Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

The construction sector of the Kingdom of Saudi Arabia (KSA), valued at USD 152 billion and employing 2.54 million people by 2023, is crucial to its economy. However, it faces challenges such as delays, disputes, and cost overruns. This study aims to address these issues by implementing Building Information Modeling (BIM) in the KSA, based on an extensive literature review highlighting the role and significance of BIM in mitigating construction claims. BIM improves collaboration, communication, and data integration among stakeholders. Hence, this study proposes a comprehensive BIM package framework comprising Revit Architecture, Microsoft Project, and Cost-X to reduce claims effectively. Validated through a KSA claims case study with a USD 1,870,000 claims value and 360-day delay, the BIM package significantly reduced the claims value to USD 188,000 and saved 275 days. Interview sessions were conducted to validate the effectiveness of the BIM package; 95% favored the use of BIM, 86% supported NEC4 contract adoption alongside BIM, 100% acknowledged BIM's potential in reducing design errors, 95% were confident in the case study's accuracy, and 82% were satisfied with data accuracy. This study confirms that BIM is an effective approach for minimizing construction claims in the KSA.

Timber-concrete composite (TCC) systems join the positive aspects of engineered wood products (good seismic behaviour, low thermal conductivity, environmental sustainability, good behaviour under fire if appropriately designed) with those of concrete (high thermal inertia, durability, excellent fire resistance). TCC facades are typically composed by an internal insulated timber-frame wall and an external concrete slab, separated by a ventilated air cavity. However, there is very limited knowledge concerning the performance of TCC facades, especially for what concerns their thermal behaviour. The present paper deals with the development and optimisation of a 2D CFD model for the analysis of TCC ventilated façades thermal behaviour. The model is calibrated and validated against the experimental data collected during the annual monitoring of a real TCC ventilated envelope in the north of Italy. Also, a new solver algorithm is developed to significantly speed up the simulation. The final model can be used for the time-efficient analysis and optimisation of the thermal performance of TCC ventilated facades, as well as other ventilated facades with external massive cladding, avoiding the expensive and time-consuming construction of mock-ups, or the use of comparably slow (conventional) CFD solvers that are less suitable for optimization studies.

Transporting water from one side of a valley or gorge to the other requires construction of an aqueduct bridge or elevated aqueduct. These features are striking elements on cultural landscapes. Unlike previous research that emphasized architecture or design and relied on documentary sources and published works, this study focuses on details of construction and first-hand observation. Roman and Medieval elevated aqueducts in Spain were subjected to rigorous field examination. Marked variations were found to exist between structures of each age. No two aqueduct bridges are alike indicating the absence of standard designs. Locally available materials were used. Construction seems to have been overseen and carried out by individuals who possessed inconsistent degrees of skill. Roman treatises discussed aqueduct bridges, but not how to build them. Many palaces were clearly designed and built by highly skilled personnel during Medieval times, but more mundane public works projects such as aqueducts appear to have been carried out by less-skilled individuals. These findings have implications regarding the construction of elevated aqueducts by Spaniards in the Americas during the 16th century.

Lump sum contracts are specific contracts used in the construction industry to give owners financial certainty and decrease risk while incentivizing contractors to finish projects on schedule and within budget. This article discusses the usage of lump sum contracts in construction projects, covering the types of projects appropriate for lump sum contracts, critical considerations for entering a lump sum contract, and the tender and preliminary expenses involved. The article also covers lump sum contracts' benefits and drawbacks and how owners and contractors allocate risk. Finally, the difficulties of implementing lump sum contracts, such as potential disagreements over scope changes and quality issues, are investigated. In general, lump sum contracts can be a valuable tool for managing construction projects, but their execution necessitates careful planning and collaboration to ensure successful completion.

The emergence of digital twins (DTs) represents a recent advancement in technological processes that support the planning, construction, and oversight of constructed assets. A DT is essentially a digital model that facilitates simulations and two-way information exchange with its real-world counterpart (a physical twin), creating opportunities for data-driven decision-making. Despite the promising prospects of DTs, both the technology and the methodologies for developing them, as well as their potential applications, remain not fully understood in both academic and industrial contexts. This research explores the applications of DTs for the management of existing assets within the AEC/FM industry. The study presents the results of a comprehensive literature review that explores existing knowledge in this domain. The findings reveal that procedures for creating DTs are still in their early stages, emphasizing potential applications in asset management throughout their lifespan, facilitating sustainability upgrades, and supporting the maintenance and restoration of heritage assets. The review concludes by providing recommendations for future research in this evolving field.

AliAmbra is a project developed to explore and promote high-quality catches of the Amvrakikos Gulf GP to Artas’ wider regions. In addition, this project aimed to implement an integrated plan of action, to form a business identity with high-added value and achieve integrated business services adapted to the special characteristics of the area. The action plan for this project was to actively search for new markets, create a collective identity for the products, promote their quality and added value, engage in gastronomes and tasting exhibitions, dissemination and publicity actions, as well as enhance the quality of the products and markets based on the customer needs. The primary focus of this publication is to observe and analyze the data retrieved from various tasting exhibitions of the AliAmbra project, with a target goal of improving customer experience and product quality.

Keywords: Demographics, Diversity, Gender, Race, Age, Professionals, Built Environment, Construction Industry, South Africa

The present state of the natural environment is significantly influenced by the construction sector. Due to the large amounts of consumed natural resources and materials as well as the high volume of emitted pollutants, the building industry is considered to have a key influence in achieving a global sustainable development. A considerable part of the ecological impact of the built environment is influenced by the energy consumed for creating appropriate indoor conditions as well as by the greenhouse gases that are emitted during the operation stage of a building’s life cycle. Therefore, the energy performances of existing buildings must be significantly improved in the near future. This paper analyzes the influence of the thermal insulation thickness of walls on the linear thermal transmittances and the heating demand of an existing building. The resulted values show that while increasing the insulation of the walls leads to a serious heat demand reduction, a deep renovation of the building cannot be achieved solely by using this solution.

