (SUHI), at the local level for the largest housing complex in Bulgaria - Lyulin district of the capital of Sofia city. The studies were carried out during a heat wave in July 2023. A difference of 16.5oC was found between locations with SUHI occurrence and suburban areas. The information benefits of locally addressed data and their direct applicability are discussed to support decision-making processes in the planning and management of urban areas, including their climate adaptation and sustainable development.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Heat waves are a significant consequence of climate change threatening public health by increased morbidity and mortality. The aim of this study was to estimate individuals’ knowledge, attitudes and practice related to heat waves. We conducted an exploratory cross-sectional study in Greece during September 2023. We employed a convenience sample of 1055 participants. We used the heat wave knowledge, awareness, practice and behavior scale (HWKAPBS) to measure our outcome. We measured several socio-demographic variables, such as gender, age, educational level, etc. as potential determinants. Mean scores for the knowledge, awareness, practice and behavior factors were 12.5, 22.7, 22.2 and 12.1 respectively. Females had higher scores on the four factors compared with males. We found a positive relationship between self-perceived health status and awareness, practice and behavior about heat waves. Similarly, we identified a positive relationship between self-perceived financial status and awareness and behavior about heat waves. Increased age was associated with increased practice score, while increased educational level was associated with increased knowledge score. Additionally, behavior score was higher among participants in urban areas than those in rural areas. We found statistically significant positive correlations between the four factors. Levels of knowledge, awareness, practice and behavior about heat waves were high in our sample. Several socio-demographic variables affect participants’ knowledge, awareness, practice and behavior concerning heat waves.

“Anti-stripping Agents" or "adhesion promoters” can enhance the chemical affinity between as-phalt and aggregate by increasing their mutual attraction. Various forms of anti-stripping agents have been proposed to mitigate pavement stripping, and siloxane-based Zychotherm is one of them. Choosing the appropriate type and dose of anti-stripping additives is no doubt vital to the intended performance. Therefore, it is critically important to determine the dose of the additives used in the modification of asphalt binders. This research developed a feasible detection method that can closely measure the dose (0.05% and 0.1%) of siloxane-based anti-stripping liquid agents. Related test methods including heat combustion test, residue visualization, burning, and ignition were implemented. Heat combustion results showed that with the addition of Zychotherm anti-stripping additive, average heat combustion value decreased by 1.34% and 1.72% for 0.05% and 0.1% Zychotherm modified binder respectively. In the burning and ignition process, the modified binder leaves yellowish substances in the residue, which is an indication of the presence of Zy-chotherm. The weight of the yellowish residue relates more to the quantity of Zychotherm in as-phalt binder.

The solar heat pump system based on photovoltaic photothermal (PV/T) modules is a new technology that integrates photovoltaics and heat reutilization. It can improve the efficiency of photovoltaic conversion and recovery the remaining heat generated during the photoelectric conversion process, thereby improving the comprehensive efficiency of the whole system. Simulink software is a visual simulation tool, which has the advantages of strong applicability, clear simulation structure and calculation process. The design of its graphical programming greatly simplifies the user modeling process and allows for direct viewing of results, therefore improving the simulation efficiency. At present, there is little research on simulation of solar heat pump systems with PV/T modules based on Simulink software. In this paper, the mathematical models of each component contained in the PV/T solar heat pump system were established based on the system working principle, energy conservation equations and some empirical formulas, and then the operation of the system was simulated by the Simulink software. Due to the operation characteristic of PV/T modules is the key influencing factor for the whole system performance, the model and simulation process for PV/T modules were introduced in detail. The results showed that the surface temperature of PV/T modules under different operating conditions was significantly lower than that of ordinary photovoltaic panels, and the temperature change amplitude was lower. As results, the power generation and photovoltaic conversion efficiency were significantly improved.

In the dairy cattle sector, the evaluation of the effects induced by heat stress is still one of the most impactful and investigated aspects as it is strongly connected to both sustainability of the production and animal welfare. On the other hand, more recently, the possibility of collecting large dataset made available by the increasing technology diffusion is paving the way for the application of advanced numerical techniques based on machine learning or big data approaches. In this scenario driven by rapid change there could be the risk of dispersing the relevant information represented by the physiological animal component, which should maintain the central role in the development of numerical models and tools. In the light of this, the present literature review aims to consolidate and synthesize existing research on the physiological consequences of heat stress in dairy cattle. The present review provides, in a single document, an overview as complete as possible of the heat stress-induced responses in dairy cattle with the intent of filling the existing research gap for extracting the veterinary knowledge present in the literature and make it available to those who are developing numerical models and tools.

