Submitted:
23 July 2025
Posted:
25 July 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Oocyte Collection and IVM
2.2. Total RNA Extraction and cDNA Synthesis
2.3. Primer Design and Amplification Efficiency
2.4. Quantitative RT-PCR
2.5. Stability of Candidate Reference Genes and Determination of the Transcript Levels of Bmp15 and Sirt1
2.6. Statistical Analysis
3. Results
3.1. In Vitro Maturation of Alpaca Oocytes
3.2. Specificity and Amplification Efficiency
3.3. Cycle Threshold (Ct) Values and Variations in RGs
3.4. Stability of Candidate Reference Genes
3.5. Determination of the Sirt1 and Bmp15 Expression Profile
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Quina, E. Inseminación artificial de alpacas en un contexto de crianza campesina; Descosur: Arequipa, Peru, 2017. [Google Scholar]
- Rodriguez, J.S.; Pearson, L.K.; Tibary, A. Infertility and Subfertility in the Female Camelid. In Llama and Alpaca Care: Medicine, Surgery, Reproduction, Nutrition, and Herd Health, 1st ed.; Cebra, C., Anderson, D.E., Tibary, A., Van Saun, R.J., Johnson, L.W., Eds.; W.B. Saunders: St. Louis, MO, USA, 2014; pp. 216–243. [Google Scholar] [CrossRef]
- Ferré, L.B.; Kjelland, M.E.; Strøbech, L.B.; Hyttel, P.; Mermillod, P.; Ross, P.J. Review: Recent advances in bovine in vitro embryo production: Reproductive biotechnology history and methods. Animals 2020, 14, 991–1004. [Google Scholar] [CrossRef] [PubMed]
- Aguila, L.; Treulen, F.; Therrien, J.; Felmer, R.; Valdivia, M.; Smith, L.C. Oocyte Selection for In Vitro Embryo Production in Bovine Species: Noninvasive Approaches for New Challenges of Oocyte Competence. Animals 2020, 10, 2196. [Google Scholar] [CrossRef] [PubMed]
- Wani, N.A. In Vitro Embryo Production (IVEP) in Camelids: Present Status and Future Perspectives. Reprod. Biol. 2021, 21, 100471. [Google Scholar] [CrossRef] [PubMed]
- Telfer, E.E.; Sakaguchi, K.; Clarkson, Y.L.; McLaughlin, M. In Vitro Growth of Immature Bovine Follicles and Oocytes. Reprod. Fertil. Dev. 2019, 32, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Tukur, H.A.; Aljumaah, R.S.; Swelum, A.; Alowaimer, A.; Saadeldin, I.M. Oocyte Development and Its Regulation. J. Anim. Reprod. Biotechnol. 2020, 35, 2–11. [Google Scholar] [CrossRef]
- Conti, M.; Franciosi, F. Acquisition of Oocyte Competence to Develop as an Embryo: Integrated Nuclear and Cytoplasmic Events. Hum. Reprod. Update 2018, 24, 245–266. [Google Scholar] [CrossRef] [PubMed]
- Sovernigo, T.C.; Adona, P.R.; Monzani, P.S.; Guemra, S.; Barros, F.D.A.; Lopes, F.G.; et al. Effects of Supplementation of Medium with Different Antioxidants during In Vitro Maturation of Bovine Oocytes on Subsequent Embryo Production. Reprod. Domest. Anim. 2017, 52, 561–569. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Tian, X.; Zhang, L.; He, C.; Ji, P.; Li, Y.; Tan, D.; Liu, G. Beneficial Effect of Resveratrol on Bovine Oocyte Maturation and Subsequent Embryonic Development after In Vitro Fertilization. Fertil. Steril. 2014, 101, 577–586. [Google Scholar] [CrossRef] [PubMed]
- Kwak, S.S.; Cheong, S.A.; Jeon, Y.; Lee, E.; Choi, K.C.; Jeung, E.B.; et al. The Effects of Resveratrol on Porcine Oocyte In Vitro Maturation and Subsequent Embryonic Development after Parthenogenetic Activation and In Vitro Fertilization. Theriogenology 2012, 78, 86–101. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhu, X.; Liang, X.; Xu, H.; Liao, Y.; Lu, K.; et al. Effects of Resveratrol on In Vitro Maturation of Porcine Oocytes and Subsequent Early Embryonic Development Following Somatic Cell Nuclear Transfer. Reprod. Domest. Anim. 2019, 54, 1195–1205. [Google Scholar] [CrossRef] [PubMed]