Based on the teaching material of "Robotics" course, this paper studied the automatic knowledge graph construction, including knowledge points extraction and knowledge point relation extraction. We proposed a new method of extracting the first-level, second-level, and third-level knowledge points as well as their prerequisite relations of knowledge points in the textbook. For the problem of insufficient knowledge of the pre-trained language model in the specific field, methods such as incremental pre-training and optimization of cost functions are employed to integrate subject knowledge into the pre-trained language model, thus improving its effectiveness. To overcome the problem that the traditional method of relationship extraction can not be applied directly to the extraction of teaching materials, a new scheme for knowledge point relationship extraction based on keyword relationship is proposed. The experimental data from textbooks shows that the F1 score of knowledge point extraction reaches 93%, considerably improved compared to the traditional model. Consequently, the knowledge point entity extraction and relationship extraction methods based on the pre-trained model can effectively extract structured information and facilitate the automatic construction of knowledge graphs.

Background: There is a lack of literature specifically examining the workplace bullying of apprentices and trainees in traditional, male-dominated sectors such as the Australian building and construction industry. Using social identity theory (SIT), the aim of this study was to gather the attitudes, thoughts, and feelings of construction industry leaders to better understand how social identification (i.e., group membership) impacts bullying on targets and perpetrators, and the willingness to report bullying for targets and bystanders. Method: One-on-one, semi-structured interviews using a purposive sample of eight leaders from construction and blue-collar industries. Qualitative data were analysed using reflexive thematic analysis. Results: Four overarching themes were identified: difficulties for apprentices transitioning into industry, the need for continued improvement to industry culture, reluctance to report bullying, and rethinking apprenticeships to empower. Each theme provides insight into the psychosocial phenomenon of the bullying of trade apprentices and suggests that an apprentices’ level of social identification with work groups shapes how bullying is identified, interpreted, and prevented. Conclusion: Findings from this study will be important for tailoring evidence-based interventions, human resource policies and initiatives for education and awareness training. Themes also highlight systemic inadequacies impacting apprentices’ mental health and skill development, with implications for the future sustainability of apprenticeship training agreements.

In response to the fire protection design challenges faced by the integrated station-city engineering under the new model of station-city fusion, such as large building volume, diverse traffic types, functional integration, spatial complexity, and inapplicable standards, this paper selects Chongqing East Station as a typical engineering case. The fire safety engineering methods and performance-based fire protection design ideas were used. The paper summarized the fire protection difficulties, such as multifunctional combination construction, large fire protection distance, large fire protection zoning area, long evacuation distance, and design of evacuation (quasi) safety zones. Combining with the actual situation of the engineering, this paper analyzed the basic technical measures taken to address these design challenges. By adopting the method of fire safety engineering, the safety of the design scheme is verified, which can provide a solution approach for the current fire protection design challenges in the integrated station-city engineering.

Leasing and recycling are important issues to achieve low-carbon sustainable development of construction machinery industry, however there are some dilemmas bothering which is caused by excessive restriction of product service life. Focusing on the problem of pricing and coordination, a two-stage model of leasing closed-loop supply chain based on the Industrial Internet platform practical application was proposed. Under the centralized and decentralized decision-making scenarios, the price of leasing and selling, maintenance effort and recovery rate are calculated respectively. By using the Shapley value method to optimize the selling price, and the two-part pricing contract to calculate the compensation fee, the global profit is reasonably distributed, while the supply chain achieving Pareto optimality. The performance of different contracts on the improvement of supply chain profit was investigated. And the correlation among parameters was also explored through sensitivity analysis and numerical simulation. The findings showed that maintenance and recycling of construction machinery can be improved with the advantage of the Industrial Internet platform, while achieving the supply chain coordination by contracts. The enhancement of maintenance effort can decrease the remanufacturing cost which is positively correlated to the selling price and leasing price of product, furthermore promoting the recovery rate of used products. In the future, reasonable control of platform cost can help improve the recycling of construction machinery.

Across the global construction industry, fatalities continue to occur from high-risk activities where the risk controls have been defined, however were unreliable. In the mining industry, Critical Control Risk Management has provided positive results in reducing major accidents, which raises the question, could the Critical Control approach reduce the fatality rate in the construction industry? This study analysed 10 years of serious and fatal incident investigation reports from four international construction companies to i) assess the reliability of their Critical Controls (CCs) and ii) assess the factors which affect the reliability of CCs. The results show the reliability of CCs, measured by implementation and effectiveness, averaged just 42%. Human performance factors including risk identification, decision-making and competency together with supervision, job planning, communication organisational factors were identified as affecting the reliability of CCs. The study used bow-tie diagrams with real event data to find the actual CC effectiveness. This gave actionable findings directly related to individual CCs enabling the participating organization to focus resources on improving specific verification processes. The results confirm the applicability of CCs for the Major Accident Event hazards analyzed and highlights further review is required of the factors which need to be considered when implementing a CC program. This paper details our methodology and results, to assist others apply CCs as a risk management tool.

Despite all their advantages, load-bearing concrete shell structures with double curvatures are not frequently in use. The main reason is the complexity of their construction. In such a context, this article starts with a brief, critical review of existing technologies while their pros and cons are highlighted. Against that background the authors then propose a new approach for the highly automated fabrication of gridshell structures from variable modules. To demonstrate the feasibility of such a new technology, a demonstrator called ConDIT 1.0, a sphere-like shell structure composed of several frames was designed and built. The frame modules were fabricated automatically using extrusion-based 3D printing and a printable, strain-hardening cement-based composite (SHCC). This article presents the design of ConDIT 1.0, the mechanical material characterization of printed SHCC, the technology of module production, the results of geometry verification for print modules using 3D scanning, and the procedure for the demonstrator’s assembly.

