Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Background: Surveys conducted in different regions of the world showed that the prevalence rates of health risk behaviors (HRBs) in university students are sometimes higher than those found in non-university populations. This study aims to identify the prevalence rates and demographic and academic environment correlates associated with HRBs among Brazilian university students. Methods: In a cross-sectional epidemiological study, a random sample of 5,310 university students answered an online questionnaire with demographic (sex, age, skin color, marital status, and paid work) and academic setting information (housing type, size of campus, year and shift of study), as well as items clustered in four HRB domains: personal safety and violence, sexual behavior and contraception, addictive substance use, and eating habits, physical activity, and sleep. The data were analyzed statistically using bivariate analysis and hierarchical multiple regression. Results: The highest prevalence rates occurred in HRBs clustered in the domain of eating habits, physical activity, and sleep (> 60%), while HRBs for personal security and violence were less prevalent (

Botswana, Eswatini and Lesotho are three Southern African countries which make use of re-turn-of-service (RoS) schemes to increase human resources for health in their countries. These initiatives bind beneficiaries to a pre-defined period of service upon completion of their studies based on the length of funding support received. We aim to review the history of these policies to understand the conceptualisation, intent and implementation of these schemes. We used a mul-ti-methods research design which consisted of a literature review, policy review and semi-structured interviews with policymakers and implementors. All three governments have a combination of grant-loan schemes and full bursaries or scholarships. The policies have all been operating for over 20-years, with Eswatini’s pre-service being the oldest since it was introduced in 1977 followed by Lesotho’s 1978 policy and Botswana’s 1995 pre-service policy. These policies have never been reviewed or updated. RoS schemes in these countries were introduced to ad-dress critical skills shortages, improve employability prospects for citizens, to have competent public sector employees by global standards, and to aid career progress of government employ-ees. Ministries of Health are passive role players. However, these schemes can only be efficient if there is clear cooperation and coordination between all stakeholders.

The supply of mental health processes in primary care has gaps. This study aims to analyze the association of agreement criteria and flows between primary care teams and the Family Health Support Center (NASF) for mental health collaborative care, considering the difference between capital and non-capital cities in Brazil. This cross-sectional study was conducted based on secondary data from the Primary Care Access and Quality Improvement Program. Agreement criteria and flows were obtained from 3883 NASF teams of the matrix support or collaborative care. The Chi-square test and multiple Poisson regression were used; p &lt; 0.05 was considered statistically significant. Prevalence ratios of negative associations demonstrated protective factors for support actions: follow-up at Psychosocial Care Center, management of psychopharmacotherapy, offer of other therapeutic actions, care process for users of psychoactive substances, and offer of activities to prevent the use of psychoactive substances. Collaborative care in primary care was effective, and capital cities were a protective factor compared with non-capital cities.

The negative implications of climate change for human health are now well-established. Yet these have not been fully considered into climate change communication strategies. Research suggests that reorienting climate change communication with a health frame could be a useful communication strategy. We conducted a long-term and broad overview of existing scientific literature in order to summarize the state of research activity in this area, by extent and by nature. The methodology is based on a scoping review of scientific articles published on climate change communication and health between 1990 and mid-2016 indexed in the PubMed, ScienceDirect, and Web of Science databases. The screened citations were reviewed for inclusion and data were extracted and coded in order to conduct quantitative (e.g. frequencies) and qualitative (i.e. content analysis) analyses.Out of 2,866 identified published papers, only 24 articles were eligible for analyses. The main themes identified were effective communication of climate change (n=10, 41.7%), the role of health professionals (n=10, 41.7%) and the perception of climate change (n=4, 16.7%). We identified a large proportion of secondary research articles (n= 15, 62.5%) including reviews (n=5, 20.8%) and opinion articles (n=10, 41.7%). A significant share - 37.57% (n=9) - of the identified articles were classified as original research articles, suggesting that the number of publications in this area - particularly original research - has not grown rapidly.This scoping review identified several themes including effective communication of climate change, the role of health professionals, and the perception of climate change in the selected articles on the subject. The research literature on the communication of climate change and health is relatively recent and emerging: the first articles on the subject were published from 2008 onward only.

Interprofessional learning (IPL) is essential to prepare healthcare trainees as the future public health workforce. WHIRL was an innovative IPL intervention that engaged multi-professional teams of volunteer healthcare trainees (n=20) to deliver health checks (n=464), including tailored advice and signposting, to employees in the UK construction industry (across 21 events, 16 sites, 10 organisations) as part of an ongoing research programme called Test@Work. Volunteers undertook a four-part training and support package of trainer-led education, observations of practice, self-directed learning and clinical supervision, together with peer mentoring. In a one-group post-test only design, IPL outcomes were measured using the Inventory of Reflective Vignette - Interprofessional Learning (IRV-IPL), and the psychometric properties of the IRV-IPL tool were tested. WHIRL demonstrably improved healthcare trainees’ interprofessional skills in all five areas of collaboration, coordination, cooperation, communication, and commendation. The IRV-IPL tool was found to be a valid and reliable measure of interprofessional competencies across three scenarios; before and after health promotion activities, and as a predictor of future health promotion competence. This industry-based workplace IPL programme resulted in attainment of health check competencies, and bridged the gap between research, education and clinical practice.

This observational study was ordered by the Medical Practitioners’ Chamber in Warsaw. The objective of the study was to evaluate the health status of physicians in relation to their occupational duties. Professional burnout was considered relative to different features of personality. This study was initially carried out from 2005–2008, but further analysis of burnout and personality was carried out from 2017–2018. The research tools were anonymous, validated questionnaires. The sample size was based on the size of the population— the registry of the Regional Chamber of Medical Practitioners— and literature on burnout prevalence. The respondents’ work places were randomly selected from the Mazovian District register. The test on burnout was completed by 378 respondents, while 62 subjects completed a personality test. Results showed that burnout syndrome was an occupational problem for healthcare workers. Professional burnout affected as many as 42% of respondents(n = 158). It affected two age groups in particular: physicians up to 31 years old and individuals aged 41-50. Moreover, neuroticism was found to be significantly related to burnout syndrome. In conclusion, burnout syndrome is common among medical practitioners, and neuroticism may be correlated with burnout syndrome.

Adolescence is a crucial phase marked by significant physical, psychological, emotional and social changes. India having the world's largest adolescent population, understanding and addressing their health needs are vital for the nation's social, political, and economic progress. The primary aim of this study is to examine the impact of key health policies on adolescent health outcomes in India. To achieve this objective, the research adopts a mixed-method approach, combining qualitative and quantitative analysis of health policies, strategies, and programs implemented since 2005 was conducted. Additionally, data from the most recent three Demographic Health Surveys (DHS) were analyzed and compared to assess changes in adolescent health indicators after the implementation of these policies/strategies. Major adolescent health policies in India were assessed, namely the Adolescent Reproductive and Sexual Health Strategy (ARSH 2005), Rashtriya Kishor Swasthya Karyakram (RKSK 2014), and School Health Programme 2020. All the strategies and programs aim to provide a comprehensive framework for sexual and reproductive health services, expand the scope of adolescent health programming, and address various health aspects. The SWOT analysis findings, highlighted strengths in targeted interventions, monitoring, and promotion, but weaknesses in awareness, societal barriers, and healthcare worker participation. Opportunities include female-friendly clinics and education about early pregnancy, while addressing substance abuse and training volunteers remain challenges. Family planning has improved, with higher contraception usage and a decrease in unmet needs. Violence reduced, and positive health behaviors increased, such as condom use. However, challenges remain, including limited access to health services, concerns about female providers, and low health insurance coverage. Nutrition indicators show a slight increase in overweight/obesity and anemia rates. Overall, progress has been made, but certain health aspects still require attention. Therefore, conducting targeted awareness campaigns, strengthening health worker and NGOs engagement, combating the increasing prevalence of overweight and obesity among adolescents are highly recommended. Further efforts are needed to achieve universal health coverage and improve adolescent health outcomes globally.

