Submitted:
09 October 2025
Posted:
10 October 2025
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Plant Material and Sample Preparation
2.2. Cloning of the OsPLR3 Gene via PCR
2.3. Bioinformatic Analysis
2.4. Total RNA Extraction
2.5. Gene Expression Analysis via RT-PCR
2.6. Quantitative Analysis of Gene Expression via Real-Time RT-PCR
2.7. Lignan Extraction from Rice Grains
2.8. Lignan Analysis via High-Performance Liquid Chromatography (HPLC)
3. Results
3.1. Cloning and Structural Characterization of the OsPLR3 Gene
- Isoform X1 consists of four exons (225, 135, 599, and 396 bp) and three introns (127, 483, and 531 bp), producing a 1,315 bp mRNA with an open reading frame (ORF) of 1,038 bp encoding a 345-amino acid protein.
- Isoform X2 comprises five exons (225, 135, 238, 204, and 396 bp), generating a 1,198 bp transcript with a 921 bp ORF encoding 306 amino acids.
- Isoform X3 also includes five exons (225, 135, 61, 204, and 396 bp), resulting in a 1,201 bp transcript with a 744 bp ORF encoding a 247-amino acid protein.
3.2. Conserved Domain and Motif Analysis of the OsPLR3 Isoforms
3.3. Structural Modeling and Molecular Docking Demonstrate the Enzymatic Function of the OsPLR3 Isoforms
3.4. Gene Expression Analysis of OsPLR3
3.5. Cis-Regulatory Element Analysis of the OsPLR3 Isoforms
3.6. Secoisolariciresinol Accumulation During Seed Development in Mae Phaya Thong Dam Rice
3.7. Phylogenetic Analysis of the OsPLR3 Isoforms
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CB-Dock2 | Cavity detection-based docking tool version 2 |
| CCAAT box | Common cis-acting element in promoter regions |
| GARE | Gibberellin-responsive element |
| HPLC | High-performance liquid chromatography |
| MBS | MYB binding site |
| MYB | Myeloblastosis transcription factor |
| NAD(P)H | Nicotinamide adenine dinucleotide phosphate (reduced form) |
| OsPLR3 | Oryza sativa pinoresinol–lariciresinol reductase 3 |
| RMSD | Root mean square deviation |
| TM-score | Template modeling score |
| Vina score | Docking binding energy score from AutoDock Vina |
| W box | WRKY transcription factor binding site |
References
- Karimi, R.; Rashidinejad, A. Lignans. In Handbook of Food Bioactive Ingredients: Properties and Applications, 1st ed.; Jafari, S.M., Rashidinejad, A., Simal-Gandara, J., Eds.; Springer International Publishing: Cham, Switzerland, 2022; pp. 1–26. [Google Scholar]
- Singh, R.; Iqbal, N.; Umar, S.; Ahmad, S. Lignan Enhancement: An Updated Review on the Significance of Lignan and Its Improved Production in Crop Plants. Phyton-Int. J. Exp. Bot. 2024, 93, 3237–3271. [Google Scholar] [CrossRef]
- De Silva, S.F.; Alcorn, J. Flaxseed Lignans as Important Dietary Polyphenols for Cancer Prevention and Treatment: Chemistry, Pharmacokinetics, and Molecular Targets. Pharmaceuticals 2019, 12, 68–132. [Google Scholar] [CrossRef] [PubMed]
- Cespedes, C.L.; Avila, J.G.; Garcia, A.M.; Becerra, J.; Flores, C.; Aqueveque, P.; Bittner, M.; Hoeneisen, M.; Martinez, M.; Silva, M. Antifungal and antibacterial activities of Araucaria araucana (Mol.) K. Koch heartwood lignans. Z. Naturforsch C J. Biosci. 2006, 61, 35–43. [Google Scholar] [CrossRef]
- Akiyama, K.; Yamauchi, S.; Nakato, T.; Maruyama, M.; Sugahara, T.; Kishida, T. Antifungal Activity of Tetra-Substituted Tetrahydrofuran Lignan, (−)-Virgatusin, and Its Structure-Activity Relationship. Biosci. Biotechnol. Biochem. 2007, 71, 1028–1035. [Google Scholar] [CrossRef] [PubMed]
- Cho, J.Y.; Choi, G.J.; Son, S.W.; Jang, K.S.; Lim, H.K.; Lee, S.O.; Sung, N.D.; Cho, K.Y.; Kim, J.C. Isolation and antifungal activity of lignans from Myristica fragrans against various plant pathogenic fungi. Pest Manag. Sci. 2007, 63, 935–940. [Google Scholar] [CrossRef]
