To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

This paper reports the findings from a pilot study designed to explore the barriers, facilitators and similarities with the delivery and implementation of two distinct models of Advance Care Planning (ACP) documentation for older adults in their last year of life used by health care professionals in their clinical practice. PACe (Proactive Anticipatory Care Plan): a GP led model and PEACE (Proactive Elderly Persons’ Advisory CarE): a nurse led model with community geriatrician oversight were used by participants in their clinical practice. Telephone interviews were conducted with general practitioners (GPs) to explore their views of using the PACe tool. Hospital admission avoidance matrons took part in face to face interviews and care staff employed in private residential care homes took part in individual telephone interviews to explore their views of using the PEACE tool. GPs and admission avoidance matrons were employed by Clinical Commissioning Groups (CCGs) and all study participants were recruited from the South East of England where data collection took place in 2015. Nine telephone interviews and two face-to-face interviews (one joint and one individual) were conducted with twelve participants. The data was analysed thematically. Participants highlighted the similarity of both tools in providing focus to ACP discussions to inform individual end-of-life care preferences. The importance of relationships was a pivotal theme-established, trusting inter-professional relationships to enable multidisciplinary teamwork and a prior relationship with the older person (or their proxy in the case of cognitive impairment) to enable conversations of this nature. Using both tools enabled participants to think critically and reflect on their own practice was another theme identified. Notwithstanding participants’ views to improve the layout of both tools, using a paper-based approach to deliver streamlined ACP and end-of-life care was a theme to emerge as a barrier which focused on the problems with access to paper-based documentation, accuracy and care co-ordination in the context of multidisciplinary team working. The value of technology in overcoming this barrier and underpin ACP as a means to help simplify service provision, promote integrated professional practice and provide seamless care was put forward as the solution.

The aim was to analyze the coping strategies used by primary health care (PHC) professionals. A cross-sectional, descriptive-analytical study was conducted with professionals working in primary health care units in São José do Rio Preto, a large city in the interior of São Paulo, Brazil. For data collection we used an instrument developed by the researchers, containing sociodemographic and professional variables, as well as the Problem Coping Modes Scale (EMEP). We evaluated 333 PHC professionals. A difference was observed between the scores of the four coping strategies (p<0.001), with the highest score for the problem-focused strategy (3.8) and the lowest score for the emotion-focused strategy (2.4). Physicians had the lowest scores in coping strategies focused on religious practices/fantastical thinking (p<0.001) and pursuit of social support (p=0.045), while community health agents had the highest scores in these coping strategies). Professionals working in PHC have different coping strategies for the problems and stressful situations experienced in the work environment. These strategies can involve more positive attitudes focused on confrontation and problem solving, to emotional responses that involve attitudes of avoidance and denial that involve attitudes of avoidance and denial of the problem.

Adolescence is a crucial phase marked by significant physical, psychological, emotional and social changes. India having the world's largest adolescent population, understanding and addressing their health needs are vital for the nation's social, political, and economic progress. The primary aim of this study is to examine the impact of key health policies on adolescent health outcomes in India. To achieve this objective, the research adopts a mixed-method approach, combining qualitative and quantitative analysis of health policies, strategies, and programs implemented since 2005 was conducted. Additionally, data from the most recent three Demographic Health Surveys (DHS) were analyzed and compared to assess changes in adolescent health indicators after the implementation of these policies/strategies. Major adolescent health policies in India were assessed, namely the Adolescent Reproductive and Sexual Health Strategy (ARSH 2005), Rashtriya Kishor Swasthya Karyakram (RKSK 2014), and School Health Programme 2020. All the strategies and programs aim to provide a comprehensive framework for sexual and reproductive health services, expand the scope of adolescent health programming, and address various health aspects. The SWOT analysis findings, highlighted strengths in targeted interventions, monitoring, and promotion, but weaknesses in awareness, societal barriers, and healthcare worker participation. Opportunities include female-friendly clinics and education about early pregnancy, while addressing substance abuse and training volunteers remain challenges. Family planning has improved, with higher contraception usage and a decrease in unmet needs. Violence reduced, and positive health behaviors increased, such as condom use. However, challenges remain, including limited access to health services, concerns about female providers, and low health insurance coverage. Nutrition indicators show a slight increase in overweight/obesity and anemia rates. Overall, progress has been made, but certain health aspects still require attention. Therefore, conducting targeted awareness campaigns, strengthening health worker and NGOs engagement, combating the increasing prevalence of overweight and obesity among adolescents are highly recommended. Further efforts are needed to achieve universal health coverage and improve adolescent health outcomes globally.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Background: Antibiotic lock therapy is an interventional modality used for treatment and prevention of central-line associated bloodstream infections. Stability and compatibility data for combinations are lacking, limiting clinical use. Objective: Compatibility and stability of daptomycin lock solutions in combination with azithromycin, gentamicin, and heparin or sodium citrate were evaluated up to 96 hours. Methods: Eight candidate lock solutions were prepared for compatibility and stability testing. All solutions were prepared in glass vials, and included daptomycin 1mg/mL in varying combinations with heparin 100 – 1,000 units/mL, trisodium citrate, azithromycin and/or gentamicin. Lactated Ringer’s solution was added as a diluent in a sufficient quantity to bring the total volume up to 5mL. Drug stability in the admixture was determined by the degradation of the components. The quantification of drugs was performed using Waters Alliance HPLC using Phenomenex Luna C8 (2), 150*2.6mm, 5µ column. A gradient run was executed for 20 minutes with 0.45% ammonium dihydrogen phosphate, pH 3.25 as eluent A and acetonitrile as eluent B at a flow rate of 1.0mL/min. Each solution was visually inspected for particulates and color change. Lock solutions were tested in triplicate. Results: Daptomycin degradation was <10% for all solutions at 48 hours, and for 7 of the 8 solutions at 72 hours. Gentamicin degradation was <5% for solutions in combination with daptomycin and trisodium citrate. No physical incompatibilities were detected. Conclusion: Study data support the stability and compatibility of daptomycin with additives in solution, allowing for fewer exchanges and longer dwell times for a lock solution. The addition of azithromycin or gentamicin may offer synergy and/or extended spectrum of activity. Daptomycin bioactivity with trisodium citrate needs confirmation.

Botswana, Eswatini and Lesotho are three Southern African countries which make use of re-turn-of-service (RoS) schemes to increase human resources for health in their countries. These initiatives bind beneficiaries to a pre-defined period of service upon completion of their studies based on the length of funding support received. We aim to review the history of these policies to understand the conceptualisation, intent and implementation of these schemes. We used a mul-ti-methods research design which consisted of a literature review, policy review and semi-structured interviews with policymakers and implementors. All three governments have a combination of grant-loan schemes and full bursaries or scholarships. The policies have all been operating for over 20-years, with Eswatini’s pre-service being the oldest since it was introduced in 1977 followed by Lesotho’s 1978 policy and Botswana’s 1995 pre-service policy. These policies have never been reviewed or updated. RoS schemes in these countries were introduced to ad-dress critical skills shortages, improve employability prospects for citizens, to have competent public sector employees by global standards, and to aid career progress of government employ-ees. Ministries of Health are passive role players. However, these schemes can only be efficient if there is clear cooperation and coordination between all stakeholders.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The health status of Hungary's population is unfavorable, with significant differences in health indicators not only compared to the EU15 but also to the Visegrad countries. Unfavorable health indicators can be disproportionate and particularly affect vulnerable groups, such as people with disabilities. The aim of the present study is to compare the health behaviour and indicators of adolescents with disabilities in Hungary with those of the HBSC survey in the Visegrad countries, and to compare the results of the Hungarian special needs adolescent population with those of the Visegrad countries. Eating habits are unfavourable for both the Visegrad countries and the young people we studied. Children with disabilities have significantly higher rates of schoolwork stress compared to other countries. Significantly higher prevalence of somatic complaints and worse mental well-being parameters higher in Hungary than in the other Visegrad countries. The results suggest that further interventions are needed in Hungary and that differentiated, professionalised health promotion is needed for young people with disabilities. The researchers propose to extend the research to adolescents with disabilities living in the Visegrad countries, on the basis of which a methodology for injury-specific health promotion could be developed, including through interna-tional interprofessional cooperation.

