CRISPR/Cas9-based gene therapy has gotten a lot of interest during last decade. This treatment protocol tries to fix disease-causing traits by changing the DNA code in the exact spot on the chromosome. Therefore, we have tried to elaborate the most current information that shows how well CRISPR/Cas9-based gene therapy works. In vivo methods, like the ones described in the next two lines, are used to study cells in live creatures, like babies that are growing or animals that are already grown up. It has also been suggested to use ex-vivo methods to change somatic stem cells or progenitor cells in a culture outside of the body before putting them back into the patient. CRISPR/Cas is a good way to change specific genes in the DNA. Clustered Regularly Interspaced Short Palindromic Repeats is the full name for CRISPR. Biotechnologists can use them to fix DNA instead of the body's natural ways of doing so. This helps physicians in treatment diseases that run in families more successfully. Cas9 is an enzyme that, along with a guide RNA, is part of the CRISPR/Cas system. As this new technology grows quickly, it is replacing normal medical processes with treatments that are more cutting-edge and can change people's lives. CRISPR-Cas technology has changed biology by making it possible to change genes quickly. CRISPR molecular tools (Cas9 or Cas12a) have a lot of potential, but they are not very useful right now because they depend on the target cell's own DNA repair systems. With or without a template, the body's natural DNA repair processes can fix DNA breaks caused by Cas9 and Cas12a-based technologies. People use these methods a lot, but their effectiveness ranges from cell type to cell type. HDR-mediated DNA repair is a part of cell division, so tools that target it don't work on cells that don't divide, like neurons. CRISPR-associated transposase (CAST) has recently been studied, which suggests that it may offer new ways to change genes with CRISPR. The CRISPR activator of type V-K that is part of CAST has the same structure as the transposase. This is because CRISPR systems can put DNA in the right place without the help of the cell's own DNA repair systems. But a lot of work is being done right now to improve Cas9 and Cas12a so that DNA can be put into a target gene more precisely. Experts are still working hard to come up with better and more reliable ways to change genes, so even though there may be a problem, both methods have useful uses.

Human gut microbiome is associated with various diseases, including autism spectrum disorders (ASD). Variations of the taxonomical composition in the gut microbiome of children with ASD have been observed repeatedly. However, features and parameters of the CRISPR-Cas systems in the gut microbiome of children with ASD have not been investigated yet. Here we demonstrate such an analysis in comparison with the healthy microbiome. For the identification of CRISPR-Cas systems, we used a combination of the publicly available tools suited for completed genomes with subsequent filtrations. In all considered datasets, the microbiomes of children with ASD contained fewer arrays per Gb of assembly, than the control group, but the arrays included more spacers on average. These patterns were observed systematically in our datasets, although their statistical significance hardly matched the thresholds. CRISPR arrays from the microbiomes of children with ASD differed from the control group neither in the fractions of spacers with protospacers from known genomes, nor in the sets of known bacteriophages providing protospacers. The majority of bacterial protospacers of the gut microbiome systems for both children with ASD and the healthy ones was located in the prophage islands.

The contribution of genetic and environmental factors to the pathophysiology of cerebral aneurysms in monozygotic twins is under-reported and presents ambiguous arguments. The morphology and hemodynamics of neurovascular arteries in a pair of monozygotic twins (MTs) were investigated to reveal the underlying mechanisms. Four arterial models were reconstructed for the twin A-right brain and left brain, twin B-left brain, and B-left brain without anterior cerebral arteries based on preclinical scanned information. Subsequently, the dimensions, configurations and outlined curves of the three-perspective geometries were compared between the MTs. Adopting an in-vitro validated numerical cerebral aneurysm model, hemodynamic patterns were investigated and compared in the MT models, respectively. Morphological comparisons of the MTs show the size and shape of cerebral arteries exist significant differences, despite of the expected genetic similarities. These differences can be attributed to variations during embryological development and external environmental influences. Qualitatively and generally, numerical results indicate the MTs have some hemodynamic similarities (e.g., time-averaged pressure (TAP) distributions (~13400 Pa), and oscillatory shear index (0~0.49), but present significant differences in specific local arteries due to morphological variances. Specifically, the difference in the volumetric blood flow rate in corresponding arteries between the MTs is from 16% (smallest) in anterior choroidal artery (AChA) to 221% (largest) in the ophthalmic artery (OphA), varying with specific compared arteries. Also, the registered hemodynamic indicators, such as the maximum time-averaged wall shear stress (TWSS) (53.6 Pa vs. 37.8 Pa), and different local OSI distributions were observed between the MTs. The findings revealed that morphological variations in MTs could be generated by embryological and environmental factors, thus assuming they share the identical morphology in cardiovascular and neurovascular systems may lead to significant misevaluations in hemodynamics quantifications and further lesions.

Crop breeding is an important global strategy to meet sustainable food demand. CRISPR-Cas is a most promising gene-editing technology for rapid and precise generation of novel germplasm, and leads to revolutionary crop breeding innovation. In this review, we summarize recent advance of CRISPR/Cas technology in gene function analyses and generation of new germplasms with increased yield, improved product quality, and enhanced resistance to biotic and abiotic stress. We highlight their applications and breakthroughs in agriculture including crop de novo domestication, decoupling the gene pleiotropy tradeoff, crop hybrid seed conventional production, hybrid rice asexual reproduction, and double haploid breeding. Moreover, the challenges and development of CRISPR/Cas technology in crops are also discussed.

