Submitted:
17 December 2024
Posted:
18 December 2024
You are already at the latest version
Abstract
A novel Bacillus subtilis HB-31 strain was isolated from Gotjawal Wetland in Jeju Island, Republic of Korea. A mucus substance produced by this strain was identified as high-molecular weight poly-γ-glutamic acid (γ-PGA) using NMR, Fourier transform infrared spectroscopy, and size-exclusion chromatography/multi-angle light scattering analyses. We evaluated whether γ-PGA improved the skin barrier using keratinocytes and reconstructed skin models. In keratinocytes, γ-PGA treatment increased mRNA expression of skin barrier markers, including filaggrin, involucrin, loricrin, serine palmitoyl transferase, fatty acid synthase, and 3-hydroxy-3-methylglutaryl coenzyme A reductase, dose-dependently. γ-PGA also enhanced hyaluronic acid synthesis by upregulating hyaluronic acid synthase-1,-2,and -3 mRNA levels and promoted aquaporin 3 expression, involved in skin hydration. In reconstructed skin models, 1% γ-PGA topical application elevated filaggrin, involucrin, CD44, and aquaporin 3 expression compared to the control. These results suggest that the newly isolated HB-31 can be used as a commercial production system of high-molecular weight γ-PGA, which can be an effective in-gredient for improving skin barrier and moisture. Further research is needed to explore the long-term effects of γ-PGA on skin health and its application in treating skin disorders.

Keywords:
1. Introduction
2. Results and Discussion
2.1. Isolation and Identification
2.2. Identification of γ-PGA
2.3. Cytotoxicity of γ-PGA in Keratinocytes
2.4. Effect of γ-PGA on Physical Skin Barrier-Related Markers in Keratinocytes
2.5. Effect of γ-PGA on Permeability Skin Barrier-Related Markers in Keratinocytes
2.6. Effect of γ-PGA on Hyaluronic Acid Synthesis in Keratinocytes
2.7. Effect of γ-PGA on AQP3 Expression in Keratinocytes
2.8. Effect of γ-PGA on Skin Barrier-Related Markers in a Reconstructed Skin Model
3. Material and Methods
3.1. Bacterial Strain Isolation and Identification
3.2. Microbial Culture and Reagent Prparation
3.3. Compound Isolation and Identification
3.4. Cell Culture
3.5. Cell Viability
3.6. RT-PCR
3.7. Immunocyto Fluorescence Analysis
3.8. Reconstructed Skin Model
3.9. Histological Analysis
3.10. Image Acquisition and Analysis
3.11. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Awasthi, S.K.; Kumar, M.; Kumar, V.; Sarsaiya, S.; Anerao, P.; Ghosh, P.; Singh, L.; Liu, H.; Zhang, Z.; Awasthi, M.K. A comprehensive review on recent advancements in biodegradation and sustainable management of biopolymers. Environ Pollut 2022, 307, 119600. [Google Scholar] [CrossRef] [PubMed]
- Shih, I.-L.; Van, Y.-T. The production of poly-(γ-glutamic acid) from microorganisms and its various applications. Bioresource Technology 2001, 79, 207–225. [Google Scholar] [CrossRef] [PubMed]
- Zeng, W.; Liu, Y.; Shu, L.; Guo, Y.; Wang, L.; Liang, Z. Production of ultra-high-molecular-weight poly-γ-glutamic acid by a newly isolated Bacillus subtilis strain and genomic and transcriptomic analyses. Biotechnol J 2024, 19, e2300614. [Google Scholar] [CrossRef]