Urbanization induced land use land cover (LULC) changes intensify the urban heat island effects. It magnifies the risk of urban dwellers and sometimes causes the loss of human life, defined as heat-related health risk (HRHR). Hence, urban LULC planning plays a crucial role. Present study analyses the impact of composition and configuration of urban LULC defined as urban landscape metric (ULM) on HRHR in Delhi at the ward level. Firstly, the HRHR is measured by using satellite thermal and other digital data. Then, measured HRHR is validated by conducting a rapid field survey. Thirdly, ULM measured at ward level using Fragstat 4 software. Finally, both, HRHR and ULM linked with bi-variate Moran's I and impacts of ULM are assessed using ordinary least square (OLS) and spatial error (SE) regression. The result indicates the high risk is found as clustered in north-east, central and middle of south-west Delhi. Built-up density intensifies HRHR and abundance of vegetation reduce it; however, it is not similar for all vegetation patches. Larger vegetation patches surrounded by dense built-up might not able to reduce the risk as much as a large vegetation patch could in other regions. Findings can be helpful for heat resilient city planning.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

Background: The Covid-19 pandemic abruptly disrupted global healthcare systems, necessitating rapid adaptations. This study evaluates the impact on health systems and services in the aftermath of the first wave in the Indian context. It analyses the disruptions, adaptive measures, and changes made, as well as the challenges faced by healthcare providers and seekers. Valuable insights from this study will enhance the resilience and preparedness of healthcare systems for future challenges. Methods: The eligible studies included primary studies conducted in the Indian context that explore the impact of COVID-19 on health services provision, utilisation, and the well-being of healthcare providers and seekers. Electronic searches were conducted in six databases: PubMed, MEDLINE, Embase, Global Health, CINAHL, and the WHO database on COVID-19. The results were analysed using detailed narrative synthesis. Results: The review includes 38 articles, incorporating a total of 22,502 subjects. There has been a substantial impact on health service provision, particularly in outpatient departments (OPD) (n=19) and elective services (n=16), while emergency services continued at sub-optimal levels (n=20). Various adaptations and changes were implemented in precautionary measures, protocols, staff allocation and training, usage of personal protective equipment (PPE), preoperative, operative, and postoperative measures, as well as physical infrastructure and resources. Depression and stress (n=14), fear of contracting the infection (n=6), stigmatisation (n=5), and financial repercussions (n=5) significantly affected the mental health of healthcare providers, and healthcare seekers also faced significant challenges (n=11). Conclusion: The study reveals COVID-19's substantial impact on health services. The healthcare system responded by quickly adjusting staff management, resource allocation, and infection prevention measures. The study also highlights the mental health challenges faced by healthcare providers and the concerns of healthcare seekers regarding delays and suboptimal care. Looking ahead, the findings underscore the importance of preparedness for future pandemics, including improved healthcare infrastructure, resource optimisation, and comprehensive protocols. Lessons learned from COVID-19 should inform strategies to mitigate disruptions and ensure the well-being of healthcare providers and seekers in future outbreaks.

Hydroponic farming systems play an increasingly important role in the sustainable production of nutrient-rich foods. The contamination of surfaces in hydroponic fresh produce production poses risks to the food safety of crops, potentially endangering public health and causing economic losses in the industry. While sanitizers are widely used in commercial hydroponic farms, their effectiveness against human pathogens on surfaces, and their impact on plant health and quality are not known. In this study, we evaluated the efficacy of chemical sanitizers in eliminating Salmonella Typhimurium from inanimate surfaces in commercial hydroponic Nutrient Film Technique (NFT) systems. Further, we assessed the impact of sanitizers on the yield, quality, and nutritional value of lettuce and basil. Sanitizers (Virkon, LanXess; Sanitate 12.0, Bi-oSafe Systems; Kleen Grow, Pace Chemical Ltd.; Green Shield, United Labs Inc.; Zerotol, BioSafe Systems; Bleach, Pure Bright), were tested against Salmonella Typhimurium inoculated on NFT surfaces (nutrient reservoirs, growing channels, top covers, drain lines). The effective treatments were then tested for their impact on lettuce and basil in a split-plot experiment conducted in commercial NFT units. Crop yield, color, and nutrient content were measured throughout the crop life cycle. While all quaternary ammonium compounds (QAC), SaniDate 12.0 (200ppm), Zorotol (5%), and Virkon (1%) eliminated Salmonella Typhimurium from commercial NFT surfaces, chlorine-based sanitizer treatments were statistically similar to water treatments on most surfaces. All chemical sanitizers impacted the yield, color, and nutritional value of lettuce and basil. SaniDate 12.0 (200ppm) was the least detrimental to crops and was identified as a potential candidate for further validation in commercial hydroponic settings. The findings of this study will be translated into recommendations for the industry and will contribute to the development of future food safety guidelines and policies.

Type 1 diabetes (T1D) has shown an increase in the incidence rate of about 3% per year over the last two decades. Continuous Insulin Subcutaneous Therapy (CSII) is widely used in the paediatric population with diabetes; however, it requires more preparation by the treating team and careful selection of potential users. Prescriptive provisions vary from Region to Region and the perspective of health workers still remains an unexplored area. The aim of the research project is to explore the representations of a group of diabetologists and psychologists working in pediatric diabetology on the national territory, regarding roles, functions and activities as part of a multidisciplinary team; their views on the potential benefits of CSII and the types of individuals applying for the use of technology. A socio-anagraphic data sheet was administered and two homogeneous focus groups were conducted by profession; they were audio recorded. The transcripts produced were analysed using the Emotional Text Mining (ETM) methodology. Each of the two corpus generated three clusters and two factors: for diabetologists, a focus on the patient in different levels of care emerged, collaborating both with other health professionals and with the territory, through the proposal of an intervention where the medical aspect is often represented by technology; also for psychologists there was a representation of interdisciplinary networking, with a greater focus on the processes inherent the management of pathology, from acceptance to the elaboration and integration of diabetes in the family narrative. The understanding of the representations of health professionals working in pediatric diabetes about new technologies can contribute to the consolidation of a network of professionals through a targeted work on possible critical issues emerged.

International migrants comprised 14% of the UK population in 2020, but migrant health in the UK has rarely been studied at a population level using primary care electronic health records (EHRs). Given the difficulty of determining migration status using EHRs, this study developed a migration phenotype and assessed its validity. We developed a phenotyping algorithm using codes for country of birth, visa status, non-English main/first language and non-UK origin. It was applied to a Clinical Practice Research Datalink (CPRD) GOLD database of 16,071,111 primary care patients between 1997 and 2018. We compared the completeness and representativeness of the identified migrant population to Office for National Statistics (ONS) country of birth and 2011 census data by year, age, sex, geographic region of birth and ethnicity. Between 1997-2018, 403,768 migrants (2.51% of the CPRD GOLD population) were identified using the phenotype. 178,749 (1.11%) of these migrants were identified by codes indicating foreign country of birth or visa status, 216,731 (1.35%) a non-English main/first language, and 8,288 (0.05%) non-UK origin. The cohort was similarly distributed compared to ONS migration statistics in terms of sex and region of birth. Recording of migration improved from identifying approximately one-tenth of the expected proportion of migrants according to the ONS in 2004 to a quarter in 2018. Younger migrants were better represented than those aged 50 and over. The migration phenotype identified a large number of migrants and can be used to undertake large-scale migration health research in CPRD GOLD to inform healthcare policy, practice and action. While the cohort was representative of the UK migrant population in terms of sex and region of birth, migration status was under-recorded in earlier years and older ages, and future studies for these groups should therefore be interpreted with caution.