With the first case of human immunodeficiency virus (HIV) infection confirmed in US in 1981, the efforts of discovering anti-HIV therapeutics have been continued ever since. Ten years later, the first HIV drug zidovudine (AZT) was developed to inhibit HIV reverse transcriptase. At meantime, scientists were enlightened to discover new drugs of different targets acting on HIV integrase, protease, and host receptors. The advent of combination antiretroviral therapy (cART) is completely a game changer, with high efficiency in suppressing viremia for people with HIV (PWH) by controlling the viral load below the detectable level. On the bright side, the ART treatment has made HIV a chronic infection rather than a fatal disease. However, it cannot eradicate integrated HIV DNA from the host cells, thus the latent viral reservoir has become a lifelong threaten. In this review, we first discuss the scientific history of conventional HIV drug discovery, with more and more anti-HIV agents have been developed to solve drug resistant issue and relieve the side effect. As a complementary therapy, advanced gene editing technologies have been applied to excise HIV provirus from host genome. Within four decades, novel research conducted on HIV treatment and their contributions to eliminate HIV have been altogether summarized in our review.

Crop yield enhancement is crucial for ensuring food security and meeting the growing global demand for agricultural products. The development of innovative technologies, such as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), has provided new avenues for precise genetic modifications in crops. In this research article, we explore the application of CRISPR technology for crop yield improvement. We discuss the methodology, present recent results, and engage in a comprehensive discussion of the potential benefits, challenges, and future prospects of CRISPR-mediated crop yield enhancement.

One of the ways to regulate the sensitivity of human cells to the influenza virus is to knock out genes of the innate immune response. Promising targets for the knockout are genes of the interferon-inducible transmembrane protein (IFITM) family, in particular the IFITM3 gene, whose product limits the entry of a virus into the cell by blocking the fusion of the viral and endosomal membranes. In this study, by means of genome-editing system CRISPR/Cas9, monoclonal cell lines with an IFITM3 knockout were obtained based on WI-38 VA13 cells (human origin). It was found that such cell lines are more sensitive to infection by influenza A viruses of various subtypes. Nonetheless, this feature is not accompanied by an increased titer of newly formed viral particles in a culture medium.

This review article offers an in-depth look at DNA, its discovery, structure, functions, and the significant role it plays in modern biomedical research. It begins by revisiting the landmark discovery of the DNA double helix by scientists Watson and Crick, a structure resembling a twisted ladder that forms the blueprint of life. The review explains the basic processes of DNA replication (copying DNA), transcription (converting DNA to RNA), and translation (turning RNA into proteins), which are fundamental to understanding how genetic information is passed on and used by living organisms. The article then explores gene regulation and epigenetics, which involve how genes are turned on or off and how environmental factors can affect gene expression without changing the DNA sequence itself. It examines how DNA interacts with various proteins and modifiers, which play crucial roles in these processes. A major focus is on the advancements in DNA sequencing technologies. From the initial Sanger sequencing method, which was labor-intensive and time-consuming, to the highly efficient next-generation sequencing (NGS) and the latest single-molecule sequencing techniques, the review covers how these technologies have revolutionized genomics and personalized medicine. It also highlights the importance of computational genomics and bioinformatics, fields that deal with analyzing and interpreting the vast amounts of data generated by DNA sequencing. The review discusses DNA's crucial role in understanding human diseases. It covers DNA-based research in cancer, rare genetic disorders, infectious diseases, and pharmacogenomics (how genes affect a person's response to drugs). It emphasizes studies that have led to new ways of diagnosing and treating diseases. The article looks at the future of DNA research. It talks about emerging technologies like CRISPR-Cas9, a revolutionary gene-editing tool that allows scientists to modify DNA with high precision. Synthetic biology, an interdisciplinary field that combines biology and engineering for designing and constructing new biological parts and systems, is also discussed. Furthermore, DNA nanotechnology, which involves designing DNA molecules for technological uses, is explored. Finally, the review addresses ethical issues in DNA research, such as privacy concerns and debates over genome editing.

Tomato (Solanum lycopersicum L.) is one of the most commercially essential vegetable crops cultivated worldwide. In addition to the nutritional value, tomato is an excellent model for studying climacteric fruits' ripening process. Despite this, the available natural pool of genes that allows expanding phenotypic diversity is limited, and the difficulties of crossing using classical selection methods when stacking traits increase proportionally with each additional feature. Genetic engineering makes it possible to introduce changes in genes of interest without changing the allelic combinations characteristic of successful commercial varieties, to enhance the expression of existing genes, to create and transfer artificial and heterologous genes, and much more. However, this requires understanding the fundamental principles of the molecular interaction. Although the leading candidate genes for these components have been identified, a complete picture of their relationship has yet to be formed. The review summarizes the latest (2017-2023) achievements related to studying the ripening processes of tomato fruits. In this work, an attempt is made to systematize the results of various research and display the interaction pattern of genes regulating the process of tomato fruit ripening.