Laser heat treatment is applied after coating. Evaluation of the results was performed by studying the microstructures by metallographic, SEM/EDX microscopy and the mechanical properties were obtained by microscopic hardness and abrasion resistance. The objective of this study was to investigate the effect of laser heat treatment on the wear resistance of metal coatings. The results show the influence of the microstructure and chemical composition of the electrodes used on the micro-hardness and wear resistance of the metal coatings.

Converting chemical energy from green hydrogen to electricity using Membrane Exchange Protons Fuel cell (PEMFC) is a promising solution in various applications such e-mobility and building facilities. The electrical efficiency of PEMFCs can reach 60%. However, they are immensely sensitive to the working temperature, requiring good thermal management. Active thermal management systems are expensive and energy-consuming. Passive thermal management systems enable PEMFC thermal management without additional energy consumption. Here various passive thermal management technologies are reviewed. Different techniques are thorougly described and critically compared in terms of complexity, efficiency, cooling rate, scope of applicability, and the sizes of PEMFCs to which they apply. The conclusions provide a solid background for further investigations, and recommendations for future work are suggested.

The shortage of precooling equipment in litchi producing regions could lead to a high loss rate, poor quality of litchis. It is urgent to develop a portable precooling device for litchi producing regions. In this study, a novel spray hydrocooler with thermal energy storage (TES) were designed, fabricated, and tested. A simple mathematical model of TES capacity, ice coil thermal resistance and refrigeration system was employed to determine hydrocooler parameters. Then designed the structure of the spray hydrocooler. Maximum charging test was implemented with full TES capacity and litchi spray hydrocooling experiments were carried out at different charging times, spray flow rate, and litchi load with one-third TES capacity. Results showed that: (1) the spray hydrocooler allows for the rapid and effective precooling of litchis; (2) the hydrocooler can precool 299 kg litchis with one-third TES storage, meet the precooling requirements; (3) the effective TES capacity achieved 1.25×108 J at the maximum TES capacity of the hydrocooler, while the energy efficiency ratio (EER) is 2; (4) the precooling capacity was maximum and the average power consumption was minimum when the litchi load was 23 kg and the spray flow rate was 30 L min-1. Longer charging time is the most important factor in increasing precooling capacity and reducing average power consumption.

In this investigation, Cu-Ni alloys for possible fixed dental prostheses (FDPs), with different aluminum additions were produced using vacuum atmosphere. Annealed alloys (He atmosphere) with low aluminum concentration showed a coarse dendritic structure, while samples with high aluminum concentration showed a refined dendritic structure. Structural defects analyses have shown a relative low vacancy concentrations. Hardness value increases approximately five times for the alloyed samples compared with the as-cast and unalloyed samples. Compression test results have shown a noticeable strengthening improvement, mainly in samples heat treated with 10 at % Al, while samples with 5 at % Al presented also acceptable resistance. Results are discussed in terms of dislocation mobility and hardening precipitation mechanism.

The spiral tube heat exchange is widely used in large-scale liquefaction process. However, the research on the friction pressure drop of the two-phase flow in the spiral tube is limited, especially for the offshore sloshing condition. In this paper, an experimental system is designed and built, and the effects of sloshing form (roll, pitch, heave), sloshing period (5-15s), mass flux (200-800 kg/(m2·s)), vapor quality (0.3-0.9) and operating pressure (2-4 MPa) on friction pressure drop of methane/ethane (C1/C2) mixture in spiral tube are studied. The result shows that the growth rate of time-averaged friction pressure drop during condensation under sloshing condition is less than 0, which indicates that sloshing will lead to drag reduction. And under the three sloshing parameters, the growth rate of time-averaged friction pressure drop of C1/C2 is reduced by-5.99%%, 5.97% and -6.70% respectively.

