Submitted:
19 September 2023
Posted:
25 September 2023
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Isolation, purification, and culture condition for Synechococcus sp.
2.2. Molecular identification
2.3. Silver nanoparticles biosynthesis
2.4. Silver nanoparticles characterization
2.5. Antibacterial estimation
2.6. Statistical analysis
3. Results and Discussion
3.1. Identification at the molecular level
3.2. Rapid indication for AgNPs preparation
3.3. Characterization of the produced silver nanoparticles
3.3.1. UV spectrum
3.3.2. FT-IR spectrum
3.3.3. Evaluation through Zeta Sizer and Potential analysis:
3.3.4. Scanning electron microscope
3.3.5. Antibacterial potentials
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abdel-Raouf, N; Al-Enazi, N. M.; Ibraheem, I.B.M. Green biosynthesis of gold nanoparticles using Galaxaura elongata and characterization of their antibacterial activity. Arabian Journal of Chemistry. 2017, 10, S3029–S3039. [Google Scholar] [CrossRef]
- Alkhulaifi, M.M.; Alshehri, J.H.; Alwehaibi, M.A.; Awad, M.A.; Al-Enazi, N.M.; Aldosari, N.S.; Hatamleh, A.A.; Abdel- Raouf, N. Green synthesis of silver nanoparticles using Citrus limon peels and evaluation of their antibacterial and cytotoxic properties. Saudi Journal of Biological Sciences. 2020, 27, 3434–3441. [Google Scholar] [CrossRef] [PubMed]
- Ibraheem, I.B.M.; Abd-Elaziz, B.E.E.; Saad, W.F.; Fathy, W.A. Green biosynthesis of silver nanoparticles using marine Red Algae Acanthophora specifera and its antimicrobial activity. J Nanomed Nanotechnol. 2016, 7, 1–4. [Google Scholar]
- He, Y.; Xie, Y.; Huangm, Y.; Xia, D.; Zhang, Y.; Liu, Y.; Xiao, Y.; Shen, F.; He, J.; Luo, L. Optimization of cyanobacteria Microcystis aeruginosa extract to improve the yield of Ag nanoparticles with antibacterial property. International Biodeterioration & Biodegradation. 2022, 171, 105407. [Google Scholar]
- Al-Amoudi, O.A.; Mutawie, H.H.; Patel, A.V.; Blunden, G. Chemical composition and antioxidant activities of Jeddah corniche algae, Saudi Arabia. Saudi Journal of Biological Sciences. 2009, 16, 23–29. [Google Scholar] [CrossRef]
- Balantrapu, K.; Goia, D.V. Silver nanoparticles for printable electronics and biological applications. Journal of materials research. 2009, 24, 2828–2836. [Google Scholar] [CrossRef]
- Albrecht, M.A.; Evans, C.W.; Raston, C.L. Green chemistry and the health implications of nanoparticles. Green chemistry. 2006, 8, 417–432. [Google Scholar] [CrossRef]
- Li, H.; Carter, J.D.; LaBean, T.H. Nanofabrication by DNA self-assembly. Materials Today. 2009, 12, 24–32. [Google Scholar] [CrossRef]
- Rajendran, R.; Ganesan, N.; Balu, S.K.; Alagar, S.; Thandavamoorthy, P.; Thiruvengadam, D. Green synthesis, characterization, antimicrobial and cytotoxic effects of silver nanoparticles using Origanum heracleoticum L. leaf extract. Int J Pharmacy & Pharmaceutical Sci. 2015, 7, 288–293. [Google Scholar]
- Husain, S.; Sardar, M.; Fatma, T. Screening of cyanobacterial extracts for synthesis of silver nanoparticles. World Journal of Microbiology and Biotechnology. 2015, 31, 1279–1283. [Google Scholar] [CrossRef]
- Lengke, M.F.; Fleet, M.E.; Southam, G. Biosynthesis of silver nanoparticles by filamentous cyanobacteria from a silver (I) nitrate complex. Langmuir. 2007, 23, 2694–2699. [Google Scholar] [CrossRef] [PubMed]