- VanGuilder, H.D.; Vrana, K.E.; Freeman, W.M. Twenty-Five Years of Quantitative PCR for Gene Expression Analysis. Biotechniques. 2008, 44, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Bär, M.; Bär, D.; Lehmann, B. Selection and Validation of Candidate Housekeeping Genes for Studies of Human Keratinocytes—Review and Recommendations. J. Invest. Dermatol. 2009, 129, 535–537. [Google Scholar] [CrossRef] [PubMed]
- Fathi, M.; Ashry, M.; Salama, A.; Badr, M.R. Developmental Competence of Dromedary Camel (Camelus dromedarius) Oocytes Selected Using Brilliant Cresyl Blue Staining. Zygote 2017, 25, 529–536. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wang, Q.; Cui, M.; Li, Q.; Mu, S.; Zhao, Z. Effect of Melatonin on the In Vitro Maturation of Porcine Oocytes, Development of Parthenogenetically Activated Embryos, and Expression of Genes Related to the Oocyte Developmental Capability. Animals 2020, 10, 207. [Google Scholar] [CrossRef] [PubMed]
- Azari, M.; Kafi, M.; Ebrahimi, B.; Fatehi, R.; Jamalzadeh, M. Oocyte Maturation, Embryo Development and Gene Expression Following Two Different Methods of Bovine Cumulus-Oocyte Complexes Vitrification. Vet. Res. Commun. 2017, 41, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Radonić, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.; Nitsche, A. Guideline to Reference Gene Selection for Quantitative Real-Time PCR. Biochem. Biophys. Res. Commun. 2004, 313, 856–862. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, E45. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Zakrajsek, B.A. Effect of experimental treatment on housekeeping gene expression: Validation by real-time, quantitative RT-PCR. J. Biochem. Biophys. Methods 2000, 46, 69–81. [Google Scholar] [CrossRef] [PubMed]
- Thellin, O.; Zorzi, W.; Lakaye, B.; De, B. Housekeeping genes as internal standards: Use and. J Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef] [PubMed]
- Nestorov, J.; Matić, G.; Elaković, I.; Tanić, N. Gene expression studies: How to obtain accurate and reliable data by quantitative real-time RT PCR. J. Med. Biochem. 2013, 32, 325–338. [Google Scholar] [CrossRef]
- Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; et al. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef] [PubMed]
- Cadenas, J.; Pors, S.E.; Nikiforov, D.; Zheng, M.; Subiran, C.; Bøtkjær, J.A.; et al. Validating reference gene expression stability in human ovarian follicles, oocytes, cumulus cells, ovarian medulla, and ovarian cortex tissue. Int. J. Mol. Sci. 2022, 23, 886. [Google Scholar] [CrossRef] [PubMed]
- Huo, Y.; Li, X.; Sun, C.; Pan, Z.; Li, Q.; Du, X. From stability to reliability: Unveiling the un-biased reference genes in porcine ovarian granulosa cells under different conditions. Gene 2024, 897, 148089. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.F.; Lan, X.L.; Chen, F.L.; Yang, Y.Z.; Jin, Y.P.; Wang, A.H. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period. PLoS ONE 2013, 8, e62462. [Google Scholar] [CrossRef] [PubMed]
- Nikishin, D.A.; Filatov, M.A.; Kiseleva, M.V.; Bagaeva, T.S.; Konduktorova, V.V.; Khramova, Y.V.; et al. Selection of stable expressed reference genes in native and vitrified/thawed human ovarian tissue for analysis by qRT-PCR and Western blot. J. Assist. Reprod. Genet. 2018, 35, 1851. [Google Scholar] [CrossRef] [PubMed]
- Lv, Y.; Zhao, S.G.; Lu, G.; Leung, C.K.; Xiong, Z.Q.; Su, X.W.; et al. Identification of reference genes for qRT-PCR in granulosa cells of healthy women and polycystic ovarian syndrome patients. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Filatov, M.A.; Nikishin, D.A.; Khramova, Y.V.; Semenova, M.L. Reference genes selection for real-time quantitative PCR analysis in mouse germinal vesicle oocytes. Zygote 2019, 27, 392–397. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Lu, J.; Wang, Y.; Wang, S. Reference gene validation for quantification of gene expression during final oocyte maturation induced by diethylstilbestrol and di-(2-ethylhexyl)-phthalate in common carp. J. Environ. Sci. 2016, 46, 47–54. [Google Scholar] [CrossRef] [PubMed]