Following the rapid spread of COVID-19 across the globe, the intense response that was demanded of diagnostic centers and research laboratories prompted the use of numerous products and protocols for the management of SARS-CoV-2 specimens. In these settings, proper handling of such infectious specimen is necessary to ensure the safety of personnel and to reduce the risk of active transmission. Our aim was to evaluate the inactivation efficacy of different inactivating methods, notably from commercial lysis buffers available in diagnostic kits. Heat and sodium dodecyl sulfate detergent were also included in our investigations. A cell culture-based assay was used, and supported by molecular qRT-PCR detection, to show in vitro infectivity reduction after inactivation treatment. Overall, all the investigated methods were successful in inactivating SARS-CoV-2. Ten minutes of contact with the commercial buffers completely stopped in vitro SARS-CoV-2 infectivity. Fifteen minutes at 68°C and 30 minutes at 56°C as well as one hour with sodium dodecyl sulfate detergent at 2, 1, 0.5, and 0.1% yielded the same results. These findings demonstrate the reliability of these protocols with regards to biosafety. Inactivation by heat and sodium dodecyl sulfate detergent are rather simple and can be readily available methods for rendering an infectious SARS-CoV-2 specimen inactive, especially in settings where commercial buffers are not available.

Thermal simulations are an important part in the design of electronic systems, especially as systems with high power density become common. In simulation-based design approaches, a considerable amount of time is spent by repeated simulations. In this work, we present a proof-of-concept study of the application of convolutional neural networks to accelerate those thermal simulations. The goal is not to replace standard simulation tools but to provide a method to quickly select promising samples for more detailed investigations. Based on a training set of randomly generated circuits with corresponding Finite Element solutions, the full 3D steady-state temperature field is estimated using a fully convolutional neural network. A custom network architecture is proposed which captures the long-range correlations present in heat conduction problems. We test the network on a separate dataset and find that the mean relative error is around 2 % and the typical evaluation time is 35 ms per sample ( 2 ms for evaluation, 33 ms for data transfer). The benefit of this neural-network-based approach is that, once training is completed, the network can be applied to any system within the design space spanned by the randomised training dataset (which includes different components, material properties, different positioning of components on a PCB, etc.).

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

Objective On the eve of the summer Olympic Games in Tokyo research focus has shifted on the core temperature responses of elite athletes competing in the heat. In the absence of the field data of core temperature during Olympic sailing competition aim of the present study was to identify core temperature response during the Tokyo 2020 Olympic Test Event. Methods Four elite athletes from Olympic sailing (177.5±5.2 cm, 71.1±7.4 kg, body mass index 22.5±1.4 kg/m2, 24.8±3.7 yrs, VO2max 50.6±7.2 mL/min/kg)): 2 males and 2 females participated in the study. Core temperature was recorded using e-Celsius ingestible capsules, heart rate using a heart rate monitor. Ambient conditions in direct sunlight were measured using portable meteo station. Results Core temperature was recorded at water environment via an ingestible capsule in 4 sailors during the training (T), and competition (C), respectively. Ambient conditions in direct sunlight were hot and humid: during training temperature were 30.9°C±1.7°C and relative humidity 81.4%±2.8%, corresponding to a wet-bulb globe temperature of 41°C±4°C and during competition temperature was 31.2°C±2.3°C and relative humidity 87.2%±4.4%, corresponding to a wet-bulb globe temperature of 45.2°C±8.9°C. Core temperature increased during training reaching higher peak values (38.6°C±0.4°C) and during competition (38.9°C±0.4°C). The highest temperature recorded was 39.4°C (C). Conclusion The current study provides unique information into the core temperature parameters under heat stress in elite Olympic sailors during training and race event.

The objective of this study was to evaluate biomarkers of heat stress (HS) from automatic milking system (AMS), the relationships between measurements of temperature-humidity index (THI) and reticulorumen ph and temperature and some automatic milking systems parameters in dairy cows (rumination time (RT), milk traits, body weight (BW) and consumption of concentrate (CC)) during summer period. The experiment was carried out on a dairy farm at 54.9587408, 23.784146. Lithuanian Black and White dairy cows (n=365) were selected. The cows were milked with Lely Astronaut® A3 milking robots with free traffic. The rations were calculated to meet physiological requirements of the animals. Daily milk yield, rumination time, body weight, milk fat and protein ratio were collected from the Lely T4C management program for analysis. The pH and temperature of the contents of cow reticulorumen were measured using specific smaX-tec boluses manufactured for animal care. The daily humidity and air temperature in the farm zone were obtained from the adjacent weather station (2 km away). According this study during HS, the higher THI had positive correlation with ML, which show tendencies to increase risk of mastitis, and decrease CC, RT, BW, MY, reticulorumen ph and F/P. Some biomarkers of HS can be milk yield, milk lactose, somatic cell count, concentrate conception, rumination time, body weight, reticulorumen ph and milk fat – protein ratio. We can recommend to monitoring these parameters in the herd management program to identify possibility of heat stress.

