Submitted:
12 December 2024
Posted:
14 December 2024
You are already at the latest version
Abstract
This study investigated whether organic acid (OA)-preserved grain could mitigate the negative effects of low crude protein (CP) diets on growth performance, intestinal health, and the coefficient of total tract digestibility (CATTD) of nutrients in weaned piglets. The grain was either conventionally dried or preserved post-harvest with 4 kg of OA per tonne. Ninety-six piglets (28 days old) were assigned to one of four diets in a 2 × 2 factorial design: (1) dried standard CP diet, (2) OA-preserved standard CP diet, (3) dried low CP diet, and (4) OA-preserved low CP diet. Standard and low CP diets contained 21% and 19% CP during the first 15 days, reducing to 19% and 17.5% CP thereafter. Faecal scores (FS) were assessed twice a day while microbial composition, inflammatory markers, colonic volatile fatty acid concentrations and intestinal morphology were measured on the 8th day post-weaning. Performance metrics were measured over the 35-day experimental period. Low CP diets consistently reduced FS (P<0.05) and increased colonic molar butyrate proportions (P<0.01) but increased duodenal IL1B expression compared to standard CP diets (P<0.05). The OA-preserved grain enhanced beneficial microbial populations (Lactobacillus, Roseburia) while lowering pro-inflammatory cytokines (IL1A, IL17) (P<0.05). While dried grain with low CP diets reduced average daily gain (ADG), colonic short-chain fatty acids (SCFA) concentrations, and nitrogen digestibility, OA-preserved grain with low CP maintained these parameters and improved final body weight (P<0.05). Overall, OA-preserved grain mitigated the performance decline associated with low CP diets by enhancing gut health, nutrient digestibility, and reducing inflammation, presenting a promising alternative nutritional strategy for post-weaned piglets.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Grain Management and Quality
2.2. Experimental Design and Diets
2.3. Animal Management
2.4. Sample Collection
2.5. Feed and Faecal Analysis
2.6. Gut Morphological Analysis
2.7. Gene Expression in the Small Intestine
2.7.1. RNA Extraction and cDNA Synthesis
2.7.2. Quantitative Real-Time Polymerase Chain Reaction (QPCR)
2.8. Microbiological Analysis
2.8.1. Microbial DNA Extraction
2.8.2. Illumina Sequencing
2.8.3. Bioinformatics
2.9. Volatile Fatty Acid Analysis
2.10. Statistical Analysis
3. Results
3.1. Grain Quality
3.2. Growth Performance and Faecal Scores
3.3. Coefficient of Apparent Total Tract Digestibility
3.4. Small Intestinal Morphology
3.5. Gene Expression Analysis
3.6. Differential Bacterial Abundance Analysis
3.6.1. Bacterial Richness and Diversity
3.6.2. Differently Abundant Phlya
3.6.3. Differently Abundant Families
3.6.4. Differently Abundant Genera
3.7. Volatile Fatty Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pluske, J.R.; Miller, D.W.; Sterndale, S.O.; Turpin, D.L. , “Associations between gastrointestinal-tract function and the stress response after weaning in pigs,” Anim. Prod. Sci., vol. 59, no. 11, p. 2015, 2019. [CrossRef]
- Lallès, J.-P.; et al. , “Gut function and dysfunction in young pigs: physiology,” Anim. Res., vol. 53, no. 4, pp. 301–316, Jul. 2004. [CrossRef]
- Pluske, J.R.; Turpin, D.L.; Kim, J.-C. , “Gastrointestinal tract (gut) health in the young pig,” Anim. Nutr., vol. 4, no. 2, pp. 187–196, Jun. 2018. [CrossRef]
- Guevarra, R.B.; et al. , “The dynamics of the piglet gut microbiome during the weaning transition in association with health and nutrition,” J. Anim. Sci. Biotechnol., vol. 9, no. 1, p. 54, Dec. 2018. [CrossRef]
- Han, X.; Hu, X.; Jin, W.; Liu, G. , “Dietary nutrition, intestinal microbiota dysbiosis and post-weaning diarrhea in piglets,” Anim. Nutr., vol. 17, pp. 188–207, Jun. 2024. [CrossRef]
- Pejsak, Z.; Kaźmierczak, P.; Butkiewicz, A.F.; Wojciechowski, J.; Woźniakowski, G. , “Alternatives to zinc oxide in pig production,” Pol. J. Vet. Sci., pp. 319–330, Mar. 2023. [CrossRef]
- Bonetti, A.; Tugnoli, B.; Piva, A.; Grilli, E. , “Towards Zero Zinc Oxide: Feeding Strategies to Manage Post-Weaning Diarrhea in Piglets,” Animals, vol. 11, no. 3, p. 642, Feb. 2021. [CrossRef]
- NRC, Nutritional Requirements of Swine. Washington DC: National Academcic Press, 2012.
