Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

This research aims to investigate psychological anxiety factors, particularly Music Performance Anxiety (MPA), that influence the sustainability of music learning systems. This study employs an innovative integration of qualitative and quantitative methodologies, marking the first use of a nonlinear system paired with a comprehensive data framework for analyzing questionnaire responses. This approach allows for a detailed examination of the effects of these factors on academic outcomes. Previous research has primarily focused on the fragmented music learning system from the perspective of teachers' instructional strategies, emphasizing phased teaching methods and learning objectives which focus often neglected a significant subset of music learners. Addressing this oversight, the current study specifically centers on the emotional aspects of anxiety within music learning systems, with a particular emphasis on students, who play a crucial role in music education. This perspective enables a deep exploration of how MPA and other related emotional factors affect music learning systems. A notable innovation of this research is the development of a stochastic nonlinear system designed to model the psychological factors impacting student music learning, complemented by a quantitative model that assesses actual learning outcomes. By analyzing this nonlinear system, the research identifies weight values for various negative emotions, particularly those related to MPA, that significantly influence the music learning process. The integration of MPA and other anxiety related emotional factors with practical learning outcomes provides a comprehensive understanding of their combined impact on the music learning system. These insights are invaluable for educators and policymakers aiming to enhance both the effectiveness and emotional well-being within music education. This comprehensive approach offers a novel perspective in understanding and improving the dynamics of music education through a more empathetic and scientifically grounded lens.

The Attentional Control Theory (ACT) suggests that trait anxiety does not directly affect performance but may alter processing efficiency through the generation of compensatory strategies. However, the ACT does not describe the nature of these strategies, which could be reflective in nature. One hundred ten students (M = 20.12; SD = 2.10) completed questionnaires on trait anxiety, metacognitive beliefs, and emotion regulation strategies (ERS). They performed two working memory tasks: the digit span task from the WAIS-IV and an emotional n-back task. Anxiety, metacognitive beliefs, and maladaptive ERS were not linked to performance but were associated with longer response times. Additionally, participants using maladaptive ERS, such catastrophizing and rumination, made fewer negative commission errors and employed more strategies during the digit span. These findings support the role of the reflective level in influencing trait anxiety's impact on performance and emphasize considering metacognitive beliefs and maladaptive ERS for a comprehensive understanding of the ACT. Identifying these variables provides insights to optimize cognitive abilities and promote academic success.

The study aimed to investigate the effect of climate change exposure on affect and pro-environmental behavioural intentions in a randomised controlled trial. An online survey was completed by 100 adult participants and included measures of affect and pro-environmental behavioural intentions pre- and post-exposure. Participants were randomly allocated to a group that saw a climate change video (n=55) or a group that saw a non-climate change video (n=45). The findings showed were that participants in the climate change group showed a significant increase in negative affect and pro-environmental behavioural intention scores post-video exposure compared to the non-climate change video group. This suggests that climate change video exposure negatively influences affect but also potentially increases the intention to act pro-environmentally. These findings have the potential to support policies and societal change, however further investigation into the type of contents, actual behaviour change, and impacts on diverse populations (e.g., minority groups) is needed that influences pro-environmental behaviours is required. Furthermore, to achieve a greater impact, future research should be conducted measuring actual pro-environmental behaviour change, including with those from diverse populations.

Background: Patients’ effective hand hygiene helps to reduce healthcare-associated infections, prevents the spread of nosocomial infections and communicable diseases, such as COVID-19. This study aimed to describe effective hand hygiene decisions based on the Health Action Process Ap-proach (HAPA) and whether this pattern is invariant for mental health. Methods: Data were collected cross-sectionally from patients who had previously been admitted to a hospital (N=279; study 1) and longitudinally from psychosomatic rehabilitation patients (N=1,073; study 2). The fit of the HAPA framework and changes in hand hygiene decisions regarding com-pliance, as well as social-cognitive variables of the HAPA, and mental health status were examined. Results: The trimmed HAPA framework fitted the data well (χ2=27.1, df=12, p<.01, CMIN/df=2.26, CFI=.97, RMSEA=.08). According to multi-group structural equation modeling, the HAPA model with hand hygiene behavior were found to be invariant with regard to mental health. Conclusion: The trimmed HAPA framework revealed to be a generic framework in explaining so-cial-cognitive processes relating to hand hygiene decisions. Helping individuals to perform hand hygiene recommendation requires intention formation and bridging the intention-behavior gap. This can be done by promoting planning and self-efficacy. All processes appear generic to partic-ipants with and without mental health challenges.

There has been limited research on improving Internet-delivered Cognitive Behavioural Therapy (ICBT) in routine online therapy clinics that serve people from diverse ethnocultural groups (PDEGs). This article describes a patient-oriented adaptation approach used to address this gap in research. A working group consisting of people with lived experience, community stakeholders, ICBT clinicians, managers, and researchers, was formed. The working group examined archival feedback on ICBT from past clients who self-identified as being from diverse ethnocultural back-grounds (N=278) and results of interviews with current patients (N=16), community stakeholders (N=6), and clinicians (N=3). The archival data and interviews revealed the majority of the pa-tients reported being satisfied with and benefitting from ICBT. Suggestions for improvement were not related to the cognitive-behavioural model and techniques, but rather to making treatment materials more inclusive. Consequently, the ICBT adaptation focused on adding content related to cultural influences on mental health, addressing stigma, diversifying case stories, examples and imagery, adding audiovisual introductions, and replacing English idioms with more descriptive language. Moreover, further training was offered to clinicians and efforts were made to improve community outreach. This study demonstrates a process for using patient-oriented research to improve ICBT within routine care serving patients of diverse backgrounds.

The circadian and stress-realizing systems are interconnected, and the balance of their interaction determines the state of human health. The objective of this study was to investigate the modulating effect of activating the circadian system on heart rate variability in female medical students with high anxiety while performing a cognitive task. After 20 minutes of adequate stimulation of circadian photoreceptors with a monochromatic blue light, the cognitive task performance resulted in a decrease in sympathetic impact. During the session of using Blue Sky Pro glasses, a trend of increasing heart rate variability was observed in a state of relative rest (especially in the first 5 minutes). A comparative analysis of the parameters of the letter cancellation test before and after light exposure revealed a statistically significant increase in the indexes reflecting mental productivity, work accuracy, and concentration of attention. The results suggest an essential physiological role of the human circadian system in modulating the autonomic and psycho-emotional conditions, as well as cognitive functions of individuals with high anxiety. Our findings indicate the possibility of quickly correcting the balance in human systemic regulatory mechanisms using the activation of retinal circadian photoreceptors by blue light.