Zoonoses are diseases transmitted from (vertebrate) animals to humans. Control and prevention of these diseases require an appropriate way to measure health for prudent and well-balanced decisions in public health. We propose a framework that aims to explore, understand and open up a conversation about the non-monetary value of animals through environmental and normative ethics. As an example of its application, participants can choose what they are willing to give in exchange for curing an animal in hypothetical scenarios selecting a human health condition to suffer, the amount of money, and lifetime as a tradeoff. We believe that considering animals beyond their monetary value in public health decisions will contribute to a more rigorous assessment of the burden of zoonotic diseases, among other health decisions. This method might help us complement the existing metrics in health, adding more comprehensive values for animal and human health for the “One Health” approach.

International migrants comprised 14% of the UK population in 2020, but migrant health in the UK has rarely been studied at a population level using primary care electronic health records (EHRs). Given the difficulty of determining migration status using EHRs, this study developed a migration phenotype and assessed its validity. We developed a phenotyping algorithm using codes for country of birth, visa status, non-English main/first language and non-UK origin. It was applied to a Clinical Practice Research Datalink (CPRD) GOLD database of 16,071,111 primary care patients between 1997 and 2018. We compared the completeness and representativeness of the identified migrant population to Office for National Statistics (ONS) country of birth and 2011 census data by year, age, sex, geographic region of birth and ethnicity. Between 1997-2018, 403,768 migrants (2.51% of the CPRD GOLD population) were identified using the phenotype. 178,749 (1.11%) of these migrants were identified by codes indicating foreign country of birth or visa status, 216,731 (1.35%) a non-English main/first language, and 8,288 (0.05%) non-UK origin. The cohort was similarly distributed compared to ONS migration statistics in terms of sex and region of birth. Recording of migration improved from identifying approximately one-tenth of the expected proportion of migrants according to the ONS in 2004 to a quarter in 2018. Younger migrants were better represented than those aged 50 and over. The migration phenotype identified a large number of migrants and can be used to undertake large-scale migration health research in CPRD GOLD to inform healthcare policy, practice and action. While the cohort was representative of the UK migrant population in terms of sex and region of birth, migration status was under-recorded in earlier years and older ages, and future studies for these groups should therefore be interpreted with caution.

Effectively responding to children’s nutritional status and eating behaviors in Mozambique requires a community-based care approach grounded in sound nursing research that is evidence-based. The Community Assessment, Intervention, and Empowerment Model (MAIEC) is a nursing theoretical model that bases clinical decision-making for community health nurses using communities as a unit of care. We used the MAIEC to identify a community-based nursing diagnosis to address children’s nutritional status and eating behaviors in Mozambique. Objectives: (1) To conduct a descriptive study of children’s nutritional status and eating behaviors in a school community in Mavalane, Mozambique, and (2) to identify a community-based nursing diagnosis using the MAIEC clinical decision-making matrix in the same school community. Method: A cross-sectional, quantitative study was conducted to assess the nutritional status of children using anthropometric data, including brachial perimeter and the tricipital skinfold, and standard deviation for the relation of weight-height, in a sample of 227 children. To assess community management of the problem and identify a community-based nursing diagnosis, we surveyed 176 parents/guardians and 49 education professionals, using a questionnaire based on the MAIEC clinical decision matrix as a reference. Results: Malnutrition was identified in more than half of the children (51.3%). We also identified a community-based nursing diagnosis of impaired community management related to the promotion of child health and healthy eating as evident by lack of community leadership, participation, and processing among more than 70% of the community members (parents/guardians and education professionals). Conclusion: A nursing diagnosis and diagnostic criteria for nutritional status and community management were identified. The need to intervene using a multidisciplinary public health approach is imperative, with the school community as the unit of care. In addition, reliable anthropometric data were used to complement the nursing diagnosis and guide future public health interventions.

Hispanics are disproportionately affected by low rates of physical activity and high rates of chronic diseases. Hispanics generally and Mexican Americans specifically are underrepresented in research on physical activity and its impact on mental well-being. Some community-based interventions have been effective in increasing physical activity among Hispanics. This study examined data from a sample of low-income Hispanic participants in free community exercise classes to characterize the association between self-reported frequency of exercise class attendance, intensity of physical activity, and participant well-being. As part of two cross-sectional samples recruited from a stratified random sample of community exercise classes, 302 participants completed a questionnaire consisting of a modified version of the Godin-Shephard Leisure-Time Exercise Questionnaire (LTEQ) and the Mental Health Continuum Short Form (MHC-SF). Adjusted binary logistic regression analyses indicated that those who achieve moderate and strenuous self-reported physical activity have 130% higher odds (p = 0.0422) of positive mental well-being after adjustment for age, attendance, and self-reported health. This study provides evidence that physical activity intensity and time are associated with flourishing mental health among Hispanics. The study provides insight into the planning and development of community-based physical activity programming tailored to low-income populations.

Objective: To explore the effect of rural-urban residence on self-reported health status with UK cancer survivors. Design: A cross-sectional postal questionnaire that collected data on demographics, post-code and self-reported health status. Methods: Independent Samples t test was used to detect differences in health status between rural and urban respondents. Pearson’s χ2 was used to control for confounding variables and multivariate analysis was conducted using Stepwise linear regression. Setting: East Midlands of England. Participants: Adult cancer survivors who had undergone primary treatment in the last five years. Participants were excluded if they had recurrence or metastatic spread, started active oncology treatment in the last twelve months and were in receipt of palliative or end of life care. Main Outcome: Residence was measured using the UK ONS RUC2011 Rural-Urban Classifications and Health Status via the UK ONS self-reported health status measure. Results: 227 respondents returned a questionnaire. Forty-five per cent (N=103) were resident in a rural area and fifty-three per cent (N=120) in an urban area. Rural (4.11±0.85) respondents had significantly (p<0.001) higher self-reported health status compared to urban (3.65±0.93) respondents (MD 0.47; 95% CI 0.23, 0.70). Conclusion: Rural respondents had significantly higher self-reported health status compared to their urban counterparts. It is hoped that the results will stimulate further work in this area and that researchers will be encouraged to collect data on rural-urban residency where appropriate.

Resumo: Este estudo teve como objetivo avaliar a Saúde Mental Positiva (SPM) e a sua relação com características sociodemográficas, literacia em saúde mental e escala de vulnerabilidade psicológica (PVS) em estudantes universitários portugueses com idades compreendidas entre os 17 e os 62 anos. Foi realizado um estudo descritivo-correlacional. Uma pesquisa online foi realizada para avaliar variáveis ​​demográficas, e vários questionários foram aplicados para avaliar saúde mental positiva, vulnerabilidade psicológica e alfabetização em saúde mental. Os dados foram coletados de 1º de novembro de 2019 a 1º de setembro de 2020. No geral, 3.405 alunos participaram do estudo. Os resultados mostram que 67,8% dos alunos revelaram um alto nível de PMH, 31,6% apresentaram um nível médio de PMH e 0,6% apresentaram um nível baixo de PMH. Os estudantes do sexo masculino relataram maior satisfação pessoal (t (3170) = -2,39, p=0,017) e autonomia (t (3170) = -3,33, p=0,001), no PMH em relação ao sexo feminino. Alunos sem bolsa pontuaram mais alto (t (3.127) = -2,04, p=0,42) no PMH do que alunos com bolsa. Estudantes que não foram deslocados de casa relataram maior (t (3170) = -1,99, p=0,047) Autocontrole em PMH do que aqueles deslocados de sua casa. Estudantes universitários com resultados de PMH mais altos têm resultados de PVS mais baixos e resultados de Alfabetização mais altos. Os achados deste estudo contribuirão para identificar as necessidades de intervenção dos alunos na PMH. Estudantes universitários com resultados de PMH mais altos têm resultados de PVS mais baixos e resultados de Alfabetização mais altos. Os achados deste estudo contribuirão para identificar as necessidades de intervenção dos alunos na PMH. Estudantes universitários com resultados de PMH mais altos têm resultados de PVS mais baixos e resultados de Alfabetização mais altos. Os achados deste estudo contribuirão para identificar as necessidades de intervenção dos alunos na PMH.