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising chemotherapeutic agent because of its selective apoptotic action on cancer cells. However, resistance to TRAIL-induced apoptosis remains a challenge in many cancers. The gintonin-enriched Panax ginseng extract fraction (GEF) has diverse pharmacological benefits. We explored the combined efficacy of GEF and TRAIL in inducing apoptosis in human renal cell carcinoma (RCC) cells. The effect of GEF treatment on viability, clonogenic potential, wound healing, and TRAIL-induced apoptotic signaling of RCC cells was studied in vitro. Our investigation revealed that GEF pre-treatment sensitized RCC cells to TRAIL-induced apoptosis, as evidenced by DNA fragmentation and cell proliferation, colony formation, and migration inhibition. This sensitization was linked to the upregulation of death receptors 4 and 5 and alterations in apoptotic protein expression; notably, decreased expression of Mu-2-related death-inducing gene, a novel anti-apoptotic protein. Our findings underscore the necessity of caspase activation for GEF/TRAIL-induced apoptosis using the pan-caspase inhibitor Z-VAD-FMK. It demonstrates that GEF sensitizes human RCC cells to TRAIL-induced apoptosis by upregulating DR4/5 and modulating apoptotic protein expression. These findings suggest a promising strategy for overcoming TRAIL resistance in cancer therapy and highlight the potential of GEF as a valuable adjunct to TRAIL-based treatments.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

The assessment of the prevalence of Subclinical Mastitis (SCM) in dairy farms is essential to validate the health status of the mammary gland. The aim of the study was to assess the prevalence of SCM in dual purpose livestock systems in Arauca, Colombian Orinoquia, through the analysis of the values found by the field diagnostic tests California Mastitis Test (CMT) and Electric Conductivity (EC). Milk samples were taken from the individual mammary quarters of 481 cows. The general prevalence, per affected room and the total number of rooms was determined according to the values obtained for each test using two methods of analysis. An ANOVA was performed to determine the difference between prevalence’s, a correlation analysis, and an analysis of sensitivity and specificity. The general prevalence was similar between the tests (CMT = 31.4%; EC = 29.7%) (p > 0.05). The prevalence of the total quarters was lower with EC (11.3% vs 14.2%) (p < 0.05). The correlations between tests were significant, but with low values (rs = 0.20-0.25). CMT and EC test concordance showed a sensitivity between 0.35-0.45 and a specificity of 0.75-0.90. The two tests showed positive results in detecting the same animals with or without the presence of the infection, although some animals that were positive for one test were not positive for the other test. The test EC classified animals and their quarters as SCM positive or negative in a more similar way to that obtained with CMT. The two diagnostic tests showed a general low prevalence of SCM in the livestock systems evaluated.

Despite the extensive literature on missing data theory and cautionary articles emphasizing the importance of realistic analysis for healthcare data, a critical gap persists in incorporating domain knowledge into missing data problem formulation, assumption specification, and method development. In this paper, we highlight the gap particularly for observational data from healthcare facilities. We address this gap by identifying ten fundamental missingness scenarios arising during data measurement, recording, and pre-processing in observational health data, influenced by physicians, patients, healthcare facilities, and data scientists. We analyze the effect of scenarios on estimand formulation, missing data identification, estimation, and sensitivity analysis. To emphasize how domain-informed analysis can improve method reliability, we conduct simulation studies under the influence of various missingness scenarios. We compare the results of three common methods in medical data analysis (complete-case analysis, Missforest imputation, and inverse probability weighting estimation) for two estimands (variable mean estimation and classification accuracy). We advocate for our analysis approach as a reference for the analysis of observational health data. Furthermore, we posit that the proposed analysis framework is applicable to other medical domains, including medical wearable data analysis.

The Portuguese health system has a universal, public, general National Health Service (NHS), tending towards free healthcare access. Created in 1979, this delivery model developed from the integration and complementarity between the different response levels (primary, hospital, continuing, and palliative care). However, over these 40 years, the initially centralized system underwent a decentralization process with the creation of Regional Health Administrations in the five mainland administrative regions. Since then, the entire NHS has settled around this new organization. The most recent step started in 2018 with decentralizing primary health care skills to 190 municipalities. This paper presents the various critical issues involved in the latest gradual decentralization process in health, intending to bring services closer to the citizens, and more focused on their needs. The article identifies and discusses the implications of this experience based on the steps foreseen in the already published legal texts.

Although health policy resides mainly with the government, industry can play an important role in building a health ecosystem. From March to May, we administered questionnaires to 1,200 individuals from the general Korean population asking about their perception of health-friendly labels, and if they would purchase such labeled products (foods, pharmaceuticals, etc.) and services (purifying water, preventing air pollution, etc.) at extra cost. The participants placed a high value on the importance of mental, social, spiritual, and physical health factors in terms of company’s products and services with a score of about 8 out of 10 (range, 7.74-8.33). Most respondents (72.4%) said they were interested in adopting health-friendly labels. When a health-friendly label is introduced (such as one by the Business for Social Responsiveness), 65.1% of the respondents said they intended to purchase the product or service, while 6.8% said they did not, and 75.0% said they were willing to pay extra for the health-friendly product or service. Multivariate logistic regression models showed urban residence, high education level, and good social health to be significantly associated with positive attitudes toward health-friendly labels. People with high income, no religion, or normal weight were more likely to say they intend to purchase products and services with health-friendly labels. They also had a more positive attitude toward paying more for such products and services, as did people with good spiritual health. This study provides data that illustrate the importance of health-friendly products and services to the general population and companies.

Objective: To explore the effect of rural-urban residence on self-reported health status with UK cancer survivors. Design: A cross-sectional postal questionnaire that collected data on demographics, post-code and self-reported health status. Methods: Independent Samples t test was used to detect differences in health status between rural and urban respondents. Pearson’s χ2 was used to control for confounding variables and multivariate analysis was conducted using Stepwise linear regression. Setting: East Midlands of England. Participants: Adult cancer survivors who had undergone primary treatment in the last five years. Participants were excluded if they had recurrence or metastatic spread, started active oncology treatment in the last twelve months and were in receipt of palliative or end of life care. Main Outcome: Residence was measured using the UK ONS RUC2011 Rural-Urban Classifications and Health Status via the UK ONS self-reported health status measure. Results: 227 respondents returned a questionnaire. Forty-five per cent (N=103) were resident in a rural area and fifty-three per cent (N=120) in an urban area. Rural (4.11±0.85) respondents had significantly (p<0.001) higher self-reported health status compared to urban (3.65±0.93) respondents (MD 0.47; 95% CI 0.23, 0.70). Conclusion: Rural respondents had significantly higher self-reported health status compared to their urban counterparts. It is hoped that the results will stimulate further work in this area and that researchers will be encouraged to collect data on rural-urban residency where appropriate.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Introduction: Bovine tuberculosis is a zoonotic disease of considerable impact, especially in livestock countries, which can cause human disease. Despite its importance, Colombia is a country in which few studies analyse its behaviour, and none develop maps using geographic information systems to characterise it. Objective: To describe the temporal-spatial distribution of bovine tuberculosis in Colombia between 2001 and 2019. Methods: Retrospective cross-sectional descriptive study, based on reports by the Colombian Agricultural Institute, of tuberculosis surveillance in cattle on farms in Colombia from 2001 to 2019. The data were converted into databases in Microsoft Access 365®, and multiple epidemiological maps were generated with the Kosmo RC1®3.0 software coupled to shape files of all the country's departments. Results: During the study period, 5,273 tuberculosis cases in bovines were identified in the different departments of Colombia (mean 278 cases/year). Regarding its temporal distribution, the number of cases varied from a maximum of 903 cases (17.12% of the total) in 2015 to a minimum of 0 between 2001 and 2004 and between 2017 and 2019 (between 2005 and 2016, the minimum was 46 cases, 0.87%). Conclusions: GIS is an essential tool for understanding the temporospatial behaviour of zoonotic diseases in Colombia, as is the case of bovine tuberculosis, with its potential implications for Human and One Health.

In the following article, it is presented an investigation of the determinants of Beds for High-Care Specialties-BHCS in the Italian regions in the context of Environmental, Social and Governance-ESG approach. Data from ISTAT-BES for 20 countries in the period 2004-2021 are been used. Different econometric techniques have been applied i.e.: Pooled Ordinary Least Squares, Panel Data with Fixed Effects, Panel Data with Random Effects, Dynamic Panel at 1 stage. Furthermore, a cluster analysis performed with a k-Means algorithm optimized with the Silhouette Coefficient indicated the presence of three clusters. Finally, eight different machine-learning algorithms are analysed to predict the future value of BHCS. The results show that the Artificial Neural Network-ANN algorithm is the best algorithm. The future value of BHSC is expected to growth on average of 4.88% for the analysed regions.