- Isago, Y.; Suzuki, R.; Isono, E.; Noguchi, Y.; Kuroyanagi, Y. Development of a Freeze-Dried Skin Care Product Composed of Hyaluronic Acid and Poly(¦Ã-Glutamic Acid) Containing Bioactive Components for Application after Chemical Peels. Open Journal of Regenerative Medicine 2014, Vol.03No.03, 11. [Google Scholar] [CrossRef]
- Wang, X.; Mohammad, I.S.; Fan, L.; Zhao, Z.; Nurunnabi, M.; Sallam, M.A.; Wu, J.; Chen, Z.; Yin, L.; He, W. Delivery strategies of amphotericin B for invasive fungal infections. Acta Pharmaceutica Sinica B 2021, 11, 2585–2604. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Liu, F.; Liu, S.; Li, H.; Ling, P.; Zhu, X. Poly-γ-glutamate from Bacillus subtilis inhibits tyrosinase activity and melanogenesis. Applied Microbiology and Biotechnology 2013, 97, 9801–9809. [Google Scholar] [CrossRef]
- Vaughn, A.R.; Clark, A.K.; Sivamani, R.K.; Shi, V.Y. Natural Oils for Skin-Barrier Repair: Ancient Compounds Now Backed by Modern Science. Am J Clin Dermatol 2018, 19, 103–117. [Google Scholar] [CrossRef] [PubMed]
- Almoughrabie, S.; Cau, L.; Cavagnero, K.; O'Neill, A.M.; Li, F.; Roso-Mares, A.; Mainzer, C.; Closs, B.; Kolar, M.J.; Williams, K.J.; et al. Commensal Cutibacterium acnes induce epidermal lipid synthesis important for skin barrier function. Sci Adv 2023, 9, eadg6262. [Google Scholar] [CrossRef]
- Ohno, Y.; Kamiyama, N.; Nakamichi, S.; Kihara, A. PNPLA1 is a transacylase essential for the generation of the skin barrier lipid ω-O-acylceramide. Nat Commun 2017, 8, 14610. [Google Scholar] [CrossRef] [PubMed]
- Bouwstra, J.A.; Nădăban, A.; Bras, W.; McCabe, C.; Bunge, A.; Gooris, G.S. The skin barrier: An extraordinary interface with an exceptional lipid organization. Prog Lipid Res 2023, 92, 101252. [Google Scholar] [CrossRef]
- Fuchs, E. Epidermal differentiation and keratin gene expression. J Cell Sci Suppl 1993, 17, 197–208. [Google Scholar] [CrossRef] [PubMed]
- Furue, M. Regulation of Filaggrin, Loricrin, and Involucrin by IL-4, IL-13, IL-17A, IL-22, AHR, and NRF2: Pathogenic Implications in Atopic Dermatitis. International Journal of Molecular Sciences 2020, 21, 5382. [Google Scholar] [CrossRef] [PubMed]
- Steinert, P.M.; Marekov, L.N. The proteins elafin, filaggrin, keratin intermediate filaments, loricrin, and small proline-rich proteins 1 and 2 are isodipeptide cross-linked components of the human epidermal cornified cell envelope. J Biol Chem 1995, 270, 17702–17711. [Google Scholar] [CrossRef] [PubMed]
- Cork, M.J.; Danby, S.G.; Vasilopoulos, Y.; Hadgraft, J.; Lane, M.E.; Moustafa, M.; Guy, R.H.; Macgowan, A.L.; Tazi-Ahnini, R.; Ward, S.J. Epidermal barrier dysfunction in atopic dermatitis. J Invest Dermatol 2009, 129, 1892–1908. [Google Scholar] [CrossRef]
- Harding, C.R.; Watkinson, A.; Rawlings, A.V.; Scott, I.R. Dry skin, moisturization and corneodesmolysis. Int J Cosmet Sci 2000, 22, 21–52. [Google Scholar] [CrossRef]
- Dübe, B.; Lüke, H.J.; Aumailley, M.; Prehm, P. Hyaluronan reduces migration and proliferation in CHO cells. Biochim Biophys Acta 2001, 1538, 283–289. [Google Scholar] [CrossRef] [PubMed]
- Song, H.; Jin, M.; Lee, S. Effect of Ferulic Acid Isolated from Cnidium Officinale on the Synthesis of Hyaluronic Acid. Journal of the Society of Cosmetic Scientists of Korea 2013, 39. [Google Scholar] [CrossRef]