The aim was to analyze the coping strategies used by primary health care (PHC) professionals. A cross-sectional, descriptive-analytical study was conducted with professionals working in primary health care units in São José do Rio Preto, a large city in the interior of São Paulo, Brazil. For data collection we used an instrument developed by the researchers, containing sociodemographic and professional variables, as well as the Problem Coping Modes Scale (EMEP). We evaluated 333 PHC professionals. A difference was observed between the scores of the four coping strategies (p<0.001), with the highest score for the problem-focused strategy (3.8) and the lowest score for the emotion-focused strategy (2.4). Physicians had the lowest scores in coping strategies focused on religious practices/fantastical thinking (p<0.001) and pursuit of social support (p=0.045), while community health agents had the highest scores in these coping strategies). Professionals working in PHC have different coping strategies for the problems and stressful situations experienced in the work environment. These strategies can involve more positive attitudes focused on confrontation and problem solving, to emotional responses that involve attitudes of avoidance and denial that involve attitudes of avoidance and denial of the problem.

In the following article, we estimate the Renunciation of Healthcare Services-RHS in Italian regions in the context of the Environmental, Social and Governance-ESG model during the period 2004-2022. The data were acquired from the ISTAT-BES dataset. The data were analyzed using the following econometric techniques: Panel Data with Fixed Effects, Panel Data with Random Effects, Pooled Ordinary Least Squares-OLS, Weighted Least Square-WLS,. Results show that RHS tends to growth with the E-Component, is negatively associated to the S-Component, and positively associate with the G-Component within the ESG model. Furthermore, a clusterization with the unsupervised k-Means algorithm is presented and the results are discussed with a confrontation between optimal and suboptimal k values optimized with the Silhouette Coefficient. Finally, a confrontation among eight different machine-learning algorithms is performed to predict the future value of RHS. Outcomes show that the Simple Regression Tree is the best predictive algorithm and that the level of RHS is predicted to growth on average of 4.4% for the Italian regions. Results are critically discussed.

In this article, we analyse the ESG determinants of the “Elderly People Treated in Integrated Home Care”-EPIHC in the Italian regions between 2004 and 2022. We used data from the ISTAT-BES database. We used different econometric techniques i.e.: Panel Data with Random Effects, Panel Data with Fixed Effects, Pooled Ordinary Least Squares-OLS and Weighted Least Squares-WLS. The results show that the EPIHC is positively associated with “Nurses, midwives, and Soil sealing by artificial cover" and negatively associated with "Museum heritage density and relevance" and "Trust in law enforcement agencies and firefighters fire". Furthermore, we have applied a k-Means algorithm with the Silhouette Coefficient and we find the presence of two clusters. Finally, we propose a confrontation among eight different machine-learning algorithms and we find that Linear Regression is the best predictive algorithm.

In the following article, it is presented an investigation of the determinants of Beds for High-Care Specialties-BHCS in the Italian regions in the context of Environmental, Social and Governance-ESG approach. Data from ISTAT-BES for 20 countries in the period 2004-2021 are been used. Different econometric techniques have been applied i.e.: Pooled Ordinary Least Squares, Panel Data with Fixed Effects, Panel Data with Random Effects, Dynamic Panel at 1 stage. Furthermore, a cluster analysis performed with a k-Means algorithm optimized with the Silhouette Coefficient indicated the presence of three clusters. Finally, eight different machine-learning algorithms are analysed to predict the future value of BHCS. The results show that the Artificial Neural Network-ANN algorithm is the best algorithm. The future value of BHSC is expected to growth on average of 4.88% for the analysed regions.

The following article presents an analysis of the impact of the Environmental, Social and Governance-ESG determinants on Hospital Emigration to Another Region-HEAR in the Italian regions in the period 2004-2021. The data are analysed using Panel Data with Random Effects, Panel Data with Fixed Effects, Pooled Ordinary Least Squares-OLS, Weighted Least Squares-WLS, and Dynamic Panel at 1 Stage. Results show that HEAR is negatively associated to E, positively to S and negatively associated to the G within the ESG model. The data were subjected to clustering with a k-Means algorithm optimized with the Silhouette coefficient. The optimal clustering with k=2 is compared to the sub-optimal cluster with k=3. The results suggest a negative relationship between the resident population and hospital emigration at regional level. Finally, a prediction is proposed with machine learning algorithms classified based on statistical performance. The results show that the Artificial Neural Network-ANN algorithm is the best predictor. The ANN predictions are critically analyzed in light of health economic policy directions.

In the following article, we analyse the determinants of the number of physicians in the context of ISTAT BES-Benessere Equo Sostenibile data among twenty Italian regions in the period 2004-2022. We apply Panel Data with Random Effects, Panel Data with Fixed Effects, and Pooled OLS-Ordinary Least Squares. We found that the number of Physicians among Italian regions is positively associated, among others, to “Trust in the Police and Firefighters”, “Net Income Inequality”, and negatively associated, among others, to “Research and Development Intensity” and “Soil waterproofing by artificial cover”. Furthermore, we apply the k-Means algorithm optimized with the Silhouette Coefficient and we find the presence of two clusters. Finally, we confront eight different machine-learning algorithms to predict the future value of physicians and we find that the PNN-Probabilistic Neural Network is the best predictive algorithm.

Type 1 diabetes (T1D) has shown an increase in the incidence rate of about 3% per year over the last two decades. Continuous Insulin Subcutaneous Therapy (CSII) is widely used in the paediatric population with diabetes; however, it requires more preparation by the treating team and careful selection of potential users. Prescriptive provisions vary from Region to Region and the perspective of health workers still remains an unexplored area. The aim of the research project is to explore the representations of a group of diabetologists and psychologists working in pediatric diabetology on the national territory, regarding roles, functions and activities as part of a multidisciplinary team; their views on the potential benefits of CSII and the types of individuals applying for the use of technology. A socio-anagraphic data sheet was administered and two homogeneous focus groups were conducted by profession; they were audio recorded. The transcripts produced were analysed using the Emotional Text Mining (ETM) methodology. Each of the two corpus generated three clusters and two factors: for diabetologists, a focus on the patient in different levels of care emerged, collaborating both with other health professionals and with the territory, through the proposal of an intervention where the medical aspect is often represented by technology; also for psychologists there was a representation of interdisciplinary networking, with a greater focus on the processes inherent the management of pathology, from acceptance to the elaboration and integration of diabetes in the family narrative. The understanding of the representations of health professionals working in pediatric diabetes about new technologies can contribute to the consolidation of a network of professionals through a targeted work on possible critical issues emerged.

Although health policy resides mainly with the government, industry can play an important role in building a health ecosystem. From March to May, we administered questionnaires to 1,200 individuals from the general Korean population asking about their perception of health-friendly labels, and if they would purchase such labeled products (foods, pharmaceuticals, etc.) and services (purifying water, preventing air pollution, etc.) at extra cost. The participants placed a high value on the importance of mental, social, spiritual, and physical health factors in terms of company’s products and services with a score of about 8 out of 10 (range, 7.74-8.33). Most respondents (72.4%) said they were interested in adopting health-friendly labels. When a health-friendly label is introduced (such as one by the Business for Social Responsiveness), 65.1% of the respondents said they intended to purchase the product or service, while 6.8% said they did not, and 75.0% said they were willing to pay extra for the health-friendly product or service. Multivariate logistic regression models showed urban residence, high education level, and good social health to be significantly associated with positive attitudes toward health-friendly labels. People with high income, no religion, or normal weight were more likely to say they intend to purchase products and services with health-friendly labels. They also had a more positive attitude toward paying more for such products and services, as did people with good spiritual health. This study provides data that illustrate the importance of health-friendly products and services to the general population and companies.