We are witnessing a progressive divestment of some institutions with strong traditions and skills in physical modelling and their consequent impoverishment, to the detriment of numerical modelling. For many reasons, the economic imperatives and the exponential growth of computational means and numerical methods should certainly not be excluded. In this work, we aimed to highlight the new requirements of the recent sophisticated developments in physical modelling, precisely due to the new needs imposed on them by mathematical and numerical modelling and the growing risks in civil construction works. In this context, reflections are reported, justified by scientific and real-world examples, on the need for maintenance and reinforcement of investments in physical modelling, both to support the scientific community and to design buildings of significant economic, social and environmental impact.

This study employed a deductive research approach and a survey strategy to assess risk perception and its influencing factors among construction workers in Malawi. Three specific construction hazards and their associated risks were selected. The hazards were ‘working at height (WAH) ‘manual handling of loads (MHL)’ and ‘heavy workload or intense pressure to be more productive (HWP)’. The study engaged multistage sampling of 376 subjects. Univariate analysis, factor analysis and multiple linear regressions were performed in order to determine the main influencing factors among the independent variables. The study established that workers were aware of risks posed by their work. They perceived the risk associated with WAH, MHL and HWP as very high (62.7%, = 8.80 ± 1.95); (48.5%, = 8.10 ± 2.38); (57.9%, = 8.49 ± 2.22) respectively. The study identified six factors as variables that showed significant effect on workers’ perception of risk (p < 0.05). These factors were “dreaded factor”, “avoidability and controllability”, “expert knowledge”, “personal knowledge”, education level and age. It is concluded that contractors in the Malawian construction industry should integrate analysis of behaviors and risk perception of the workers and other players to guide the identification of better health and safety interventions at their worksites.

Recently there has been growing interest in the application of game theory (GT) to solve many diverse problems in the field of construction, including i.a.: tender preparation, selection of a contractor for construction works, negotiating terms and conditions of cooperation of the parties to the contract, analysis and modeling of investment risk. In the authors opinion, the use of GT by general contractor (GC) of construction works to indicate the best strategy leading to winning court proceedings in a situation of conflict with investor (IN), so far has not been the subject of research. Taking into account the above, the aim of the presented paper is to indicate the optimal strategy from the GC point of view in the conflict situation with IN. The article presents a list of the most common causes of conflicts between parties of the construction works' contract, defines the background of the problem and the cause of the dispute, and on its basis, the authors generate the theoretical model of the game. Based on the analyzed game model, expected payoffs for players were calculated and the probability border value at which GC should apply the indicated strategy determined. The results of the study show that in the case when the probability of issuing a judgment favorable for GC is at least equal to 69.23%, it is justified to use an aggressive strategy. The analysis also confirms that from the financial perspective, litigation in most cases of conflicts in the area of construction should be the last choice.

Traditionally understood in reference to distance education, cognitive presence may be defined as "the extent to which the participants in any particular configuration of a community of inquiry can construct meaning through sustained communication. The purpose of this paper was to create a blueprint for the reflective ePortfolio as the capstone project for my graduate degree. The blueprint was accomplished by adapting for use cognitive presence as a tool for both analysis and framing, which has never been done to the best of my knowledge. I considered myself to be a participant in a “community of inquiry” model and substituted the result of my interaction with each of the required instructor-course content pairings I took to serve as fellow participants in this community model. The result of my participation was understood to be the knowledge and experience that I have gained, which was reflected in eight of my academic research papers. These selected papers were the artifacts around which my ePortfolio was ultimately developed and demonstrated my participation as an active member in this community of inquiry constructing meaning through sustained communication.

The electrocardiogram (ECG) was the first biomedical signal where digital signal processing techniques were extensively applied. By its own nature, the ECG is typically a sparse signal, composed of regular activations (the QRS complexes and other waveforms, like the P and T waves) and periods of inactivity (corresponding to isoelectric intervals, like the PQ or ST segments), plus noise and interferences. In this work, we describe an efficient method to construct an overcomplete and multi-scale dictionary for sparse ECG representation using waveforms recorded from real-world patients. Unlike most existing methods (which require multiple alternative iterations of the dictionary learning and sparse representation stages), the proposed approach learns the dictionary first, and then applies an efficient sparse inference algorithm to model the signal using the learnt dictionary. As a result, our method is much more efficient from a computational point of view than other existing methods, thus becoming amenable to deal with long recordings from multiple patients. Regarding the dictionary construction, we locate first all the QRS complexes in the training database, then we compute a single average waveform per patient, and finally we select the most representative waveforms (using a correlation-based approach) as the basic atoms that will be resampled to construct the multi-scale dictionary. Simulations on real-world records from Physionet's PTB database show the good performance of the proposed approach.

Resistive patch array incorporating with metallic backplane provided an effective way to the achievement of broadband metamaterial absorbers(MAs). When loading metallic metamaterial to resistive MA, the outstanding construction helps realize more flexible and diversified forms of broadband absorption. In this paper, we attempted to load metallic resonators(MRs) to resistive MA in the three-dimensional construction, which benefits further enhancement of lower-frequency absorption. Simulation showed that the partial absorption band was separated to lower frequency, while the rest of broadband absorption was unaffected. Meanwhile, after combining multi-unit of the proposed MAs, the stair-stepping broadband absorption was also achieved. At last, three samples were fabricated. The agreements between simulations and experimental results demonstrated that resistive MA loaded with MRs provided an effective way for further enhancement of lower-frequency absorption with almost no change of the absorbing structure and areal density. Thus, it is worthy to expect a wide range of applications to emerge inspired from the proposed attempt.