- O’Connor, T.; Wilmut, I.; Taylor, J. Quantitative evaluation of reference genes for real-time PCR during in vitro maturation of ovine oocytes. Reprod. Domest. Anim. 2013, 48, 477–483. [Google Scholar] [CrossRef] [PubMed]
- Mamo, S.; Gal, A.B.; Bodo, S.; Dinnyes, A. Quantitative evaluation and selection of reference genes in mouse oocytes and embryos cultured in vivo and in vitro. BMC Dev. Biol. 2007, 7, 14. [Google Scholar] [CrossRef] [PubMed]
- Paulini, F.; Melo, E.O. The role of oocyte-secreted factors GDF9 and BMP15 in follicular development and oogenesis. Reprod. Domest. Anim. 2011, 46, 354–361. [Google Scholar] [CrossRef] [PubMed]
- Zabihi, A.; Shabankareh, H.K.; Hajarian, H.; Foroutanifar, S. Resveratrol addition to in vitro maturation and in vitro culture media enhances developmental competence of sheep embryos. Domest. Anim. Endocrinol. 2019, 68, 25–31. [Google Scholar] [CrossRef] [PubMed]
- 35 Di Emidio, G.; Falone, S.; Vitti, M.; D’Alessandro, A.M.; Vento, M.; Di Pietro, C.; Amicarelli, F.; Tatone, C. SIRT1 signalling protects mouse oocytes against oxidative stress and is deregulated during aging. Hum. Reprod. 2014, 29, 2006–2017. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, J.; Zhang, Z.; Yi, J.; He, C.; Wang, F.; et al. Resveratrol compares with melatonin in improving in vitro porcine oocyte maturation under heat stress. J. Anim. Sci. Biotechnol. 2016, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.J.; Sun, A.G.; Zhao, S.G.; Liu, H.; Ma, S.Y.; Li, M.; et al. Resveratrol improves in vitro maturation of oocytes in aged mice and humans. Fertil. Steril. 2018, 109, 900–907. [Google Scholar] [CrossRef] [PubMed]
- Piras, A.R.; Ariu, F.; Maltana, A.; Leoni, G.G.; Martino, N.A.; Mastrorocco, A.; et al. Protective effect of resveratrol against cadmium-induced toxicity on ovine oocyte in vitro maturation and fertilization. J. Anim. Sci. Biotechnol. 2022, 13, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Takeo, S.; Sato, D.; Kimura, K.; Monji, Y.; Kuwayama, T.; Kawahara-Miki, R.; et al. Resveratrol improves the mitochondrial function and fertilization outcome of bovine oocytes. J. Reprod. Dev. 2014, 60, 92–99. [Google Scholar] [CrossRef] [PubMed]
- Itami, N.; Shirasuna, K.; Kuwayama, T.; Iwata, H. Resveratrol improves the quality of pig oocytes derived from early antral follicles through sirtuin 1 activation. Theriogenology 2015, 83, 1360–1367. [Google Scholar] [CrossRef] [PubMed]



| Gene | Function | Primer sequence 5’–3’ | Product sizea | GenBank Acc. No |
|---|---|---|---|---|
| Actb | Cytoskeletal structural protein | F: TCTTCCAGCCCTCCTTCCT R: GATCTCCTTCTGCATCCTGTC |
175 | XM_031676709.1 |
| Gapdh | Glycolytic enzyme | F: GTGAACCACGAGAAGTATGAC R: TCCTTCCACGATGCCAAAGT |
117 | XM_006210852.2 |
| Rplp0 | Ribosomal protein | F: AGCCACATTGCTGAACATGC R: TAACCAATCTGCAGACACACG |
154 | HQ385999.1 |
| Ppia | Peptidyl-prolyl cis-trans isomerase activity | F: TTCATCTGCACTGCCAAGAC R: TGTCCACAGTCAGCAATGGT |
152 | XM_006217133.3 |
| Sirt1 | Oxidative stress | F: ACCTCCACGACCACAAAAAG R: ACACACCTGGGTCATCAACA |
167 | XM_006220260 |
| Bmp15 | Folliculogenesis | F: TTCTTCTTTGGGGACTGGTG R: AGCATATACCGCAAGGGATG |
184 | XM_006217832.3 |
| Group | Biological replicates | Total Number of oocytes | Maturation rate n (%) |
|---|---|---|---|
| Control | 14 | 334 | 94 (28.1 %)a |
| Resv 2 µM Resv 10 µM |
10 15 |
218 351 |
87 (39.9 %)b 94 (26.8 %)a |
| Rank | ∆CT | BestKeeper | NormFinder | GeNorm |
|---|---|---|---|---|
| 1 | Rplp0 | Gapdh | Rplp0 | Gapdh / Rplp0 |
| 2 | Ppia | Rplp0 | Ppia | |
| 3 | Gapdh | Ppia | Actb | Ppia |
| 4 | Actb | Actb | Gapdh | Actb |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).