Alzheimer’s disease is a prominent neurological disorder, which leads to progressive dementia. The microtubule-associated protein Tau is been considered as one of the major causes of Alzheimer’s disease. Physiologically Tau assists in the stabilization of microtubules, contrary to this the pathological state of Tau results in the formation of neurotoxic tangles of Tau. The posttranslational modifications, such as GSK-3β-mediated Tau phosphorylation results in the generation of Tau pathology. Neuroinflammation generated in Alzheimer’s disease, contributes to elevated body temperature. The aim of present work is to study the effect of high temperature on Tau phosphorylation. The neuroblastoma cells were exposed to heat stress for 40 minutes. The immunofluorescence and western blot studies suggested that high temperature increases the levels of GSK-3β in cells. Heat stressed cells was also observed to have elevated levels of phosphorylated Tau. Additionally, heat stressed cells found to have modulated nuclear transport as the level of Ran was reduced. The results of present work suggested that increased temperature could be considered as a risk factor in Alzheimer’s disease as it elevated the GSK-3β levels in cells thus, resulting in increased Tau phosphorylation.

Energy system optimization models (ESOM) are widely used to inform about energy transition strategies. The heterogeneity of consumers, especially in the heat sector, is rarely considered in these model types. Integrating consumer heterogeneity and behavioral factors into ESOMs may generate new insights for energy policy. In this study a literature review was conducted, identifying empirical data on consumer behavior for adopting residential heating systems. This data was integrated into an ESOM for the German heat sector, combining established methods for integrating consumer heterogeneity and a novel approach for calculating indirect costs, representing behavioral factors. The incorporation of consumer choice leads to a higher diversity in technology market shares in a business as usual and an ambitious measures scenario. Especially, the future role of log wood technologies in the private household sector may have been underestimated in previous studies and should be discussed, when designing policies. Still, these findings need to be handled with care, since the empirical data basis and the methodological basis is limited.

Chronic heat stress (HS), aggravated by global warming, reduces the production efficiency of the buffalo dairy industry. Here, we conducted a proteomic analysis to investigate the adaptation strategies used by buffalo in response to heat stress. Seventeen differentially abundant proteins with known functions were detected using label-free quantification (LFQ), and five of these differentially expressed proteins were validated with parallel reaction monitoring (PRM). These five proteins were associated with various aspects of heat stress, including decreased heat production, increased blood oxygen delivery, and enhanced natural disease resistance. Lipase (LPL), glutathione peroxidase 3 (GPX3), cathelicidin-2 (CATHL2, LL-37), ceruloplasmin (CP), and hemoglobin subunit alpha 1 (HBA1) were shown to play cooperative roles in the tolerance of chronic HS in dairy buffalo. We found that high levels of HBA1 increased blood oxygen transport capacity. Our results increase our understanding of the adaptation of dairy buffalo to chronic heat stress.

We apply the stochastic thermodynamics formalism to describe the dynamics of systems of complex Langevin and Fokker-Planck equations. We provide in particular a simple and general recipe to calculate thermodynamical currents, dissipated and propagating heat for networks of nonlinear oscillators. By using the Hodge decomposition of thermodynamical forces and fluxes, we derive a formula for entropy production that generalises the notion of non-potential forces and makes transparent the breaking of detailed balance and of time reversal symmetry for states arbitrarily far from equilibrium. Our formalism is then applied to describe the off-equilibrium thermodynamics of a few examples, notably a continuum ferromagnet, a network of classical spin-oscillators and the Frenkel-Kontorova model of nano friction.

The future power equipment tends to take hydrogen or middle/low heat-value syngas as fuel for low emission. The heat transfer of film cooled turbine blade shall be influenced more by radiation. Its characteristic of conjugate heat transfer is studied experimentally and numerically in the paper by considering radiation heat transfer, multi-composition gas and TBC. The Weighted Sum of Gray Gases spectral model and Discrete Transfer Model are utilized to solve the radiative heat transfer in the multi-composition field, while validated against the experimental data for the studied cases. It is shown that the plate temperature increases significantly when considering the radiation and the temperature gradient of the film cooled plate becomes larger. It is also shown that increasing percentage of steam in gas composition results in increased temperature on the film-cooled plate. The normalized temperature of the film-cooled plate decreases about 0.02, as the total percentage of steam in hot gas increases per 7%. As for the TBC effect, it can smooth out the the temperature distribution and insulate the heat to a greater extent when the radiative heat transfer becomes significant.