Along with environmental pollutions, urban planning has been connected to public health. The research indicates that the quality of built environments plays an important role in reducing mental disorders and overall health. The structure and shape of the city are considered as one of the factors influencing happiness and health in urban communities and the type of the daily activities of citizens. The aim of this study was to promote physical activity in the main structure of the city via urban design in a way that the main form and morphology of the city can encourage citizens to move around and have physical activity within the city. Functional, physical, cultural-social, and perceptual-visual features are regarded as the most important and effective criteria in increasing physical activities in urban spaces based on literature review. The environmental quality of urban spaces and their role in the physical activities of citizens in urban spaces were assessed by using the questionnaire tool and analytical network process (ANP) of structural equation modeling. Further, the space syntax method was utilized to evaluate the role of the spatial integration of urban spaces on improving physical activities. Based on the results, the consideration of functional diversity, spatial flexibility and integration, security, and the aesthetic and visual quality of urban spaces plays an important role in improving the physical health of citizens in urban spaces. Further, more physical activities, including motivation for walking and consequently, the sense of public health and happiness, were observed in the streets having higher linkage and space syntax indexes with their surrounding texture.

The investment in digital e-Health services is a priority direction in the development of global health care systems. While people are increasingly using the Web for health information, it is not entirely clear what is the physicians’ attitude towards digital transformation, and the acceptance of new technologies in healthcare. The aim of this cross-sectional survey study was to investigate physicians’ self-digital skills, and their opinions on obtaining online health knowledge by patients, as well as the recognition of physicians’ attitudes towards e-Health solutions. Principal Component Analysis (PCA) was performed to emerge the variables from self-designed questionnaire, and cross-sectional analysis comparing descriptive statistics and correlations for dependent variables using the one-way ANOVA (F-test). 307 physicians participated in the study, reported using the internet mainly several times a day (66.8%). Most participants (70.4%) were familiar with new technologies and rate their e-Health literacy high, although 84.0% reported the need for additional training in this field, and reported a need to introduce a larger number of subjects shaping digital skills (75.9%) in medical studies 53.4% of physicians perceived Internet-sourced information as sometimes reliable, and in general assessed the effects of using it by their patients negatively (41.7%). Digital skills increased significantly with frequency of internet use (F = 13.167; p = 0.0001), and decreased with physicians’ age, and the need for training. Those who claimed that patients often experienced health benefits from online health showed higher digital skills (-1.06). Physicians most often recommended their patients to obtain laboratory test results online (32.2%), and to arrange medical appointments via the Internet (27.0%). Along with the deterioration of physicians’ digital skills, the recommendation of e-Health solutions decreased (r = 0.413), and lower the assessment of e-Health solutions for the patient (r = 0.449). Physicians perceive digitization as a sign of the times, and frequently use its tools in daily practice. The evaluation of Dr. Google’s phenomenon and online health is directly related to their own e-Health literacy skills, but there is still a need for practical training to deal with digital revolution.

Background: It is very important that nurses receive adequate training in Sexual and Reproductive Health (SRH). In this study, the contents of the SRH subject in the undergraduate nursing curricula of 77 Spanish universities were examined in order to determine what SRH training nursing students are receiving. Methods: The contents of the SRH subject of all the curricula that were available online were reviewed. The distribution of the contents (topics) in the two areas (reproductive health and sexual health) was analyzed, and the prevalence of each topic was established. It was also determined whether there were differences in topics between public (n=52) and private universities (n=25). Results: The training of nursing students focuses mainly on the area of Reproductive Health (15 topics). Most of the topics of this area had a prevalence greater than 50%. Although the area of Sexual Health had 14 topics, most of these topics had a low prevalence (&lt;20%), especially in private universities. Conclusions: It was found that there is considerable variation in the distribution and prevalence of SRH topics between universities. The contents of the area of Reproductive Health are usually prevalent in most of the curricula, however the contents of the area of Sexual Health are very limited in most of the universities. An organizational effort is required to determine and standardize the contents of SRH that nursing students should receive in Spain to avoid inequalities in their training.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

Age-related macular degeneration (AMD) is a common ocular disease characterized by the de-generation of the central area of the retina in elderly population. Progression and response to treatment is influenced by genetic and non-genetic factors. Proteomics is a powerful tool to study, at the molecular level, the mechanisms underlaying the progression of the diseases, to identify new therapeutical targets and to establish biomarkers to monitor progression and treatment ef-fectiveness. In this work we pursue to systematically review the use of proteomic-based ap-proaches for the study of the molecular mechanisms underlying the development of AMD, as well as the progression of the disease and the on-treatment patient monitoring. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) reporting guidelines were followed. Proteomic approaches have identified key players on the onset of the disease, such as proteins involved in lipid metabolism and oxidative stress, but also in the progression to advanced stages, including factors related to extracellular matrix integrity and angiogenesis. Although an-ti-vascular endothelial growth factor (anti-VEGF)-based therapy has been crucial in the treatment of neovascular AMD it is necessary to get deeper into the underlying disease mechanisms to move forward to next-generation therapies of the later-stage forms of this multifactorial disease.

Music and language are hypothesized to share neural resources, particularly at the level of syntax processing. Recent reports suggest that attention modulates this sharing of neural resources, but the time-course of the effects of attention, and the degree to which attention operates similarly on music and language, are yet unclear. In this EEG study we manipulate the syntactic structure of simultaneously presented musical chord progressions and garden-path sentences in a modified rapid serial visual presentation paradigm, while varying top-down attentional demands to the two modalities. The Early Right Anterior Negativity (ERAN) was observed in response to both attended and unattended musical syntax violations. In contrast, an N400 was only observed in response to attended linguistic syntax violations, and a P3 only in response to attended musical syntax violations. Results show that top-down allocation of attention indeed affects the processing of syntax in both music and language, with different neural resources acting upon the two modalities particularly at later stages of cognitive processing. However, the processing of musical syntax at an earlier stage of the perceptual-cognitive pathway, as indexed by the ERAN, is partially automatic, and is strongly indicative of separate neural resources for music and language.

The following article presents an analysis of the impact of the Environmental, Social and Governance-ESG determinants on Hospital Emigration to Another Region-HEAR in the Italian regions in the period 2004-2021. The data are analysed using Panel Data with Random Effects, Panel Data with Fixed Effects, Pooled Ordinary Least Squares-OLS, Weighted Least Squares-WLS, and Dynamic Panel at 1 Stage. Results show that HEAR is negatively associated to E, positively to S and negatively associated to the G within the ESG model. The data were subjected to clustering with a k-Means algorithm optimized with the Silhouette coefficient. The optimal clustering with k=2 is compared to the sub-optimal cluster with k=3. The results suggest a negative relationship between the resident population and hospital emigration at regional level. Finally, a prediction is proposed with machine learning algorithms classified based on statistical performance. The results show that the Artificial Neural Network-ANN algorithm is the best predictor. The ANN predictions are critically analyzed in light of health economic policy directions.

Health literacy describes skills and competencies that enable people to gain access to, understand and apply health information to positively influence their own health and the health of those in the social environment. In an increasingly media saturated and digitized world, these skill sets are necessary for accessing and navigating sources of health information and tools, such as television, the Internet, and mobile apps. The concepts of Media Health Literacy (MHL) and eHealth Literacy (eHL) describe the specific competencies such tasks require. This article introduces the two concepts, and then reviews findings on the associations of MHL and eHL with several contextual variables in the social environment such as socio-demographics, social support, and system complexity, as a structural variable. As eHL and MHL are crucial for empowering people to actively engage in their own health, a growing body of literature reports of the potential and the effectiveness of intervention initiatives to positively influence these competencies. From an ethical standpoint, equity is emphasized, stressing the importance of accessible media environments for all - including those at risk of exclusion from (digital) media sources. Alignment of micro and macro contextual spheres will ultimately facilitate both non-digital and digital media to effectively support and promote public health.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

A U.S. government health agency conducted epidemiological studies to evaluate whether exposures to drinking water contaminated with volatile organic compounds at U.S. Marine Corps Base Camp Lejeune, North Carolina, were associated with increased health risks to children and adults. These health studies required knowledge of contaminant concentrations in drinking water—at monthly intervals—delivered to family housing, barracks, and other facilities within the study area. Because concentration data were limited or unavailable during much of the period of contamination (1950s–1985), the historical reconstruction process was used to quantify estimates of monthly mean contaminant-specific concentrations. This paper integrates many efforts, reports, and papers into a synthesis of the overall approach to, and results from, a drinking-water historical reconstruction study. Results show that at the Tarawa Terrace water treatment plant (WTP) reconstructed (simulated) tetrachloroethylene (PCE) concentrations reached a maximum monthly average value of 183 micrograms per liter (ug/L) compared to a one-time maximum measured value of 215 ug/L and exceeded the U.S. Environmental Protection Agency’s current maximum contaminant level (MCL) of 5 ug/L during the period November 1957–February 1987. At the Hadnot Point WTP, reconstructed trichloroethylene (TCE) concentrations reached a maximum monthly average value of 783 ug/L compared to a one-time maximum measured value of 1,400 ug/L during the period August 1953–December 1984. The Hadnot Point WTP also provided contaminated drinking water to the Holcomb Boulevard housing area continuously prior to June 1972, when the Holcomb Boulevard WTP came on line (maximum reconstructed TCE concentration of 32 ug/L) and intermittently during the period June 1972–February 1985 (maximum reconstructed TCE concentration of 66 ug/L). Applying the historical reconstruction process to quantify contaminant-specific monthly drinking-water concentrations is advantageous for epidemiological studies when compared to using the classical exposed versus unexposed approach.