Background: The Covid-19 pandemic abruptly disrupted global healthcare systems, necessitating rapid adaptations. This study evaluates the impact on health systems and services in the aftermath of the first wave in the Indian context. It analyses the disruptions, adaptive measures, and changes made, as well as the challenges faced by healthcare providers and seekers. Valuable insights from this study will enhance the resilience and preparedness of healthcare systems for future challenges. Methods: The eligible studies included primary studies conducted in the Indian context that explore the impact of COVID-19 on health services provision, utilisation, and the well-being of healthcare providers and seekers. Electronic searches were conducted in six databases: PubMed, MEDLINE, Embase, Global Health, CINAHL, and the WHO database on COVID-19. The results were analysed using detailed narrative synthesis. Results: The review includes 38 articles, incorporating a total of 22,502 subjects. There has been a substantial impact on health service provision, particularly in outpatient departments (OPD) (n=19) and elective services (n=16), while emergency services continued at sub-optimal levels (n=20). Various adaptations and changes were implemented in precautionary measures, protocols, staff allocation and training, usage of personal protective equipment (PPE), preoperative, operative, and postoperative measures, as well as physical infrastructure and resources. Depression and stress (n=14), fear of contracting the infection (n=6), stigmatisation (n=5), and financial repercussions (n=5) significantly affected the mental health of healthcare providers, and healthcare seekers also faced significant challenges (n=11). Conclusion: The study reveals COVID-19's substantial impact on health services. The healthcare system responded by quickly adjusting staff management, resource allocation, and infection prevention measures. The study also highlights the mental health challenges faced by healthcare providers and the concerns of healthcare seekers regarding delays and suboptimal care. Looking ahead, the findings underscore the importance of preparedness for future pandemics, including improved healthcare infrastructure, resource optimisation, and comprehensive protocols. Lessons learned from COVID-19 should inform strategies to mitigate disruptions and ensure the well-being of healthcare providers and seekers in future outbreaks.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

The health status of Hungary's population is unfavorable, with significant differences in health indicators not only compared to the EU15 but also to the Visegrad countries. Unfavorable health indicators can be disproportionate and particularly affect vulnerable groups, such as people with disabilities. The aim of the present study is to compare the health behaviour and indicators of adolescents with disabilities in Hungary with those of the HBSC survey in the Visegrad countries, and to compare the results of the Hungarian special needs adolescent population with those of the Visegrad countries. Eating habits are unfavourable for both the Visegrad countries and the young people we studied. Children with disabilities have significantly higher rates of schoolwork stress compared to other countries. Significantly higher prevalence of somatic complaints and worse mental well-being parameters higher in Hungary than in the other Visegrad countries. The results suggest that further interventions are needed in Hungary and that differentiated, professionalised health promotion is needed for young people with disabilities. The researchers propose to extend the research to adolescents with disabilities living in the Visegrad countries, on the basis of which a methodology for injury-specific health promotion could be developed, including through interna-tional interprofessional cooperation.

This article delves into the pivotal role that biodiversity of soil microbes plays in bolstering tree health and overall agroecosystem productivity. With the advent of regenerative agricultural practices, there has been a resurgence of interest in understanding the complex interactions between soil microbiota and plant roots, particularly through processes like rhizophagy. Rhizophagy, the digestion of living root cells by soil microorganisms, stands out as a fundamental mechanism in nutrient cycling and overall tree vitality. By examining the impact of enhanced microbial diversity on tree health, we shed light on the practical applications, such as the utilization of the BEAM Inoculant product, which has demonstrated remarkable efficacy in augmenting soil health and, consequently, tree Vigor

COVID-19 has proven to be detrimental across the globe, most notably affecting the United States at an alarming rate compared to comparable countries. The pandemic has had multifactorial implications on the way communities in the United States prevent, prepare for, and address the virus; however, the impact of the pandemic on rural health is less well understood. Historically, rural communities have faced a unique set of challenges regarding accessing and receiving adequate healthcare, addressing chronic illness, and eliminating health disparities closely associated with the population’s socioeconomic status; the pandemic has exacerbated these challenges. The purpose of the current study was to conduct a systematic review of the literature to evaluate the effect of the COVID-19 pandemic on rural populations both at the individual and community level. Results indicated that rural health disparities increased both at the individual and system-wide levels as a direct result of the pandemic. Budget cuts significantly affected the infrastructure of rural hospitals resulting in them being unequipped to handle such high volumes of COVID-19 cases. The lack of infectious disease specialists, access to larger medical centers with substantial numbers of ICU beds and ventilators, and an overall lack of preparedness overwhelmed rural communities. Although comorbidities such as diabetes and heart disease were associated with poorer health outcomes for a multitude of reasons, the lack of clinic and physician availability for routine care during the pandemic further exacerbated the clinical link from COVID-19 positivity to comorbidities. Furthermore, mental health deteriorated as substance use increased to a greater extent in rural communities compared to urban, during the pandemic. This study shows that health comorbidities, mental health, substance use, health literacy, access to healthcare, among others can serve as key indicators for improving healthcare in rural communities. Future studies should seek to identify key issues that disproportionately affected rural communities in comparison to their urban counterparts considering the pandemic, as well as identify gaps in the availability of rural health resources that can improve the lives of millions of Americans now and during the next pandemic.

Trees provide key ecosystem services, but the health and sustainability of these plants is under increasing biotic and abiotic threat, including from the growing incidences of non-native invasive plant pests (including pathogens). The island of Ireland (Ireland and Northern Ireland) is generally accepted to have a high plant health status, in part due to its island status and because of the national and international regulations aimed at protecting plant health. To establish a baseline of the current pest threats to tree health for the island of Ireland, the literature and unpublished sources were reviewed to produce a dataset of pests of trees on the island of Ireland. The dataset contains 396 records of pests of trees on the island of Ireland, the majority of pests being arthropods and fungi, and indicating potentially more than 44 non-native pest introductions. The reliability of many (378) of the records was judged to be high, therefore the dataset provides a robust assessment of the state of pests of trees recorded on the island of Ireland. We analyse this dataset and review the history of plant pest invasions, including (i) discussion on notable native and non-native pests of trees, (ii) pest interceptions at borders and (iii) pests and climate change. The dataset establishes an important baseline for the knowledge of plant pests on the island of Ireland, and will be a valuable resource for future plant health research and policy making.

Safe water is a global public health concern amid increasing scarcity and pollution. Bottled water production and consumption contribute to these problems. This study examines tap water consumption in Italy, assessing associated sociodemographic factors and related health outcomes such as obesity and self-perceived health status. Data from the Italian National Statistics Institute's "Aspects of daily life" survey (N=45,597) were analyzed. Covariates included education, age, gender, economic status, region, concerns about waste and climate change, consumption of carbonated drinks excluding water, alcohol consumption, consumption of vegetables, consumption of snacks, body mass index, and self-perceived health status. Bivariate analyses and mixed-effect logistic regression models explored the associations. People who drink tap water were 19,674 with a higher prevalence in people aged 45 to 59 old, people with a graduate/post-graduate degree diploma, with optimal economic resources, and concerned about waste production and climate change, coming from the North-East regions of Italy. Underweight people showed a higher prevalence of TW assumption as well as those who drink less than occasionally carbonated drinks, drink alcohol, consume vegetables more than once a day, and snacks less than once a week with a satisfying level perceived health status. Regressions showed that all age classes are less likely to drink tap water than people younger than 20 years old. The category with “inadequate” economic resources is more likely to consume tap water. Low educational classes show a low likelihood of consuming tap water as well as Islands. A concern about waste production and climate change is associated with an increased likelihood of assuming tap water. Tap water consumption was negatively associate with obesity but not with a satisfactory Self-perceived health status. Insights from this study can inform public health strategies.