As the most active plateau on the Earth, the Qinghai-Tibet Plateau has a complex crust-mantle structure. Knowledge of the distribution of such a structure provides information for understanding the underlying geodynamic processes. We obtains a three-dimensional density model of crustal and upper mantle beneath Qinghai-Tibet plateau and its surrounding areas from the residual geoid anomalies using the Earth Gravitational Model (EGM) 2008. We estimate a refined density model by iterations, using an initial density contrast model. We confirm that the EGM2008 mission products can be used to constrain the crust-mantle density structures. Our major findings are: (1). At 300-400 km depth, high-D anomalies terminate around Jinsha River Suture (JRS) in the central TP, suggesting that the Indian plate has been reached over the Bangong Nujiang Suture (BNS) and almost reach to the JRS. (2). On the eastern TP, low-D anomalies at the depth of 0-300 km together with high-D anomalies at 400-670 km further verified the current eastward subduction of Indian plate. The ongoing subduction provides forces to the occurrences of frequent earthquakes and volcano. (3). At 600 km depth, low-D anomalies inside the TP illustrate the existence of hot weak material beneath there, contributing to the external material inward-thrusting.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

This study investigates the fixed-time consensus-based attitude control problem for large telescope on-orbit construction subject to discrete-time communication, unknown tiny disturbance torque, model uncertainty, and actuator saturation under an undirected communication graph. Motivated by the need to save wireless communication resources, the communication scheme was designed to exploit interference, which can save communication resources in proportion to the number of modular unit mirrors. Then, a fixed-time observer with discrete-time communication was proposed, which also handles the unknown channel attenuation problem when exploiting information interference. Moreover, based on the backstepping procedure and the suitably defined adaptive compensation law, the fixed-time attitude consensus control law was proposed to handle unknown tiny disturbance torque, model uncertainty, and actuator saturation. Finally, comparative simulation results were provided to verify the effectiveness of the fixed-time observer and proposed fixed-time control law.

The integration of digital technologies into construction practices has emerged as a pivotal area of interest, reflecting its substantial influence on the future trajectory of the construction industry. This study undertakes a comprehensive bibliometric analysis of literature on construction digitalization spanning from 2013 to 2023, sourced from the Elsevier Scopus database. Employing key terms such as "construction digitalization," "BIM," "construction 4.0," and "digital construction methodologies," the research methodically extracts and scrutinizes relevant articles. Advanced tools like the VOS viewer were utilized to delve into the bibliometric networks, offering insights into prevailing research trends within the built environment sector. The findings reveal a pronounced emphasis on digital modeling, automation, blockchain technologies, and emerging paradigms such as smart contracts and modular construction. This investigation enriches the academic discourse by elucidating the varied subtleties, ongoing shifts, and prospective directions in the ever-evolving landscape of construction digitalization research.

The decarbonization of the built environment, both in new construction and renovation, is crucial to mitigate its relevant impact on climate change and achieve the Paris agreement goals. This study presents a systematic LCA-based methodology to assess the whole life carbon emissions of buildings, applied to a proposal for the regeneration of one of Milan’s disused railway yards. As an entry for the 2020 Reinventing Cities competition, Scalo Lambrate is a project for a mainly residential neighborhood with a public park. Strategies to reduce carbon emissions deriving both from the operational energy and construction and maintenance were evaluated and their effects compared to a reference scenario over a time horizon of 100 years. The results show that, while the opportunities to reduce carbon emissions during the use phase are somehow limited due to the already stringent performance requirements for new builds, the use of fast-growing biogenic materials for construction materials, even if mixed with more traditional ones, can provide a significant reduction of the global warming potential over the whole life cycle, with a reduction of 70% over the baseline. The remaining emissions can be offset with afforestation initiatives that, however, must be assessed against land use issues.

Centimeter-level localization and rotation angle estimation of flatbed trucks are major problems in unmanned forklift automated loading scenes. To solve it, this study proposes a method for high-precision positioning and rotation angle estimation of flatbed trucks based on BeiDou and vision. First, an unmanned forklift equipped with a ToF camera and double antenna mobile receiver for BeiDou positioning collects depth images and localization data near the front and rear endpoints of the flatbed. Then DDRNet-23-slim was used to segment the flatbed from the depth image and extract the straight lines at the edges of the flatbed using the Hough transform and compute the set of intersection points of the lines. A neighborhood feature vector was designed to locate the endpoint of a flatbed from a set of intersection points by feature screening. Finally, the relative coordinates of the endpoints were converted to a customized forklift navigation coordinate system by BeiDou positioning, and rotation angle estimation was performed by the front and rear endpoints. Experiments showed that the endpoint positioning error was less than 3 cm and the rotation angle estimation error was less than 0.1°. The precision of the method meets the demand for automated flatbed truck loading by unmanned forklifts.

Digital infrastructure is the basic guarantee for digital transformation, it is of practical significance to discuss how to effectively use digital infrastructure construction to promote the digital transformation of tourism enterprises. This paper examines the impact of digital infrastructure construction on tourism enterprises based on the "Broadband China" policy as a quasi-natural experiment. A-share tourism listed enterprises from 2010 to 2021 are studied using the double difference method. Findings indicate that digital infrastructure construction positively and significantly influences the digital transformation of tourism enterprises, driven by digital leadership and innovation capabilities. State-owned, small-scale, and high-growth tourism enterprises benefit more from this transformation. The results suggested that the state should develop differentiated digital infrastructure plans based on the specific conditions of different tourism enterprises. Additionally, tourism enterprises should enhance digital leadership and innovation capabilities through strategic changes and digital applications to amplify the impact of digital infrastructure on their transformation.

Background: As long-lived organisms, urban trees often encounter development and redevelopment activities in close proximity during their lifespans. These activities can damage tree roots, often through methods like root severing during trenching or excavation. Methods: In 2017, we simulated trenching damage on mature Quercus virginiana Mill. trees at three different distances from the base (3x, 6x, and 12x the stem diameter). After five years, we revisited these trees to assess root regrowth based on the cut root's cross-sectional area (CSA) and distance from the base. Results: We observed regrowth in all but 38 (6.7%) of the 557 cut roots revisited. The lack of regrowth in some roots was not associated with our original treatments, the CSA of the roots at the time of trenching, or distance between the cut root end and the trunk (minimum P-value = 0.841). On average, the observed CSA of the regrowth was 22.2% of the original root's CSA. Only our original trenching treatments significantly predicted the level of regrowth observed five years after pruning (P-value = 0.024). Discoloration due to root pruning was minimal. Conclusion: In summary, our findings indicate that root systems require many years to recover from trenching damage. Increasing the distance between trenching activities and trees may have a minor effect on root regrowth but primarily helps reduce initial stress on the tree.