Supporting the implementation of school food and nutrition policies (SFNPs) is an international priority to encourage healthier eating among children and youth. Schools are an important intervention setting to promote childhood nutrition, and many jurisdictions have adopted policies, guidelines, and programs to modify the school nutrition environment and promote healthier eating. The purpose of this study was to explore the association between perceived adequacy and capacity for SFNP implementation on food availability and policy adherence in the province of Nova Scotia (NS), Canada, one of the first regions in Canada to launch a comprehensive SFNP. A cross sectional online survey was conducted in 2014-15 to provide a current-state of policy implementation and adherence. Adequacy and capacity for food policy implementation was used to assess policy adherence through the availability of prohibited ‘minimum’ nutrition foods. An exploratory factor analysis was conducted on a selected of available foods and ‘slow’ and ‘quick’ service food composition measures were dichotomized for food availability. Schools with above perceived average adequacy and capacity for policy implementation had more than three times (3.62) greater odds of adhering to a lunch policy, while schools that adhered to a snack and lunch policy had 52% and 82% lower odds of serving quick service foods, respectively. This study identified the need for appropriate adequacy and capacity for policy implementation to ensure policy adherence and improve the school food environment. These findings highlight the potential of SFNPs to have a positive impact on childhood nutrition, but adequately supporting their implementation is critical to ensure their impact.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

This review focuses on the emerging evidence for the association between estimated cardiorespiratory fitness (eCRF) and metabolic risk factors. Given the challenges associated with directly measuring cardiorespiratory fitness (CRF) in large populations, eCRF presents a practical alternative for predicting metabolic health risks. A literature search identified six relevant cohort studies from 2021 to 2024 that investigated the association of eCRF with hypertension, hyperglycemia, dyslipidemia, and obesity. The review findings highlight a consistent inverse relationship between higher eCRF and lower incidence of metabolic risks in line with CRF cohort studies. This review highlights the importance of low eCRF as a primordial indicator for metabolic risks and underscores the need for broader application. Future research directions should include exploring eCRF's predictive accuracy across diverse populations and health outcomes and testing its real-world applicability in healthcare and public health settings.

Health innovations are generally oriented on a techno-economic vision. In this perspective, technologies are seen as an end in themselves, and there is no arrangement between the technical and the social values of innovation. This vision prevails in sanitary crises, in which management is carried out based on the search for punctual, reactive, and technical solutions to remedy a specific problem without a systemic/holistic, sustainable, or proactive approach. This paper attempts to contribute to the literature on the epistemological orientation of innovations in the field of public health. Taking the Covid-19 and Ebola crises as examples, the primary objective is to show how innovation in health is oriented towards a techno-economic paradigm. Second, we propose a repositioning of public health innovation towards a social paradigm that will put more emphasis on the interaction between social and health dimensions in the perspective of social change.

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

This article addresses the socioeconomic gradient in immigrant health by exploring immigration status and social capital as key considerations in measurement and development of health-promoting research and practice. This paper also seeks to draw attention to the importance of understanding how researchers approach the study of health disparities affecting minoritized and immigrant populations. A critical examination of the measures used in comparative health research challenges scholars to consider the different pathways through which socio-economic factors impact health and underscores the ethical commitment of health disparities researchers to consider the relevance and implications of their work. Given the reliance on existing data from national population health surveys to test the assumptions of the immigrant paradox, any immigrant-specific measure of SES with limited application to a large, representative sample of immigrants would likely hold little appeal to both researchers and practitioners. Understanding the mechanisms through which socioeconomic status influences immigrant health can allow scholars to address the needs of immigrant populations and advocate more effectively for programs and policies that seek to advance the health of all people.

Semantic interoperability facilitates exchange and access of health data that is being documented in EHRs with various semantic features. In the EU, the regulation proposal of European health data space requires development of semantic interoperability. To achieve a fully integrated EHDS ecosystem leveraging the value of health data, stakeholders need to overcome challenges of implementing common standards and other semantic interoperability features. We aimed to research what scientific evidence is available on developing semantic interoperability. Our research questions focused specifically on key features and approaches for semantic interoperability and on possible benefits of these choices. For that purpose, we performed a systematic literature review by defining our study framework based on previous research. Our results consisted of 10 studies where data models, ontologies, terminologies, classifications, and standards were applied for building interoperability. Through increased access to interoperable patient information, a better quality and outcomes in care can be achieved. Better communication based on easily accessible data is facilitated between health professionals and between clinicians and the patients. When heading towards semantic harmonization as outlined in the EHDS proposal, more experiences and analyses are needed to assess how applicable the chosen solutions are for semantic interoperability of European health care data.

Aedes aegypti mosquitoes are primary vectors of dengue, yellow fever, chikungunya and Zika viruses. Ae. aegypti is highly anthropophilic and relies nearly exclusively on human blood meals and habitats for reproduction. Socioeconomic factors may influence the spread of Ae. aegypti due to its close relationship with humans. This paper describes and summarizes the published literature on how socioeconomic variables influence the distribution of Ae. aegypti mosquitoes in the mainland United States. A comprehensive search of PubMed/Medline, Scopus, Web of Science, and EBSCO Academic Search Complete through June 12, 2019 was used to retrieve all articles published in English on the association of socioeconomic factors and the distribution of Ae. aegypti mosquitoes. Additionally, a hand search of mosquito control association websites was conducted in an attempt to identify relevant grey literature. Articles were screened for eligibility using the process described in the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Initially, 3,493 articles were identified through the database searches and previously known literature. After checking for duplicates, 2,145 articles remained. 570 additional records were identified through the grey literature search for a total of 2,715 articles. These articles were screened for eligibility using their titles and abstracts, and 2,677 articles were excluded for not meeting the eligibility criteria. Finally, the full text for each of the remaining articles (n = 38) was read to determine eligibility. Through this screening process, 11 articles were identified for inclusion in this review. The findings for these 11 studies revealed inconsistent relationships between the studied socioeconomic factors and the distribution and abundance of Ae. aegypti. The findings of this review suggest a gap in the literature and understanding of the influence of anthropogenic factors on the distribution of Ae. aegypti that could hinder efforts to implement effective public health prevention and control strategies should a disease outbreak occur.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Individuals with low health literacy (HL) are known to have poorer health outcomes and to have higher mortality rates compared to individuals with higher HL: hence, the improvement of HL is a key outcome in modern healthcare systems. Healthcare providers are therefore asked to support patients’ literacy skills by encouraging the implementation of autonomy-supportive patient centered communication (PCC), which in turn requires the enhancement of patient engagement. Our main hypothesis is that the well-known relationship between autonomy-supportive PCC and HL is mediated by patient engagement which is known to play a role in HL promotion and that is related to PCC as well. The purpose of this study was to formulate a hypothetical structural equation model (SEM) linking PCC to patient engagement and HL. A cross-sectional survey design was employed involving 1007 Italian chronic patients. The hypothetical model was tested using SEM to verify the hypothesized mediation of patient engagement between PCC and HL. Results show that the theoretical model has a good fit indexes and that patient engagement fully mediates the relationship between PCC and HL. This finding suggests healthcare systems to implement a new paradigm where patients are supported to play an autonomous role in their own healthcare.

