Submitted:
01 September 2025
Posted:
02 September 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Identification of HUCMSCs and HFD/STZ-Induced T2DM Mouse Model
2.2. Illustrates the Effects of HUCMSCs Combined with 20(R)-Rg3 on Insulin Resistance in Mice with T2DM
2.3. HUCMSCs Combined with 20(R)-Rg3 Promote Glycogen Storage in T2DM Mice
2.4. HUCMSCs Combined with 20(R)-Rg3 Promote Insulin Secretion and Islet Regeneration
2.5. Transcriptome Differential Expression Analysis
2.6. Functional Enrichment Analysis of Differentially Expressed Genes
3. Discussion
Synergistic Mechanisms of HUCMSCs and 20(R)-Rg3: Toward a “1 + 1 > 2” Effect
4. Materials and Methods
4.1. Animals and Treatment
4.2. Oral Glucose Tolerance Tests (OGTTs)
4.3. Intraperitoneal Insulin Tolerance Tests (IPITTs)
4.4. Culture for the Identification of HUCMSCs
4.5. Osteogenic Differentiation Assay
4.6. Adipogenic Differentiation Assay
4.7. Biochemical Sampling and Analysis
4.8. RNA Sequencing
4.9. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
4.10. Histological Analysis
4.11. Immunofluorescence Analysis
4.12. Single-Cell RNA Sequencing (scRNA-seq)
4.12.1. Sample Quality Control
4.12.2. Library Preparation for Transcriptome Sequencing
4.12.3. Clustering and Sequencing (Novogene Experimental Department)
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Consent for publication
Declaration of Competing Interest
Abbreviations
| HUCMSCs | human umbilical cord mesenchymal stem cells |
| T2DM | type 2 diabetes mellitus |
| HFD | high-fat diet |
| STZ | streptozotocin |
| TG | triglycerides |
| TC | total cholesterol |
| LDL | low-density lipoprotein |
| HDL | high-density lipoprotein |
| DM | diabetes mellitus |
| IR | insulin resistance |
| AMPK | adenosine monophosphate-activated protein kinase |
| PPARγ | peroxisome proliferator-activated receptor γ |
| IRS-1 | insulin receptor substrate |
| OGTTs | oral glucose tolerance tests |
| IPITTs | intraperitoneal insulin tolerance tests |
| TP | total protein |
| ALB | albumin |
| AST | aspartate aminotransferase |
| ALT | alanine aminotransferase ; |
| Cr | creatinine |
| BUN | blood urea nitrogen |
| C-P | C-peptide |
| VEGF | vascular endothelial growth factor |
| PGE2 | prostaglandin E2 |
| HbA1c | glycated hemoglobin |
| INS | insulin concentration |
| ELISA | enzyme-linked immunosorbent assay |
| GO | gene ontology |
| KEGG | kyoto encyclopedia of genes and genomes |
| cDNA | complementary DNA |
| PPI | protein-protein interaction |
| RT-qPCR | Real-time quantitative polymerase chain reaction |
| H&E | hematoxylin-eosin |
| PAS | periodate-Schiff staining |
| scRNA-seq | single-cell RNA sequencing |
| IDF | international diabetes federation |
| ISCT | identification criteria established by the International Society for Cell & Gene Therapy |
| GCK | glucokinase |
| PEPCK | phosphoenolpyruvate carboxykinase |
| G6Pase | glucose-6-phosphatase |
| PGC-1α | peroxisome proliferator-activated receptor gamma coactivator 1-alpha |
| TNF-α | tumor necrosis factor-α |
| IL-1β | interleukin-1β |
| PCA | principal component analysis |
| DEGs | differentially expressed genes |
| PPI | protein-protein interaction |
| HGF | hepatocyte growth factor |
| SOD | superoxide dismutase |
| NF-κB TGF-β |
nuclear factor kappa B transforming growth factor-β |
References
- SUN Y, SHI H, YIN S, et al. Human Mesenchymal Stem Cell Derived Exosomes Alleviate Type 2 Diabetes Mellitus by Reversing Peripheral Insulin Resistance and Relieving β-Cell Destruction [J]. ACS Nano, 2018, 12(8): 7613-28. [CrossRef]
- ZANG L, HAO H, LIU J, et al. Mesenchymal stem cell therapy in type 2 diabetes mellitus [J]. Diabetol Metab Syndr, 2017, 9: 36. [CrossRef]
- LU L-L, LIU L-Z, LI L, et al. Sodium butyrate improves cognitive dysfunction in high-fat diet/streptozotocin-induced type 2 diabetic mice by ameliorating hippocampal mitochondrial damage through regulating AMPK/PGC-1α pathway [J]. Neuropharmacology, 2024, 261: 110139. [CrossRef]
- RAZ I, RIDDLE M C, ROSENSTOCK J, et al. Personalized management of hyperglycemia in type 2 diabetes: reflections from a Diabetes Care Editors' Expert Forum [J]. Diabetes Care, 2013, 36(6): 1779-88.