The Portuguese health system has a universal, public, general National Health Service (NHS), tending towards free healthcare access. Created in 1979, this delivery model developed from the integration and complementarity between the different response levels (primary, hospital, continuing, and palliative care). However, over these 40 years, the initially centralized system underwent a decentralization process with the creation of Regional Health Administrations in the five mainland administrative regions. Since then, the entire NHS has settled around this new organization. The most recent step started in 2018 with decentralizing primary health care skills to 190 municipalities. This paper presents the various critical issues involved in the latest gradual decentralization process in health, intending to bring services closer to the citizens, and more focused on their needs. The article identifies and discusses the implications of this experience based on the steps foreseen in the already published legal texts.

Along with environmental pollutions, urban planning has been connected to public health. The research indicates that the quality of built environments plays an important role in reducing mental disorders and overall health. The structure and shape of the city are considered as one of the factors influencing happiness and health in urban communities and the type of the daily activities of citizens. The aim of this study was to promote physical activity in the main structure of the city via urban design in a way that the main form and morphology of the city can encourage citizens to move around and have physical activity within the city. Functional, physical, cultural-social, and perceptual-visual features are regarded as the most important and effective criteria in increasing physical activities in urban spaces based on literature review. The environmental quality of urban spaces and their role in the physical activities of citizens in urban spaces were assessed by using the questionnaire tool and analytical network process (ANP) of structural equation modeling. Further, the space syntax method was utilized to evaluate the role of the spatial integration of urban spaces on improving physical activities. Based on the results, the consideration of functional diversity, spatial flexibility and integration, security, and the aesthetic and visual quality of urban spaces plays an important role in improving the physical health of citizens in urban spaces. Further, more physical activities, including motivation for walking and consequently, the sense of public health and happiness, were observed in the streets having higher linkage and space syntax indexes with their surrounding texture.

Background: Australia’s healthcare system is complex and fragmented which can create challenges in healthcare, particularly in rural and remote areas. Aboriginal people experience inequalities in healthcare treatment and outcomes. This study aimed to investigate barriers and enablers to accessing healthcare services for Aboriginal people living in rural and remote Australia. Methods: Semi-structured interviews were conducted with healthcare delivery staff and stakeholders recruited through snowball sampling. The communities were selected for their high proportion of Aboriginal people and geographical representation (coastal, rural, and border). Thematic analysis identified barriers and enablers. Results: Thirty-one interviews were conducted (n =5 coastal, n=13 remote, and n=13 border) and six themes identified: 1) Improved coordination of healthcare services; 2) Better communication between services and patients; 3) Trust in services and cultural safety; 4) Importance of prioritizing health services by Aboriginal people; 5) Importance of reliable, affordable and sustainable services; 6) Distance and transport availability. These themes were often present as both barriers and enablers to healthcare access for Aboriginal people. They were also present across the healthcare system and within all three communities. Conclusions: This study describes a pathway to better healthcare outcomes for Aboriginal Australians by providing insights into ways to improve access.

Health literacy describes skills and competencies that enable people to gain access to, understand and apply health information to positively influence their own health and the health of those in the social environment. In an increasingly media saturated and digitized world, these skill sets are necessary for accessing and navigating sources of health information and tools, such as television, the Internet, and mobile apps. The concepts of Media Health Literacy (MHL) and eHealth Literacy (eHL) describe the specific competencies such tasks require. This article introduces the two concepts, and then reviews findings on the associations of MHL and eHL with several contextual variables in the social environment such as socio-demographics, social support, and system complexity, as a structural variable. As eHL and MHL are crucial for empowering people to actively engage in their own health, a growing body of literature reports of the potential and the effectiveness of intervention initiatives to positively influence these competencies. From an ethical standpoint, equity is emphasized, stressing the importance of accessible media environments for all - including those at risk of exclusion from (digital) media sources. Alignment of micro and macro contextual spheres will ultimately facilitate both non-digital and digital media to effectively support and promote public health.

Due to the increasing risk of extreme events caused by climate change (i.e. floods, fires, hurricanes) or wars, European veterinary public health may need some improvement. Utilizing a mix of qualitative (participatory observation) and quantitative methods (Internet mining), we analyzed the Greek media responses to the millennial flood in Thessaly (September 2023), focusing on animal health (including wild, companion animals and livestock) and public sentiment towards epizootic/epidemic threats. The study revealed a gap in crisis management plans regarding veterinary-related issues, emphasizing the need for comprehensive emergency response strategies. Our findings show how: (i) lay-referral system is projecting perception of epidemic threats into the population; (ii) emotional load of images of animal carcasses is misused by media creators aiming for big audience; (iii) pets owners are creating on-line communities for searching and treatment of their pets. Our results stress the importance of integrating crisis communication in consecutive phases of the discourse, such as (i) weather change; (ii) acute flood; (iii) recovery; (iv) outbreaks, into veterinary practices to better prepare for such disasters.

Aim: Shockwaves have been felt all over the world as a result of war, inflation, food shortages, and the COVID-19 pandemic's long tail. The aim of the study is to correlate present global conflicts, pandemic and socio-economic crises with present healthcare sustainability, identifying possible threats and visualize future global health crises if all these catastrophes persist for long. Materials and Methods: PubMed, ALTAVISTA, Embase, Scopus, Web of Science, and the Cochrane Central Registers were prioritized to collect public health issues. Results: The global economic slowdown, sharp decline in financial asset values, decline in imports and exports, contraction of industrial production, rise in inflation, decrease in wages, rise in unemployment, damage to the social security caused by numerous natural calamities, human displacement due to pandemic and ongoing conflicts tear down not only the economic sector but also the health sector. It is already late for taking corrective measure by the participation every country, community or intelligence. Only healthcare issues, highlighted in this study, if focused in the highest platforms, could compel global leaders to forego conflicts and work together. Conclusion: The global health sector will be collapsed soon, if proper initiatives are not taken right now, which has already been grossly mistreated by the pandemic.

The investment in digital e-Health services is a priority direction in the development of global health care systems. While people are increasingly using the Web for health information, it is not entirely clear what is the physicians’ attitude towards digital transformation, and the acceptance of new technologies in healthcare. The aim of this cross-sectional survey study was to investigate physicians’ self-digital skills, and their opinions on obtaining online health knowledge by patients, as well as the recognition of physicians’ attitudes towards e-Health solutions. Principal Component Analysis (PCA) was performed to emerge the variables from self-designed questionnaire, and cross-sectional analysis comparing descriptive statistics and correlations for dependent variables using the one-way ANOVA (F-test). 307 physicians participated in the study, reported using the internet mainly several times a day (66.8%). Most participants (70.4%) were familiar with new technologies and rate their e-Health literacy high, although 84.0% reported the need for additional training in this field, and reported a need to introduce a larger number of subjects shaping digital skills (75.9%) in medical studies 53.4% of physicians perceived Internet-sourced information as sometimes reliable, and in general assessed the effects of using it by their patients negatively (41.7%). Digital skills increased significantly with frequency of internet use (F = 13.167; p = 0.0001), and decreased with physicians’ age, and the need for training. Those who claimed that patients often experienced health benefits from online health showed higher digital skills (-1.06). Physicians most often recommended their patients to obtain laboratory test results online (32.2%), and to arrange medical appointments via the Internet (27.0%). Along with the deterioration of physicians’ digital skills, the recommendation of e-Health solutions decreased (r = 0.413), and lower the assessment of e-Health solutions for the patient (r = 0.449). Physicians perceive digitization as a sign of the times, and frequently use its tools in daily practice. The evaluation of Dr. Google’s phenomenon and online health is directly related to their own e-Health literacy skills, but there is still a need for practical training to deal with digital revolution.