Immersive experiences in green areas and particularly in forests have long been known to produce beneficial effects for human health. However, the exact determinants and mechanisms leading to healthy outcomes remain to be elucidated. The purpose of this study was to investigate whether inhaling plant-emitted biogenic volatile compounds, namely monoterpenes (MTs), can produce specific effects on anxiety. Data from 505 subjects participating in 39 structured forest therapy sessions in different Italian sites, were collected. Monoterpenes air concentration was measured at each site. STAI State questionnaires were administered before and after the sessions as a measure of anxiety. A propensity score matching analysis was then performed, considering an above-average exposure to inhalable air MTs as the treatment: the estimated effect was -1.28 STAI-S points (95% C.I. -2.51 to -0.06, p = 0.04), indicating that the average effect of exposure to high MT air concentrations during forest therapy sessions is to decrease anxiety.

Depression and anxiety are prevalent, persistent and difficult to treat industrialized world mental health problems. These disorders negatively modify an individual’s life perspective through brain function imbalances, notably in the amygdala and hippocampus, and are primarily treated with pharmaceuticals and psychotherapy. Nevertheless, these mental health issues have only increased in the number of individuals affected and the intensity of their suffering—especially as a result of COVID-19 restrictions and fears. An approach to alleviating depression and anxiety in relation to researchers self-identifying as experiencing burnout is promising. Enhancing resilience, the approach considers depression and anxiety as consequences of the particular method people adopt in ordering their memories, and focuses on narrative development. The method encourages accepting of different perspectives as unique and necessary in creating safe protection from research burnout. Moving from an identification of personal character to prompting plot development of memory, the method promotes resilience by encouraging thoughtful reconsideration of the negative assessments by participants of their circumstances that can lead to depression and anxiety. The method of ordering and group members’ feedback are inspected, including during the period of COVID-19 restrictions, and conclusions are offered regarding further research to encourage burnout resilience to diminish depression and anxiety.

The COVID-19 pandemic has contributed to mental health problems worldwide. Nurses are particularly prone to stress because they directly care for individuals with suspected or confirmed cases of COVID-19. The aim of this study is to explore the association between the mental health promotion strategies used by nurses during the coronavirus disease (COVID-19) outbreak and their symptoms of depression, anxiety, and stress, and to compare the strategies and symptoms of mental health nurses and non-mental health nurses. Cross-sectional study was conducted with a sample of 821 nurses. Portuguese nurses demonstrated high symptoms of depressive symptoms, stress, and anxiety. Healthy eating, physical activity, rest between shifts, maintaining social contacts, verbalizing feelings/emotions, and spending less time searching for information about COVID-19 are associated with better mental health. Mental health nurses have less depression, anxiety, and stress, and use more strategies to promote mental health than other nurses. We consider it important to promote nurses’ mental health literacy by encouraging them to develop skills and strategies aimed at improving their resilience and ability to deal with difficult situations while caring for the population.

Background We intend to examine whether the COVID-19 outbreak influences medical decision-making (MDM) among Non-COVID patients. Method We recruit 287 patients who admit to ER department due to cardiovascular complaints. Anxiety level was measured using three questionnaires (GAD-7, Beck Inventory, and the cardiac anxiety questionnaire). A fourth survey was designed to assess MDM considerations. Results 64% of patients were male (median age 54). Almost half of the patients were found to have moderate to severe levels of anxiety.79.3% of patients reported that the outbreak influenced their MDM. 44.5% of patients sought medical care 2-3 from the onset of symptoms. Coronary artery disease was found in only 26 patients (9.1%). Almost half of the patients stated that they would have gone earlier if not for the current pandemic. Conclusion Non-COVID patients seeking medical care had a high anxiety level that directly affected decision-making and put them at unnecessary risk.

In March 2020 the World Health Organization declared the “pandemic state” due to COVID-19 imposing strict confinement of the world population. People were forced to spend more time at home, changing some daily routines, including social interactions, the possibility to perform sports, and diet habits. These changes could exert a greater impact on patients suffering from chronic diseases, such as endocrine patients. This study aimed to assess the effects of Covid-19 induced quarantine on daily habits in a group of patients with endocrine disorders, focusing on food consumption, eating, and sleep habits during the confinement. Eighty-five endocrine patients were enrolled. A structured interview was administered investigating: socio-demographic information, general medical conditions and habits adopted during the quarantine. All patients underwent the Spielberger State Anxiety Inventory (STAI-Y1) to assess state anxiety. Subjects had mainly a sedentary lifestyle. We found a significant increase in the number of cigarettes in smokers, an increase of meals consumed during the confinement and a high rate of sleep disorder occurrence, especially insomnia. The changes of daily habits were, probably, due to the alterations of routine, that determined more bore and inactivity during the day.

Traditionally it has been thought necessary to lose 2% of body mass due to dehydration, before functioning is disrupted, although recently adverse effects have been reported with a loss of 0.5-0.7%. It is, however, unclear whether the response to small decreases in mass reflects dehydration, mechanisms that help to adapt to a loss of bodily fluid, or a placebo effect. Individuals were therefore subject to a temperature of 30°C for three hours, and mood and cognition monitored. To explore the possibility of a placebo response, the consumption of plain or coloured water was compared. To consider changes in hydration status, drinks known to differ in their ability to rehydrate were contrasted. Not drinking was disruptive, although a combination of plain water and electrolyte’s most effectively prevented a decline in functioning, indicating a role for rehydration after a loss of 0.52% body mass. There was, however, also evidence of a placebo response: a combination of plain water and electrolytes was better able to prevent a decline in functioning than coloured plain water and electrolytes. As increased anxiety was a robust response, it was discussed whether the renin–angiotensin–aldosterone system might be part of the mechanism.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Pregnancy is a complex biological process which is associated with significant metabolic and hemodynamic changes of the maternal body which allow a normal fetal growth. The inability to adapt to these changes can affect the cardiovascular health. During pregnancy, women may experience mood swings, anxiety and emotional ambivalence. These symptoms can lead to stress and have a negative impact on the mental well-being of expectant mothers. It is crucial to know the aspects that can influence the development of cardiovascular problems among pregnant women in order to manage these cases properly. The current narrative review explores and summarizes the evidence regarding the impact of stress and anxiety on cardiovascular health in pregnant women. Understanding the physiological adaptations that the body undergoes throughout pregnancy is crucial for educating and supporting individuals as well as healthcare professionals. This enables them to recognize any risk factors or pathological conditions that may exacerbate pregnant women's health. In order to reduce maternal morbidity and mortality from cardiovascular disease, a psychological and cardiovascular risk factor screening that is done either before or during pregnancy may be able to identify situations that call for particular medical and/or psychological therapies.