- Gaafar, A.; Salama, D.Z.; Askar, M.S.; Hariri, E.M.; Bakry, B.A. In vitro antioxidant and antimicrobial activities of lignan flax seed extract (Linum usitatissimum, L.). Int. J. Pharm. Sci. Rev. Res. 2013, 23, 291–297. [Google Scholar]
- Markulin, L.; Corbin, C.; Renouard, S.; Drouet, S.; Gutierrez, L.; Mateljak, I.; Auguin, D.; Hano, C.; Fuss, E.; Laine, E. Pinoresinol-lariciresinol reductases, key to the lignan synthesis in plants. Planta 2019, 249, 1695–1714. [Google Scholar] [CrossRef] [PubMed]
- Hano, C.; Martin, I.; Fliniaux, O.; Legrand, B.; Gutierrez, L.; Arroo, R.R.; Mesnard, F.; Lamblin, F.; Laine, E. Pinoresinol-lariciresinol reductase gene expression and secoisolariciresinol diglucoside accumulation in developing flax (Linum usitatissimum) seeds. Planta 2006, 224, 1291–1301. [Google Scholar] [CrossRef]
- Hemmati, S.; Schmidt, T.J.; Fuss, E. (+)-Pinoresinol/(−)-lariciresinol reductase from Linum perenne Himmelszelt involved in the biosynthesis of justicidin B. FEBS Lett. 2007, 581, 603–610. [Google Scholar] [CrossRef]
- Andargie, M.; Vinas, M.; Rathgeb, A.; Moller, E.; Karlovsky, P. Lignans of Sesame (Sesamum indicum L.): A Comprehensive Review. Molecules 2021, 26, 883–935. [Google Scholar] [CrossRef]
- Kim, H.J.; Ono, E.; Morimoto, K.; Yamagaki, T.; Okazawa, A.; Kobayashi, A.; Satake, H. Metabolic engineering of lignan biosynthesis in Forsythia cell culture. Plant Cell Physiol. 2009, 50, 2200–2209. [Google Scholar] [CrossRef]
- Durazzo, A.; Zaccaria, M.; Polito, A.; Maiani, G.; Carcea, M. Lignan Content in Cereals, Buckwheat and Derived Foods. Foods 2013, 2, 53–63. [Google Scholar] [CrossRef]
- Das, M.; Dash, U.; Mahanand, S.S.; Nayak, P.K.; Kesavan, R.K. Black rice: A comprehensive review on its bioactive compounds, potential health benefits and food applications. Food Chem. Adv. 2023, 3, 100462–100472. [Google Scholar] [CrossRef]
- Vargas, C.G.; da Silva Junior, J.D.; Rabelo, T.K.; Moreira, J.C.F.; Gelain, D.P.; Rodrigues, E.; Augusti, P.R.; Rios, A.O.; Flôres, S.H. Bioactive compounds and protective effect of red and black rice brans extracts in human neuron-like cells (SH-SY5Y). Food Res. Int. 2018, 113, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Goufo, P.; Trindade, H. Rice antioxidants: Phenolic acids, flavonoids, anthocyanins, proanthocyanidins, tocopherols, tocotrienols, gamma-oryzanol, and phytic acid. Food Sci. Nutr. 2014, 2, 75–104. [Google Scholar] [CrossRef]
- Liu, G.; Wang, H.; Gao, H.; Yu, S.; Liu, C.; Wang, Y.; Sun, Y.; Zhang, D. Alternative Splicing of Functional Genes in Plant Growth, Development, and Stress Responses. Int. J. Mol. Sci. 2025, 26, 5864–5883. [Google Scholar] [CrossRef] [PubMed]
- Lam, P.Y.; Wang, L.; Lo, C.; Zhu, F.Y. Alternative Splicing and Its Roles in Plant Metabolism. Int. J. Mol. Sci. 2022, 23, 7355–7375. [Google Scholar] [CrossRef]
- Xu, Z.; Xiao, Y.; Guo, J.; Lv, Z.; Chen, W. Relevance and regulation of alternative splicing in plant secondary metabolism: Current understanding and future directions. Hortic. Res. 2024, 11, 173–188. [Google Scholar] [CrossRef]
- Kapustin, Y.; Souvorov, A.; Tatusova, T.; Lipman, D. Splign: Algorithms for computing spliced alignments with identification of paralogs. Biol. Direct 2008, 3, 20–33. [Google Scholar] [CrossRef] [PubMed]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar]
- Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Gonzales, N.R.; Gwadz, M.; Lu, S.; Marchler, G.H.; Song, J.S.; Thanki, N.; Yamashita, R.A.; Yang, M.; Zhang, D.; Zheng, C.; Lanczycki, C.J.; Marchler-Bauer, A. The conserved domain database in 2023. Nucleic Acids Res. 2023, 51, 384–388. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Zheng, W.; Wuyun, Q.; Li, Y.; Liu, Q.; Zhou, X.; Peng, C.; Zhu, Y.; Freddolino, L.; Zhang, Y. Deep-learning-based single-domain and multidomain protein structure prediction with D-I-TASSER. Nat. Biotechnol. 2025, 1−26.