Background: Internal migrants had obstacles in accessing local public health services in China. This study aimed to estimate the utilization of local public health services and its determinants among internal migrants. Methods: Data were from the 2014 and 2015 nationally representative cross-sectional survey of internal migrants in China. Multivariate logistic regressions were used to estimate the relationship between socioeconomic, migration, demographic characteristics and public health services utilization. Results: Internal migrants in more developed eastern regions used less public health services. Those with higher socioeconomic status were more likely to use public health services. The broader and shorter they migrated, the less they used public health services. Compared to migration within the city, migration across provinces is negatively associated with health records (OR=0.88, 95% CI: 0.86-0.90), health education (OR=0.97, 95% CI: 0.94-1.00), and health education on NCDs (OR=0.92, 95% CI: 0.89-0.95) or through Internet channel (OR=0.96, 95% CI: 0.94-0.99). Conclusion: Public health services coverage for internal migrants has seen great improvement due to government subsides. Internal migrants with lower socioeconomic status and across provinces need to be targeted. More attention should be given to the local government in the developed eastern regions in order to narrow the regional gaps.

Background: The COVID-19 pandemic has sped up digital health transformation across the health sectors to enable innovative health service delivery. Such transformation relies on competent managers with the capacity to lead and manage. However, the health system has not adopted a holistic approach in addressing the health management workforce development needs, with many hurdles to overcome. The objectives of this paper are to present the findings of a three-step approach in understanding the current hurdles in developing a health management workforce that can enable and maximise the benefits of digital health transformation, and to explore ways of overcoming such hurdles. Methods: A three-step, systematic approach was undertaken, including an Australian digital health policy documentary analysis, an Australian health service management postgraduate program analysis, and a scoping review of international literatures. Results: The main findings will guide the formulation of strategies in developing a digitally enabled health management workforce in the digital health era. Conclusions: With the ever-changing landscape of digital health, being able to lead and manage in times of system transformation requires a holistic approach to develop the necessary health management workforce capabilities and system-wide capacity. The evidence would support that this can be achieved with the required system, policy, educational and professional organizational enablers, which drive a digital health focused approach across all the healthcare sectors, in a coordinated and contextual manner.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Positive Health (PH) has been described as a promising transformative innovation to address the challenges of promoting well-being and reducing the burden of disease. The aim of this study is to review the current state of knowledge about PH as introduced by Huber et al. (2016) within the available scientific literature. A rapid review of the literature following the Cochrane Rapid Review recommendations. Three databases were searched (PubMed, Google Scholar, and CINAHL). Data were extracted and synthesized using a narrative approach. A total of 55 articles were included. Initial evaluation studies reveal promising results both at individual and collective levels. However, a need is expressed in several articles for further refinement of the conceptualization of PH and ways to make the effects of the PH approach more measurable. Professionals also expressed a desire for a more informed application and elaboration of the PH method across various settings and populations to enhance its effectiveness in practice. This rapid review highlights the transformative potential of PH in shifting from a disease-focused to a health-oriented paradigm of healthcare. It underscores the need for continued research regarding further development of the concept and its practical method, along with the necessity for methodological innovation.

Previous research suggests that the economic crisis can affect mental health. The purpose of this study was to analyse the association of risk of poor mental health with various socioeconomic, demographic, health, quality of life and social support variables; and to evaluate the contribution of socioeconomic variables most affected by the beginning of the economic crisis (employment situation and income) on the changes in the prevalence of the risk of poor mental health between 2005 and 2010. A study of prevalence evolution in adult population residents of the Valencian Community in the Spanish Mediterranean was conducted. We studied 5781 subjects in 2005 and 3479 in 2010. Logistic regression models have been adjusted to analyse the association between variables. A standardization procedure was carried out to evaluate which part of the changes in overall prevalence could be attributed to variations in the population structure by age, sex, employment status and income between the years under study. The prevalence of GHQ + increased from 2005 to 2010, in both men and women. Several variables were closely associated with the risk of poor mental health (sex, age, country of birth, number of non-mental chronic diseases, social support, disability, cohabitation in couple, employment status, and income). The changes produced as a result of the onset of the economic crisis in income and unemployment (increase in low income and in unemployment rates) contributed to the increase of poor mental health risk. This could confirm the sensitivity of mental health to the economic deterioration caused by the crisis.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

COVID-19 is a potentially fatal viral infection. This study investigates geography, demography, socioeconomics, health conditions, hospital characteristics, and politics as potential explanatory variables for death rates at the state and county levels. Data from the Centers for Disease Control and Prevention, the Census Bureau, Centers for Medicare and Medicaid, Definitive Healthcare, and USAfacts.org were used to evaluate regression models. Yearly pneumonia and flu death rates (state level, 2014-2018) were evaluated as a function of the governors’ political party using repeated measures analysis. At the state and county level, spatial regression models were evaluated. At the county level, we discovered a statistically significant model that included geography, population density, racial and ethnic status, three health status variables along with a political factor. State level analysis identified health status, minority status, and the interaction between governors’ parties and health status as important variables. The political factor, however, did not appear in a subsequent analysis of 2014-2018 pneumonia and flu death rates. The pathogenesis of COVID-19 has greater and disproportionate effect within racial and ethnic minority groups, and the political influence on the reporting of COVID-19 mortality was statistically relevant at the county level and as an interaction term only at the state level.

Background/Objectives: The purpose of this study was to evaluate the relationship between 1-year mortality and health insurance benefit extension policy items in severe pneumonia pa-tients requiring mechanical ventilation using a South Korean nationwide cohort. Methods: A nationwide population-based retrospective study was conducted using the Korean National Health Insurance database. A total of 1,099 patients (542 patients in the health insurance benefit item group and 557 patients in the control group) were included. The primary outcome was 1-year mortality. Results: Among patients with health insurance benefit extension policy items, 203 patients (37.5%) were diagnosed with hemato-oncological disease, who were categorized as group A, and 339 patients (62.5%) were diagnosed with cerebrovascular, cardiovascular, or rare diseases, who were categorized as group B. Group B had lower 1-year mortality (50.7% vs. 62.5%, P

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Concerning the hippocampal mechanisms that simultaneously function to map environmental position and to generate episodic memories, a developing consensus emerged by the early 21st century. The hippocampus was recognized as embodying the primary location of personal narrative development, with the ability to create stable and coherent narrative largely representing the mental health of individuals. Determining recent advances regarding the relationship among the hippocampus, narrative, and mental health, a limited, six-database review was conducted for peer reviewed articles published since 2019. Of the 127 records located, 14 reports were included for study. The results support the necessity of creating and maintaining a stable and coherent narrative as fundamental to human mental health such that facts will be distorted in personal accounts, sleep will be disrupted, and DNA altered to retain one’s personal narratives. With narrative development fundamental to human mental health, a goal of interventions concerning hippocampal function and positive health outcomes is enhancing personal narratives in providing individuals with the ability to construct and recall those that are robust and effective. One such intervention that has proven successful in this regard, the Health Narratives Research Process, is outlined with its most recent results presented, offering opportunity for further such research.

Climate change related increases in frequency and intensity of heatwaves affect viticulture, leading to losses in yield and grape quality. We assessed whether canopy architecture manipulation mitigates the effects of summer stress in a Mediterranean vineyard. Muscat of Alexandria grapevines were monitored during 2019-2020. Two canopy shoot positioning treatments were applied: Vertical shoot positioning (VSP); and Modulated shoot positioning (MSP), the west side upper foliage released to promote partial shoot leaning, shading the clusters. Clusters were sampled at pea size (PS), veraison (VER) and full maturation (FM). Measurements included rachis anatomy and hydraulic conductance, and aquaporins (AQP) and stress-related genes expression in cluster tissues. Results show significant seasonal and interannual differences in Kh and vascular anatomy. At VER, Krachis , Krachis+pedicels, and xylem diameter decreased but were unaffected by treatments. The Phloem/Xylem ratio was either increased (2019) or reduced (2020) in MSP, compared to VSP. Most AQP were down-regulated at FM in pedicels, and up-regulated at VER in pulp. A potential maturation shift in MSP was observed, confirmed by the up-regulation of several stress-related genes in all tissues. The study pinpoints the role of canopy architecture in berry water relations and stress response during ripening.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

The current state-of-the-art does not provide a universal and rapid method of determining the state of health (SOH) of a battery or a supercapacitor without carefully examining the degradation of hundreds of full charge/discharge cycles. Lithium-ion batteries, sodium-ion batteries and supercapacitors of different cell chemistries were studied by impedance spectroscopy during lifetime tests. Faradaic and capacitive charge storage are distinguished by the relationships between stored electric charge and capacitance. For batteries, impedance spectroscopy is best applicable in the flat region of the voltage-charge curve. An approximately linear correlation between pseudocapacitance and Ah capacity is observed as long as overcharge and deep discharge are avoided. The correct calculation of quantities related to complex impedance and differential capacitance is outlined – which may also be useful as an introductory text and tutorial for newcomers to the field. Novel diagram types are proposed for the purpose of instant performance and failure diagnosis of batteries and supercapacitors.