New digital interventions have shown potential in managing asthma and improving patients' quality of life compared with conventional interventions. Our objective was to conduct an exhaustive survey of the application of digital health technologies in evaluating, treating, and self-managing psychological and psychopathological elements linked to asthma. We analyzed a compendium of research papers and systematic reviews pertaining to asthma, encompassing themes such as outdoor air pollution, early life wheezing disorders, atopic dermatitis, digital strategies for asthma self-management, psychiatric conditions and asthma, familial impacts on pediatric asthma, and the utilization of mobile health apps for managing asthma. We scrutinized eight chosen studies to evaluate the capacity of digital health technologies to enhance the man-agement and treatment outcomes of psychological factors related to asthma. The studies under review indicate that eHealth interventions, mixed reality instruments, mHealth technolo-gy-augmented nurse-led interventions, and smartphone apps incorporating Bluetooth-enabled sensors for asthma inhalers can markedly enhance self-management of symptoms, quality of life, and mental health outcomes, particularly in children and adolescents with asthma. Nonetheless, additional research is required to ascertain their efficacy and practicability across diverse populations and environments. Customized interventions that cater to the unique needs and preferences of asthma patients and associated psychological elements are vital to ensure the persistent and equitable adoption of these technologies. We underscore the significance of addressing psychological elements in the management and treatment of asthma and advocate for ongoing research and development in this domain.

Background: Caring for individuals with mental disorders poses significant challenges for caregivers, often leading to compromised quality of life and mental health issues such as stress, anxiety, and depression. This study aims to assess the extent of these challenges among caregivers in Greece, identifying which demographic factors influence their well-being. Method: A total of 157 caregivers were surveyed using the SF-12 Health Survey for quality of life assessment and the DASS-21 questionnaire for evaluating stress, anxiety, and depression symptoms. T-tests, Kruskal-Wallis tests, Pearson correlation coefficients, and regression analyses were applied to understand the associations between demographics, quality of life, and mental health outcomes. Results: The study found that caregivers, especially women and younger individuals, faced high levels of mental health challenges. Marital status, educational level, and employment status also significantly influenced caregivers' well-being. Depression was the most significant factor negatively correlating with the mental component of quality of life. The magnitude of burden experienced by caregivers highlighted the urgency for targeted social and financial support, as well as strategic treatment programs that consider caregiver well-being. Conclusions: Caregivers of individuals with mental disorders endure significant stress, anxiety, and depression, influencing their quality of life. Demographic factors such as age, gender, marital status, education, and employment status have notable impacts. Findings emphasize the need for society-wide recognition of caregivers' roles and the creation of comprehensive support and intervention programs to alleviate their burden, particularly in the context of the COVID-19 pandemic.

Background: A personalized approach to occupational medicine allows specialists to 1 prevent professional hazards such as stress-related depression and anxiety in extreme work environments. Objective: we aim to detect genetic markers of low resilience to stress. Methods: The study cohort included 97 elite athletes and 167 special forces personnel. The research team collected buccal mucosa samples and examined psychological status with the Hospital Anxiety and Depression Scale (HADS). We assessed 35 variants within selected genes that are most often associated with low resilience to stress, anxiety, and depression. Fisher’s Exact test was used to determine nonrandom associations between scores in the HADS scale and the genetic variants. We also trained machine learning models to predict score values from genotyping findings and ranked genetic biomarkers according to their predictive power. Results: High-risk depression profiles included C/T genotype of MTHFR C677T and A/C variant of MTHFR A1298C. Susceptibility to anxiety was associated with several polymorphisms regulating neuroactive substances, immune response, and coagulation. The ML models accurately detect depression or anxiety levels with MAE/ROV of 17.69±1.35 and 17.86±2.09% respectively. Conclusions: The study findings justify a polymorphic nature of anxiety and confirm the immune system's involvement in regulating stress response.

Intergenerational integration has given rise to a novel aging paradigm known as all-age communities, which is garnering international attention. In China, the aging population and the implementation of the three-child policy have resulted in increased demand for retirement and childcare services among residents in older neighborhoods. Consequently, there is a pressing need to retrofit these older neighborhoods to accommodate all-age living arrangements given the high demand they generate. Therefore, this study undertakes research interviews with residents and constructs an exploratory theoretical model rooted in established theory. To assess the significance of our model, we employ Smart PLS 3.0 based on 297 empirical data points. Our findings indicate that anxiety has a significant negative effect on payment behavior; objective perception, willingness to pay, and government assistance exert significant positive effects on payment behavior. By comprehensively analyzing the mechanisms underlying residents’ payment behavior, this study provides valuable insights to the government for promoting the aging process within communities and formulating effective transformation policies.

Acute myocardial infarction (AMI) is a leading cause of morbidity and mortality worldwide. This study aimed to test the efficacy of a newly-developed symptom self-management program on health outcomes among inpatients post-AMI. A pilot randomised, controlled trial was utilised. A convenience sample of 90 was recruited from a tertiary hospital in Singapore. Adult inpatients with post-AMI were randomly assigned to the three groups: IManage-HSet, IManage-FF or control group. Sample size was computed using power analysis. Data were collected through self-reported questionnaires and physiological instruments. Data analyses included univariate statistics, analysis of variance and repeated measure analysis of variance. Ninety participants were recruited with 30 in each group. Participants in the IManage-HSet and IManage-FF group had significantly greater relaxation (ηp2 = 0.11), lower objective stress (ηp2 =0.14), and greater knowledge (ηp2 = 0.62) than those of the control group. The two intervention groups had lower subjective stress (ηp2 = 0.04), depression (ηp2 = 0.01), and anxiety (ηp2 = 0.03) than the control but such differences did not achieve statistical significance. Furthermore, most participants reported that they were satisfied with the programs and they provided positive comments on the contents, educational materials and relaxation practice. This pilot study supports the potential benefits and feasibility of the IManage-VR and IManage-FF interventions on stress, perceived relaxation, knowledge and patient satisfaction. Contents of the symptom management interventions could be added into current cardiac rehabilitation programs. Future RCTs with multi-centered sites and larger sample size are required to further test the intervention. This study was prospectively registered with the International Standard Randomised Controlled Trial on the 5th August 2014 with registration number ISRCTN61027816.