- NYENWE E A, JERKINS T W, UMPIERREZ G E, et al. Management of type 2 diabetes: evolving strategies for the treatment of patients with type 2 diabetes [J]. Metabolism, 2011, 60(1). [CrossRef]
- BOURA-HALFON S, ZICK Y. Phosphorylation of IRS proteins, insulin action, and insulin resistance [J]. Am J Physiol Endocrinol Metab, 2009, 296(4): E581-E91. [CrossRef]
- WANG M, SONG L, STRANGE C, et al. Therapeutic Effects of Adipose Stem Cells from Diabetic Mice for the Treatment of Type 2 Diabetes [J]. Mol Ther, 2018, 26(8): 1921-30. [CrossRef]
- OH K-K, YOON S-J, SONG S H, et al. The synchronized feature of Saururus chinensis and gut microbiota against T2DM, NAFLD, obesity and hypertension via integrated pharmacology [J]. Artif Cells Nanomed Biotechnol, 2024, 52(1): 278-90. [CrossRef]
- CHEN Q, QIU F-S, XIE W, et al. Gypenoside A-loaded mPEG-PLGA nanoparticles ameliorate high-glucose-induced retinal microvasculopathy by inhibiting ferroptosis [J]. Int J Pharm, 2024, 666: 124758. [CrossRef]
- VIKRAM A, TRIPATHI D N, KUMAR A, et al. Oxidative stress and inflammation in diabetic complications [J]. Int J Endocrinol, 2014, 2014: 679754. [CrossRef]
- YE C, LI Y, SHI J, et al. Network pharmacology analysis revealed the mechanism and active compounds of jiao tai wan in the treatment of type 2 diabetes mellitus via SRC/PI3K/AKT signaling [J]. J Ethnopharmacol, 2025, 337(Pt 2): 118898. [CrossRef]
- NAUCK M A, WEFERS J, MEIER J J. Treatment of type 2 diabetes: challenges, hopes, and anticipated successes [J]. Lancet Diabetes Endocrinol, 2021, 9(8): 525-44. [CrossRef]
- LU L L, LIU L Z, LI L, et al. Sodium butyrate improves cognitive dysfunction in high-fat diet/streptozotocin-induced type 2 diabetic mice by ameliorating hippocampal mitochondrial damage through regulating AMPK/PGC-1α pathway [J]. Neuropharmacology, 2024, 261: 110139.
- ABU-RMEILEH N M E, HUSSEINI A, CAPEWELL S, et al. Preventing type 2 diabetes among Palestinians: comparing five future policy scenarios [J]. BMJ Open, 2013, 3(12): e003558. [CrossRef]
- SONG J, LIU J, CUI C, et al. Mesenchymal stromal cells ameliorate diabetes-induced muscle atrophy through exosomes by enhancing AMPK/ULK1-mediated autophagy [J]. J Cachexia Sarcopenia Muscle, 2023, 14(2): 915-29. [CrossRef]
- YIN Y, HAO H, CHENG Y, et al. The homing of human umbilical cord-derived mesenchymal stem cells and the subsequent modulation of macrophage polarization in type 2 diabetic mice [J]. Int Immunopharmacol, 2018, 60: 235-45. [CrossRef]
- AIERKEN A, LI B, LIU P, et al. Melatonin treatment improves human umbilical cord mesenchymal stem cell therapy in a mouse model of type II diabetes mellitus via the PI3K/AKT signaling pathway [J]. Stem cell research & therapy, 2022, 13(1): 164. [CrossRef]
- DE SOUZA L R, JENKINS A L, JOVANOVSKI E, et al. Ethanol extraction preparation of American ginseng (Panax quinquefolius L) and Korean red ginseng (Panax ginseng C.A. Meyer): differential effects on postprandial insulinemia in healthy individuals [J]. J Ethnopharmacol, 2015, 159: 55-61. [CrossRef]
- SMITH I, WILLIAMSON E M, PUTNAM S, et al. Effects and mechanisms of ginseng and ginsenosides on cognition [J]. Nutr Rev, 2014, 72(5): 319-33. [CrossRef]
- WONG A S T, CHE C-M, LEUNG K-W. Recent advances in ginseng as cancer therapeutics: a functional and mechanistic overview [J]. Nat Prod Rep, 2015, 32(2): 256-72.
- YUAN H-D, KIM J T, KIM S H, et al. Ginseng and diabetes: the evidences from in vitro, animal and human studies [J]. J Ginseng Res, 2012, 36(1): 27-39.
- MOHANAN P, SUBRAMANIYAM S, MATHIYALAGAN R, et al. Molecular signaling of ginsenosides Rb1, Rg1, and Rg3 and their mode of actions [J]. J Ginseng Res, 2018, 42(2): 123-32. [CrossRef]
- LEE C H, KIM J-H. A review on the medicinal potentials of ginseng and ginsenosides on cardiovascular diseases [J]. J Ginseng Res, 2014, 38(3): 161-6.
- HWANG J-T, LEE M-S, KIM H-J, et al. Antiobesity effect of ginsenoside Rg3 involves the AMPK and PPAR-gamma signal pathways [J]. Phytother Res, 2009, 23(2): 262-6.