- Alavi, M. Bacteria and fungi as major bio-sources to fabricate silver nanoparticles with antibacterial activities. Expert Review of Anti-Infective Therapy. 2022, 20, 897–906. [Google Scholar] [CrossRef]
- Hamed, S.M.; Abdel-Alim, M.M.; Abdel-Raouf, N.; Ibraheem, I.B.M. Biosynthesis of silver chloride nanoparticles using the cyanobacterium Anabaena variabilis. Life Science Journal. 2017, 14, 25–30. [Google Scholar]
- Omar, R.; Ibraheem, I.B.M.; Hassan, S.; Elsayed, N.M.K. Biogenic Synthesis of Different forms of Bio-caped Silver Nanoparticles Using Microcystis sp. and its Antimicrobial Activity. Current Nanoscience. 2023, 19, 1–13. [Google Scholar] [CrossRef]
- Arya, A.; Gupta, K.; Chundawat, T.S.; Vaya, D. Biogenic synthesis of copper and silver nanoparticles using green alga Botryococcus braunii and Its antimicrobial activity. Bioinorganic Chemistry and Applications. 2018, 7879403. [Google Scholar] [CrossRef]
- Kordy, M.G.M.; Abdel-Gabbar, M.; Soliman, H.A.; Aljohani, G.; BinSabt, M.; Ahmed, I.A.; Shaban, M. Phyto-capped Ag nanoparticles: green synthesis, characterization, and catalytic and antioxidant activities. Nanomaterials. 2022, 12, 373. [Google Scholar] [CrossRef]
- Piasecka, A.; Krzeminska, I.; Tys, J. Physical methods of microalgal biomass pretreatment. International Agrophysics. 2014, 28, 341–348. [Google Scholar] [CrossRef]
- Shirai, M.; Matumaru, K.; Ohotake, A.; Takamura, Y.; Aida, T.; Nakano, M. Development of a solid medium for growth and isolation of axenic Microcystis Strains (Cyanobacteria). Applied and Environmental Microbiology. 1989, 55, 2569–2571. [Google Scholar] [CrossRef]
- Ranjan, R.; Chinnibabu, B.; Sadhu, N. Training Manual On Live feed for Marine finfish and shellfish culture. 17th–22nd March, 2016. Isolation and Purification of microalgae. 2016, 5, 46–54. [Google Scholar]
- Rippka, R.; Deruelles, J.; Waterbury, J.B.; Herdman, M.; Stanier, R.Y. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. Microbiology. 1979, 111, 1–61. [Google Scholar] [CrossRef]
- Prabhu, N.; Raj, D.T.; Yamuna, G.K.; Ayisha, S.S.; Puspha, J.; Innocent, D. Synthesis of silver phyto nanoparticles and their antibacterial efficacy. Digest Journal of Nanomaterials & Biostructures (DJNB). 2010, 5, 185–189. [Google Scholar]
- Mock, J.J.; Barbic, M.; Smith, D.R.; Schultz, D.A.; Schultz, S. Shape effects in plasmon resonance of individual colloidal silver nanoparticles. The Journal of Chemical Physics. 2002, 116, 6755–6759. [Google Scholar] [CrossRef]
- Thatoi, P.; Kerry, R.G.; Gouda, S.; Das, G.; Pramanik, K.; Thatoi, H.; Patra, J.K. Photo-mediated green synthesis of silver and zinc oxide nanoparticles using aqueous extracts of two mangrove plant species, Heritiera fomes and Sonneratia apetala and investigation of their biomedical applications. Journal of Photochemistry and Photobiology B: Biology. 2016, 163, 311–318. [Google Scholar] [CrossRef]
- Manosalva, N.; Tortella, G.; Cristina-Diez, M.; Schalchli, H.; Seabra, A.B.; Durán, N.; Rubilar, O. Green synthesis of silver nanoparticles: effect of synthesis reaction parameters on antimicrobial activity. World Journal of Microbiology and Biotechnology. 2019, 35, 88. [Google Scholar] [CrossRef] [PubMed]