- Suiryanrayna, M.V.A.N.; Ramana, J.V. , “A review of the effects of dietary organic acids fed to swine,” J. Anim. Sci. Biotechnol., vol. 6, no. 1, p. 45, Dec. 2015. [CrossRef]
- O’Doherty, J.V.; Bouwhuis, M.A.; Sweeney, T. , “Novel marine polysaccharides and maternal nutrition to stimulate gut health and performance in post-weaned pigs,” Anim. Prod. Sci., vol. 57, no. 12, p. 2376, 2017. [CrossRef]
- Heo, J.M.; Opapeju, F.O.; Pluske, J.R.; Kim, J.C.; Hampson, D.J.; Nyachoti, C.M. , “Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds: Feeding strategies without using in-feed antibiotics,” J. Anim. Physiol. Anim. Nutr., vol. 97, no. 2, pp. 207–237, Apr. 2013. [CrossRef]
- Eriksen, E.Ø.; et al. , “Post-weaning diarrhea in pigs weaned without medicinal zinc: risk factors, pathogen dynamics, and association to growth rate,” Porc. Health Manag., vol. 7, no. 1, p. 54, Dec. 2021. [CrossRef]
- Heo, J.M.; Kim, J.C.; Hansen, C.F.; Mullan, B.P.; Hampson, D.J.; Pluske, J.R. , “Feeding a diet with decreased protein content reduces indices of protein fermentation and the incidence of postweaning diarrhea in weaned pigs challenged with an enterotoxigenic strain of Escherichia coli1,” J. Anim. Sci., vol. 87, no. 9, pp. 2833–2843, Sep. 2009. [CrossRef]
- Gao, J.; et al. , “Protein Level and Infantile Diarrhea in a Postweaning Piglet Model,” Mediators Inflamm., vol. 2020, pp. 1–15, 20. 20 May. [CrossRef]
- Yun, H.M.; Lei, X.J.; Cheong, J.Y.; Kang, J.S.; Kim, I.H. , “Effect of different levels of fiber and protein on growth performance and fecal characteristics in weaning pigs,” Korean J. Agric. Sci., vol. 44, no. 3, 2017. [CrossRef]
- Lynegaard, J.C.; Kjeldsen, N.J.; Hansen, C.F.; Williams, A.R.; Nielsen, J.P.; Amdi, C. , “Reduction in Diarrhoea and Modulation of Intestinal Gene Expression in Pigs Allocated a Low Protein Diet without Medicinal Zinc Oxide Post-Weaning,” Animals, vol. 12, no. 8, p. 989, Apr. 2022. [CrossRef]
- Khan, S.H.; Iqbal, J. , “Recent advances in the role of organic acids in poultry nutrition,” J. Appl. Anim. Res., vol. 44, no. 1, pp. 359–369, Jan. 2016. [CrossRef]
- Jokiniemi, T.; Jaakkola, S.; Turunen, M.; Ahokas, J. , “Energy consumption in different grain preservation methods,” Agron. Res., vol. 12, no. 1, pp. 81–94, 2014.
- Burke, J.; Spink, J.; Hackett, R. , “Wheat in the Republic of Ireland,” in The World Wheat Book: A History of Wheat Breeding, vol. Volume 2, Lavoisier Publishing, 2011, pp. 107–118.