We review the emerging international body of evidence on attitudes and willingness to pay (WTP) for novel foods produced with New Plant Engineering Techniques (NPETs). NPETs include genome/gene editing, cisgenesis, intragenesis, RNA interference and others. These novel foods are often beneficial for the environment and human health and more sustainable under increasingly prevalent climate extremes. These techniques can also improve animal welfare and disease resistance when applied to animals. Despite these promising attributes, evidence suggests that many, but not all consumers, discount these novel foods relative to conventional ones. Our systematic review sorts out findings to identify conditioning factors which can increase the acceptance of and WTP for these novel foods in a significant segment of consumers. International patterns of acceptance are identified. We also analyze how information and knowledge interact with consumer acceptance of these novel foods and technologies. Heterogeneity of consumers across cultures and borders, and in attitudes towards science and innovation emerges as key determinants of acceptance and WTP. Acceptance and WTP tend to increase when beneficial attributes—as opposed to producer-oriented cost-saving attributes—are generated by NPETs. NPETs improved foods are systematically less discounted than transgenic foods. Most of the valuation elicitations are based on hypothetical experiments and surveys and await validation through revealed preferences in actual purchases in food retailing environments.

The highly adaptable parasite Trypanosoma cruzi undergoes complex developmental stages to exploit host organisms effectively. Each stage involves the expression of specific proteins and precise intracellular structural organization. These morphological changes depend on key structures that control intracellular components’ growth and redistribution. In trypanosomatids, the flagellar attachment zone (FAZ) connects the flagellum to the cell body and plays a pivotal role in cell expansion and structural rearrangement. While FAZ proteins are well-studied in other trypanosomatids, there is limited knowledge about specific components, organization, and function in T. cruzi. This study employed the CRISPR/Cas9 system to label endogenous genes and conduct deletions to characterize FAZ-specific proteins during epimastigote cell division and metacyclogenesis. In T. cruzi, these proteins exhibited distinct organization compared to counterparts in T. brucei. TcGP72 is anchored to the flagellar membrane, while TcFLA-1BP is anchored to the membrane lining the cell body. We identified unique features in the organization and function of the FAZ in T. cruzi compared to other trypanosomatids. Deleting these proteins had varying effects on intracellular structures, cytokinesis, and metacyclogenesis. This study reveals specific variations that directly impact the success of cell division and differentiation of this parasite.

Research on Cas9 nucleases from different organisms holds great promise for advancing genome engineering and gene therapy tools as it could provide novel structural insights into CRISPR editing mechanisms, expanding its application area in biology and medicine. The current study focuses on generating a construct to express a compact Cas9 nuclease (AnoCas9) from the thermophilic microorganism Anoxybacillus flavithermus. Next, distinctive AnoCas9 properties are investigated. AnoCas9 gene is expressed in E.coli producing a polypeptide fused with the maltose-binding protein (MBP-AnoCas9). His-Tag in its structure enables purification using metal-chelate chromatography followed by the cleavage of the polypeptide by TEV protease. Bioinformatical analysis of the CRISPR array found in the genome of an Anoxybacillus flavithermus strain helps predict a functional PAM sequence for AnoCas9, which is supported by in vitro experiments. The purified protein demonstrates nuclease activity in the presence of crRNA:tracrRNA duplex in the 37-60 °С range, with maximum activity observed at 45-55 °С. The analysis of FAM-labeled dsDNA substrate cleavage has allowed us to determine the functional AnoCas9 PAM motif as 5’-NNNNCDAA-3’. Thus, AnoCas9 adds to the repertoire of thermophilic Cas9 effectors and its properties suggest application in areas requiring the presence of thermostable CRISPR/Cas systems.

Scientists can use the Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system, which is a powerful and flexible tool for changing the genome, to change only certain parts of the genome. This has helped researchers figure out how target genes work in biology and disease. CRISPR/Cas9 is made up of a sequence-specific CRISPR RNA (crRNA) set and a generic Cas9 nuclease. The crRNA set tells Cas9 where to cut DNA and cause double-strand breaks. In the next step of cellular DNA repair, insertions, deletions, and swaps are made at specific spots. For CRISPR/Cas9-mediated DNA cleavage to be specific, the target sequences must match the crRNA, and a protospacer nearby motif must be placed after the target sequences. In this article, we talk about how CRISPR/Cas9 works at the molecular level, what it can be used for, what it can't do, and what its future clinical treatment promise might be.

RNA, as an important substance for regulating biological growth and development, has significant implications for visualization research. However, many spontaneously fluorescent substances in plants greatly interfere with the effectiveness of plant bioimaging. Aggregetion- induced emission luminogens (AIEgens), due to their luminescent properties, tunable molecular size, high fluorescence intensity, good photostability, and low cell toxicity, have been widely applied in the animal and medical fields. We have found that AIEgens have great potential as RNA fluorescent probes for efficient imaging in plants. In this review, we first introduce several common RNA labeling forms and point out their pros and cons. We briefly describe the development of AIEgens and the AIE mechanism, and then present various practical applications of AIEgens, including detailed examples of their use as biological markers. To further promote the application of AIE in the field of RNA, we suggest the use of AIEgens to modify target RNA via techniques such as click chemistry or CRISPR/Cas, to achieve RNA visualization in plants. highly possible to modify target RNA with AIEgens in vivo for RNA visualization.

Abstract: CRISPR/Cas systems are used for genome editing, both in basic science and in bio-technology. At the same time, CRISPR/Cas editors have several limitations, including insufficient specificity leading to "off-targets" and the dependence of activity on chromatin state. A number of highly specific Cas9 variants have been obtained now, but most of them are characterized by reduced activity on eukaryotic chromatin. We identified a spatial cluster of amino acid residues in the PAM-recognizing domain of Streptococcus pyogenes Cas9, whose mutations restore the activity of one of the highly specific forms of SpyCas9 without reducing its activity in Saccharomyces cere-visiae. In addition, one of these new mutations also increases the efficiency of SpyCas9-mediated editing of a site localized on the stable nucleosome. The improved Cas9 variants we obtained, which are capable of editing hard-to-reach regions of the yeast genome, may help in both basic research and yeast biotechnological applications.