- Liu, Y.; Yang, X.; Gan, J.; Chen, S.; Xiao, Z.X.; Cao, Y. CB-Dock2: Improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting. Nucleic Acids Res. 2022, 50, 159–164. [Google Scholar] [CrossRef]
- Kim, S.; Chen, J.; Cheng, T.; Gindulyte, A.; He, J.; He, S.; Li, Q.; Shoemaker, B.A.; Thiessen, P.A.; Yu, B.; Zaslavsky, L.; Zhang, J.; Bolton, E.E. PubChem 2025 update. Nucleic Acids Res. 2025, 53, 1516–1525. [Google Scholar] [CrossRef] [PubMed]
- Lescot, M.; Dehais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouze, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hutabarat, L.S.; Greenfield, H.; Mulholland, M. Quantitative determination of isoflavones and coumestrol in soybean by column liquid chromatography. J. Chromatogr. A 2000, 886, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Kuhnle, G.G.; Dell’aquila, C.; Low, Y.L.; Kussmaul, M.; Bingham, S.A. Extraction and quantification of phytoestrogens in foods using automated solid-phase extraction and LC/MS/MS. Anal. Chem. 2007, 79, 9234–9239. [Google Scholar] [CrossRef]
- von Heimendahl, C.B.; Schafer, K.M.; Eklund, P.; Sjoholm, R.; Schmidt, T.J.; Fuss, E. Pinoresinol-lariciresinol reductases with different stereospecificity from Linum album and Linum usitatissimum. Phytochemistry 2005, 66, 1254–1263. [Google Scholar] [CrossRef]
- Xia, Z.Q.; Costa, M.A.; Pelissier, H.C.; Davin, L.B.; Lewis, N.G. Secoisolariciresinol dehydrogenase purification, cloning, and functional expression. Implications for human health protection. J. Biol. Chem. 2001, 276, 12614–12623. [Google Scholar] [CrossRef]
- Meagher, L.P.; Beecher, G.R.; Flanagan, V.P.; Li, B.W. Isolation and Characterization of the Lignans, Isolariciresinol and Pinoresinol, in Flaxseed Meal. J. Agric. Food Chem. 1999, 47, 3173–3180. [Google Scholar] [CrossRef] [PubMed]
- Sicilia, T.; Niemeyer, H.B.; Honig, D.M.; Metzler, M. Identification and Stereochemical Characterization of Lignans in Flaxseed and Pumpkin Seeds. J. Agric. Food Chem. 2003, 51, 1181–1188. [Google Scholar] [CrossRef] [PubMed]
- Fryatt, T.; Botting, N.P. The synthesis of multiply 13C-labelled plant and mammalian lignans as internal standards for LC-MS and GC-MS analysis. J. Label. Compd. Radiopharm. 2005, 48, 951–969. [Google Scholar] [CrossRef]
- Youn, B.; Moinuddin, S.; Davin, L.; Lewis, N.; Kang, C. Crystal Structures of Apo-form and Binary/Ternary Complexes of Podophyllum Secoisolariciresinol Dehydrogenase, an Enzyme Involved in Formation of Health-protecting and Plant Defense Lignans. J. Biol. Chem. 2005, 280, 12917–12926. [Google Scholar] [CrossRef]
- Venglat, P.; Xiang, D.; Qiu, S.; Stone, S.L.; Tibiche, C.; Cram, D.; Alting-Mees, M.; Nowak, J.; Cloutier, S.; Deyholos, M.; Bekkaoui, F.; Sharpe, A.; Wang, E.; Rowland, G.; Selvaraj, G.; Datla, R. Gene expression analysis of flax seed development. BMC Plant Biol. 2011, 11, 74–89. [Google Scholar] [CrossRef]