ASTM A743 CA6NM alloy is a martensitic stainless steel typically used in energy industry -runners and hydraulic turbine components- due to its superior toughness, yield and fatigue properties. In both the manufacturing, shielded metal arc welding is applied to join for this grade steels. However, weldability of the steels is limited due to formation of hard and brittle phases such as untempered martensite during welding and post weld heat treatment processes. The formation causes a reduction in toughness. In this study, influence of post-weld heat treatment procedure (single tempering and double tempering) and parameters on microstructure and hardness of AWS410NiMo all weld metal. Hardness tests were conducted from weld metal. Microstructures of the all weld metals subjected to different heat treatment process were characterized.

The color changes corresponding to chromophore structures in lignin caused by exposure of Eucalyptus（Eucalyptus grandis and E. urophylla）to heat were investigated. Eucalyptus wood samples were heated in saturated steam atmospheres for 10 h at 110℃, 130℃, and 150℃. The lignin was isolated before and after heat treatment. The physicochemical properties of the lignin and changes in chromophore structures during heat treatment was evaluated through wet chemical analysis, FTIR, UV-Vis, GPC, XPSand 13C-NMR. The color of the wood became darker and redder with the increase in pressure and temperature. Depolymerization and dehydration reactions occurred via demethoxylation with heat treatment in saturated steam at 110℃ or 130℃. Lignin condensed to form insoluble compounds after heat treatment in saturated steam at 150℃. G units increased and S units decreased through demethylation during heat treatment, as revealed by FTIR and 13C-NMR analysis.

This study examines the optimization of ground source heat pump (GSHP) systems and energy piles for sustainable urban development, with a focus on Southeast Asia. GSHPs, which utilize geothermal energy for indoor HVAC needs, offer a sustainable alternative to traditional systems by utilizing consistent subsurface temperatures for heating and cooling. The study highlights the importance of understanding thermal movement within the soil, especially in soft marine clays prevalent in Southeast Asia, to improve GSHP system efficiency. Using a one-dimensional finite-difference model, the study examines the effects of soil thermal conductivity and density on system performance. The results show that GSHP systems, especially when integrated with energy piles, significantly reduce electricity consumption and greenhouse gas emissions, underscoring their potential to mitigate the urban heat island effect in densely populated areas. Despite challenges posed by the region's hot and humid climate, which could affect long-term effectiveness, the study highlights the need for further study, including field experiments and advanced modeling techniques, to optimize GSHP configurations and fully exploit geothermal energy in urban environments. The study's insights into soil thermal dynamics and system design optimization contribute to the advancement of sustainable urban infrastructure development.

Remote sensing technologies are critical for analyzing the escalating impacts of global climate change and increasing urbanization, providing vital insights into land surface temperature (LST), land use and cover (LULC) changes, and the identification of urban heat island (UHI) and surface urban heat island (SUHI) phenomena. This research focuses on the nexus between LULC alterations and variations in LST and air temperature (Tair), with a specific emphasis on the intensified SUHI effect in Kharkiv, Ukraine. Employing an integrated approach, the study analyzes time-series data from Landsat and MODIS satellites, alongside Tair climate records, utilizing machine learning techniques and linear regression analysis. Key findings indicate a statistically significant upward trend in Tair and LST during summer months from 1984 to 2023, with a notable positive correlation between Tair and LST across both datasets. MODIS data exhibit a stronger correlation R² = 0.879, compared to Landsat R² = 0.663. The application of supervised classification through Random Forest algorithms and vegetation indices on LULC data reveals significant alterations, manifested as a 70.3% increase in urban land, concurrently with a decrement in vegetative cover, especially 15.5% reduction in dense vegetation and a 62.9% decrease in sparse vegetation. Change detection analysis elucidates a 24.6% conversion of sparse vegetation into urban land, underscoring a pronounced trajectory towards urbanization. Temporal and seasonal LST variations across different LULC classes were analyzed using kernel density estimation (KDE) and boxplot analysis. Urban areas and sparse vegetation had the smallest average LST fluctuations, at 2.09°C and 2.16°C, respectively, but recorded the most extreme LST values. Water and dense vegetation classes exhibited slightly larger fluctuations of 2.30°C and 2.24°C, with the bare land class showing the highest fluctuation 2.46°C, but fewer extremes. Quantitative analysis with the application of Kolmogorov-Smirnov tests across various LULC classes substantiated the normality of LST distributions p &gt; 0.05 for both monthly and annual data sets. Conversely, the Shapiro-Wilk test validated the normal distribution hypothesis exclusively for monthly data, indicating deviations from normality in the annual data. Thresholded LST classifies urban and bare lands as warmest classes with 39.51°C, 38.20°C and water by 35.96°C and dense vegetation 35.52°C, sparse vegetation 37.71°C as coldest, a trend consistent annually and monthly. The analysis of SUHI effects demonstrates an increasing trend in UHI intensity, with statistical trends indicating a growth in average SUHI values over time. This comprehensive study underscores the critical role of remote sensing in understanding and addressing the impacts of climate change and urbanization on local and global climates, emphasizing the need for sustainable urban planning and green infrastructure to mitigate UHI effects.