- Neme, K.; Mohammed, A. , “Mycotoxin occurrence in grains and the role of postharvest management as a mitigation strategies. A review,” Food Control, vol. 78, pp. 412–425, Aug. 2017. [CrossRef]
- Matumba, L.; et al. , “Five keys to prevention and control of mycotoxins in grains: A proposal,” Glob. Food Secur., vol. 30, p. 100562, Sep. 2021. [CrossRef]
- Coradi, P.C.; Fernandes, C.H.P.; Helmich, J.C.; Goneli, A.L.D. , “Effects of drying air temperature and grain initial moisture content on soybean quality (Glycine Max (L.) Merrill),” Eng. Agríc., vol. 36, no. 5, pp. 866–876, Oct. 2016. [CrossRef]
- Jimoh, K.A.; Hashim, N.; Shamsudin, R.; Man, H.C.; Jahari, M.; Onwude, D.I. , “Recent Advances in the Drying Process of Grains,” Food Eng. Rev., vol. 15, no. 3, pp. 548–576, Sep. 2023. [CrossRef]
- Menon, A.; Stojceska, V.; Tassou, S.A. , “A systematic review on the recent advances of the energy efficiency improvements in non-conventional food drying technologies,” Trends Food Sci. Technol., vol. 100, pp. 67–76, Jun. 2020. [CrossRef]
- Partanen, K.H.; Mroz, Z. , “Organic acids for performance enhancement in pig diets,” Nutr. Res. Rev., vol. 12, no. 1, pp. 117–145, Jun. 1999. [CrossRef]
- Maher, S.; et al. , “Organic acid preservation of cereal grains improves grain quality, growth performance, and intestinal health of post-weaned pigs,” Anim. Feed Sci. Technol., p. 116078, Aug. 2024. [CrossRef]
- Laca, A.; Mousia, Z.; Dı, M.; Webb, C.; Pandiella, S.S. , “Distribution of microbial contamination within cereal grains,” J. Food Eng., vol. 72, no. 4, pp. 332–338, Feb. 2006. [CrossRef]
- Soleimany, F.; Jinap, S.; Abas, F. , “Determination of mycotoxins in cereals by liquid chromatography tandem mass spectrometry,” Food Chem., vol. 130, no. 4, pp. 1055–1060, Feb. 2012. [CrossRef]
- McCARTHY, J.F.; Bowland, J.P.; Aherne, F.X. , “INFLUENCE OF METHOD UPON THE DETERMINATION OF APPARENT DIGESTIBILITY IN THE PIG,” Can. J. Anim. Sci., vol. 57, no. 1, pp. 131–135, Mar. 1977. [CrossRef]
- Walsh, A.M.; Sweeney, T.; O’Shea, C.J.; Doyle, D.N.; O’Doherty, J.V. , “Effect of dietary laminarin and fucoidan on selected microbiota, intestinal morphology and immune status of the newly weaned pig,” Br. J. Nutr., vol. 110, no. 9, pp. 1630–1638, Nov. 2013. [CrossRef]
- Clarke, L.C.; et al. , “Effect of β-glucanase and β-xylanase enzyme supplemented barley diets on nutrient digestibility, growth performance and expression of intestinal nutrient transporter genes in finisher pigs,” Anim. Feed Sci. Technol., vol. 238, pp. 98–110, Apr. 2018. [CrossRef]
- Iwaki, K.; Nimura, N.; Hiraga, Y.; Kinoshita, T.; Takeda, K.; Ogura, H. , “Amino acid analysis by reversed-phase high-performance liquid chromatography,” J. Chromatogr. A, vol. 407, pp. 273–279, Jan. 1987. [CrossRef]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. , “Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition,” J. Dairy Sci., vol. 74, no. 10, pp. 3583–3597, Oct. 1991. [CrossRef]
- Rattigan, R.; Sweeney, T.; Maher, S.; Thornton, K.; Rajauria, G.; O’Doherty, J.V. , “Laminarin-rich extract improves growth performance, small intestinal morphology, gene expression of nutrient transporters and the large intestinal microbial composition of piglets during the critical post-weaning period,” Br. J. Nutr., vol. 123, no. 3, pp. 255–263, Feb. 2020. [CrossRef]