Background: It is very important that nurses receive adequate training in Sexual and Reproductive Health (SRH). In this study, the contents of the SRH subject in the undergraduate nursing curricula of 77 Spanish universities were examined in order to determine what SRH training nursing students are receiving. Methods: The contents of the SRH subject of all the curricula that were available online were reviewed. The distribution of the contents (topics) in the two areas (reproductive health and sexual health) was analyzed, and the prevalence of each topic was established. It was also determined whether there were differences in topics between public (n=52) and private universities (n=25). Results: The training of nursing students focuses mainly on the area of Reproductive Health (15 topics). Most of the topics of this area had a prevalence greater than 50%. Although the area of Sexual Health had 14 topics, most of these topics had a low prevalence (&lt;20%), especially in private universities. Conclusions: It was found that there is considerable variation in the distribution and prevalence of SRH topics between universities. The contents of the area of Reproductive Health are usually prevalent in most of the curricula, however the contents of the area of Sexual Health are very limited in most of the universities. An organizational effort is required to determine and standardize the contents of SRH that nursing students should receive in Spain to avoid inequalities in their training.

Aedes aegypti mosquitoes are primary vectors of dengue, yellow fever, chikungunya and Zika viruses. Ae. aegypti is highly anthropophilic and relies nearly exclusively on human blood meals and habitats for reproduction. Socioeconomic factors may influence the spread of Ae. aegypti due to its close relationship with humans. This paper describes and summarizes the published literature on how socioeconomic variables influence the distribution of Ae. aegypti mosquitoes in the mainland United States. A comprehensive search of PubMed/Medline, Scopus, Web of Science, and EBSCO Academic Search Complete through June 12, 2019 was used to retrieve all articles published in English on the association of socioeconomic factors and the distribution of Ae. aegypti mosquitoes. Additionally, a hand search of mosquito control association websites was conducted in an attempt to identify relevant grey literature. Articles were screened for eligibility using the process described in the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Initially, 3,493 articles were identified through the database searches and previously known literature. After checking for duplicates, 2,145 articles remained. 570 additional records were identified through the grey literature search for a total of 2,715 articles. These articles were screened for eligibility using their titles and abstracts, and 2,677 articles were excluded for not meeting the eligibility criteria. Finally, the full text for each of the remaining articles (n = 38) was read to determine eligibility. Through this screening process, 11 articles were identified for inclusion in this review. The findings for these 11 studies revealed inconsistent relationships between the studied socioeconomic factors and the distribution and abundance of Ae. aegypti. The findings of this review suggest a gap in the literature and understanding of the influence of anthropogenic factors on the distribution of Ae. aegypti that could hinder efforts to implement effective public health prevention and control strategies should a disease outbreak occur.

Concerning the hippocampal mechanisms that simultaneously function to map environmental position and to generate episodic memories, a developing consensus emerged by the early 21st century. The hippocampus was recognized as embodying the primary location of personal narrative development, with the ability to create stable and coherent narrative largely representing the mental health of individuals. Determining recent advances regarding the relationship among the hippocampus, narrative, and mental health, a limited, six-database review was conducted for peer reviewed articles published since 2019. Of the 127 records located, 14 reports were included for study. The results support the necessity of creating and maintaining a stable and coherent narrative as fundamental to human mental health such that facts will be distorted in personal accounts, sleep will be disrupted, and DNA altered to retain one’s personal narratives. With narrative development fundamental to human mental health, a goal of interventions concerning hippocampal function and positive health outcomes is enhancing personal narratives in providing individuals with the ability to construct and recall those that are robust and effective. One such intervention that has proven successful in this regard, the Health Narratives Research Process, is outlined with its most recent results presented, offering opportunity for further such research.

The assessment of the prevalence of Subclinical Mastitis (SCM) in dairy farms is essential to validate the health status of the mammary gland. The aim of the study was to assess the prevalence of SCM in dual purpose livestock systems in Arauca, Colombian Orinoquia, through the analysis of the values found by the field diagnostic tests California Mastitis Test (CMT) and Electric Conductivity (EC). Milk samples were taken from the individual mammary quarters of 481 cows. The general prevalence, per affected room and the total number of rooms was determined according to the values obtained for each test using two methods of analysis. An ANOVA was performed to determine the difference between prevalence’s, a correlation analysis, and an analysis of sensitivity and specificity. The general prevalence was similar between the tests (CMT = 31.4%; EC = 29.7%) (p > 0.05). The prevalence of the total quarters was lower with EC (11.3% vs 14.2%) (p < 0.05). The correlations between tests were significant, but with low values (rs = 0.20-0.25). CMT and EC test concordance showed a sensitivity between 0.35-0.45 and a specificity of 0.75-0.90. The two tests showed positive results in detecting the same animals with or without the presence of the infection, although some animals that were positive for one test were not positive for the other test. The test EC classified animals and their quarters as SCM positive or negative in a more similar way to that obtained with CMT. The two diagnostic tests showed a general low prevalence of SCM in the livestock systems evaluated.

Health literacy is an indicator of a society’s ability to make better health judgement for themselves and the people around them. This study investigates the prevalence of health literacy among Malaysian adults and provides an overall picture of the current health literacy state of the society. The study also highlights socio-demographics markers of communities with limited health literacy which may warrant future intervention. A population based self-administered survey using the Health Literacy Survey Malaysian Questionnaire18 (HLS-M-Q18) instrument was conducted as part of the National Health Morbidity Survey 2019 in Malaysia. The nationwide survey utilized two-staged stratified random sampling method. A sample of 9478 individuals aged 18 and above participated in the study. The health literacy score was divided into three levels; limited, sufficient and excellent. Findings showed that majority Malaysian population has sufficient health literacy level, albeit leaning towards the lower end of the category with an average score of 35.5. The limited health literacy groups are associated with respondents with older age, lower education level and lower household income. Overall health literacy state for Malaysia is categorized at a lower sufficient level. Health literacy improvements should focus on communities with limited health literacy level.

Identifying health care equity indicators is an important first step in integrating the concept of equity into assessments of health care system performance, particularly in emergency care. We conducted a systematic review of administrative data-derived health care equity indicators and their association with socio-economic determinants of health (SEDH) in emergency care settings. Following PRISMA-Equity reporting guidelines, Ovid MEDLINE, EMBASE, PUBMED and Web of Science were searched for relevant studies. The outcomes of interest were indicators of health care equity and the associated SEDH they examine. Among 29 studies identified, 14 equity indicators were identified and grouped into four categories that reflect the patient emergency care pathway. Total emergency department (ED) visits and ambulatory care sensitive condition-related ED visits were the two most frequently used equity indicators. Despite some conflicting results, all identified SEDH (social deprivation, income, education level, social class, insurance coverage and health literacy) are associated with inequalities in access to and use of emergency care. In conclusion, the use of administrative data-derived indicators combined with identified SEDH could improve healthcare equity measurement in emergency care settings across health care systems worldwide.

The study aimed to estimate the prevalence and correlates of overweight and obesity among adults in Iraq. Data from a 2015 nationally representative cross-sectional survey of 3,916 persons 18 years and older were analysed that responded to a questionnaire, physical and biochemical measures. Multinomial logistic regression was utilized to predict determinants of overweight and obesity relative to under or normal weight. Results indicate that 3.6% of the participants were underweight (BMI <18.5 kg/m²), 30.8% had normal weight (BMI 18.5-24.9 kg/m²), 31.8% were overweight (25.0-29.9 kg/m²), and 33.9% had obesity (BMI ≥ 30.0 kg/m²). In adjusted multinomial logistic regression, aged 40-49 years (Adjusted Relative Risk Ratio-ARRR: 4.47, Confidence Interval-CI: 3.39-5.91), urban residence (ARRR: 1.28, CI: 1.14-2.18), hypertension (ARRR: 3.13, CI: 2.36-4.17) were positively, and male sex (ARRR: 0.47, CI: 0.33-0.68), having more than primary education (ARRR: 0.69, CI: 0.50-0.94), and larger household size (≥5 members) (ARRR: 0.45, CI: 0.33-0.60) were negativey associated with obesity. About two in three adult participants were overweight/obese, and sociodemographic and health risk factors were found that can be utilized in targeting interventions.