- Arévalo-Gallegos, A.; Garcia-Perez, J.S.; Carrillo-Nieves, D.; Ramirez-Mendoza, R.; Iqbal, H.M.; Parra-Saldívar, R. Botryococcus braunii as a bioreactor for the production of nanoparticles with antimicrobial potentialities. International Journal of Nanomedicine. 2018, 13, 5591. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.U.; Wei, Y.; Khan, Z.U.H.; Tahir, K.; Khan, S.U.; Ahmad, A.; Khan, F.U.; Cheng, L.; Yuan, Q. Electrochemical and antioxidant properties of biogenic silver nanoparticles. International Journal of Electrochemical Science. 2015, 10, 7905–7916. [Google Scholar] [CrossRef]
- da Silva, M.P.; Serafini, M.Y.M.; Nádya Pesce Da, S.; Adriano, B. Development and characterization of phosphatidylcholine nanovesicles containing the antimicrobial peptide nisin. Food Research International. 2010, 43, 1198–1203. [Google Scholar] [CrossRef]
- Salehi, S.; Shandiz, S.A.S.; Ghanbar, F.; Darvish, M.R.; Ardestani, M.S.; Mirzaie, A.; Jafari, M. Phytosynthesis of silver nanoparticles using Artemisia marschalliana Sprengel aerial part extract and assessment of their antioxidant, anticancer, and antibacterial properties. International Journal of Nanomedicine. 2016, 11, 1835. [Google Scholar]
- Aiad, M.; Moursi, E.; El-Dissoky, R.; Amer, M. Response of maize crop to irrigation under different rates and doses of nitrogen fertilization in the North Nile Delta Region. Journal of Soil Sciences and Agricultural Engineering. 2014, 5, 77–92. [Google Scholar] [CrossRef]
- Ismail, G.A.; El-Sheekh, M.M.; Samy, R.M.; Gheda, S.F. Antimicrobial, antioxidant, and antiviral activities of biosynthesized silver nanoparticles by phycobiliprotein crude extract of the cyanobacteria Spirulina platensis and Nostoc linckia. BioNanoScience. 2021, 11, 355–370. [Google Scholar] [CrossRef]
- Marslin, G.; Siram, K.; Maqbool, Q.; Selvakesavan, R.K.; Kruszka, D.; Kachlicki, P.; Franklin, G. Secondary metabolites in the green synthesis of metallic nanoparticles. Materials. 2018, 11, 940. [Google Scholar] [CrossRef]
- Kuhn, D.A.; Vanhecke, D.; Michen, B.; Blank, F.; Gehr, P.; Petri-Fink, A.; Rothen-Rutishauser, B. Different endocytotic uptake mechanisms for nanoparticles in epithelial cells and macrophages. Beilstein journal of nanotechnology. 2014, 5, 1625–1636. [Google Scholar] [CrossRef] [PubMed]
- Malarkodi, C.; Rajeshkumar, S.; Paulkumar, K.; Jobitha, G.G.; Vanaja, M.; Annadurai, G. Biosynthesis of semiconductor nanoparticles by using sulfur reducing bacteria Serratia nematodiphila. Advances in nano research. 2013, 1, 83–91. [Google Scholar] [CrossRef]
- Garibo, D.; Borbón-Nuñez, H.A.; Díaz de León, J.N.; Mendoza, E.G.; Estrada, I.; Toledano-Magaña, Y.; Tiznado, H.; Ovalle-Marroquin, M.; Soto-Ramos, A.G.; Blanco, A.; Rodríguez, J.A.; Romo, O.A.; Chávez-Almazán, L.A.; Susarrey-Arce, A. Green synthesis of silver nanoparticles using Lysiloma acapulcensis exhibit high-antimicrobial activity. Scientific Reports. 2020, 10, 12805. [Google Scholar] [CrossRef] [PubMed]
- Dakal, T.C.; Kumar, A.; Majumdar, R.S.; Yadav, V. Mechanistic basis of antimicrobial actions of silver nanoparticles. Frontiers in Microbiology. 2016, 7, 1831. [Google Scholar] [CrossRef] [PubMed]











| Sample ID | Primer Sequence | |
|---|---|---|
| The studied cyanobacterium | Forward | GTCACGCCCGAAGTCGTTAC |
| Reverse | CCTCTGTGTGCCTAGGTATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).