- Caporaso, J.G.; et al. , “QIIME allows analysis of high-throughput community sequencing data,” Nat. Methods, vol. 7, no. 5, pp. 335–336, 10. 20 May. [CrossRef]
- Magoč, T.; Salzberg, S.L. , “FLASH: fast length adjustment of short reads to improve genome assemblies,” Bioinformatics, vol. 27, no. 21, pp. 2957–2963, Nov. 2011. [CrossRef]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. , “UCHIME improves sensitivity and speed of chimera detection,” Bioinformatics, vol. 27, no. 16, pp. 2194–2200, Aug. 2011. [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. , “VSEARCH: a versatile open source tool for metagenomics,” PeerJ, vol. 4, p. e2584, Oct. 2016. [CrossRef]
- Eren, A.M.; et al. , “Oligotyping: differentiating between closely related microbial taxa using 16S rRNA gene data,” Methods Ecol. Evol., vol. 4, no. 12, pp. 1111–1119, Dec. 2013. [CrossRef]
- Angly, F.E.; Dennis, P.G.; Skarshewski, A.; Vanwonterghem, I.; Hugenholtz, P.; Tyson, G.W. , “CopyRighter: a rapid tool for improving the accuracy of microbial community profiles through lineage-specific gene copy number correction,” Microbiome, vol. 2, no. 1, p. 11, Dec. 2014. [CrossRef]
- Kim, B.-R.; et al. , “Deciphering Diversity Indices for a Better Understanding of Microbial Communities,” J. Microbiol. Biotechnol., vol. 27, no. 12, pp. 2089–2093, Dec. 2017. [CrossRef]
- Wagner, B.D.; et al. , “On the Use of Diversity Measures in Longitudinal Sequencing Studies of Microbial Communities,” Front. Microbiol., vol. 9, p. 1037, 18. 20 May. [CrossRef]
- McMurdie, P.J.; Holmes, S. , “phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data,” PLoS ONE, vol. 8, no. 4, p. e61217, Apr. 2013. [CrossRef]
- Collins, C.L.; et al. , “Post-weaning and whole-of-life performance of pigs is determined by live weight at weaning and the complexity of the diet fed after weaning,” Anim. Nutr., vol. 3, no. 4, pp. 372–379, Dec. 2017. [CrossRef]
- Jeaurond, E.A.; Rademacher, M.; Pluske, J.R.; Zhu, C.H.; De Lange, C.F.M. , “Impact of feeding fermentable proteins and carbohydrates on growth performance, gut health and gastrointestinal function of newly weaned pigs,” Can. J. Anim. Sci., vol. 88, no. 2, pp. 271–281, Jun. 2008. [CrossRef]
- Pluske, J.R.; Pethick, D.W.; Hopwood, D.E.; Hampson, D.J. , “Nutritional influences on some major enteric bacterial diseases of pig,” Nutr. Res. Rev., vol. 15, no. 2, pp. 333–371, Dec. 2002. [CrossRef]
- Tang, Q.; et al. , “Nutrition strategies to control post-weaning diarrhea of piglets: From the perspective of feeds,” Anim. Nutr., vol. 17, pp. 297–311, Jun. 2024. [CrossRef]
- Kim, H.; Shin, H.; Kim, Y.Y. , “Effects of different levels of dietary crude protein on growth performance, blood profiles, diarrhea incidence, nutrient digestibility, and odor emission in weaning pigs,” Anim. Biosci., vol. 36, no. 8, pp. 1228–1240, Aug. 2023. [CrossRef]
- Lynegaard, J.C.; et al. , “Low protein diets without medicinal zinc oxide for weaned pigs reduced diarrhea treatments and average daily gain,” Animal, vol. 15, no. 1, p. 100075, Jan. 2021. [CrossRef]
- Marchetti, R.; et al. , “Protein Content in the Diet Influences Growth and Diarrhea in Weaning Piglets,” Animals, vol. 13, no. 5, p. 795, Feb. 2023. [CrossRef]
- Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. , “Gut Microbiota Dysbiosis in Postweaning Piglets: Understanding the Keys to Health,” Trends Microbiol., vol. 25, no. 10, pp. 851–873, Oct. 2017. [CrossRef]
- Ross, F.C.; et al. , “The interplay between diet and the gut microbiome: implications for health and disease,” Nat. Rev. Microbiol., Jul. 2024. [CrossRef]
- Holmes, A.J.; et al. , “Diet-Microbiome Interactions in Health Are Controlled by Intestinal Nitrogen Source Constraints,” Cell Metab., vol. 25, no. 1, pp. 140–151, Jan. 2017. [CrossRef]
- He, X.; Zhao, S.; Li, Y. , “Faecalibacterium prausnitzii: A Next-Generation Probiotic in Gut Disease Improvement,” Can. J. Infect. Dis. Med. Microbiol., vol. 2021, pp. 1–10, Mar. 2021. [CrossRef]
- Mukherjee, A.; Lordan, C.; Ross, R.P.; Cotter, P.D. , “Gut microbes from the phylogenetically diverse genus Eubacterium and their various contributions to gut health,” Gut Microbes, vol. 12, no. 1, p. 1802866, Nov. 2020. [CrossRef]
- Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.N.; Mackay, C.R.; Macia, L. , “The Role of Short-Chain Fatty Acids in Health and Disease,” in Advances in Immunology, vol. 121, Elsevier, 2014, pp. 91–119. [CrossRef]
- Bai, Y.; et al. , “Sources of Dietary Fiber Affect the SCFA Production and Absorption in the Hindgut of Growing Pigs,” Front. Nutr., vol. 8, p. 719935, Jan. 2022. [CrossRef]
- Bedford, A.; Gong, J. , “Implications of butyrate and its derivatives for gut health and animal production,” Anim. Nutr., vol. 4, no. 2, pp. 151–159, Jun. 2018. [CrossRef]
- Chen, J.; Vitetta, L. , “The Role of Butyrate in Attenuating Pathobiont-Induced Hyperinflammation,” Immune Netw., vol. 20, no. 2, p. e15, 2020. [CrossRef]
- Salvi, P.S.; Cowles, R.A. , “Butyrate and the Intestinal Epithelium: Modulation of Proliferation and Inflammation in Homeostasis and Disease,” Cells, vol. 10, no. 7, p. 1775, Jul. 2021. [CrossRef]
- Rattigan, R.; Sweeney, T.; Maher, S.; Ryan, M.T.; Thornton, K.; O’Doherty, J.V. , “Effects of reducing dietary crude protein concentration and supplementation with either laminarin or zinc oxide on the growth performance and intestinal health of newly weaned pigs,” Anim. Feed Sci. Technol., vol. 270, p. 114693, Dec. 2020. [CrossRef]
- Lallès, J.P.; Sève, B.; Pié, S.; Blazy, F.; Laffitte, J.; Oswald, I.P. , “Weaning Is Associated with an Upregulation of Expression of Inflammatory Cytokines in the Intestine of Piglets,” J. Nutr., vol. 134, no. 3, pp. 641–647, Mar. 2004. [CrossRef]
- Moreira, T.G.; et al. , “Dietary protein modulates intestinal dendritic cells to establish mucosal homeostasis,” Mucosal Immunol., p. S1933021924000606, Jun. 2024. [CrossRef]
- Wang, Y.; Zhou, J.; Wang, G.; Cai, S.; Zeng, X.; Qiao, S. , “Advances in low-protein diets for swine,” J. Anim. Sci. Biotechnol., vol. 9, no. 1, p. 60, Dec. 2018. [CrossRef]
- Dugan, M.E.R.; Aalhus, J.L.; Uttaro, B. , “Nutritional Manipulation of Pork Quality: Current Opportunities,” Adv. Pork Prod., vol. 15, no. 237–243, 2004.
- Connolly, R.; Sweeney, T.; Maher, S. , “Organic acid and salt treatment of cereal at harvest improves growth performance in the post weaned pig,” Anim.-Sci. Proc., vol. 13, no. 2, p. 204, 2022.