With the continuous development of digital transformation and upgrading of Chinese construction enterprises, it is becoming increasingly important to measure their digital level, find the problems in the enterprise transformation process, and identify the key factors of enterprise digital capacity enhancement. This paper constructs a construction enterprise digital transformation maturity evaluation model from six first-level indicators and 20 second-level indicators, including digital strategy, digital business application, digital technology capability, data capability, digital organization capability, and change management. Digital maturity is divided into five levels: business management, process operation, intelligent construction, intelligent scene application, and industrial ecological collaboration. A detailed process of digital maturity evaluation based on the method of Analytic Hierarchy Process (AHP)-Decision Testing and Evaluation Laboratory (DEMATEL) is then developed. A questionnaire survey of 25 experts is used to weight the various parameters in the model, which is then demonstrated with an example construction enterprise. The model comprehensively reflects digital levels under the background of the digital economy. Its application will help understand the advantages and disadvantages enterprises face in their digital transformation to enable targeted measures to improve their digital transformation capabilities and efficiency, enhance their core competitiveness of enterprises, and promote the development of digital transformation in the construction industry.

For enhancing the efficiency of cantilever casting the construction in the bridge, a novel rhombus traveling track of hanging basket was developed and optimized. The civil software titled Midas was applied to analyse the mechanical properties of the hanging basket with full load and control load. The strength and distortion of the walking mechanism were within the specified range when the maximum beam unit internal force of 149.69Mpa, which was less than the allowable stress of steel 175Mpa, and the anti-overturning safety factor of the hanging basket was 2.5 to meet the requirements. Through the comparative analysis of the key components and the finite element calculation, it was found that there was about 30% redundancy in the structure performance. Therefore, further optimization of each structure was carried out, and the front elevation of the main truss of 20° was achieved. It obtained the best performance in all aspects.

Kenya’s construction industry is experiencing exponential growth in tandem with construction trends globally. With the growth experienced in the industry, there has been significant growth in the economy and a 50% contribution to the world’s landfill waste and pollution to the adjacent environment. Globally, the construction industry is among the largest consumers of natural resources and significant contributors to pollution. This has given rise to high pressure to adopt environmentally sensitive approaches in the construction industry to present a competitive advantage. It is, therefore, crucial to address the need for sustainability measures for Landscape Architecture projects to increase knowledge and awareness, create incentives geared towards supporting sustainable practices, and leverage legal instruments and policies. Green construction practices and strategies have positively impacted the environment and the Kenyan construction industry’s social and economic performance. However, there are several barriers to the adoption and improvement of monitoring and evaluation of sustainable practices, thus slowing down the industry in taking charge of sustainability.

Over the past few decades, the quantity of construction waste has steadily risen in tandem with the expansion of construction activities and the rapid pace of development and urbanization. This problem is rooted in the practice of delivering materials to construction sites without totally using them for their intended purpose. The primary aim of the JIT tactic is to ensure that the precise materials required for production are available at the precise location, exact time, and appropriate quantity, thereby facilitating timely production. Presently, the use of ready-mix concrete is the most typical instance of a just-in-time construction process Developed countries have benefitted immensely from the use. However, the reverse is the case in developing countries like Nigeria, where indigenous contractors still employ traditional in-situ concreting even when faced with restrictive site space. This study focuses on investigating Ready-mix concrete, to project its immense benefits and effectiveness in minimizing lean construction waste. A survey research design and case study were adopted for this study, with the population being the management staff of construction firms in Lagos State, Nigeria. The questionnaire was used to collect data and the targeted respondents were purposively selected from the population. A total number of 112 questionnaires were administered with a response rate of 51%. Percentage, mean, standard deviation, and ANOVA were used to analyze the data. The mean value is above 3 on a Likert Scale of 5, while faster construction speed and uniform quality of concrete are the topmost benefits derived from adopting Ready-mix Concrete in Nigeria. The Case study also revealed the effectiveness of Ready-mix concrete in minimizing the two lean construction wastes that were examined, namely; waste of overproduction and waste of waiting. It is recommended Just-in-Time technique should be extended to other construction materials aside from concrete to improve waste minimization through the adoption of an overall JIT policy for the construction process.

The state of BIM adoption and implementation in facility management in Africa has been regarded as a developmental discourse gradually gaining grounds. While several studies have focused on manual review of the intellectual progression of BIM research, this confined review however understates the evolution of BIM in facility management. This approach therefore is not always representative of the picture of BIM in facility management at its formative stage. This paper aims to present a scientometric review of BIM in facility management exploring the intellectual progress made so far by authors. The state of the art of BIM in facility management research and practice and the challenges debilitating against BIM in facility management research. The review revealed a considerable amount of research endeavours limited by inadequate collaboration acorss organizations and institutions. The study also revealed the low degree of awareness amongst researchers in the AEC sector. While North America and China were leading countries due to the activity of few universities, Africa wasn’t as visible in research endeavours. The study recommended an increase in awareness drive across countries and increased government effort, joint funding for research to include gaps in practice issues.