- Bollag, W.B.; Aitkens, L.; White, J.; Hyndman, K.A. Aquaporin-3 in the epidermis: more than skin deep. Am J Physiol Cell Physiol 2020, 318, C1144–c1153. [Google Scholar] [CrossRef]
- Boury-Jamot, M.; Sougrat, R.; Tailhardat, M.; Le Varlet, B.; Bonté, F.; Dumas, M.; Verbavatz, J.M. Expression and function of aquaporins in human skin: Is aquaporin-3 just a glycerol transporter? Biochim Biophys Acta 2006, 1758, 1034–1042. [Google Scholar] [CrossRef]
- Qin, H.; Zheng, X.; Zhong, X.; Shetty, A.K.; Elias, P.M.; Bollag, W.B. Aquaporin-3 in keratinocytes and skin: its role and interaction with phospholipase D2. Arch Biochem Biophys 2011, 508, 138–143. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.H.; Lee, A.Y. Reduced aquaporin3 expression and survival of keratinocytes in the depigmented epidermis of vitiligo. J Invest Dermatol 2010, 130, 2231–2239. [Google Scholar] [CrossRef] [PubMed]
- Ikarashi, N.; Ogiue, N.; Toyoda, E.; Kon, R.; Ishii, M.; Toda, T.; Aburada, T.; Ochiai, W.; Sugiyama, K. Gypsum fibrosum and its major component CaSO4 increase cutaneous aquaporin-3 expression levels. J Ethnopharmacol 2012, 139, 409–413. [Google Scholar] [CrossRef] [PubMed]
- Ikarashi, N.; Kon, R.; Kaneko, M.; Mizukami, N.; Kusunoki, Y.; Sugiyama, K. Relationship between Aging-Related Skin Dryness and Aquaporins. International Journal of Molecular Sciences 2017, 18, 1559. [Google Scholar] [CrossRef]
- Filatov, V.; Sokolova, A.; Savitskaya, N.; Olkhovskaya, M.; Varava, A.; Ilin, E.; Patronova, E. Synergetic Effects of Aloe Vera Extract with Trimethylglycine for Targeted Aquaporin 3 Regulation and Long-Term Skin Hydration. Molecules 2024, 29. [Google Scholar] [CrossRef]
- Suhail, S.; Sardashti, N.; Jaiswal, D.; Rudraiah, S.; Misra, M.; Kumbar, S.G. Engineered Skin Tissue Equivalents for Product Evaluation and Therapeutic Applications. Biotechnol J 2019, 14, e1900022. [Google Scholar] [CrossRef]
- Lelièvre, D.; Canivet, F.; Thillou, F.; Tricaud, C.; Le Floc'h, C.; Bernerd, F. Use of reconstructed skin model to assess the photoprotection afforded by three sunscreen products having different SPF values against DNA lesions and cellular alterations. Journal of Photochemistry and Photobiology 2024, 19, 100213. [Google Scholar] [CrossRef]
- Plaza, C.; Meyrignac, C.; Botto, J.M.; Capallere, C. Characterization of a New Full-Thickness In Vitro Skin Model. Tissue Eng Part C Methods 2021, 27, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Hall, M.J.; Lopes-Ventura, S.; Neto, M.V.; Charneca, J.; Zoio, P.; Seabra, M.C.; Oliva, A.; Barral, D.C. Reconstructed human pigmented skin/epidermis models achieve epidermal pigmentation through melanocore transfer. Pigment Cell Melanoma Res 2022, 35, 425–435. [Google Scholar] [CrossRef] [PubMed]
- Ryu, J.S.; Park, H.S.; Kim, M.J.; Lee, J.; Jeong, E.Y.; Cho, H.; Kim, S.; Seo, J.Y.; Cho, H.D.; Kang, H.C.; et al. Liposomal fusion of plant-based extracellular vesicles to enhance skin anti-inflammation. Journal of Industrial and Engineering Chemistry 2024. [Google Scholar] [CrossRef]
- Ko, H.J.; Sim, S.A.; Park, M.H.; Ryu, H.S.; Choi, W.Y.; Park, S.M.; Lee, J.N.; Hyun, C.G. Anti-Photoaging Effects of Upcycled Citrus junos Seed Anionic Peptides on Ultraviolet-Radiation-Induced Skin Aging in a Reconstructed Skin Model. Int J Mol Sci 2024, 25. [Google Scholar] [CrossRef]