- Tugnoli; Giovagnoni; Piva; Grilli, “From Acidifiers to Intestinal Health Enhancers: How Organic Acids Can Improve Growth Efficiency of Pigs,” Animals, vol. 10, no. 1, p. 134, Jan. 2020. [CrossRef]
- Ren, C.; et al. , “Immune Response of Piglets Receiving Mixture of Formic and Propionic Acid Alone or with Either Capric Acid or Bacillus Licheniformis after Escherichia coli Challenge,” BioMed Res. Int., vol. 2019, pp. 1–9, Mar. 2019. [CrossRef]
- Holanda, D.M.; Kim, S.W. , “Mycotoxin Occurrence, Toxicity, and Detoxifying Agents in Pig Production with an Emphasis on Deoxynivalenol,” Toxins, vol. 13, no. 2, p. 171, Feb. 2021. [CrossRef]
- Wojtacha, P.; et al. , “Effects of a Low Dose of T-2 Toxin on the Percentage of T and B Lymphocytes and Cytokine Secretion in the Porcine Ileal Wall,” Toxins, vol. 13, no. 4, p. 277, Apr. 2021. [CrossRef]
- Dempsey, E.; Corr, S.C. , “Lactobacillus spp. for Gastrointestinal Health: Current and Future Perspectives,” Front. Immunol., vol. 13, p. 840245, Apr. 2022. [CrossRef]
- Cao, G.; et al. , “Effects of Bacillus licheniformis on the Growth Performance, Antioxidant Capacity, Ileal Morphology, Intestinal Short Chain Fatty Acids, and Colonic Microflora in Piglets Challenged with Lipopolysaccharide,” Animals, vol. 13, no. 13, p. 2172, Jul. 2023. [CrossRef]
- Kou, X.; et al. , “Exploring the Effect of Gastrointestinal Prevotella on Growth Performance Traits in Livestock Animals,” Animals, vol. 14, no. 13, p. 1965, Jul. 2024. [CrossRef]
- Tamanai-Shacoori, Z.; et al. , “Roseburia Spp.: A Marker of Health?,” Future Microbiol., vol. 12, no. 2, pp. 157–170, Feb. 2017. [CrossRef]
- Jiang, H.; Fang, S.; Yang, H.; Chen, C. , “Identification of the relationship between the gut microbiome and feed efficiency in a commercial pig cohort,” J. Anim. Sci., vol. 99, no. 3, p. skab045, Mar. 2021. [CrossRef]
- Amat, S.; Lantz, H.; Munyaka, P.M.; Willing, B.P. , “Prevotella in Pigs: The Positive and Negative Associations with Production and Health,” Microorganisms, vol. 8, no. 10, p. 1584, Oct. 2020. [CrossRef]
- Bergamaschi, M.; et al. , “Gut microbiome composition differences among breeds impact feed efficiency in swine,” Microbiome, vol. 8, no. 1, p. 110, Dec. 2020. [CrossRef]
- Beringer, A.; Noack, M.; Miossec, P. , “IL-17 in Chronic Inflammation: From Discovery to Targeting,” Trends Mol. Med., vol. 22, no. 3, pp. 230–241, Mar. 2016. [CrossRef]
- Di Paolo, N.C.; Shayakhmetov, D.M. , “Interleukin 1α and the inflammatory process,” Nat. Immunol., vol. 17, no. 8, pp. 906–913, Aug. 2016. [CrossRef]
- Rauw, W.M. , “Immune response from a resource allocation perspective,” Front. Genet., vol. 3, 2012. [CrossRef]
- Zhang, Q.; Hou, Y.; Bazer, F.W.; He, W.; Posey, E.A.; Wu, G. , “Amino Acids in Swine Nutrition and Production,” in Amino Acids in Nutrition and Health, vol. 1285, G. Wu, Ed., in Advances in Experimental Medicine and Biology, vol. 1285., Cham: Springer International Publishing, 2021, pp. 81–107. [CrossRef]