In this paper, industrial structure distortion, two-way FDI and carbon emission intensity are brought into a unified research framework, and based on China's panel data from 2011 to 2020, empirical tests are conducted employing Exploratory Spatial Data Analysis (ESDA), spatial econometric model and intermediary effect test. The results show the following. Firstly, China's industrial structure distortion index shows a downward trend. The industrial structure distortion index is the highest in the west, followed by the middle, and the lowest in the East. Secondly, the relationship between carbon emission intensity and economic development shows a "decoupling" effect and keeps decreasing year by year. The spatial disparity is remarkable, showing the pattern of "the east leading, the middle catching up and the west lagging ". At the provincial level, except in Xinjiang province, the carbon emission intensity of other provinces showed different degrees of decline. In terms of spatial distribution, the polarization characteristics of carbon emission intensity are significant, and the traditional spatial distribution pattern has been broken. Thirdly, there is a positive spatial correlation between China's industrial structure distortion, two-way FDI and carbon emission intensity. The distortion of industrial structure will not only lead to the increase of local carbon emission intensity but also produce reverse spillover to adjacent areas. IFDI and OFDI provide a strong driving force for the decline of carbon emission intensity. IFDI promotes the decline of carbon emission intensity in adjacent areas, while OFDI will increase the carbon emission intensity in surrounding areas. The interaction of IFDI and OFDI can significantly reduce the carbon emission intensity of local and adjacent areas. Fourthly, the results of intermediary effect analysis show that two-way FDI is the two channels of industrial structure distortion affecting carbon emission intensity. Industrial structure distortion can affect the transmission mechanism of carbon emission intensity by affecting two-way FDI.

To explore the spatial network structure characteristics and driving effects of carbon emission intensity in China's construction industry, the investigation combined the modified gravity model and social network analysis method to deeply analyze the spatially associated network structure characteristics and driving effects of carbon emission intensity in China's construction industry, based on the measurement of carbon emission data of China's construction industry from 2006 to 2017. The results show that the regional differences of carbon emission of construction industry are significant, and the carbon emission intensity of construction industry show a fluctuation trend. The overall network of carbon emission intensity shows an obvious “core-edge” state, the hierarchical network structure is gradually broken. Economically developed provinces generally play a leading role in the network, and play an intermediary role to guide other provinces to develop together with them. Among the network blocks, most of the blocks play the role of “brokers”. The block with the leading economic development has a strong influence on the other blocks. The increase of network density, the decrease of network hierarchy and network efficiency will reduce the construction carbon emission intensity.

The global coronavirus (COVID-19) pandemic has created a whole new set of risks in construction industries generating unprecedented delays, disruptions, and uncertainty on construction projects, and has forced the industries in adopting more sophisticated technologies while combating the reduced workforce on job sites. Further, the post-pandemic era of construction is expected to be a lot different as the industries will embrace the technology as the augmentation and collaboration strategy. Thus, it will be extremely hard to sustain for construction industries in the absence of effective risk management. The existing risk plans need to be inspected for their capability of handling new risks arising from COVID-19 and the project managers will need to make the necessary revisions as needed. This paper discusses on past (NORM), present (NEW NORM), and future (Post COVID-19 NORM) of the construction industry and highlights key strategies for managing projects and construction risks during and post COVID-19 pandemic.

This research is aimed at evaluating two different scenarios, firstly, appraising the impacts of employing the concepts of Total Quality Management (TQM) to the construction projects in Saudi Arabia. The results of the study were obtained through utilization of a descriptive analytical approach, where 300 questionnaires were distributed to engineering firms and companies with a response rate of 200 questionnaires, hence achieving the study sample for this research. The data gathered was analyzed by applying the Statistical Package for Social Science (SPSS) program and calculating the Relative importance index (RII) and the mean values. From the research conducted, the outcomes showed that the management’s ability to commit using TQM while applying BIM obtained a relative importance of (0.717), while the relative importance for the management’s ability to commit using TQM without the application of BIM is (0.552). The results showed that construction projects in Saudi Arabia still sustain setbacks from applying TQM concepts and suffer from the lack of administrative, scientific and technical applications. In a second scenario, a hybridized support vector regression (SVR) Harris-hawks optimization (HHO) (i.e., SVR-HHO) were used to predict the TQM. The performance accuracy of the models was checked through three different evaluation metrics namely; mean square error (MSE), correlation co-efficient (CC) and Nash-Sutcliffe efficiency (NSE). the hybridized emerging SVR-HHO outperformed the other two data driven approaches in both the training and testing stages based on the employed evaluation metrics. Overall, the obtained results showed that both the machine learning and metaheuristic approaches were capable of predicting TQM.

The umbrella concept for the current efforts to digitize construction is known as Construction 4.0. One of its key concepts is cyber-physical systems. The construction industry is not only creating increasingly valuable digital assets (in addition to physical ones) but also the buildings and built infrastructures are increasingly monitored and controlled using digital technology. Both make construction a vulnerable target of cyber-attacks. While the damage to digital assets, such as designs and cost calculations, may result in economic damage, attacks on digitally-controlled physical assets may damage the well-being of occupants and, in worst-case scenarios, even damage (or death) to the users. The problem is amplified by the emerging cyber-physical nature of the systems, where the human checks may be left out. We propose that construction learns from the work done in the context of critical infrastructures (CI). First, a lot of CI is construction-related, and the process of designing and building it must be secured accordingly. Second, while most assets may not be critical in the CI sense, they are critical to the operations of a business and the lives of citizens. In the end, we recommend some steps so that well-established processes of critical infrastructure protection trickle down to make Construction 4.0 and the built environment more cyber-secure. With that in mind, we describe the possible inclusion of Construction 4.0 considerations into existing critical infrastructure protection (CIP) frameworks with minimum frictions. We also propose some suggestions regarding possible future courses of action to improve the increasingly vulnerable cyber-security environment of the built environment across all life cycle phases - design, construction, operation, maintenance, and end of life.