Hypoxia represents one of the key factors that stimulate the growth of leukemic cells in their niche. Leukemic cells in hypoxia are forced to reprogram their original transcriptome, miRNome, and metabolome. How the coupling of miRNAs/mRNAs helps to maintain or progress the leukemic status is still not fully described. MicroRNAs (miRNAs) regulate practically all biological processes within cells and play a crucial role in leukemia development/progression. Here we worked with the human cell line MEC-1 (human chronic lymphocytic leukemia (CLL)) where we deleted mature miR-155 by CRISPR/Cas9. MEC-1 cells in hypoxia showed a higher proliferation rate with a relatively low level of apoptosis. Interestingly, miR-155 deficiency decreased the proliferation rate in both, normoxia and hypoxia. Besides common hypoxia-related genes (HIF1α, EGLN1, VHL, HK1, and HK2), we also measured, genes for glucose transporters SLC2A1 (GLUT1) and SLC2A3 (GLUT3). Surprisingly, only SLC2A3 (GLUT3) showed significant overexpression in hypoxia conditions in miR-155 deficient MEC-1cells which points to the possible novel target of miR-155 in CLL. Increased glucose uptake and decreased lactate support our hypothesis that miR-155 deficiency and hypoxia transform cell metabolism. To conclude, miR-155 deficiency and hypoxia-impaired glucose metabolism stimulate GLUT3 in CLL cells.

Antioxidant, anti-inflammatory and chemo-preventive features have been reported for the carotenoid diatoxanthin. Diatoxanthin is only produced by a few groups of microalgae where it functions in photoprotection. Its large-scale production in microalgae is currently not feasible. In fact, rapid conversion into the inactive pigment diadinoxanthin is triggered when the cells are removed from the high-intensity light source, which will be the case during large-scale harvesting of microalgae biomass. Zeaxanthin epoxidase (ZEP) 2 and/or ZEP3 have been suggested to be responsible for the back-conversion of high-light accumulated diatoxanthin to diadinoxanthin in low light in diatoms. Using the CRISPR/Cas9 gene editing technology we knocked out the ZEP2 and ZEP3 genes in the already commercially used marine diatom Phaeodactylum tricornutum to investigate their role in the diadinoxanthin-diatoxanthin cycle, and to determine if one of the mutant strains could function as a diatoxanthin production line. Light shift experiments proved that ZEP3 encodes the enzyme converting diatoxanthin to diadinoxanthin in low light. Loss of ZEP3 caused the high-light accumulated diatoxanthin to be stable for several hours after the cultures had been returned to low light, suggesting that zep3 mutant strains could be suitable as commercial production lines of diatoxanthin.

Keywords: leptophages; Cas system; bacteriophages; Leptospira interrogans

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The Shisa family is a type of single-transmembrane adaptor proteins containing an N-terminal cysteine-rich domain and a proline-rich C-terminal region. Nine Shisa subfamily genes have been proposed in most vertebrates; however, some of them might be species-specific. The number of Shisa genes present in zebrafish remains unclear. The purpose of this study was to investigate the evolutionary relationships among Shisa family genes in zebrafish (TU strain) using phylogenetic and syntenic analyses. The function of shisa-2 was preliminarily examined via CRISPR/Cas13d-mediated knockdown. Following identification in zebrafish,10 Shisa family genes, namely shisa-1, 2, 3, 4, 5, 6, 7, 8, 9a, and 9b, were classified into three main clades and six subclades. Their encoding proteins contained a cysteine-rich N-terminal domain and a proline-rich C-terminal region containing different motifs. A specific syntenic block containing atp8a2 and shisa-2 was observed to be conserved across all species. Furthermore, all these genes were found to be expressed during embryogenesis. shisa-2 was expressed in the presomitic mesoderm, somites, and so on. shisa-2 was identified as a regulator of the expression of the somite formation marker mesp-ab. Overall, our study provides new insights into the evolution of Shisa family genes and the control of shisa-2 over the convergent extension cells of somatic precursors in zebrafish.

Commonly employed methods for reversibly disrupting gene expression, such as those based on RNAi or CRISPRi, are rarely capable of achieving >80-90% downregulation, making them unsuitable for targeting genes that require more complete disruption to elicit a phenotype. Genetic deletion, on the other hand, while enabling complete disruption of target genes, often produces undesirable irreversible consequences such as cytotoxicity or cell death. Here we describe the design, development and detailed characterization of a dual-function "TRE-Lox" system for effecting either (a) doxycycline (Dox)-mediated downregulation or (b) genetic deletion of cathepsin D (CatD), based on targeted insertion of a tetracycline-response element (TRE) and two LoxP sites into the 5' end of the endogenous gene (CTSD). Using an optimized reverse-tetracycline transrepressor (rtTR) variant fused with the Krüppel-associated box (KRAB) domain, we show that CatD expression can be disrupted by as much as 98% in mouse embryonic fibroblasts (MEFs). This system is highly sensitive to Dox (IC50 = 1.46 ng/mL) and results in rapid (t1/2 = 0.57 d) and titratable downregulation of CatD. Notably, even near-total disruption of CatD expression was completely reversed by withdrawal of Dox. As expected, transient expression of Cre recombinase results in complete deletion of the CTSD gene. The dual functionality of this novel system will facilitate future studies of the involvement of CatD in various diseases, particularly those attributable to partial loss of CatD function. In addition, the TRE-Lox approach should be applicable to the regulation of other target genes requiring more complete disruption than can be achieved by traditional methods.