- Luise, D.; Chalvon-Demersay, T.; Lambert, W.; Bosi, P.; Trevisi, P. , “Meta-analysis to evaluate the impact of the reduction of dietary crude protein on the gut health of post-weaning pigs,” Ital. J. Anim. Sci., vol. 20, no. 1, pp. 1386–1397, Jan. 2021. [CrossRef]
- Den Besten, G.; Van Eunen, K.; Groen, A.K.; Venema, K.; Reijngoud, D.-J.; Bakker, B.M. , “The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism,” J. Lipid Res., vol. 54, no. 9, pp. 2325–2340, Sep. 2013. [CrossRef]
| Cereal crop type | Wheat | Barley | ||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved |
| Analysis post storage (g/kg) | ||||
| DM | 873.5 | 840.5 | 873.5 | 848.5 |
| Ash | 16.2 | 15.8 | 19.5 | 19.0 |
| GE (MJ/kg) | 15.9 | 15.2 | 16.1 | 15.6 |
| Crude protein | 89.0 | 84.5 | 103.5 | 87.5 |
| Crude fibre | 25.5 | 23.5 | 57.5 | 52.0 |
| Starch | 626.5 | 608.5 | 530.0 | 504.0 |
| Fat | 14.5 | 14.0 | 15.5 | 14.0 |
| TMC (cfu/g) | 37000 | 3800 | 27000 | 2400 |
| Mycotoxin levels (μg/kg)a | ||||
| Deoxynivalenol | <75 | <75 | <75 | <75 |
| T-2 Toxin | <4.00 | <4.00 | 6.96 | <4.00 |
| HT-2 Toxin | <4.00 | <4.00 | 30.1 | 8.66 |
| Zearalenone | <10 | <10 | <10 | <10 |
| Ochratoxin A | 3.2 | <1.00 | 1.8 | <1.0 |
| Dietary Treatments* | ||||||||
| Stage 1 Diets | Stage 2 Diets | |||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Dried | OA-preserved | Dried | OA-preserved |
| Crude protein level | Standard | Standard | Low | Low | Standard | Standard | Low | Low |
| Ingredients (g/kg) | ||||||||
| Wheat | 328 | 328 | 328 | 328 | 403 | 403 | 403 | 403 |
| Barley | 150 | 150 | 150 | 150 | 150 | 150 | 150 | 150 |
| Maize | 95 | 95 | 170 | 170 | 80.75 | 80.75 | 144.5 | 144.5 |
| Full fat soya | 170 | 170 | 140 | 140 | 144.5 | 144.5 | 119 | 119 |
| Soya bean meal | 95 | 95 | 70 | 70 | 80.75 | 80.75 | 59.5 | 59.5 |
| Soya bean concentrate | 40 | 40 | 60 | 60 | 34 | 34 | 51 | 51 |
| Whey powder | 50 | 50 | 50 | 50 | 42.5 | 42.5 | 42.5 | 42.5 |
| Soya oil | 30 | 30 | 30 | 30 | 25.5 | 25.5 | 25.5 | 25.5 |
| Starch | 4.7 | 4.7 | - | - | 4.7 | 4.7 | - | - |
| Salt | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 |
| Mono calcium phosphate | 4.2 | 4.2 | 4.2 | 4.2 | 4.2 | 4.2 | 4.2 | 4.2 |
| Calcium carbonate | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 |
| Lysine HCl | 2.5 | 2.5 | 4.9 | 4.9 | 2.5 | 2.5 | 4.9 | 4.9 |
| DL-Methionine | 2 | 2 | 2.5 | 2.5 | 2 | 2 | 2.5 | 2.5 |
| L-Threonine | 1.8 | 1.8 | 2.7 | 2.7 | 1.8 | 1.8 | 2.7 | 2.7 |
| Tryptophan | 0.3 | 0.3 | 0.7 | 0.7 | 0.3 | 0.3 | 0.7 | 0.7 |
| Valine | - | - | 0.5 | 0.5 | - | - | 0.5 | 0.5 |
| Dietary Treatments* | ||||||||
| Stage 1 Diets | Stage 2 Diets | |||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Dried | OA-preserved | Dried | OA-preserved |
| Crude protein level | Standard | Standard | Low | Low | Standard | Standard | Low | Low |
| Ingredients (g/kg) | ||||||||
| DM | 895.0 | 886.0 | 896.0 | 882.5 | 894.0 | 878.5 | 892.5 | 888.0 |
| Ash | 45.5 | 44.5 | 39.5 | 36.5 | 43.0 | 39.5 | 33.5 | 32.0 |