The epidemic of Coronavirus Disease 2019 (Covid-19) has brought many changes to people's life. This study aims to analysis Chinese people's psychological change and life after quarantining Wuhan and explore the influencing factors. Based on data from a web-survey after quarantining Wuhan (N=3268), the principal-component-analysis (PCA), multiple-linear-regression (MLR), propensity-score-matching (PSM) were used to explore the psychological change of people in China and the influencing factors. 83.3% of the respondents said that the impact of the epidemic on their life had increased after quarantining Wuhan. A considerable proportion of people's anxiety increased, being reflected in negative emotion, behavioral response and physiological response. The proportion of people who said their anxiety had increased in Wuhan was higher than that in other regions (p <0.05). The anxiety of people who were in medical isolation increased less than those who were not (p <0.05). All three aspects of people’s anxiety were positively related with time of medical isolation and degree of the attention on the epidemic (p＜0.05) except the effect of attention degree on the physiological response (p＝0.06). The measure of medical isolation at home should be advocated. Yet people should reduce the concern for the epidemic while paying attention to self-protection.

The COVID-19 crisis has brought unprecedented strain on healthcare systems around the world. It has perhaps taught us some key lessons that are worth considering and addressing to help build more sustainable health systems as well as improve our ability to combat future epidemics.

Recently there is a growing concern regarding potential health hazards linked with 5G deployment and radio frequency emitted by these stations. It becomes fundamentally important to scientifically address these concerns. In this paper, the health risks incorporated with 5G are discussed critically in the light of scientific work and debunk these tittle-tattles where required. We confute scientifically the “5G appeal”, discuss effects of 5G on health, its implications on privacy, pandemics, ecosystem and role of world health organization in fighting these narratives. Finally, we provide future direction to negate these false claims linked with 5G.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Type 2 diabetes (T2DM) presents an enormous global healthcare challenge, especially among rural communities due to limited access. To overcome this, many low- and middle-income countries are resorting to task shifting, using community health workers (CHWs) for diabetes management. However, its successful implementation depends on the practice behaviours and knowledge of these workers. This cross-sectional study from rural South India aimed to evaluate the proficiency of 275 CHWs in diabetes screening and management. A customized questionnaire, developed through experts and government was used to evaluate the practice behaviours and knowledge. Analytical methodologies consisted of descriptive statistics, logistic regression, and mosaic plots for comprehensive data interpretation. Results showed significant deficiencies of mean correct practice behaviours at 48 and 50% respectively. The identified gaps included diabetes diagnosis, HbA1c testing, diet, self-management, complications screening and risk assessment. In several areas, correct practice behaviour was reported by a relatively large number of CHWs despite incorrect answers to the related knowledge questions such as referral to the health centres, self-management and calculation of diabetes risk assessment. Addressing these deficiencies requires a thorough needs assessment and tailored training for improved diabetes management by CHWs. Training of CHWs, should not only identify prior knowledge and/or behaviour but also their interrelationship to help create a robust and flexible set of practice behaviours.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Positive Health (PH) has been described as a promising transformative innovation to address the challenges of promoting well-being and reducing the burden of disease. The aim of this study is to review the current state of knowledge about PH as introduced by Huber et al. (2016) within the available scientific literature. A rapid review of the literature following the Cochrane Rapid Review recommendations. Three databases were searched (PubMed, Google Scholar, and CINAHL). Data were extracted and synthesized using a narrative approach. A total of 55 articles were included. Initial evaluation studies reveal promising results both at individual and collective levels. However, a need is expressed in several articles for further refinement of the conceptualization of PH and ways to make the effects of the PH approach more measurable. Professionals also expressed a desire for a more informed application and elaboration of the PH method across various settings and populations to enhance its effectiveness in practice. This rapid review highlights the transformative potential of PH in shifting from a disease-focused to a health-oriented paradigm of healthcare. It underscores the need for continued research regarding further development of the concept and its practical method, along with the necessity for methodological innovation.

Fungi constitute a diverse group with highly positive and negative impacts in different envi-ronments, having several natural roles and beneficial applications in human life, but also caus-ing several concerns. Fungi can affect human health directly, but also indirectly by being detri-mental for animal and plant health influencing food safety and security. Climate changes are al-so affecting fungal distribution, prevalence, and their impact on different settings. Searching for sustainable solutions to deal with these issues is challenging due to the complexity of the inter-actions among fungi and agriculture, animal production, environment, and human health. In this way, the “One Health” approach may be useful to get some answers since it recognizes that human health is closely connected to animal and plant health, as well as to the shared environ-ment. This review aims to explore and correlate each of those factors influencing human health in this “One Health” perspective.

(1) Influenza causes a significant health and socio-economic burden every year, and health personnel (HP) are at higher risk of exposure to respiratory pathogens than general population. (2) The study purpose was to describe and compare influenza vaccine uptake and its prognostic factors among Medical Doctors (MDs) and Non-Medical Health Personnel (NMHP) vs Non-HP (NHP). We analysed 2014-2018 data (N=105,608) from the Italian Behavioural Risk Factor Surveillance System PASSI that, since 2008, has been collecting health-related information continuously in sampled adults. (3) MDs and NMHP represented, respectively, 1.1% and 4.6% of the sample. Among HP, 22.8% (CI 19.8% - 26.1%) of MDs and 8.5% (CI 7.5% - 9.5%) of NMHP reported to have been vaccinated vs 6.3% (CI 6.1% - 6.5%) in NHP. This difference is confirmed in the three categories (MDs, NMHP, NHP), even more across age groups: in 18-34yy, respectively, 9.9%, 4.4%, 3.4% vs 28.4%, 13.9%, 10.6% in 50-64yy. PASSI surveillance shows an increasing influenza vaccination uptake over time, especially among MDs (22.2% in 2014 vs 30.5% in 2018). (4) Despite such increase, especially among younger HP, influenza vaccination uptake is low. Even more under pandemic scenarios, these figures represent key information to address effective strategies for disease prevention and health promotion.

Abstract Issue Addressed: Men’s Sheds (‘Sheds’) have been identified as inherently health promoting and as potential settings to engage ‘hard-to-reach’ men in more structured health promotion initiatives. However, little is known about the sociodemographic or health and wellbeing characteristics of Shed members (‘Shedders’) on which such initiatives might be based. This study captures a baseline cross sectional analysis of Shedders (n=384) who participated in ‘Sheds for Life’, a health promotion initiative tailored to Sheds. Methods: Objective health measure, (body composition, blood pressure, blood lipids) captured via health screening as well as sociodemographic and health and wellbeing measures (physical activity, subjective wellbeing, mental health, social capital, cooking and diet) via questionnaires were assessed. Results: Participants were mostly over 65 years, retired with limited educational attainment. The majority were in the ‘at-risk’ categories for objective health measures, with most being referred to their GP following health screening. Older Shedders were also more likely to meet physical activity guidelines. Mental wellbeing was positively correlated with life satisfaction and increased social capital and these were also positively correlated with physical activity. Conclusions: Findings highlight the potential of Sheds in reaching a ‘hard-to-reach’ and ‘at-risk’ cohort of men. Despite a high prevalence of ‘at-risk’ objective health measures, participants report their health in positive terms. Future health promotion initiatives should capitalise on the inherent health promoting properties of Sheds. So what? Findings raise important implications for prioritising and designing health promotion initiatives in Shed settings.

Health innovations are generally oriented on a techno-economic vision. In this perspective, technologies are seen as an end in themselves, and there is no arrangement between the technical and the social values of innovation. This vision prevails in sanitary crises, in which management is carried out based on the search for punctual, reactive, and technical solutions to remedy a specific problem without a systemic/holistic, sustainable, or proactive approach. This paper attempts to contribute to the literature on the epistemological orientation of innovations in the field of public health. Taking the Covid-19 and Ebola crises as examples, the primary objective is to show how innovation in health is oriented towards a techno-economic paradigm. Second, we propose a repositioning of public health innovation towards a social paradigm that will put more emphasis on the interaction between social and health dimensions in the perspective of social change.