Driving factors of smart city construction are exploratively studied by grounded theory method based on text sources from journal papers in SCI and CSSCI databases. Initial scale of driving factors about smart city construction is obtained on the basis of above analyses. This paper modifies measuring items of the initial scale with a small sample pretest and reliability test, then forms final items by exploratory factor analysis. According to the above scale, questionnaires are designed to obtain empirical data, and confirmatory factor analysis is used to verify further validity and reliability of the scale. The results show that driving factors of smart city construction include three main dimensions: problem-oriented factors, business- or technology-driven factors and endogenous development requirements.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

This study explores the current landscape of social value (SV) research in the construction industry, analyzing global trends and identifying future research directions. Using bibliometric analysis, research published in Elsevier Scopus database from 2013 to 2023 was extracted using the keywords "social value" AND "construction industry." Results indicate a focus on social value indicators, socioeconomic impacts, project management, innovative practices, and cross-sector collaborations. The study also reveals a lack of attention to SV in African countries' construction sectors. By highlighting research areas and identifying gaps, this study contributes to academic literature, suggesting the need for guidelines, particularly in developing countries, and advocating for further research on SV in the built environment and strategies for global social value creation.

To facilitate the promotion and application of the whole process engineering consulting (WPEC) model, the transmission mechanism of influencing factors in WPEC's promotion and application is investigated. It identifies and categorizes the influencing factors within the framework of "external environment-project factors-stakeholders", systematically organizing and summarizing ten primary categories and thirty-eight secondary influencing factors of WPEC's promotion and ap-plication. Utilizing the complex network analysis method, a network of influencing factors in the promotion and application of WPEC is constructed. The network is then converted into three binary networks based on weight, which are subjected to structural analysis and motif analysis. On this basis, the transmission mechanism of influencing factors in WPEC's promotion and applica-tion and its causations are explored.

Cycle times at workstations in offsite construction factories fluctuate widely due to various influencing factors. Consequently, relying on average rates, such as length per unit of time, for estimating cycle times proves to be inaccurate, often leading to significant deviations between production schedules and actual operations. To address this issue, this study proposes an estimation system that leverages machine-learning-based prediction, statistical methods, 3D simulation, and computer vision to predict cycle times at the workstation level. Testing of the system on a semi-automated wood-wall framing workstation in a panelized construction factory shows that it reduces the mean absolute error and sum of errors by approximately 36% and 68%, respectively, compared to the fixed rate method. The results also highlight the efficacy of using computer vision data for training machine-learning models for cycle time estimation, the importance of identifying and understanding the factors influencing cycle times, and the impact of random delays on the accuracy of cycle time estimation systems.

Building carbon footprint analysis is a key instrument for assessing the impact of different constructions on climate change. Several standards and methodologies are available to calculate the footprint of buildings, including standards and norms, life cycle assessment (LCA), and dedicated software tools. The use of BIM software for these calculations is both scientifically justified and very practical. This scientific publication focusses on the application of a BIM-based research methodology for the analysis of the carbon footprint of a single-family house. The research process included the following steps: (i) design of a single-family house with timber frame construction using Archicad BIM software, (ii) simulation of the building energy performance using the EcoDesigner Star plug-in, (iii) life cycle assessment (LCA) using the plug-in for Archicad, (iv) preparation of a second model with traditional masonry construction for comparison, and (v) comparative analysis of the single-family house models with timber frame and masonry construction. Analysis of the results highlights significant differences in CO2e emissions between masonry and timber buildings and the varying impact of individual elements on the total CO2e emissions of the buildings studied. These findings are relevant for future work on sustainable building design and construction, which aims to minimise negative environmental impacts. The goal of minimising the cumulative carbon footprint of buildings is critical to achieving the Sustainable Development Goals and combating climate change.

Additive manufacturing enables the realization of complex component designs that can not be achieved with conventional processes, such as the integration of lattice structures for weight reduction. To include lattice structures in component designs, an automated algorithm compatible to conventional CAD is required that is able to handle various lattice topologies as well as variable local shape parameters such as strut radii. Furthermore, smooth node transitions are desired since previous studies indicate advantages regarding reduced stress concentrations and the structural response to loadings such as fatigue performance. The surface patch-based algorithm developed in this work is able to solidify given lattice frames to smooth lattice structures without manual construction steps. The algorithm requires only a few seconds of sketching time for each node and favours paralellization. Automated special case workarounds as well as fallback mechanisms are considered for non-standard inputs. It is demonstrated on irregular lattice topologies and applied for the construction of a lattice infill of an aircraft component that was additively manufactured.

Purpose – The paper aims to view how researchers have operationalized social impact assessment for construction projects over the last ten years. Design/methodology/approach – A systematic review was used to investigate case studies in the Social Life-Cycle Assessment (S-LCA) to analyze the application of the methodology. A qualitative study of 19 articles published between 2012 and 2022 was used to collect content on multiple categories impeding S-LCA through case studies in the construction industry. Findings – Our results showed the existence of limitations on the qualitative and quantitative aspects in measuring the social indicators. They were associated with the scoring method and the lack of data in some articles. Social implications – From this review, we understood that S-LCA has flaws in terms of the quality of the measurement, scoring method, and the lack of social data. Lack of social data means social impacts are being neglected and not assessed properly since there are several challenges pointed out throughout literature Originality/value – The originality of this research is that it focuses on case studies in the construction industry. It studies the operationalization of the S-LCA in this specific industry showing the different characteristics and challenges in the last 10 years.

Cropland area is closely related to food production. More previous focuses were paid on impacts of extreme events on food production, but less on cropland dynamics. This study took the Farming-Pastoral Ecotone of Northern China (FPEN) as a case area, to investigate its cropland area dynamics and driving factors in view of perspectives of extreme events, environmental conditions, socioeconomic development, urban expansion, and ecological construction. We used ridge regression approach to quantify contributions of these drivers to cropland area dynamics. Results showed that cropland area increased significantly at a rate of 333.5km2/a during 1992−2020 and were spatially clustered in east of the FPEN. Impact extent and size each driving factor on cropland trend presented large spatiotemporal differences, but ecological construction (EC) had overall the greatest impact on cropland area changes, followed by urban expansion (UE). In comparison, TL10p has the smallest. UE-dominated areas increased 41.9% since 2010s, but still less than EC. Furthermore, we found that extreme events effects on cropland area trend evidently increased. Particularly, TH90p displayed the most increase (~99.4%). Cropland area changes dominated by extreme temperature events in 2010−2020 increased nearly six times than that in 1992−2010. These findings suggest that increasing impacts of extreme weather events on cropland area changes should be cautioned.