Many researches have identified that adverse childhood experiences (ACEs) are associated with non-suicidal self-injury (NSSI) and suicidality. However, most studies have been restricted to a few types of ACEs. This study aims to investigate associations of 13 common types of ACEs with NSSI, suicidal ideation (SI) and suicide attempt (SA), as well as the mediation of depressive and anxiety symptoms therein. A total of 1771 students aged 11-16 years who participated in the baseline survey of the Chinese Adolescent Health Growth Cohort study were included for the analysis. ACEs, SI, SA, depressive and anxiety symptoms were recorded by standard questionnaire. Of included participants, 92.0% reported one or more category of ACEs. Smoking, parent-child separation, emotional abuse, physical abuse and being bullied were positively associated with NSSI, with the adjusted odds ratio (aOR) of 2.41(95%CI, 1.01-5.75), 1.80(1.28-2.54), 1.69(1.21-2.37), 2.08(1.44-3.01) and 1.87(1.35-2.59), respectively; smoking (4.03, 1.66-9.81), parent-child separation (1.42, 1.07-1.90), emotional abuse (1.91, 1.41-2.59), physical abuse (1.80, 1.27-2.57), emotional neglect (1.78, 1.28-2.49) and being bullied (2.08, 1.54-2.81) were positively associated with SI; smoking(4.30, 1.67-11.10), emotional abuse (2.42, 1.58-3.72) and being bullied (1.75, 1.17-2.60) were positively associated with SA. The associations of ACEs with NSSI, SI and SA were each partially or completely mediated through depressive and anxiety symptoms. Children and adolescents who had experiences of smoking, physical abuse and being bullied during childhood are consistently and independently associated with NSSI and suicidality, and these associations may be largely mediated through depressive and anxiety symptoms.

Nearly half a century has passed since the discovery of cytoplasmic inheritance of human chloramphenicol resistance. The inheritance was then revealed to take place maternally by mitochondrial DNA (mtDNA). Later, a number of mutations in mtDNA were identified as a cause of severe inheritable metabolic diseases with neurological manifestation, and the impairment of mitochondrial functions has been probed in the pathogenesis of a wide range of illnesses including neurodegenerative diseases. Recently growing number of preclinical studies has revealed that animal behaviors are influenced by the impairment of mitochondrial functions and possibly by the loss of mitochondrial stress resilience. Indeed, as high as 54% of patients with one of the most common primary mitochondrial diseases, mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) syndrome, present psychiatric symptoms including cognitive impairment, mood disorder, anxiety, and psychosis. Mitochondria are multifunctional organelles which produce cellular energy and play a major role in other cellular functions including homeostasis, cellular signaling, and gene expression, among other. Mitochondrial functions are observed to be compromised and to become less resilient under continuous stress. Meanwhile, stress and inflammation have been linked to the activation of the tryptophan (Trp)-kynurenine (KYN) metabolic system, which observably contributes to development of pathological conditions including neurological and psychiatric disorders. This narrative review discusses the functions of mitochondria and the Trp-KYN system, the interaction of the Trp-KYN system with mitochondria, and the current understanding of the involvement of mitochondria and the Trp-KYN system in preclinical and clinical studies of major neurological and psychiatric diseases.

Immersion in forest environments was shown to produce beneficial effects to human health, in particular psychophysical relaxation, so much that this practice is increasingly recognized as a form of integrative medicine. Limited evidence exists about both statistical significance and size of the effects conditioned on personal characteristics, as well as on the main external variables. The primary purpose of this study was to substantiate the very concept of forest therapy by means of the quantification and significance of the psychological effects, stratified by gender, age groups and place of residence. A preliminary qualitative analysis of the main determinants, in particular the method of conducting, the meteorological comfort and the concentration of volatile organic compounds in the forest atmosphere, was afforded. Seven forest therapy sessions were performed in late summer though early fall, resulting in 150 psychological self-assessment questionnaires administered before and after each session. The results were comparable or even better than others reported in the international literature. Moreover, preliminary evidence arose about different functionality towards specific psychological indexes conditioned at least on gender and age groups, as well as meteorological comfort, structured programs and, possibly, volatile organic compounds showed an impact on the outcomes.

COVID-19 pandemic has the potential to adversely affect the mental health of healthcare workers (HCWs). The public healthcare system in Greece was already facing serious challenges at the outset of the outbreak following years of austerity and an escalating refugee crisis. The multi-center, cross-sectional study aims to assess the levels and associated risk factors of anxiety, depression, traumatic stress and burnout of frontline staff in Greece. A total of 464 HCWs in six reference hospitals completed a self-administered questionnaire comprising of sociodemographic and work-related information and psychometric scales. The proportion of HCWs with symptoms of moderate/severe depression, anxiety and traumatic stress were 30%, 25% and 33% respectively. Burnout levels were particularly high with 65% of respondents scoring moderate/severe in Emotional Exhaustion, 92% severe in Depersonalization and 51% low/moderate in Personal Accomplishment. Predictive factors of adverse psychological outcomes included fear, perceived stress, risk of infection, lack of protective equipment and low social support. The psychological burden associated with Covid-19 in healthcare professionals in Greece is considerable with more than half experiencing at least mild mental health difficulties. Findings signal the need for immediate organizational and individually tailored interventions to enhance resilience and support wellbeing under pandemic conditions.

Background: Clinical trails have revealed that patients with depression generally accompanied with learning and memory impairment, which critically impact on individual’s health and development. Danggui-Shaoyao-San (DSS), a famous Chinese complex prescription, significantly overcame depression and relieved cognitive disorder based on previous research and publication. However, its effectsand potential mechanism against chronic restraint stress (CRS) remained unknown. Methods: CRS animal model was established and mice were divided to six groups while they were oral administrated with Danggui-Shaoyao-San at doses of 1.25, 2.5 and 5 g/kg for 14 days. Emotional and cognitive performances were detected by behavior tests, meanwhile neural plasticity and its molecular mechanism were examined by Dil staining, western blot and immunofluorescence. Results: DSS treatment dose-dependently improved locomotion ability in open filed test, overcame depression behavior in forced swimming test and elevated plus maze test, enhanced learning and memory ability in Morris water maze test. CRS decreased number of total spines and mushroom spines, while DSS treatment dose-dependently restored these by Dil staining. Expression of BDNF and GluR1 were significantly down-regulated in CRS group, which were significantly normalized by DSS. Conclusions: DSS treatment dose-dependently reversed CRS-induced cognitive impairments by inducing structural remodeling of neurons.