- Raxwal, V.K.; Riha, K. The Biological Functions of Nonsense-Mediated mRNA Decay in Plants: RNA Quality Control and Beyond. Biochem. Soc. Trans. 2023, 14, 31–39. [Google Scholar]
- Renouard, S.; Tribalatc, M.-A.; Lamblin, F.; Mongelard, G.; Fliniaux, O.; Corbin, C.; Marosevic, D.; Pilard, S.; Demailly, H.; Gutierrez, L.; Hano, C.; Mesnard, F.; Lainé, E. RNAi-mediated pinoresinol lariciresinol reductase gene silencing in flax (Linum usitatissimum L.) seed coat: Consequences on lignans and neolignans accumulation. J. Plant Physiol. 2014, 171, 1372–1377. [Google Scholar] [CrossRef]
- Dinkova-Kostova, A.T.; Gang, D.R.; Davin, L.B.; Bedgar, D.L.; Chu, A.; Lewis, N.G. (+)-Pinoresinol/(+)-lariciresinol reductase from Forsythia intermedia. Protein purification, cDNA cloning, heterologous expression and comparison to isoflavone reductase. J. Biol. Chem. 1996, 271, 29473–29482. [Google Scholar] [CrossRef]
- Min, T.; Kasahara, H.; Bedgar, D.L.; Youn, B.; Lawrence, P.K.; Gang, D.R.; Halls, S.C.; Park, H.; Hilsenbeck, J.L.; Davin, L.B.; Lewis, N.G.; Kang, C. Crystal Structures of Pinoresinol-Lariciresinol and Phenylcoumaran Benzylic Ether Reductases and Their Relationship to Isoflavone Reductases. J. Biol. Chem. 2003, 278, 50714–50723. [Google Scholar] [CrossRef] [PubMed]
- Tamura, M.; Tsuji, Y.; Kusunose, T.; Okazawa, A.; Kamimura, N.; Mori, T.; Nakabayashi, R.; Hishiyama, S.; Fukuhara, Y.; Hara, H.; Sato-Izawa, K.; Muranaka, T.; Saito, K.; Katayama, Y.; Fukuda, M.; Masai, E.; Kajita, S. Successful expression of a novel bacterial gene for pinoresinol reductase and its effect on lignan biosynthesis in transgenic Arabidopsis thaliana. Appl. Microbiol. Biotechnol. 2014, 98, 8165–8177. [Google Scholar] [CrossRef]
- Rainha, J.; Gomes, D.; Rodrigues, L.R.; Rodrigues, J.L. Synthetic Biology Approaches to Engineer Saccharomyces cerevisiae towards the Industrial Production of Valuable Polyphenolic Compounds. Life 2020, 10, 56–77. [Google Scholar] [CrossRef] [PubMed]









| OsPLR3 Isoform | Ligand | Vina Score (kcal/mol) | Binding Pocket (CurPocket ID) | Cavity Volume (Å3) |
Key Contact Residues† | Figure |
|---|---|---|---|---|---|---|
| X1 | Pinoresinol | –8.5 | C2 | 934 | GLU112, TYR113, ASN153, PHE154, LEU155, TYR158, LYS133 | 5A |
| X1 | Lariciresinol | –9.6 | C2 | 934 | GLU112, TYR113, ASN153, PHE154, LEU155, TYR158, LYS133 | 5B |
| X2 | Pinoresinol | –8.4 | C2 | 1028 | GLU112, TYR113, GLY114, LEU115, ASN153, PHE154, LEU155, LYS133 | 5C |
| X2 | Lariciresinol | –9.2 | C2 | 1028 | GLU112, TYR113, GLY114, LEU115, ASN153, PHE154, LEU155, LYS133 | 5D |
| Primer name | Sequence (5′→3′) | Tm | Ta | PCR product size (base pairs) | ||
|---|---|---|---|---|---|---|
| Isoform X1 | Isoform X2 | Isoform X3 | ||||
| OsPLR3.Ex.F | AAGATTACCCGAGCCTGCTG | 60.5 | 56 | 584 | 487 | 290 |
| OsPLR3.Ex.R | GACATTTCCCGAGGGTCTCA | 60.5 | 56 | |||
| Rice Extract | Secoisolariciresinol (mg/g ground rice) |
|---|---|
| Milky | 1.70 ± 0.20ᵃ |
| Soft dough | 2.10 ± 0.25b |
| Maturity | 3.45 ± 0.19c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).