Background: The potential of Artificial intelligent (AI) models to process and interpret large health datasets at scale could revolutionize public health and epidemiology, providing a foundation for public health. Ethics has been recognized as a priority concern in the development and deployment of AI. Because AI technology can jeopardize patient safety, privacy, and posing a new set of ethical problems that must be addressed. Objectives: We aim to provide a holistic view on what are the different ethical and legal principles that was addressed in the included studies regarding the use of AI in public health and what are the ethical challenges that can arise.Methods: Following PRISMA guideline, five bibliographic databases were used in our search: PubMed, Scopus, JSTOR, IEEE Xplore, and Google Scholar from 2015 to February 2022. Four reviewers carried out study selection and data extraction, and the data extracted was synthesized by a narrative approach. Results: This review included 23 unique publications out of a total of 1123 items that were initially identified. Different ethical principles regarding the uses of AI in public health and community health were identified and discussed distinctly in the current review. The common ethical and legal themes that this review focused on are equity, bias, privacy and security, safety, transparency, confidentiality, accountability, social justice, and autonomy. In addition, five ethical challenges were mentioned. Conclusion: Research regarding ethical and legal principles and challenges about using AI in public health specifically consider a new filed, because all previous themes are concerning the physical and patients’ area where it focuses only on the clinical settings.

The present short communication aimed to determine the effects of vegetable cultivation on health. We conducted a qualitative study using responses to an open-ended question that was part of a survey on regional differences on vegetable intake. Participants in this study were residents of Gunma Prefecture, Japan, and were aged between 20–74 years. In the questionnaire, we asked: “Aside from increasing vegetable intake, how does vegetable cultivation affect your health?” We were able to categorize the answers into six subcategories related to physical health, mental health, and social well-being.

Background: Drinking and smoking have economic consequences and are the main risk factors of mortality and morbidity. Disease-specific deaths attributable to using substances present the primary health indicator in this study. This analysis focuses on mortality in productive age, 15 to 64 years since those deaths are considered the highest economic burden. Method: In the analytical part, data from the Registry of deaths of the Czech Republic for 1994 to 2017 were used. The number of deaths attributable to smoking and drinking was calculated using attributable fractions, based on literature review. This research aimed to reveal the gender differences in deaths attributable to drinking and smoking, according to age, and the differences in deaths regarding smoking or drinking. Results: The mortality attributable to smoking and drinking differs across age groups and genders. The highest median share of tobacco-related deaths is in the age group, 60—64 years. The highest median share of alcoholic deaths is in the age group of 50—54 years. Conclusions: There are significant differences between genders in both, smoking and drinking. A prevention program should be targeted to different age groups.

Interprofessional learning (IPL) is essential to prepare healthcare trainees as the future public health workforce. WHIRL was an innovative IPL intervention that engaged multi-professional teams of volunteer healthcare trainees (n=20) to deliver health checks (n=464), including tailored advice and signposting, to employees in the UK construction industry (across 21 events, 16 sites, 10 organisations) as part of an ongoing research programme called Test@Work. Volunteers undertook a four-part training and support package of trainer-led education, observations of practice, self-directed learning and clinical supervision, together with peer mentoring. In a one-group post-test only design, IPL outcomes were measured using the Inventory of Reflective Vignette - Interprofessional Learning (IRV-IPL), and the psychometric properties of the IRV-IPL tool were tested. WHIRL demonstrably improved healthcare trainees’ interprofessional skills in all five areas of collaboration, coordination, cooperation, communication, and commendation. The IRV-IPL tool was found to be a valid and reliable measure of interprofessional competencies across three scenarios; before and after health promotion activities, and as a predictor of future health promotion competence. This industry-based workplace IPL programme resulted in attainment of health check competencies, and bridged the gap between research, education and clinical practice.

Antimicrobial resistance (AMR) is an increasingly pressing threat to human, animal, and environmental health. Reducing the use of antibiotics in agriculture has been identified as a key way to curb the spread of AMR. However, the effect of such policies on AMR prevalence, and their broader impacts on agricultural, health, and economic outcomes at the population level have proven very difficult to estimate and compare. This paper draws on and formalises ideas presented at the JPIAMR New Perspectives on Bacterial Drug Resistance workshop in June of 2022. With reference to emerging literature on the topic, it proposes a quantitative framework for estimating the relevant causal relationships needed to quantify the cross-sectoral impacts of AMR policies in agriculture, and for comparing these outcomes in like terms in a way which can feed directly into policy decision-making, notably without prohibitive data requirements. The ability of researchers to apply frameworks such as this will be increasingly necessary in order to holistically capture the impacts of AMR policies and to situate them in the broader policy context; especially where the mechanisms of transmission are opaque or complex, where data availability is limited; and where policymakers must allocate scarce resources among many competing objectives.

In large-capacity energy storage systems, instructions are decomposed typically using an equalized power distribution strategy, where clusters/modules operate at the same power and durations. When dispatching shifts from stable single conditions to intricate coupled conditions, this distribution strategy inevitably results in increased inconsistency and hastened system aging. This paper presents a novel differentiated power distribution strategy comprising three control variables: the rotation status, the operating boundaries for both Depth of Discharge (DOD) and C-rates (C) within a control period. The proposed strategy integrates an aging cost prediction model developed to express the mapping relationship between these control variables and aging costs. Additionally, it incorporates the multi-colony particle swarm optimization (Mc-PSO) algorithm into the optimization model to minimize aging costs. The aging cost prediction model consists of three functions: predicting health features (HFs) based on the cumulative charge/discharge throughput quantity and operating boundaries, characterizing HFs as comprehensive scores, and calculating aging costs using both comprehensive scores and residual equipment value. Further, we elaborated on the engineering application process for the proposed control strategy. In the simulation scenarios, this strategy prolonged the service life by 14.62%, reduced the overall aging cost by 6.61%, and improved module consistency by 21.98%, compared with the traditional equalized distribution strategy. In summary, the proposed strategy proves effective in elongating service life, reducing overall aging costs, and increasing the benefit of energy storage systems in particular application scenarios.

Paramedics are increasingly being subjected to violence, creating the potential for significant physical and psychological harm. Where a patient has a history of violent behavior, hazard flags - applied either to the individual, their residential address, or phone number - can alert paramedics to the possibility of violence, potentially reducing the risk of injury. Leveraging a novel violence reporting process embedded in the electronic patient care record, we reviewed violence reports filed over a thirteen-month period since its inception in February 2021to assess the effectiveness of hazard flagging as a potential risk mitigation strategy. Upon reviewing a report, paramedic-supervisors can generate a hazard flag if recurrent violent behavior from the patient is anticipated. In all, 502 violence reports were filed, for which paramedic-supervisors generated hazard flags in 20% of cases (n=99). In general, cases were not flagged either because the incident occurred at a location not amenable to flagging, or because the supervisors felt that a hazard flag was not warranted based on the details in the report. Hazard flagging was associated with an increased risk of violence during subsequent paramedic attendance (Odds Ratio [OR] 6.21, p

(1) Background: With continuous globalization and modernization of people's lives, lifestyle has changed dramatically, with decreased physical activity and increased unhealthy eating patterns in many nations throughout the world. With the COVID-19 pandemic and changes taking place in people’s health and lifestyles around the world, the need for rehabilitation is expected to rise in the coming years.(2)Methods: This paper analyzes the integration model of sports and health care using theoretical analysis, literature reviews, logical reasoning, and other methods.(3)Results: The integration of sports and health care in China has entered the stage of practical implementation after many years of development, forming a few representative integration patterns. Governments, communities, community hospitals, hospitals, and third-party institutions are the main participants, with the community playing an important role in the integration. Pharmacies, sports venues, and schools with sufficient staff have a relatively low participation rate.(4)Conclusion: The grading treatment has been applied in health management and sports rehabilitation, based on the development of digital medicine, a government-led grading treatment model of "health management center" can promote the participation of multiple subjects in the integration of sports and health care, solving the problems existing in the current integration process to a certain extent.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Dust inhalation is a huge concern in the mining environment and within all its operations. In fact, dust to be one of the most serious occupational hazards in the mining industry. Coal and crystalline silica dust are the causes of serious, sometimes fatal lung diseases such as pneumoconiosis, which affects coal miners, as well as silicosis, tuberculosis, chronic bronchitis, emphysema, chronic obstructive pulmonary disease, and chronic renal disease, which affect coal and other types of miners. The resulting effects both affect workers and nearby communities. The mining industry has in the past, employed several approaches to reduce effects of dust. But these strategies have often been ineffective because the grass withers during the dry season and sprayed water is rapidly absorbed or evaporates. This paper endeavors to review information on dust in the mining environment and how it is a nuisance to workers and communities and establish what strategies exist for this.