Because rice is native to tropical and subtropical regions, it is generally more sensitive to cold stress compared to other cereals. Low temperature stress has become one of the most important conditions that affects the growth, development, and yield of rice. Plant NAC (NAM, ATAF1/2, and CUC) transcription factors are known to play significant regulatory roles in the stress response. In our research, we found that OsNAC050 (LOC_Os03g60080） is mainly expressed in leaves, and low temperature can further up-regulate its expression. OsNAC050 mutants created using CRISPR-Cas9 gene editing technology showed significantly enhanced tolerance to low temperature treatment. Detection of enzyme activities related to the redox pathway also showed that the mutants had stronger viability under low temperature stress. Comparative transcriptome analysis showed that photosynthesis and soluble sugar metabolism were significantly affected in the osnac050 mutant lines, suggesting that OsNAC050 may participate in the above molecular pathways in the response to low temperature stress. The results will enhance our understanding of molecular mechanisms underlying the responses to cold stress in rice and can provide new strategies for engineering cold-tolerance in high-yielding rice varieties.

Leptospira, which are known to be important disease-causing agents transmitted between animals and humans, results in significant illness and, in some cases, significant death in human populations. This study aims to examine the genomic structure of Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 to identify the specific genetic factors that contribute to antimicrobial resistance (AMR) and defense against phages. The genome, consisting of two contigs totaling 4,630,574 base pairs, underwent thorough examination for protein-coding sequences, transfer RNA genes, and ribosomal RNA genes. A total of twenty-two antibiotic resistance genes that specifically target essential cellular processes such as cell wall synthesis, DNA replication, and protein synthesis have been identified. Significant among these were gidB, GdpD, and PgsA, each involved in separate aspects of antibiotic resistance. In addition, the investigation explored the defense mechanisms of bacteriophages, revealing the presence of defense islands that contain a range of anti-phage systems, including RM_Type_IV, PrrC, Borvo, CAS_Class1-Subtype-IC, and CAS_Class1-Subtype-IB. This comprehensive genomic analysis enhances our understanding of the molecular mechanisms that determine Leptospira's ability to adapt to various environments. The identified genetic factors linked to AMR and defense against phages not only enhance our scientific comprehension but also provide a basis for focused interventions to reduce the impact of leptospirosis.

Because it can make exact double-strand breaks in DNA, CRISPR-Cas9 can help almost every species and type of cell. It is a powerful way to change the DNA code. CRISPR-Cas9 can be used for a lot more than just changing genes. We are close to being able to do high-throughput gene screening, epigenome editing, in-vivo cell tagging, and RNA change. With the help of CRISPR-Cas9, the function of genes can be studied better, and more realistic disease models can be made. The revolutionary new discipline of gene editing has the potential to profoundly impact healthcare and the life sciences. By simplifying the process of creating double-strand breaks in the DNA of almost any species or kind of cell, CRISPR-Cas9 has revolutionized gene editing. Numerous applications have been found for the CRISPR-Cas9 system. High-throughput gene screening, RNA modification, live-cell chromosome marking, and epigenome editing are all examples. CRISPR-Cas9 facilitates gene research, leading to the development of CRISPR-based disease models. CRISPR-Cas9-based methods of altering the genome will aid researchers in learning more about sickness and discovering better ways to cure it, despite the fact that there are still many questions and large difficulties to answer.

Glioblastoma (GBM) is the most common malignant brain tumor in adults. Despite advancements in treatment, the prognosis for patients with GBM remains poor due to its aggressive nature and resistance to therapy. CRISPR-based genetic screening has emerged as a powerful tool for identifying genes crucial for tumor progression and treatment resistance, offering promising targets for tumor therapy. In this review, we provide an overview of the recent advancements in CRISPR-based genetic screening approaches and their applications in GBM. We highlight how these approaches have been used to uncover genetic determinants of GBM progression and susceptibility to various therapies. Furthermore, we discuss ongoing challenges and future directions of CRISPR-based screening methods in advancing GBM research.

The rapid and accurate detection of parasites is crucial for timely curative intervention in parasitosis and for epidemiological surveillance. To meet the needs of clinical diagnosis, it is imperative to develop a diagnostic tool based on nucleic acid that combines the sensitivity and specificity of established nucleic acid amplifica-tion tests with the speed, cost-effectiveness, and convenience of isothermal amplification methods. A new nu-cleic acid detection method, utilizing the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) nuclease, holds promise for point-of-care testing. Specifically, the CRISPR-Cas12a system has demonstrated numerous advantages for detecting parasites, with hopeful outcomes for identify-ing malaria, toxoplasmosis, and other parasitic ailments. This review provides an overview of how CRISPR-Cas12a can be utilized for parasite detection, evaluates its advantages and disadvantages, and sug-gests ways to improve the efficiency and sensitivity of CRISPR-Cas12a-based assays.