Throughout this paper the impact of anxiety on adolescent athlete’s is highlighted through analyzing neurological and psychological aspects involved in sports performance. The neuroanatomy and neuropsychology of the human brain plays a major role in developing athlete’s that has only begun to be analyzed within recent years. Especially in young athletes, there are numerous factors that affect performance on the field that originate from the environment and training the adolescent athlete is involved in. Sports performance is viewed as a major physical factor such as training and lifting weights, however the psychological aspect of sports performance often goes unnoticed. Athletes can begin to develop mental fatigue and anxiety which inevitably can decrease their ability to perform. The athlete’s internal suffering begins to go unnoticed, as the only tangible factor is watching their performance decrease. This causes the athlete to push themselves further in training resulting in greater mental fatigue. This paper emphasizes the numerous factors neurologically that play a role in athletic performance which should be focused on in adolescent athletes as they navigate the challenges and competition that are apparent within athletics. It is critical to understand the processes and hormonal changes the body undergoes with training and playing a sport, this information can change the way adolescent sports are approached and advanced.

Abstract Background Fatigue Syndrome (FS) is described as extreme exhaustion following ordinary activities. Sleep deprivation, the use of antidepressants, autoimmune illnesses, and anemia are also risk factors for FS. Symptoms of FS include headache, dizziness, and dyspnea, among others. Objective: This study focused on assessing the prevalence of fatigue syndrome (FS) and its association with depression and anxiety, among the medical students in Saudi Arabia. Methodology In this cross-sectional investigation conducted in 2023, 740 medical students participated. Data were gathered using an online survey, which encompassed four key sections: Sociodemographic details, the 11-item Chalder Fatigue Questionnaire (CFQ), the 9-item Primary Health Questionnaire (PHQ) assessing depression, and the Generalized Anxiety Disorder 7-item (GAD-7) scale. Analyses were performed by the use of SPSS version 25. Results A total of 740 students were surveyed, 417 (56.4%) satisfied the diagnostic requirements for fatigue syndrome (FS), with most of them being females. Furthermore, 234 (31.2%) and 296 (40.8%) of the participants reported having significant anxiety symptoms and depressive symptoms, respectively. FS was positively correlated with symptoms of anxiety and depression (P

The Sars-Cov-2 pandemic led to several needed containing measures that conditioned the onset of depressive, anxiety and post-traumatic stress symptoms in population. These symptoms, espe-cially if not diagnosed and treated, can also occur in patients undergoing surgery with high im-pact on people’s lives, like hysterectomy. To evaluate the post-surgical distress and anx-ious-depressive symptoms following hysterectomy for benign disease focusing on the impact of COVID-19 pandemic. The prospective observational cohort study included patients undergoing hysterectomy for benign disease. Psychologic evaluation through social-demographic question-naires was obtained before surgery (T1), postoperatively (T2), and 3 months after surgery (T3). The HADS (Hospital Anxiety and Depression Scale) was used to evaluate anxious-depressive symptoms and the PCL-5 (Post-traumatic Stress Disorder Checklist for DSM-5) compared the on-set of post-surgical distress and anxiety and depressive symptoms. The pre-COVID-19 pan-demic period was compared to the post-COVID-19 pandemic phase. Patients treated after COVID-19 pandemic showed higher depressive symptoms rate compared to those treated before (p-value=0.02); conversely, pre-COVID-19 patients were more prone to develop a PTSD (p-value=0.04). A significative association between the occurrence PTSD and anxiety-depressive symptoms registered at T2 a (p-value=0.007) and T3 (p-value

Delve into the dynamic realms of neuroscience, neurology, and psychiatry with this groundbreaking editorial, unveiling the intricate mechanisms of brain function and dysfunction. Explore the latest advancements in molecular biology, genetics, epigenetics, pharmacology, and neuroimaging that are revolutionizing our understanding of neurological and psychiatric disorders. Uncover the challenges and gaps in translating cutting-edge research into practical clinical applications, aiming to enhance the lives of patients and their families. Discover the pivotal role of neuroplasticity in reshaping the brain's adaptability throughout life, alongside the promising potential of non-invasive brain stimulation techniques like transcranial magnetic stimulation and transcranial direct current stimulation. Embark on a journey of innovation and collaboration as researchers and clinicians strive to bridge the gap between bench and bedside, offering hope for improved diagnosis, prevention, and treatment of complex neurological and psychiatric conditions. Join us in this exploration of transformative ideas and novel interventions that hold the key to a brighter future for individuals and society.

The orexin/hypocretin neuropeptide family has emerged as a focal point of neuroscientific research following the discovery that this family plays a crucial role in a variety of physiological and behavioral processes. These neuropeptides serve as powerful neuromodulators, intricately shaping autonomic, endocrine, and behavioral responses across species. Notably, they serve as master regulators of vigilance and stress responses; however, their role in complex processes such as food intake, metabolism, and thermoregulation warrant further investigation. This narrative review provides a journey through the evolution of our understanding of the orexin system, from its initial discovery to the promising progress made in developing orexin derivatives. It goes beyond conventional boundaries, striving to synthesize the multifaceted activities of orexins. Special emphasis is placed on domains such as stress response, fear, anxiety, and learning, in which the authors contributed to the literature with original publications. This article demonstrates the orchestrating role of the orexins in several intricate and integrative physiological processes. It also overviews the advancement of orexin pharmacology, which has already yielded some promising successes, particularly in the treatment of sleep disorders. This interdisciplinary approach to studying neuropeptides unveils their significance as vital connectors between transient functional changes and lasting structural adaptations. Ultimately, it advances our understanding of the intricate physiological and behavioral contributions of the orexin/hypocretin neuropeptide family.

This study investigated whether reciprocal collaborative pedagogy significantly impacts Indonesian electrical engineering polytechnic students in reducing reading anxiety and improving self-efficacy in ESP reading comprehension skills. Fifty Polytechnic students were equally assigned to two groups. Control groups learned in the traditional reciprocal teaching method individually. Experimental group engaged in reciprocal collaborative pedagogy. Each group received a 6-week reading strategy training. E-learning platforms were used in this study as a complementary tool to distribute ESP reading materials, announcements, and the experiment details being taught. The quantitative and qualitative results demonstrated that the tasks in reciprocal collaborative pedagogy positively affects Indonesian electrical engineering polytechnic students' learning experience and outcomes. This pedagogy promotes a productive learning environment through peer interaction, active engagement, and peer group discussions of the whole learning activities, reducing feelings of anxiety and building confidence in ESP-specialized text.