Individuals with low health literacy (HL) are known to have poorer health outcomes and to have higher mortality rates compared to individuals with higher HL: hence, the improvement of HL is a key outcome in modern healthcare systems. Healthcare providers are therefore asked to support patients’ literacy skills by encouraging the implementation of autonomy-supportive patient centered communication (PCC), which in turn requires the enhancement of patient engagement. Our main hypothesis is that the well-known relationship between autonomy-supportive PCC and HL is mediated by patient engagement which is known to play a role in HL promotion and that is related to PCC as well. The purpose of this study was to formulate a hypothetical structural equation model (SEM) linking PCC to patient engagement and HL. A cross-sectional survey design was employed involving 1007 Italian chronic patients. The hypothetical model was tested using SEM to verify the hypothesized mediation of patient engagement between PCC and HL. Results show that the theoretical model has a good fit indexes and that patient engagement fully mediates the relationship between PCC and HL. This finding suggests healthcare systems to implement a new paradigm where patients are supported to play an autonomous role in their own healthcare.

Background/Objectives: The purpose of this study was to evaluate the relationship between 1-year mortality and health insurance benefit extension policy items in severe pneumonia pa-tients requiring mechanical ventilation using a South Korean nationwide cohort. Methods: A nationwide population-based retrospective study was conducted using the Korean National Health Insurance database. A total of 1,099 patients (542 patients in the health insurance benefit item group and 557 patients in the control group) were included. The primary outcome was 1-year mortality. Results: Among patients with health insurance benefit extension policy items, 203 patients (37.5%) were diagnosed with hemato-oncological disease, who were categorized as group A, and 339 patients (62.5%) were diagnosed with cerebrovascular, cardiovascular, or rare diseases, who were categorized as group B. Group B had lower 1-year mortality (50.7% vs. 62.5%, P

Due to its time effective, joint friendly and highly customizable character whole-body-electromyostimulation (WB-EMS) is regarded as a feasible solution for a large variety of training issues particularly in the area of non-athletic application. To identify gaps in research and summarize prevalent evidence we conducted an evidence map on outcomes addressed by WB-EMS trials in middle-aged to older, non-athletic adults. Based on a comprehensive systematic search in five databases and two study registers according to PRISMA, 54 projects published in 80 articles were included. More than 90% of the studies reported outcomes related to the physical fitness or function domain. Body composition parameters were addressed by two thirds of the projects. Health-related outcomes addressed by WB-EMS included cancer/neoplasm (n=7), endocrine regulation (n=8), glucose metabolism (15), nervous system diseases (n=2), cardiovascular system diseases (n=22), non-specific chronic low back pain (n=4), osteopenia (n=5) and diseases of the renal system (n=12). Outcomes related to inflammation were addressed 18 times. Of importance, no studies reported clinically relevant adverse effects related to the WB-EMS intervention. In summary, while considerable evidence on outcomes related to fitness/function and body composition is prevalent, evidence gaps of WB-EMS research were particular evident for diseases of the nervous and cerebrovascular system.

Occupational accidents, despite continuous safety updates, are still a scourge in the occupational and forensic spheres, constituting, among other things, the subject of a large share of litigation. Demographic data can help to understand the areas where the application of health surveillance is lacking. This meta-analysis sets out to analyze data from studies on accidents at work, focusing on the correlation between the areas in which accidents occur and whether or not personal safety equipment is used, about the different regulations in force. For the selection of the data, a systematic review was carried out according to the PRISMA guidelines, with the primary objective of identifying the trend of occupational accidents in specific geographical areas, which differ in terms of the attention paid to preventive aspects. The data we highlighted showed, regarding the type of accident, substantial differences between low-income countries and industrialized countries (stratified according to the Human Development Index) and, an overall indifference as to whether or not individual safety devices were used, revealing that, despite the continuous normative evolution in the field of safety at work, even today, the investigative data on the actual application of the regulations, during accidents at work, is underestimated and little researched.

Cyperus rotundus L. exhibits promising potential for the development of functional foods due to its documented pharmacological and biological activities. This study investigated the antioxidant and anti-diabetic properties of C. rotundus kombucha. The results demonstrated potent antioxidant activity with an IC50 value of 76.7±9.6 uL/mL for the DPPH assay and 314.2±16.9 uL/mL for the ABTS assay. Additionally, the kombucha demonstrated alpha-glucosidase inhibitory with an IC50 value of 142.7±5.2 µL/mL. This in vitro antioxidant potential was further validated in vivo using Drosophila. Drosophila fed a high-sugar diet and supplemented with pure kombucha revealed significant increases in DPPH and ABTS free radical scavenging activity. Drosophila on a high-sugar diet supplemented with varying kombucha concentrations manifested enhanced resistance to oxidative stresses induced by H2O2 and paraquat. Concurrently, there was a notable decline in lipid peroxidation levels. Additionally, significant upregulations in CAT, SOD1, and SOD2 activities were observed when the high-sugar diet was supplemented with kombucha. Furthermore, in vivo assessments using Drosophila demonstrated significant reductions in alpha-glucosidase activity when fed with kombucha. A comprehensive GC-MS and HPLC analysis of C. rotundus kombucha detected the presence of antioxidative and anti-glucosidase compounds. In conclusion, C. rotundus kombucha exhibits considerable antioxidant and anti-diabetic properties, demonstrating its potential as a beneficial beverage for health promotion.

This article addresses the socioeconomic gradient in immigrant health by exploring immigration status and social capital as key considerations in measurement and development of health-promoting research and practice. This paper also seeks to draw attention to the importance of understanding how researchers approach the study of health disparities affecting minoritized and immigrant populations. A critical examination of the measures used in comparative health research challenges scholars to consider the different pathways through which socio-economic factors impact health and underscores the ethical commitment of health disparities researchers to consider the relevance and implications of their work. Given the reliance on existing data from national population health surveys to test the assumptions of the immigrant paradox, any immigrant-specific measure of SES with limited application to a large, representative sample of immigrants would likely hold little appeal to both researchers and practitioners. Understanding the mechanisms through which socioeconomic status influences immigrant health can allow scholars to address the needs of immigrant populations and advocate more effectively for programs and policies that seek to advance the health of all people.

With enhanced life expectancy and ageing global populations, the prevalence of multimorbidity continues to increase. However, there is a dearth of evidence linked to multimorbidity diagnoses, treatments and health outcomes which remains a concern for future proofing optimal healthcare services. Generating evidence is critical to managing multimorbidity, promoting public health and minimizing health inequalities via effective healthcare policies that improve quality of life for vulnerable populations. This study assessed meta-epidemiology of multimorbidity to report the gaps in scientific knowledge and clinical practice. A systematic methodology was designed and published in PROSPERO (CRD42022347308) to report meta-epidemiology analyses using databases including PubMed, Web of Science, ScienceDirect, EMBASE, The Cochrane Gynaecology and Fertility Group Specialised Register of Controlled Trials and MEDLINE for studies published between the 1^st of January 1980 - 31^st December 2022. A random-effects model was used to estimate the pooled proportion of multimorbidity in adults. Forest plots, pooled odds ratios and statistical heterogeneity metrics were used to assess the association between multimorbidity and investigated factors. Funnel plots and Egger’s regression were used to detect and correct for publication bias. Our findings identified women to be 0.32 times more likely to have multimorbidity in comparison to males. In regard to ethnicity, white people were 0.47 times less likely to develop comorbidities than black people. People who identified as a drinker or unmarried were more likely to develop comorbidities than those who are non-drinkers or married, respectively. Regardless of smoking status, people were equally likely to have comorbidity. In terms of environmental influences, people in rural areas were found to be 0.2 times less likely to have comorbidity in comparison to those living in urban areas. Interestingly, people with a higher education level were 0.57 times more likely to develop comorbidities than those with only a high school education. It is evident that multimorbidity has a significant burden globally and impacts the provision of care necessitated across populations given its association with several social determinants of health. Robust research and healthcare policies are required to better manage multimorbidity in patients. An example of such intervention includes employing prevention programs to reduce risk and incidence of multimorbidity within at-risk populations.