Genetic engineering in the field for designing crop improvement has become an essential element in responding to the increasing need for food safety, environmental sustainability, and climate-resilient crops. The latest molecular technology is used by many breeders today to achieve remarkable results. Fast genome editing is currently being seen in a variety of organisms, including plants, because to the high specificity, high effectiveness, and low production cost of CRISPR/Cas [Clustered regulatory interspaced short palindromic repeat (CRISPR)-associated protein (Cas)] technology. Its applications in developing higher-yielding, nutrition rich, disease resistance, stress-tolerant crops fruits, and vegetables. Therefore, this technology has the potential to revolutionize agriculture and contribute to global food security. The Cas protein provides the enzymatic machinery necessary for the acquisition of new cells that target invasion elements. Cas proteins such as Cas9, Cas12, Cas13, and Cas14, among others, have distinct architectures and have been used to create new genetic tools that improve features that are important for agriculture. The versatility of Cas has accelerated genomic analysis and facilitated the use of CRISPR/Cas to manipulate and alter nucleic acid sequences in cells of different organisms. This review provides the evolution of CRISPR technology exploring its mechanisms and contrasting it with traditional breeding and transgenic approaches to improve different stress tolerance. We will also discuss the CRISPR/Cas system and explore the workings of the three Cas proteins that are currently known to exist: Cas12, Cas13, and Cas14. The edited crops by this technology do not have foreign DNA inserted into their genome, therefore, they are considered as non-transgenic by the regulatory bodies in most countries.

In "genome editing," a type of genetic engineering, DNA is added, taken away, or changed in an organism's genome. Biomedicine, biotechnology, and synthetic biology, just to name a few, have all gained a lot from how often this method is used. Before the editing process can start, a Double-Strand Breaks (DSB) must be made in the DNA at a specific gene. Researchers have made nucleases, which are sometimes called "molecular scissors," to fix this DSB. Transcription activator-like effector nucleases (TALENs), Zinc-finger nucleases (ZFNs), and homing endonucleases are all examples of protein targets that have been studied and changed. The last part gave an overview of these study projects and explained how to make Cas12a for specific uses. The applications of Cas12a have been extensively studied in recent years, but the protein still holds a lot of promise as a treatment and screening tool. In order to give a quick review of CRISPR-Cas12a and its uses, we will briefly talk about the structure and function of the different parts of the reaction pathway that lead up to the catalysis of the target DNA. Cas12a uses a multistep process to make sure that it is selecting the right DNA. This is a good trait for a device that changes the DNA because it makes it less likely that something bad will happen. Even though data shows that a new CRISPR RNAs (crRNA) molecule can stop Cas12a from randomly destroying ssDNA, it may still hurt the host cell while trying to change the genome. The action of Cas12a catalysis, which is a powerful tool for changing the genome, needs to be changed so that it can be more easily controlled and managed. Using what we know about how Cas12a works, we have made mutants that are less active on ssDNA and more active on dsDNA. So far, only Cas9 and Cas12a, which are both part of the CRISPR family, have been used to change the genome. Because of how similar and different these two endonucleases are, CRISPR can now be used for multiple scientific purposes. Cas12a is better than Cas9 because it makes double-strand breaks (DSBs) that favor Homology-Directed Repair (HDR) over Non-homologous end joining (NHEJ) and can change more than one copy of the genome at the same time. Both Cas9 and Cas12a are being changed to make them better at detecting Protospacer Adjacent Motif (PAM) than they are in their natural state. This will make it possible to start focusing on more genes.

Prostate cancer is a common cancer among men and typically progresses slowly for several decades before becoming aggressive and spreading to other organs, leaving few treatment options. While large animals have been studied, the dog's prostate is anatomically similar to humans and has been used to study spontaneous prostate cancer. However, most research currently focuses on the mouse as a model organism due to the ability to genetically modify their prostatic tissues for molecular analysis. One hallmark in this research was the identification of the prostate-specific promoter Probasin, allowing for prostate-specific expression of transgenes. This has led to generations of mice with aggressive prostatic tumors through overexpression of the SV40 oncogene. The Probasin promoter is also used to drive Cre expression and allow researcher to generated prostate specific loss-of-function studies. Another landmark in the process of modeling prostate cancer in mice was orthoptic delivery of viral particles. This technology allows selective overexpression of oncogenes from lentivirus or the use of CRISPR to generate complex loss of function studies. These genetic modified models are complemented by classical xenografts of human prostate tumor cells in immune deficient mice. Overall, pre-clinical models have provided a portfolio of model systems to study and address complex mechanisms in prostate cancer for improved treatment options. This review will focus on the advances of each technique.

Plants are exposed to a variety of abiotic and biotic stresses leading to increased formation of reactive oxygen species (ROS) in plant cells. ROS are capable of oxidizing proteins, pigments, lipids, nucleic acids, and other cell molecules, disrupting their functional activity. During the process of evolution, numerous antioxidant systems were formed in plants, including antioxidant enzymes and low-molecular-weight non-enzymatic antioxidants. Antioxidant systems perform neutralization of ROS and therefore prevent oxidative damage of cell components. In the present review, we focus on the biosynthesis of non-enzymatic antioxidants in higher plant cells such as ascorbic acid (vitamin C), glutathione, flavonoids, isoprenoids, including carotenoids, tocopherol (vitamin E), ubiquinone and plastoquinone. Their functioning and their reactivity with respect to individual ROS are described. The review is also devoted to the modern genetic engineering methods, which are widely used to change the quantitative and qualitative content of the non-enzymatic antioxidants in cultivated plants. These methods allow to obtain various plant lines with given properties in a rather short time. The most successful approaches for plant transgenesis and plant genome editing for the enhancement of the biosynthesis and the content of these antioxidants are discussed.