Zoonoses are diseases transmitted from (vertebrate) animals to humans. Control and prevention of these diseases require an appropriate way to measure health for prudent and well-balanced decisions in public health. We propose a framework that aims to explore, understand and open up a conversation about the non-monetary value of animals through environmental and normative ethics. As an example of its application, participants can choose what they are willing to give in exchange for curing an animal in hypothetical scenarios selecting a human health condition to suffer, the amount of money, and lifetime as a tradeoff. We believe that considering animals beyond their monetary value in public health decisions will contribute to a more rigorous assessment of the burden of zoonotic diseases, among other health decisions. This method might help us complement the existing metrics in health, adding more comprehensive values for animal and human health for the “One Health” approach.

Objective: This study aimed to determine impact of eHealth literacy on health promotion activities and preventive health practice among adolescents. Methods: This cross-sectional study was conducted between March and May 2022 with 706 adolescents in Çorum, Turkey. A face to face questionnaire form including socio demographic characteristics, preventive health practices, eHealth Literacy scale and Adolescent Health Promotion Scale were used. The data of the research were analyzed with the SPSS 22.0 program. Percentage, mean, Pearson Correlation analysis and multiple regression analysis were used in the analyzes. The p<0.05 value was considered statistically significant in the evaluations. Results: In the study, 55.8% were female and the mean age of the whole group was 16.09±2.63 years. The mean score of eHealth Literacy scale was 29.40±6.29. The mean of the total scores obtained from the Adolescent Health Promotion Scale was 137.97±21.87. Among the adolescents 96.0% didn’t use alcohol and 81% didn’t smoke. The rate of annual weight measure was 68.8%. Measurements of annual blood pressure, annual blood iron, annual cholesterol, annual dental examination and regular exercise rate were below 50%. There was a significant positive correlation between eHealth literacy and the Adolescent Health Promotion Scale (p<0.001). Multiple linear regression analysis was performed to predict eHealth literacy using the variables of Adolescent Health Promotion and preventive health practices. eHealth literacy was positively and significantly predicts health promotion behaviors (β= 0.27, t (695)= 7.54, p<0.001). eHealth literacy increased annual weight measurement by more than 0.13 (β=0.13), the annual blood iron measurement by more than 0.16 (β=0.16), annual dental examination by more than 0.11 (β=0.11). Conclusions: Adolescents ehealth literacy was high and effected via health promotion activities and preventive health practices. Developing eHealth litracy interventions will be important for environments with a high concentration of adolescents (schools, courses). Also, primary health care services should be entegrated with school environment.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Cyperus rotundus L. exhibits promising potential for the development of functional foods due to its documented pharmacological and biological activities. This study investigated the antioxidant and anti-diabetic properties of C. rotundus kombucha. The results demonstrated potent antioxidant activity with an IC50 value of 76.7±9.6 uL/mL for the DPPH assay and 314.2±16.9 uL/mL for the ABTS assay. Additionally, the kombucha demonstrated alpha-glucosidase inhibitory with an IC50 value of 142.7±5.2 µL/mL. This in vitro antioxidant potential was further validated in vivo using Drosophila. Drosophila fed a high-sugar diet and supplemented with pure kombucha revealed significant increases in DPPH and ABTS free radical scavenging activity. Drosophila on a high-sugar diet supplemented with varying kombucha concentrations manifested enhanced resistance to oxidative stresses induced by H2O2 and paraquat. Concurrently, there was a notable decline in lipid peroxidation levels. Additionally, significant upregulations in CAT, SOD1, and SOD2 activities were observed when the high-sugar diet was supplemented with kombucha. Furthermore, in vivo assessments using Drosophila demonstrated significant reductions in alpha-glucosidase activity when fed with kombucha. A comprehensive GC-MS and HPLC analysis of C. rotundus kombucha detected the presence of antioxidative and anti-glucosidase compounds. In conclusion, C. rotundus kombucha exhibits considerable antioxidant and anti-diabetic properties, demonstrating its potential as a beneficial beverage for health promotion.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

This study aims to understand the temporal and spatial characteristics of public concern for "children's mental health" in China in the context of the COVID-19 epidemic. Baidu Index is a research tool to collect and analyze massive data of Chinese netizens' behaviors. Using Baidu Index as the research tool, this paper analyzes the trend and distribution of Chinese netizens' attention to "children's mental health" from December 1st, 2019 to March 20th, 2022 from three aspects of trend research, need map, and crowd portrait. The study found that since the outbreak of COVID-19, the search trend of "children's mental health" has shown a cyclical change, peak in May and valley around the Spring Festival and National Day, and stable in other periods. "Mental health", "handwritten newspaper on mental health" and "youth mental health" are the most popular buzzwords among the public. The groups concerned of "children's mental health" is mainly distributed in Guangdong, Jiangsu, Beijing, and the majority are women between 30 and 39 years old. Meanwhile, search trend for "mental health" are like that for "children's mental health." The factors influencing the search volume change of "children's mental health" include Chinese traditional holidays, Spring Festival, National Day, Chinese Mental Health Day, and policies and instructions on children's mental health issued by the PRC Ministry of Education. The public would like to know about "mental health", "handwritten newspaper on mental health" and "adolescent mental health".

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

The Japanese Association for Acute Medicine Committee recently proposed a novel classification system for the severity of heat-related illnesses. The illnesses are simply classified into three stages based on symptoms and management or treatment. Stages I, II, and III broadly correspond to heat cramp and syncope, heat exhaustion, and heat stroke, respectively. Our objective was to examine whether this novel severity classification is useful in the diagnosis by healthcare professionals of patients with severe heat-related illness and organ failure. A nationwide surveillance study of heat-related illnesses was conducted between June 1 and September 30, 2012, at emergency departments in Japan. Among the 2130 patients who attended 102 emergency departments, the severity of their heat-related illness was recorded for 1799 patients, who were included in this study. In the patients with heat cramp and syncope or heat exhaustion (but not heat stroke), the blood test data (alanine aminotransferase, creatinine, blood urea nitrogen, and platelet counts) for those classified as stage III were significantly higher than those of patients classified as stage I or II. There were no deaths among the patients classified as stage I. This novel classification may avoid underestimating the severity of heat-related illness.

Objectives Asylum seekers in Germany represent a highly vulnerable group from a health perspective due to a variety of risk factors. At the same time their access to healthcare is restricted. While the introduction of the Electronic Health Insurance Card (EHIC) for asylum seekers instead of healthcare-vouchers is discussed controversially using politico-economic reasons, there is hardly any empirical evidence on its actual impact on the use of medical services Study design Thus, the aim of this study is to examine the influence of the possession of the EHIC on the use of medical services by asylum seekers as measured by their consultation rate of ambulant physicians (CR). For this purpose, a standardized survey was carried out to 260 asylum seekers in different municipalities of which some have introduced the EHIC for asylum seekers, while others have not. Methods Various CR were differentiated considering possible third variables as well as confounding factors. The period prevalence was compared between the groups "with EHIC" and "without EHIC" using a two-sided t-test. Multivariate analysis was done using a linear OLS regression model. Results Asylum seekers who are in possession of the EHIC are significantly more likely to seek ambulant medical care than those receiving healthcare-vouchers. Their CR, however, does not differ significantly from the age-corrected CR of the autochtonous population. Taking into account relevant covariables, the possession of the EHIC can be viewed as an independent influencing factor on the asylum seekers' use of medical care. Conclusions The results of this study suggest that having to ask for healthcare-vouchers at the social security office could be a relevant barrier for asylum seekers. Nevertheless, the ownership of the EHIC does not seem to lead to an overuse of medical services.