Improper lifting measures of long-span spatial steel structures during construction process may delay the construction period and even cause safety accidents. Few studies on long-span spatial steel structures considered time-varying mechanical characteristic during construction process. In order to achieve safe and efficient installation in a long-span spatial steel structure, this research presents a time-varying mechanical analysis of the synchronous and asynchronous integral lifting and a single and interlaced point’s asynchronous integral lifting analysis method of a long-span spatial steel structure. The results showed that in the case of asynchronous lifting of single point, the displacement influence on other members is related to the distance. The closer the distance from the lifting point, the greater the influence. In asynchronous integral lifting, the lifting point with large lifting force is first installed to the specified position, and the lifting point with small lifting force is installed to the specified position.

The digital representation of various signals allows, at the subsequent stages of their transmission, to apply correction codes that provide protection against possible errors arising from the action of interference in the communication channel. At the same time, it is important that, with the required correcting ability, these codes have the maximum possible speed. The article presents the results of calculations for linear codes, showing their really achievable limiting capabilities.

To address the severe distresses of asphalt pavement, a new type of pavement maintenance treatment, porous ultra-thin overlay (PUTO) with small particle size was proposed. The PUTO has a thickness of 1.5~2.5 cm and a large void ratio of 18~25%. As a newly asphalt mixture, the structure characteristics differ from traditional pavement. Therefore, it is necessary to investigated the fabrication schemes in laboratory and on-site, respectively. In this study, the optimal fabrication schemes, including compaction temperature and number of blows of PUTO were determined based on Cantabro test and volumetric parameters. Then, the corresponding relationship between laboratory and on-site compaction work was then established based on the energy equivalent principle. On this basis, the numbers of on-site rolling passes and the combination method were calculated. The results show that increased compaction temperature and number of blows reduce the height and enhance the compactness of the Marshall sample. With the same temperature and number of blows, the scattering resistance of coarse gradation (PAC-1) is better than that of fine gradation (PAC-2), and the increased asphalt viscosity significantly improves the scattering resistance of the asphalt mixture. To ensure the scattering resistance and volumetric characteristic, the initial compaction temperature of the PAC-1 and PAC-2 should not be lower than 150 °C and 165 °C, respectively. Then, the laboratory compaction work and on-site compaction work were calculated and converted based on the principle of energy equivalence. Consequently, the on-site compaction combination of rolling machines for four asphalt mixtures was determined. According to the volumetric parameters, the paving test section proved that the construction temperature and the on-site rolling combination determined by laboratory tests are reasonable, and ultra-thin overlay has good structural stability, drainage and skid resistance.

The construction industry is one of the most fatal industries, so it is important to pay more attention to safety solutions. Even though work-related accidents are known as major waste in construction projects, little attention has been paid so far to incorporating safety into the lean construction framework. In this research, lean construction theory is reviewed through the lens of safety. That being so, the identified challenges in previous research on improving safety in construction projects are categorized and those related to the concept of lean project delivery are introduced. Then, the principles of the lean construction framework are explained and the relevant changes for incorporating safety into the framework are introduced and discussed. It is expected that this hybrid model would further enrich the lean construction framework. The careful attention of project executives to this model may improve the safety situation in construction projects.

The consistently positive Australian economic environment and stable population increase have led to a higher demand for new houses in recent years. Prefabrication is a promising method to help alleviate the issues related to housing shortage and affordability due to reduced material wastage, construction delays due to weather conditions, unexpected costs, shortage in labour and onsite risks. With the advancements in automation and manufacturing methods such as Design for Manufacturing and Assembly (DfMA), the quality and precision of prefabricated materials is tightly controlled, and the fabrication and assembly period are reduced. However, the full potential of prefabricated construction is yet to be realised in part due to most of developments being focused on its superstructure. A review of the current available options suitable for houses is necessary to understand the present state of the residential footing industry, which will help evaluate the necessary innovations for the growth of the Australian construction industry considering the local reactive soil conditions. This paper presents a summary of existing footing systems and potential prefabricated footing solutions for low-rise residential structures with one storey to two storeys. This paper also reviews the benefits and challenges of designing, manufacturing, transporting, handling and installing of prefabricated footings on site, which have great influence on the acceptance of these innovative footing systems.

A copula is a useful tool for constructing bivariate and/or multivariate distributions. In this article, we consider a new modi fied class of (Farlie-Gumbel-Morgenstern) FGM bivariate copula for constructing several dierent bivariate Kumaraswamy type copulas and discuss their structural properties, including dependence structures. It is established that construction of bivariate distributions by this method allows for greater flexibility in the values of Spearman's correlation coefficient rho,  and Kendall's tau . For illustrative purposes, one representative data set is utilized to exhibit the applicability of these proposed bivariate copula models.

This research integrates systemic and participatory techniques to model the Russian Federation construction innovation system. Understanding this complex construction innovation system, and determining the best levers for enhancing it, requires the dynamic modelling of a number of factors such as flows of resources and activities, policies, uncertainty and time. To build the foundations for such a dynamic model, the employed study method utilised an integrated stakeholder-based participatory approach coupled with structural analysis (MICMAC - Matrice d'Impacts Croisés Multiplication Appliquée à un Classement Cross-Impact Matrix). This method identified the key factors of the Russian Federation construction innovation system, their causal relationship (i.e. influence/dependence map) and ultimately a causal loop diagram. The generated model reveals pathways to improving construction innovation in the Russian Federation, and underpins the future development of an operationalised systems dynamic model.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.