This comprehensive review traces the transformative journey of genomic mapping, ushering in the era of "Genomic Atlas 2.0," characterized by advanced strategies and cutting-edge technologies. Beginning with a historical overview, it highlights the evolution from early linkage analysis to the current landscape shaped by high-throughput sequencing. Key breakthroughs are emphasized, showcasing the pivotal role of platforms such as Illumina and Oxford Nanopore in accelerating the identification of genetic variations. Long-read sequencing technologies, including PacBio and Oxford Nanopore, are explored as transformative elements overcoming limitations associated with short-read sequencing. The review delves into spatial genomics and chromatin conformation capture techniques, revealing the three-dimensional intricacies of the genome, with a particular focus on the revolutionary impact of Hi-C in understanding chromatin interactions. CRISPR technologies emerge as indispensable tools in Genomic Atlas 2.0, enabling targeted genome editing and the generation of precise genetic models. Functional genomics screens, utilizing RNA interference and CRISPR-based techniques, are discussed for their scalable precision in deciphering genome functions. Navigating challenges, the review addresses complexities in data integration and ethical considerations, offering strategies to ensure the robustness and ethical conduct of genetic mapping. Looking optimistically towards the future, it explores opportunities such as improved sequencing accuracy and novel applications of CRISPR technologies. Envisioning the expansion of genomics into personalized medicine, agriculture, and conservation biology, the review serves as a guiding resource for researchers, scientists, and students navigating the intricate terrain of Genomic Atlas 2.0.

The study titled "Molecular Choreography of DNA: Insights and Innovations" explores the intricate dance of DNA, shedding light on its structure, function, and regulation. This comprehensive review delves into the historical significance of DNA research, from Watson and Crick's double helix discovery to recent innovations in genomics and molecular biology. The review highlights DNA's roles in replication, repair, gene regulation, and chromatin dynamics, emphasizing the precision and complexity of its molecular choreography. Innovations like CRISPR-Cas9 gene editing and advanced sequencing technologies have revolutionized our understanding of DNA, opening new avenues for scientific exploration. This study aims to provide readers with a deeper appreciation of DNA's central role in life's choreographed processes.

Adamantinomatous Craniopharyngioma (ACP) is a rare epithelial tumor located in the craniopharyngeal duct, often associated with high morbidity and a high long-term recurrence rate. ACP is predominantly diagnosed in children below the age of 15 and accounts for a majority of Craniopharyngioma cases in the United States. It is most commonly caused by a mutation in exon 3 of the CTNNB1 gene, which promotes overaccumulation of β-Catenin in the WNT pathway. As β-Catenin accumulates, it over-activates the transcription factor, causing an over-transcription of WNT proteins and uncontrolled cell growth. Current methods of treatment for ACP are centered around surgical intervention and radiotherapy, including gross-total resection (GTR), subtotal resection (STR), and a combination of subtotal resection and adjuvant radiotherapy (STR+XTR). These methods of treatment are associated with high risk due to the proximity of ACP to critical structures near the craniopharyngeal duct. High recurrence rates and morbidity are closely associated with current methods of treatment and other methods have yet to be attempted in craniopharyngioma. This review will explore two possible methods of non-surgical and non-radiological therapeutic interventions. The use of RNAi therapy and CRISPR may provide insight and be a potential way to treat ACP with increased quality of life and decreased recurrence rates.

In the world's first pig-to-human cardiac xenotransplant, the elevated levels of porcine cytomeg-alovirus (PCMV) are considered key factors contributing to patient mortality. This has renewed attention to PCMV, a virus widely prevalent in pigs. Currently, there are no effective drugs or vaccines targeting PCMV, and its high detection difficulty poses challenges for prevention and control research. In this study, antiviral small hairpin RNA (shRNA) was selected and inserted into the Rosa26 and miR-17-92 loci of pigs via a CRISPR/Cas9-mediated knock-in strategy. Further in vitro viral challenge experiments demonstrated that these genetically edited pig cells could effec-tively limit PCMV replication. Through this process, we constructed a PCMV-infected cell model, validated partial viral interference sites, enhanced gene knock-in efficiency, performed gene editing at two different gene loci, and ultimately demonstrated that RNA interference (RNAi) technology combined with CRISPR/Cas9 has the potential to generate pig cells with enhanced antiviral infec-tion capabilities. This opens up possibilities for the future production of pig populations with anti-viral functionalities.

Gene editing is now easy to make new disease models through in-vivo and in vitro tests. It can potentially be used to make animals with single-gene or multiple-gene changes. The mutant strains with changed germlines are no longer needed with in vivo gene editing, which uses the CRISPR-Cas9 system to target cells of interest in their normal tissues. Whereas, the AAVs and other viral vectors have made it possible to change cells selectively. Gene editing hade made it possible to use human induced pluripotent stem cells (iPSC) to model diseases that run in families. Researchers can compare and contrast the human genomes of many different ethnic and racial groups using this method. Scientists may be able to make a disease in a lab dish using iPSCs from a patient. Using CRISPR, iPSCs made from patient cells can be fixed if they have certain problems. This shows that gene therapy is possible and shows what happens when cells aren't working right. The fact that CRISPR-Cas9 can change the DNA by just one nucleotide has had a huge effect on biological studies. CRISPR is becoming more and more popular, which shows how useful, easy, and effective it is. With the broad use of CRISPR-based apps, the tool is now used for much more than just changing genes. This method can be used to screen the whole genome, control the translation of genes based on their sequence, and edit several genes at the same time. Scientists can now model diseases in different species and learn more about how genes work because of these advances. Genome-wide association studies and genome-editing tools like CRISPR are giving us a good look at the future of personalized medicine.