- Cario-André, M.; Briganti, S.; Picardo, M.; Nikaido, O.; Gall, Y.; Ginestar, J.; Taı̈eb, A. Epidermal reconstructs: a new tool to study topical and systemic photoprotective molecules. Journal of Photochemistry and Photobiology B: Biology 2002, 68, 79–87. [Google Scholar] [CrossRef] [PubMed]
- T. Seki, C.K.C., H. Mikami, and Y. Oshima. Deoxyribonucleic acid homology and taxonomy of the genus Bacillus. Int. J. Syst. Bacteriol 1978, 28, 182–189. [Google Scholar] [CrossRef]
- Cai, M.; Han, Y.; Zheng, X.; Xue, B.; Zhang, X.; Mahmut, Z.; Wang, Y.; Dong, B.; Zhang, C.; Gao, D.; et al. Synthesis of Poly-γ-Glutamic Acid and Its Application in Biomedical Materials. Materials 2024, 17, 15. [Google Scholar] [CrossRef]
- Jungersted, J.M.; Hellgren, L.I.; Jemec, G.B.; Agner, T. Lipids and skin barrier function--a clinical perspective. Contact Dermatitis 2008, 58, 255–262. [Google Scholar] [CrossRef] [PubMed]
- Sakai, S.; Sayo, T.; Kodama, S.; Inoue, S. N-Methyl-L-serine stimulates hyaluronan production in human skin fibroblasts. Skin Pharmacol Appl Skin Physiol 1999, 12, 276–283. [Google Scholar] [CrossRef]
- Yu, H.Y.; Yang, I.-J.; Lincha, V.R.; Park, I.S.; Lee, D.-U.; Shin, H.M. The Effects of the Fruits of Foeniculum vulgare on Skin Barrier Function and Hyaluronic Acid Production in HaCaT Keratinocytes. 2015.
- Tricarico, P.M.; Mentino, D.; De Marco, A.; Del Vecchio, C.; Garra, S.; Cazzato, G.; Foti, C.; Crovella, S.; Calamita, G. Aquaporins Are One of the Critical Factors in the Disruption of the Skin Barrier in Inflammatory Skin Diseases. International Journal of Molecular Sciences 2022, 23, 4020. [Google Scholar] [CrossRef] [PubMed]
- Screaton, G.R.; Bell, M.V.; Jackson, D.G.; Cornelis, F.B.; Gerth, U.; Bell, J.I. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci U S A 1992, 89, 12160–12164. [Google Scholar] [CrossRef] [PubMed]
- Aruffo, A.; Stamenkovic, I.; Melnick, M.; Underhill, C.B.; Seed, B. CD44 is the principal cell surface receptor for hyaluronate. Cell 1990, 61, 1303–1313. [Google Scholar] [CrossRef]
- Li, J.; Tang, H.; Hu, X.; Chen, M.; Xie, H. Aquaporin-3 gene and protein expression in sun-protected human skin decreases with skin ageing. Australas J Dermatol 2010, 51, 106–112. [Google Scholar] [CrossRef]
- Rockstroh, T. [Changes in the nomenclature of bacteria after the 8th edition of Bergey's Manual of the Determinative Bacteriology]. Z Arztl Fortbild (Jena) 1977, 71, 545–550. [Google Scholar] [PubMed]
- Birrer, G.A.; Cromwick, A.M.; Gross, R.A. Gamma-poly(glutamic acid) formation by Bacillus licheniformis 9945a: physiological and biochemical studies. Int J Biol Macromol 1994, 16, 265–275. [Google Scholar] [CrossRef]
- Chettri, R.; Bhutia, M.O.; Tamang, J.P. Poly-γ-Glutamic Acid (PGA)-Producing Bacillus Species Isolated from Kinema, Indian Fermented Soybean Food. Front Microbiol 2016, 7, 971. [Google Scholar] [CrossRef] [PubMed]
- S. E. Kang, J.H.R., C. Park, M. H. Sung, I. H. Lee. Distribution of poly-r-glutamate (r-PGA) producers in Korean fermented foods, Cheongkukjang, Doenjang, and Kochujang. Food Sci. Biotechnol 2005, 14, 704.