Pure silver as well as silver compounds have been used as antiseptics for centuries. Nowadays, the most frequently applied form of silver is a nanoparticle form. Several studies demonstrate the ability of silver nanoparticles and silver salts to accumulate in the brain of laboratory ani-mals as well as the ability of silver nanoparticles to influence behavioral and cognitive functions of laboratory mammals. For the first time, the influence of a silver salt, in particular, silver citrate on the change dynamics of behavioral and cognitive functions of laboratory mice at the daily oral exposure during 30, 60, 120 and 180 days is investigated in the present research. We observed the anxiety increase after 30 days of the exposure as well as the ability of mice to adapt to the prolonged oral exposure of silver citrate manifested in the anxiety decrease, increase of locomotor activity and the tendency of long-term contextual memory improvement. Increase of locomotor activity and memory improvement might be associated with the sensitivity increase and regarded as compensatory mechanism to anxiety increase. The observed phenomenon is classified as a hormetic effect. A comparison with the analogous study implemented polyvi-nylpyrrolidone coated silver nanoparticles is carried out. It was concluded that the nanoform is more neurotoxic.

Anxiety disorders are among the most common mental disorders worldwide, and often respond incompletely to existing treatments. Selenium, a micronutrient that is a component of several biologically active selenoproteins, is also involved in several aspects of brain functioning, and may exert antidepressant and anxiolytic effects through multiple pathways. The current paper is a scoping review of translational, observational and interventional evidence on the potential role of selenium and its compounds in the management of anxiety and related disorders. Evidence from animal models suggests that this approach may be promising. Though evidence from observational studies in humans is inconsistent and affected by several confounding factors, the available evidence from randomized controlled trials suggests that selenium supplementation may be beneficial in the management of certain anxiety-related conditions, such as anxiety in medically ill patients, prevention of anxiety following exposure to traumatic stress, and obsessive-compulsive disorder. This paper provides a critical evaluation of the existing evidence base, including unanswered questions that could serve as the focus of further research, and outlines the potential benefits and risks associated with the use of selenium in anxiety disorders.

Functional Connectivity analysis using Electroencephalography signals is common. The EEG signals are converted to networks by transforming the signals into a correlation matrix and analyzing the resulting networks. Here, four learning models, namely, Logistic Regression, Random Forest, Support Vector Machine, and Recurrent Neural Networks, are implemented on the correlation matrix data to classify them either on their psychometric assessment or the effect of therapy; The EEG data is trail-based/event-related. The classifications based on RNN provided higher accuracy( 74-88%) than the other three models( 50-78%). Instead of using individual graph features, a correlation matrix provides an initial test of the data. When compared with the time-resolved correlation matrix, it offered a 4-5% higher accuracy. The time-resolved correlation matrix is better suited for dynamic studies here; it provides lower accuracy when compared to the correlation matrix, a static feature.

The burden of COVID-19 pandemic on health systems and the physical and mental health of healthcare workers (HCWs) has been substantial. This cross-sectional study aims to assess the effects of Covid-19 on the psychological wellbeing of mental health workers who provide care to a vulnerable patient population that have been particularly affected during this crisis. A total of 387 HCWs from across a large urban mental health service completed a self-administered questionnaire consisting of socio-demographic, lifestyle and work-based information and validated psychometric scales. Depression and anxiety were measured using the Patient Health Questionnaire (PHQ-9) and the Generalized Anxiety Disorder Scale (GAD-7) respectively, sleep problems with the Athens Insomnia Scale (AIS), burnout with the Maslach Burnout Inventory (MBI) and resilience with the Resilience Scale-14 (RS-14). Multivariable logistic regression analysis was performed to determine potential mediating factors. Prevalence of burnout was notable, with 52% recording moderate/severe in Emotional Exhaustion, 19.5% moderate/severe in Depersonalisation and 55.5% low/moderate Personal Accomplishment. Over half of all respondents (52%) experienced sleep problems; the presence of depressive symptoms was a significant predictor of insomnia. An increase in potentially harmful lifestyle changes, such as smoking, alcohol consumption and over-eating was also observed. However, high Resilience was reported by 70% of the sample and the importance of this is highlighted. Female gender was associated with increased levels of depression and emotional exhaustion while those with a history of mental health conditions were most at risk of affective symptoms, insomnia and burnout. Overall, our study revealed considerable levels of psychological distress and maladaptive coping strategies but also resilience and satisfaction with organizational support provided. Findings can inform tailored interventions in order to mitigate vulnerability and prevent long-term psychological sequelae.

In the context of the economic and political uncertainty associated with the 2019-nCoV pandemic, it is necessary to determine the socio-psychological factors involved in the transformation of the behavior of insurance consumers under the influence of a biogenic threat. This study measures financial anxiety and its impact on the insurance behavior of Russian citizens. The correlation, comparative, and regression analyses of the financial anxiety of Russian citizens cover three stages of observation: before the start of the 2019 nCoV pandemic (“FA up to 19 nCoV; N = 766), during the period of quarantine measures announced in Russia in March 2020 (“FA 19-nCoV-1”; N = 856), and after the relaxation of quarantine measures at the end of April 2020 (“FA 19-nCoV-2”; N = 963).Psychological analysis data were obtained from the online survey “Financial anxiety (in the context of insurance)”. The questionnaire is psychometrically reliable and easy to use. It includes five measurement scales: MR1—Physical manifestations of financial incentive anxiety, MR2—With money shortages and financial uncertainty, MR3—The value of insurance coverage, MP4—Financial Confidence, and MR5—Perception of insurance and investment risks. It was found that Russian citizens consider it important to have insurance coverage for a “rainy day”, and they showed confidence in the insurance market during the biogenic crisis. However, unfortunately, during the 19-nCoV-1 and 19-nCoV-2 periods, Russian citizens did not feel financially secure, unlike in the period before 19-nCoV. Women showed high scores for physical manifestations of financial anxiety and low financial confidence in the future, in contrast to men, regardless of the observation period.

