Submitted:
14 March 2025
Posted:
17 March 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Participants
2.2. Total Genetic Score
2.3. Statistical Analysis
2.4. DNA Extraction and Genotyping
3. Results
4. Discussions
5. Conclusion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Iannaccone, A., et al., Stay Home, Stay Active with SuperJump®: A Home-Based Activity to Prevent Sedentary Lifestyle during COVID-19 Outbreak. Sustainability, 2020. 12(23): p. 10135. [CrossRef]
- Amato, A., et al., Analysis of Body Perception, Preworkout Meal Habits and Bone Resorption in Child Gymnasts. International Journal of Environmental Research and Public Health, 2021. 18(4): p. 2184.
- Widmann, M., A.M. Nieß, and B. Munz, Physical Exercise and Epigenetic Modifications in Skeletal Muscle. Sports Med, 2019. 49(4): p. 509-523. [CrossRef]
- Appel, M., et al., Effects of Genetic Variation on Endurance Performance, Muscle Strength, and Injury Susceptibility in Sports: A Systematic Review. Front Physiol, 2021. 12: p. 694411. [CrossRef]
- Varillas-Delgado, D., et al., Genetics and sports performance: the present and future in the identification of talent for sports based on DNA testing. Eur J Appl Physiol, 2022. 122(8): p. 1811-1830. [CrossRef]
- Semenova, E.A., E.C.R. Hall, and I.I. Ahmetov, Genes and Athletic Performance: The 2023 Update. Genes, 2023. 14(6): p. 1235. [CrossRef]
- Amato, A., et al., Total genetic score: An instrument to improve the performance in the elite athletes. Acta Medica Mediterranea, 2018.
- Jones, N., et al., A genetic-based algorithm for personalized resistance training. Biology of sport, 2016. 33(2): p. 117-126. [CrossRef]
- Chiu, Y.H., et al., Impact of angiotension I converting enzyme gene I/D polymorphism on running performance, lipid, and biochemical parameters in ultra-marathoners. Medicine (Baltimore), 2019. 98(29): p. e16476. [CrossRef]
- Balberova, O.V., et al., Candidate Genes of Regulation of Skeletal Muscle Energy Metabolism in Athletes. Genes (Basel), 2021. 12(11). [CrossRef]
- Kurtuluş, M., et al., Genetic differences in peroxisome proliferator-activated receptor alpha gene in endurance athletes (long distance runners) and power/endurance athletes (wrestlers, football players). Journal of Basic and Clinical Health Sciences, 2023. 7(2): p. 723-730. [CrossRef]
- Olga1AB, F., et al., Association of muscle-specific creatine kinase (CKM) gene polymorphism with combat athlete status in Polish and Russian cohorts. Arch Budo, 2013. 3: p. 233-237.
- Batavani, M.R., et al., Comparison of muscle-specific creatine kinase (CK-MM) gene polymorphism (rs8111989) among professional, amateur athletes and non-athlete karatekas. Asian Journal of Sports Medicine, 2017. 8(2). [CrossRef]
- Fedotovskaya, O., et al., Association of muscle-specific creatine kinase (CKMM) gene polymorphism with physical performance of athletes. Human Physiology, 2012. 38: p. 89-93. [CrossRef]
- Ahmetov, II, et al., Advances in sports genomics. Adv Clin Chem, 2022. 107: p. 215-263.
- Homma, H., et al., The Association between Total Genotype Score and Athletic Performance in Weightlifters. Genes (Basel), 2022. 13(11). [CrossRef]
- Amato, A., et al., Influence of nutrition and genetics on performance: a pilot study in a group of gymnasts. Human Movement, 2017. 18(3): p. 12-16. [CrossRef]
- Küchler, E.C., et al., Buccal cells DNA extraction to obtain high quality human genomic DNA suitable for polymorphism genotyping by PCR-RFLP and Real-Time PCR. J Appl Oral Sci, 2012. 20(4): p. 467-71. [CrossRef]
- John, R., M.S. Dhillon, and S. Dhillon, Genetics and the Elite Athlete: Our Understanding in 2020. Indian J Orthop, 2020. 54(3): p. 256-263. [CrossRef]
- Kumari, N., et al., ACE Gene I/D Polymorphism and Cardiometabolic Risk Factors: A Cross Sectional Study of Rural Population. Biochem Genet, 2024. 62(2): p. 1008-1020. [CrossRef]
- Gasser, B., et al., ACE-I/D Allele Modulates Improvements of Cardiorespiratory Function and Muscle Performance with Interval-Type Exercise. Genes (Basel), 2023. 14(5). [CrossRef]
- Cocci, P., et al., Genetic variants and mixed sport disciplines: a comparison among soccer, combat and motorcycle athletes. Annals of Applied Sport Science, 2019. 7(1): p. 1-9. [CrossRef]


| Characteristics | Mean±SD |
| Age (years) | 22.1±5.8 |
| Body mass (kg) | 66.1±15.4 |
| Body height (cm) | 173.0±9.5 |
| BMI (kg·m−2) | 21.8±3.2 |
| Gene | Polymorphism | GS Power Oriented | Involved Metabolism |
| ACE | DD | 2 | Anaeorobic |
| ID | 1 | Anaerobic/Aerobic | |
| II | 0 | Aerobic | |
| PPARα | CC | 2 | Anaeorobic |
| CG | 1 | Anaerobic/Aerobic | |
| GG | 0 | Aerobic | |
| CKM | GG | 2 | Anaeorobic |
| AG | 1 | Anaerobic/Aerobic | |
| AA | 0 | Aerobic |
| Gene | Primers Sequence | Denaturation | Annealing | Extension | Cycles |
| ACE | F:5’GCCCTGCAGGTGTCTGCAGCATGT3’ | 94° 30’’ | 56° 45’’ | 72° 1’ | 35 |
| R:5’GGATGGCTCTCCCCGCCTTGTCTC3’ | |||||
| PPARα | F:5’ACAATCACTCCTTAAATATGGTGG3’ | 94° 30’’ | 59° 30’’ | 72° 30’’ | 35 |
| R:5’AAGTAGGGACAGACAGGACCAGTA3’ | |||||
| CKM | F:5’GGGATGCTCAGACTCACAGA3’ | 94° 40’’ | 53° 45’’ | 72° 1’ | 30 |
| R:5’AACTTGAATTTAGCCCAACG3 |
| Gene | Restriction Enzyme | Digestion | Polymorphism | Fragment Lenght |
| ACE | Not required | - | DD | 319 bp |
| II | 597 bp | |||
| ID | 319 + 597 bp | |||
| PPARα | TAQ I | 65° | CC | 216 + 50 bp |
| 2:30h | GG | 266 bp | ||
| CG | 266 + 216 + 50 bp | |||
| CKM | NCO I | 37° | GG | 359 bp |
| 2:30h | AA | 206 + 153 bp | ||
| AG | 359 + 206 + 153 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).