- Tian, G.F. , J; Wei, X; Ji, Z; Ma, Xin; Qi, G; Chen, S Enhanced expression of pgdS gene for high production of poly-gamma-glutamic aicd with lower molecular weight in Bacillus licheniformis WX-02. Journal of Chemical Technology and Biotechnology 2014, 89, 1825–1832. [Google Scholar] [CrossRef]
- Goto, A.; Kunioka, M. Biosynthesis and Hydrolysis of Poly(γ-glutamic acid) from Bacillus subtilis IF03335. Biosci Biotechnol Biochem 1992, 56, 1031–1035. [Google Scholar] [CrossRef] [PubMed]
- Ko, H.J.; Kim, J.; Ahn, M.; Kim, J.H.; Lee, G.S.; Shin, T. Ergothioneine alleviates senescence of fibroblasts induced by UVB damage of keratinocytes via activation of the Nrf2/HO-1 pathway and HSP70 in keratinocytes. Exp Cell Res 2021, 400, 112516. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.W.; Lee, J.; Park, Y.I. 7,8-Dihydroxyflavone attenuates TNF-α-induced skin aging in Hs68 human dermal fibroblast cells via down-regulation of the MAPKs/Akt signaling pathways. Biomed Pharmacother 2017, 95, 1580–1587. [Google Scholar] [CrossRef]
- Han, D.; Kim, H.Y.; Lee, H.J.; Shim, I.; Hahm, D.H. Wound healing activity of gamma-aminobutyric Acid (GABA) in rats. J Microbiol Biotechnol 2007, 17, 1661–1669. [Google Scholar] [PubMed]







| Gene | Primer | Sequence (5’to 3’) |
|---|---|---|
| FLG | Sense | AAGCTTCATGGTGATGCGAC |
| Antisense | TCAAGCAGAAGAGGAAGGCA | |
| IVL | Sense | ACCTAGCGGACCCGAAATAA |
| Antisense | TGGAACAGCAGGAAAAGCAC | |
| LOR | Sense | CACTGGGGTTGGGAGGTAGT |
| Antisense | GCTCTCATGATGCTACCCGA | |
| SPT | Sense | CTGCTGAAGTCCTCAAGGAGTA |
| Antisense | GGTTCAGCTCATCACTCAGAATC | |
| HMG-CoA | Sense | GATCCAGGAGCGAACCAA |
| Antisense | GCGAATAGACACACCACGTT | |
| FAS | Sense | CCTCACTGCCATCCAGATTG |
| Antisense | CTGTTTACATTCCTCCCAGGAC | |
| HAS-1 | Sense | CCACCCAGTACAGCGTCAAC |
| Antisense | CATGGTGCTTCTGTCGCTCT | |
| HAS-2 | Sense | TTTGTTCAAGTCCCAGCAGC |
| Antisense | ATCCTCCTGGGTGGTGTGAT | |
| HAS-3 | Sense | CCCAGCCAGATTTGTTGATG |
| Antisense | AGTGGTCACGGGTTTCTTCC | |
| GAPDH | Sense | CAAAGTTGTCATGGATGACC |
| Antisense | CCATGGAGAAGGCTGGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).