In the context of economic and political uncertainty associated with the 2019-nCoV pandemic, it is necessary to determine the socio-psychological factors in the transformation of the behavior of insurance consumers under the influence of the biogenic threat. This study is devoted to measuring financial anxiety and its impact on the insurance behavior of Russian citizens. Correlation, comparative and regression analyzes of financial anxiety of Russian citizens cover three stages of observation: before the start of the 2019 nCoV pandemic (“FA up to 19 nCoV; N = 766), during the period of quarantine measures announced in Russia in March 2020 (“ FA 19- nCoV-1 "; N = 856) and after the relaxation of quarantine measures at the end of April 2020 (" FA 19-nCoV-2 "; N = 963). Psychological analysis data were obtained from the online survey "Financial anxiety (in the context of insurance)". The questionnaire is psychometrically reliable and easy to use, including 5 measurement scales: MR1. Physical manifestations of financial incentive anxiety, MR2. With money shortages and financial uncertainty, MR3. The value of insurance coverage, MP4. Financial Confidence, MR5. Perception of insurance and investment risks. Russian citizens considered it important to have insurance coverage on a “rainy day” and showed confidence in the insurance market during the biogenic crisis. But, unfortunately, Russian citizens during the 19-nCoV-1 and 19-nCoV-2 periods did not feel financially secure in the future, unlike the period before 19-nCoV. ”Women showed high scores for physical manifestations of financial anxiety and low financial confidence in the future, in contrast to men, regardless of the observation period.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Trait anxiety, emotion regulation strategies, and metacognitive beliefs influence executive functions (EF) and academic achievement. This study examines their interplay and impact on academic success. In total, 275 adolescents (10-17 years) and parents completed an online questionnaire assessing trait anxiety, emotion regulation strategies, metacognition, parent-reported behaviors related to executive functioning, and overall school average. Preliminary analyses confirmed consistency with existing literature for each variable and their interaction. Furthermore, we conducted a network analysis among the main variables. This analysis supports the need to pay more attention to reflective variables - maladaptive emotion regulation strategies and metacognitive beliefs about worry - when studying trait anxiety. These variables were linked to problematic executive functioning in adolescents. These latter had a negative link to academic achievement. This study offers innovative insights by investigating less-explored relationships in the scientific literature. It reveals high and significant correlations between metacognitive beliefs, maladaptive emotion regulation strategies and trait anxiety (r &gt; .500, p &lt; .001) but also between these variables and both executive functioning and academic achievement. These findings offer new perspectives for research and underscore the importance of holistically examining psychological factors related to academic success.

Depression and anxiety are the most common mental health disorders worldwide. Internet-Delivered Cogni-tive Behaviour Therapy (ICBT) can reduce barriers to care for broad cross sections of the population. How-ever, People of Diverse Ethnocultural Backgrounds (PDEGs) other than White/Caucasian underutilize mental health services and are underrepresented in clinical trials of psychological interventions. To address this research gap, we adapted an evidence-based ICBT program for PDEGs. The current pilot study explores the effectiveness, satisfaction, and engagement in the adapted ICBT by PDEGs (N=41) when benchmarked against a sample of PDEGs (N=134) drawn from a previous non-adapted version of the ICBT program. Inntent-to-treat analyses showed that the adapted ICBT program is effective in reducing anxiety and de-pression symptoms among PDEGs. Large within-group pre-to-post-treatment Cohen’s effect sizes of d = 1.23, 95% CI [0.68, 1.77] and d = 1.24, 95% CI [0.69, 1.79] were found for depression and anxiety, respectively. Further, 81.8% of the PDEGs who received the adapted ICBT program reported high overall satisfaction, 90.9 % reported increased confidence in managing symptoms, and 70.7% of participants completed the ma-jority of the psychoeducational lessons in the ICBT program. No statistically significant differences in clinical outcomes, engagement, and satisfaction were found between the pilot study and benchmark sample. Future directions for ICBT research with PDEGs are described.

Cancer patients may experience significant distress. The “Emotion Thermometers” (ETs) are a short visual analogue scale used to screen patients for psychosocial risk. This study aimed to assess emotional distress in a large sample of cancer patients attending psychological services at an NGO, and to explore factors that may contribute to it. The ETs were answered by 899 cancer patients. They were, on average, 59.9 years old, the majority were female, had breast cancer, were under treatment or were disease-free survivors, and reported high levels of emotional distress, above the cut-off (≥5). A Generalized Linear Model was used to measure the association between the level of Distress and 33 items of the problem list. Four items - sadness, depression, sleep and breathing - were found to be significantly related to a higher level of Distress. Additionally, women and those who were in the palliative phase also had significantly higher levels of Distress. Conclusions: The results confirm the need for early emotional screening in cancer patients, as well as the relevance of attending to the characteristics of each patient. Additionally, they highlight the utility of the ETs for the clinical practice, allowing to optimize the referral to specialized psy-chosocial services.

The fear of missing out (FoMO) is characterized in the literature as a fear that others are having rewarding experiences while one is missing out, and a constant need to keep connected with one’s social network. Driven by Social Determination Theory (SDT) FoMO has been linked with Problematic Social Networking Sites use (PSNSU), negative affectivity (NA), self-esteem (SE) and sleep disturbances. The present study reports findings from 512 individuals (79.1% women, mean age 30.5 years, SD= 8.61). Structural equation modelling (SEM) suggests that the duration of SNSs use and the numbers of SNSs platforms actively used partially mediated the relationship between FoMO and PSNSU. In turns, PSNSU partially mediated the relationship between FoMO and NA. Furthermore, the present study has extended the literature by incorporating the Vulnerability Model in the FoMO concept, identifying that SE partially mediated the relationship between FoMO and NA, while NA fully mediated the relationship between FoMO and sleeping disturbances. Accordingly, the present has extended previous research findings in showing exercise as a potential protective factor to prevent against FoMO. Practical and theoretical implications are discussed.

The COVID-19 pandemic has become a public health emergency of international concern, which may affect lifestyle habits and mental health. Based on national health profile assessments, this study investigates perceived changes of lifestyle habits in response to the COVID-19 pandemic and associations between perceived lifestyle changes and mental health in Swedish working adults. Among 5,599 individuals (50% women, 46.3 years), the majority reported no change (sitting 77%, daily physical activity 71%, exercise 69%, diet 87%, alcohol 90%, and smoking 97%) due to the pandemic. Changes were more pronounced during the first wave (April-June) compared to the second (October-December). Women, individuals <60 years, having a university degree, being white-collar workers and having unhealthy lifestyle habits at baseline had higher odds of changing lifestyle habits compared to their counterparts. Negative changes in lifestyle habits as well as more time in mentally passive sitting at home was associated with higher odds of mental ill-health (including health anxiety regarding one’s own and relatives’ health, generalized anxiety and depression symptoms, and concerns regarding employment and economy). The results em-phasize the need to support healthy lifestyle habits to strengthen the resilience in vulnerable groups of individuals to future viral pandemics, and prevent health inequalities in society.