- GINSBERG H N, MACCALLUM P R. The obesity, metabolic syndrome, and type 2 diabetes mellitus pandemic: II. Therapeutic management of atherogenic dyslipidemia [J]. J Clin Hypertens (Greenwich), 2009, 11(9): 520-7. [CrossRef]
- SMITH B K, STEINBERG G R. AMP-activated protein kinase, fatty acid metabolism, and insulin sensitivity [J]. Curr Opin Clin Nutr Metab Care, 2017, 20(4): 248-53. [CrossRef]
- DONG X, KONG L, HUANG L, et al. Ginsenoside Rg1 treatment protects against cognitive dysfunction via inhibiting PLC-CN-NFAT1 signaling in T2DM mice [J]. J Ginseng Res, 2023, 47(3): 458-68. [CrossRef]
- CHEN Q, QIU F S, XIE W, et al. Gypenoside A-loaded mPEG-PLGA nanoparticles ameliorate high-glucose-induced retinal microvasculopathy by inhibiting ferroptosis [J]. Int J Pharm, 2024, 666: 124758. [CrossRef]
- CAI Y, LI Y, XIONG Y, et al. Diabetic foot exacerbates gut mycobiome dysbiosis in adult patients with type 2 diabetes mellitus: revealing diagnostic markers [J]. Nutr Diabetes, 2024, 14(1): 71. [CrossRef]
- KOWALSKA K, WILCZOPOLSKI P, BUŁAWSKA D, et al. The Importance of SGLT-2 Inhibitors as Both the Prevention and the Treatment of Diabetic Cardiomyopathy [J]. Antioxidants (Basel), 2022, 11(12). [CrossRef]
- PERREAULT L, SKYLER J S, ROSENSTOCK J. Novel therapies with precision mechanisms for type 2 diabetes mellitus [J]. Nat Rev Endocrinol, 2021, 17(6): 364-77. [CrossRef]
- DAVIS N E, HAMILTON D, FONTAINE M J. Harnessing the immunomodulatory and tissue repair properties of mesenchymal stem cells to restore β cell function [J]. Curr Diab Rep, 2012, 12(5): 612-22. [CrossRef]
- MIKŁOSZ A, CHABOWSKI A. Adipose-derived Mesenchymal Stem Cells Therapy as a new Treatment Option for Diabetes Mellitus [J]. J Clin Endocrinol Metab, 2023, 108(8): 1889-97.
- SHEN S, LIAO Q, WONG Y K, et al. The role of melatonin in the treatment of type 2 diabetes mellitus and Alzheimer's disease [J]. Int J Biol Sci, 2022, 18(3): 983-94.
- NI J, LIU Z, JIANG M, et al. Ginsenoside Rg3 ameliorates myocardial glucose metabolism and insulin resistance via activating the AMPK signaling pathway [J]. J Ginseng Res, 2022, 46(2): 235-47. [CrossRef]
- HAN S, ZHANG X, LI Z, et al. A ginsenoside G-Rg3 PEGylated long-circulating liposome for hyperglycemia and insulin resistance therapy in streptozotocin-induced type 2 diabetes mice [J]. Eur J Pharm Biopharm, 2024, 201: 114350. [CrossRef]
- ZHANG X-J, DENG Y-X, SHI Q-Z, et al. Hypolipidemic effect of the Chinese polyherbal Huanglian Jiedu decoction in type 2 diabetic rats and its possible mechanism [J]. Phytomedicine, 2014, 21(5): 615-23. [CrossRef]









| Primer name | Primer Sequence |
| GAPDH Forward Primer | GGTGAAGGTCGGTGTGAACG |
| GAPDH Reverse Primer | CTCGCTCCTGGAAGATGGTG |
| G6Pase Forward Primer | CGACTCGCTATCTCCAAGTGA |
| G6Pase Reverse Primer | GGGCGTTGTCCAAACAGAAT |
| PEPCK Forward Primer | CTGCATAACGGTCTGGACTTC |
| PEPCK Reverse Primer | GCCTTCCACGAACTTCCTCAC |
| GCk Forward Primer | AGGAGGCCAGTGTAAAGATGT |
| GCk Reverse Primer | CTCCCAGGTCTAAGGAGAGAAA |
| IL-1β Forward Primer | GAAATGCCACCTTTTGACAGTG |
| IL-1β Reverse Primer | TGGATGCTCTCATCAGGACAG |
| TNF-α Forward Primer | CAGGCGGTGCCTATGTCTC |
| TNF-α Reverse Primer | CGATCACCCCGAAGTTCAGTAG |
| Arg1 Forward Primer | CTCCAAGCCAAAGTCCTTAGAG |
| Arg1 Reverse Primer | GGAGCTGTCATTAGGGACATCA |
| PGC-1 Forward Primer | TATGGAGTGACATAGAGTGTGCT |
| PGC-1 Reverse Primer | GTCGCTACACCACTTCAATCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).