Despite the remarkable success of Carnot’s heat engine cycle in founding the discipline of thermodynamics two centuries ago, false viewpoints of his use of the caloric theory in the cycle still linger, limiting his legacy. An action revision of the Carnot cycle can correct this, showing that the heat flow powering external mechanical work is compensated internally with configurational changes in the thermodynamic or Gibbs potential of the working fluid, differing in each stage of the cycle quantified by Carnot as caloric. Action (@) is a property of state having the same physical dimensions as angular momentum (mrv=mr2ω). However, this property is scalar rather than vectorial, including a dimensionless phase angle (@=mr2ωδφ). We have recently confirmed with atmospheric gases that their entropy is a logarithmic function of the relative vibrational, rotational and translational action ratios with Planck’s quantum of action ħ. The Carnot principle shows that the maximum rate of work (puissance motrice) possible from the reversible cycle is controlled by the difference in temperature of the hot source and the cold sink, the colder the better. This temperature difference between the source and the sink also controls the isothermal variations of the Gibbs potential of the working fluid, that Carnot identified as reversible temperature-dependent but unequal exchanges in caloric. Importantly, the engine’s inertia ensures that heat from work performed adiabatically in the expansion phase is all restored to the working fluid during the adiabatic recompression, less the net work performed. This allows both the energy and the thermodynamic potential to return to the same values at the beginning of each cycle, a point strongly emphasized by Carnot. Our action revision equates Carnot’s calorique, or the non-sensible heat later described by Clausius as ‘work-heat’ exclusively to negative Gibbs energy (-G) or quantum field energy. This action field complements the sensible energy or vis-viva heat as molecular kinetic motion and its recognition should have significance for designing more efficient heat engines or better understanding of the heat engine powering the Earth’s climates.

The inhibition of heat shock protein 90 (Hsp90) a molecular chaperone for multiple oncogenic client proteins is considered as a promising approach to overcome radioresistance. Since most Hsp90 inhibitors activate HSF-1 that induces the transcription of cytoprotective and tumor-promoting stress proteins such as Hsp70 and Hsp27, a combined approach consisting of HSF-1 knockdown (k.d.) and Hsp90 inhibition was investigated. A specific HSF-1 k.d. was achieved in H1339 lung cancer cells using RNAi-Ready pSIRENRetroQ vectors with puromycin resistance. The Hsp90 inhibitor NVP-AUY922 was evaluated at low concentrations - ranging from 1-10nM - in control and HSF-1 k.d. cells. Protein expression (i.e., Hsp27/Hsp70, HSF-1, pHSF-1) and transcriptional activity was assessed by Western blot analysis and luciferase assays and radiosensitivity was measured by proliferation, apoptosis (Annexin V, active caspase 3), clonogenic cell survival, alkaline comet, γH2AX, 53BP1 and Rad51 foci assays. The k.d. of HSF-1 resulted in a significant reduction of basal and NVP-AUY922-induced Hsp70/Hsp27 expression levels. A combined approach consisting of HSF-1 k.d. and low concentrations of the Hsp90 inhibitor NVP-AUY922 potentiates radiosensitization which involves an impaired homologous recombination mediated by Rad51. Our findings are key for clinical applications of Hsp90 inhibitors with respect to adverse hepatotoxic effects.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.