In chronic hepatitis C (CHC) patients, interferon-based treatments showed toxicity, limited efficacy, and psychiatric manifestations. Direct-acting antiviral (DAA) agents appeared safer, though it remains unclear if they may exacerbate or foster mood symptoms in drug-naïve CHC patients. We evaluated 62 CHC patients’ mental status, before and 12 weeks after DAA therapy, by assessment scales and psychometric instruments. We subdivided patients into two groups, CHC patients with (Group A) or without (Group B) a current and/or past psychiatric history. After DAA treatment, Group A patients showed low anxiety and improved depression, no variation in self-report distress, but worse general health perceptions. No significant difference emerged from coping strategies. Depression and anxiety improved in Group B, and no change emerged from total self-reported distress, except for somatization. Moreover, Group B increased problem-focused strategies for suppression of competing activities, and decreased strategies of instrumental social support. Contrarily, Group B reduced significantly emotion-focused strategies, such as acceptance and mental disengagement, and improved vitality, physical and social role functioning. DAA therapy is safe and free of hepatological and psychiatric side effects in CHC patients, regardless of current and/or past psychiatric history. In particular, patients without a psychiatric history also remarkably improved their quality of life.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

TomoBreast hypothesized that hypofractionated 15 fractions/3 weeks image-guided radiation therapy (H-IGRT) can reduce lung-heart toxicity, as compared with normofractionated 25-33 fractions/5-7 weeks conventional radiation therapy (CRT). 123 women with stage I-II operated breast cancer were randomized to receive CRT (N=64) or H-IGRT (N=59). The primary endpoint used a four-items measure of the time to 10% alteration in any of patient self-reported measure, physician clinical evaluation, echocardiography or lung function tests, analyzed by intention-to-treat without exclusion. Results found comparable survivals, but H-IGRT significantly reduced the toxicity measured by lung diffusion capacity and alveolar volume as compared with CRT, G1 in 53% (31/59) versus 72% (44/61) patients, P=0.006; G2, 29% versus 48%, P=0.020. H-IGRT significantly reduced the risk of composite cardio-pulmonary alteration at 5 years, 10.2% versus 26.7%, P=0.024. In conclusion, TomoBreast is a proof-of-concept that image-guided radiation-therapy can improve the overall balance of lung-heart outcomes in breast cancer adjuvant therapy. Furthermore, the significance of the findings supports the efficacy of a small trial size design, which can be critical when clinical research resources are limited.

Novel strategies have been developed to reduce or to avoid the intravitreal injections (IVTs) of the antiangiogenic (ranibizumab; RBZ) and the anti-inflammatory (triamcinolone acetonide; TA) agents used to treat vitreoretinal diseases. One of the strategies include liposomes. In this study, it was evaluated the safety and efficacy of topical triamcinolone-loaded liposomes formulation (TALF) as an adjuvant to intravitreal RBZ therapy in treatment-naive patients with neovascular age related macular degeneration (nAMD). Subjects were randomly assigned to the RBZ-TALF or the RBZ-pro re nata (RBZ-PRN) group. Patients from the RBZ-TALF group were instructed to apply TALF for a 12-month period after a single dose of RBZ. Patients from the RBZ-PRN group received three monthly RBZ-IVTs. Retreatment with RBZ was considered in case of nAMD reactivation. Related to safety, non-ocular abnormalities were observed during TALF therapy. Owing to the efficacy, non-significant differences are identified in visual acuity or central foveal thickness when the RBZ-PRN and RBZ-TALF groups are compared. Importantly the average number of RBZ injections was significantly lower in the RBZ-TALF group (2.5 ± 1.4 vs 6.1 ± 1.3 IVTs; p=0004). Therefore, TALF used as an adjuvant to RBZ reduce the number of RBZ-IVTs retreatment with optimal visual and anatomic results.

As Automated Driving Systems (ADS) technology gets assimilated into the market, the driver’s obligation will be changed to a supervisory role. A key point to consider is the driver’s engagement in the secondary task to maintain the driver/user in the control loop. The paper’s objective is to monitor driver engagement with a game and identify any impacts the task has on hazard recognition. We designed a driving simulation using Unity3D and incorporated three tasks: No-task, AR-Video, and AR-Game tasks. The driver engaged in an AR object interception game while monitoring the road for threatening road scenarios. From the results, there was less than 1 second difference between the means of gaming task (mean = 2.55s, std = 0.1002s) to no-task (mean = 2.55s, std = 0.1002s). Game scoring followed three profiles/phases: learning, saturation, and decline profile. From the profiles, it is possible to quantify/infer drivers’ engagement with the game task. The paper proposes alternative monitoring that has utility, i.e., entertaining the user. Further experiments AR-Game focusing on real-world car environment will be performed to confirm the performance following the recommendations derived from the current test.

Aging is accompanied by frontal lobe and non-dominant hemisphere recruitment that supports executive functioning, such as inhibitory control, which is crucial to all cognitive functions. Yet, the spatio-temporal sequence of processing underlying successful inhibition and how it changes with age is understudied. Thus, we assessed N200 (conflict monitoring) and P300 (response inhibition, performance evaluation) event-related potentials (ERPs) in young and healthy older adults during comparably performed successful stop-signal inhibition. We additionally interrogated the continuous spatio-temporal dynamics of N200- and P300-related activation within each group. Young adults had left hemisphere dominant N200, while older adults had overall larger amplitudes and right hemisphere dominance. N200 activation was biphasic in both groups but differed in scalp topography. P300 also differed, with larger right amplitudes in young, but bilateral amplitudes in old, with old larger than young in the left hemisphere. P300 was characterized by an early parieto-occipital peak in both groups, followed by a parietal slow wave only in older adults. A temporally similar but topographically different final wave followed in both groups that showed anterior recruitment in older adults. These findings illuminate differential age-related spatio-temporal recruitment patterns for conflict monitoring and response inhibition that are critically important for understanding age-related compensatory activation.

This study aims to develop a performance evaluation system that can facilitate performance evaluation at region, hospital, and department levels to enable better cost management for sustainable development. A multi-level system of performance evaluation informs a hierarchical assessment of cost management from regions to hospitals to departments using diagnosis-related group (DRGs). Various metrics are developed employing the variances between targets and actuals where targets are determined from two perspectives: benchmarking using external regional prices and change management using internal data. Targets for the latter are statistically based and specifically incorporate variability. The model is applied to two hospitals, twenty departments, nine DRGs and 1071 inpatients. The analyses indicate that the approach can provide a practical evaluation tool that allows for particular characteristics at multiple levels. The system provides macro-micro and external-internal perspectives in performance, enabling high-level variances to be decomposed thereby identifying sources of performance variability and financial impact.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centered on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese and to individualize the interventions, with a focus from weight change to individual's overall well-being.