The exploration of three-dimensional (3D) DNA structures marks a pivotal shift in genomics, offering unprecedented insights into the intricacies of cellular regulation, disease genesis, and the potential for novel diagnostic and therapeutic strategies. This study delves into the dynamic nature of 3D genome organization, investigating how these structures influence cellular functions in response to environmental changes and over time. Through a combination of real-time imaging and advanced computational models, we aim to unravel the complex interplay between 3D DNA structures, non-coding RNAs, and chromatin organization, and their collective impact on gene expression and cellular differentiation. A significant focus is placed on understanding the role of 3D DNA structures in the development and progression of genetic disorders. By employing comprehensive genomic and epigenomic profiling, this research seeks to identify structural aberrations linked to diseases, paving the way for the development of targeted diagnostics and therapies. Additionally, the study explores the potential of genome editing technologies, such as CRISPR-Cas systems, in correcting these structural abnormalities, while also addressing the ethical, legal, and social implications (ELSI) of such interventions. Integrating data from various genomic analyses, we propose the development of advanced computational models to predict the effects of 3D DNA structures on gene expression and cellular function. This integrative approach not only promises to enhance our understanding of genomic regulation but also sets the stage for groundbreaking advances in genomics-based diagnostics and therapeutics. The findings of this study have the potential to revolutionize our approach to treating genetic disorders, offering a new frontier in personalized medicine.

The adulteration of goat milk powder occurs frequently, cattle-derived and soybean-derived ingredients are common adulterants in goat milk powder. However, simultaneously and rapidly detecting cattle-derived and soybean-derived components is still a challenge. high throughput and efficient screening method for adulteration detection is need. In this study, a rapid method was developed to detect the adulteration of common cattle-derived and soybean-derived components simultaneously in goat milk powder by combining the CRISPR/ Cas12a system with recombinant polymerase amplification (RPA). A dual DNA extraction method was employed, primers and crRNA for dual detection were designed and screened, and a series of condition optimizations were carried out in this experiment. The optimized assay can rapidly detect cattle-derived and soybean-derived components in 40 min. The detection limits of both cattle-derived and soybean-derived components were 1% (w/w) for the mixed adulteration models. The established method was applied into a blind survey of 55 commercially available goat milk powder products. The results showed that 36.36% of the samples contained cattle-derived or soybean-derived ingredients, which revealed the noticeable adulteration situation in the goat milk powder market. This study realizes a fast flow of dual extraction, dual amplification and dual detection of cattle-derived and soybean-derived components in goat milk powder for the first time. It can be used for high-throughput and high-efficiency on-site primary screening of goat milk powder adulterants, and provide a technical reference for combating with food adulteration.

Biological nanoparticles (NPs), such as extracellular vesicles (EVs), exosome-mimetic nanovesicles (EMNVs) and nanoghosts (NGs), are perspective non-viral delivery vehicles for all types of therapeutic cargo. Biological NPs are renowned for their exceptional biocompatibility and safety, alongside their ease of functionalization, but a significant challenge arises when attempting to load therapeutic payloads, such as nucleic acids (NAs). One effective strategy involves fusing biological NPs with liposomes loaded with NAs, resulting in hybrid carriers that offer the benefits of both biological NPs and the capacity for high cargo loads. Despite their unique parameters, one of the major issues of virtually any nanoformulation is the ability to escape degradation in the compartment of endosomes and lysosomes which determines the overall efficiency of nanotherapeutics. In this study, we fabricated all major types of biological and hybrid NPs and studied their response to acidic environment observed in endolysosomal compartment. In this study, we show that EMNVs display increased protonation and swelling relative to EVs and NGs in an acidic environment. Furthermore, the hybrid NPs exhibit an even greater response compared to EMNVs. Short-term incubation of EMNVs in acidic pH corresponding to late endosomes and lysosomes again induces protonation and swelling, whereas hybrid NPs are ruptured, resulting in the decline of their quantities. Our findings demonstrate that in an acidic environment, there is enhanced rupture and release of vesicular cargo observed in hybrid EMNVs that are fused with liposomes compared to EMNVs alone. This was confirmed through PAGE electrophoresis analysis of mCherry protein loaded into nanoparticles. In vitro analysis of NPs colocalization with lysosomes in HepG2 cells demonstrated that EMNVs mostly avoid endolysosomal compartment whereas hybrid NPs escape it over time. To conclude, (1) hybrid biological NPs fused with liposomes appear more efficient in the endolysosomal escape via the mechanism of proton sponge associated with scavenging of protons by NPs, influx of counterions and water, and rupture of endo/lysosomes, but (2) EMNVs are much more efficient than hybrid NPs in actually avoiding endolysosomal compartment in human cells. These results reveal biochemical differences across four major types of biological and hybrid NPs, and indicate that EMNVs are more efficient in escaping or avoiding endolysosomal compartment.