| GE (MJ/kg) | 17.06 | 16.74 | 16.65 | 16.74 | 16.86 | 16.58 | 16.68 | 16.47 |
| Crude fat | 63.0 | 61.0 | 58.5 | 57.0 | 57.0 | 56.0 | 54.0 | 53.0 |
| Crude protein | 193.5 | 191.5 | 185.0 | 182.5 | 188.5 | 187.5 | 172.5 | 175.0 |
| Crude fibre | 28.5 | 25.5 | 25.0 | 23.5 | 28.5 | 23.5 | 25.5 | 22.0 |
| NDF | 111.5 | 100.5 | 107.0 | 98.0 | 112.5 | 98.0 | 106.5 | 95.0 |
| ADF | 33.5 | 28.5 | 31.0 | 28.5 | 34.0 | 28.5 | 30.5 | 27.0 |
| Starch | 319.0 | 299.0 | 354.0 | 350.0 | 340.0 | 336.5 | 383.5 | 375.5 |
| Lysine | 15.67 | 15.65 | 15.57 | 15.55 | 14.07 | 14.06 | 14.24 | 14.25 |
| Threonine | 11.01 | 11.04 | 10.71 | 10.70 | 10.98 | 10.10 | 9.99 | 9.96 |
| Methionine and cysteine | 10.29 | 10.31 | 10.03 | 10.01 | 9.67 | 9.70 | 9.55 | 9.53 |
| Leucine | 19.37 | 19.35 | 17.49 | 17.45 | 14.04 | 14.06 | 14.27 | 14.30 |
| Iso-Leucine | 10.88 | 10.86 | 9.53 | 9.56 | 9.87 | 9.84 | 8.72 | 8.76 |
| Arginine | 14.34 | 14.37 | 12.05 | 12.06 | 13.05 | 13.08 | 11.10 | 11.07 |
| Histidine | 5.92 | 5.95 | 5.18 | 5.20 | 5.45 | 5.44 | 4.79 | 4.78 |
| Phenylalanine | 11.24 | 11.27 | 9.73 | 9.76 | 10.30 | 10.33 | 9.02 | 9.04 |
| Tyrosine | 7.51 | 7.53 | 6.56 | 6.54 | 6.87 | 6.90 | 6.09 | 6.07 |
| Alanine | 10.37 | 10.35 | 9.33 | 9.36 | 9.40 | 9.44 | 8.53 | 8.55 |
| Aspartic | 22.48 | 22.45 | 19.75 | 19.78 | 19.97 | 19.95 | 17.74 | 17.77 |
| Glutaminc | 46.99 | 47.1 | 41.92 | 41.90 | 44.2 | 44.6 | 40.05 | 40.01 |
| Glycine | 9.00 | 9.03 | 7.81 | 7.78 | 8.35 | 8.36 | 7.33 | 7.30 |
| Serine | 11.41 | 11.40 | 9.93 | 9.96 | 10.51 | 10.50 | 9.23 | 9.23 |
| Proline | 15.63 | 15.60 | 14.32 | 14.34 | 14.88 | 14.86 | 13.75 | 13.78 |
| Tryptophan | 2.72 | 2.74 | 2.73 | 2.74 | 2.56 | 2.55 | 2.62 | 2.60 |
| Valine | 12.02 | 12.04 | 10.62 | 10.66 | 8.62 | 8.63 | 7.83 | 7.80 |
| TMC (cfu/g) | 6200 | 3700 | 4800 | 3300 | 4300 | 3700 | 5600 | 4000 |
| Mycotoxin levels (mg/kg)a | ||||||||
| Deoxynivalenol | <75 | <75 | <75 | <75 | <75 | <75 | <75 | <75 |
| T-2 Toxin | 5.62 | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 |
| HT-2 toxin | 23.1 | 13.3 | 14.1 | 11.3 | <15.7 | <10.8 | <10.7 | <10.6 |
| Zearalenone | 35 | 37 | 30 | 27 | 39 | 31 | 23 | 25 |
| Ochratoxin | 1.09 | <1.0 | 2.39 | <1.00 | <1.65 | <1.00 | <1.60 | <1.00 |
| Target gene | Gene name | Accession no. | Forward primer (5’-3’) Reverse primer (5’-3’) |
|
|---|---|---|---|---|
| Nutrient transporters | ||||
| FABP2 | Fatty Acid Binding Protein 2 | NM_001031780.1 | F: CAGCCTCGCAGACGGAACTGAA R: GTGTTCTGGGCTGTGCTCCAAGA |
|
| SLC2A1 | Solute Carrier family 2 Member 1 | XM_003482115.1 | F: TGCTCATCAACCGCAATGA R: GTTCCGCGCAGCTTCTTC |
|
| SLC15A1 | Solute Carrier Family 15 Member 1 | NM_214347.1 | F: GGATAGCCTGTACCCCAAGCT R: CATCCTCCACGTGCTTCTTGA |
|
| Inflammatory markers | ||||
| IL1A | Interleukin 1A | NM_214029.1 | F: CAGCCAACGGGAAGATTCTG R: ATGGCTTCCAGGTCGTCAT |
|
| IL1B | Interleukin 1B | NM_001005149.1 | F: TTGAATTCGAGTCTGCCCTGT R: CCCAGGAAGACGGGCTTT |
|
| IL6 | Interleukin 6 | NM_214399.1 | F: GACAAAGCCACCACCCCTAA R:CTCGTTCTGTGACTGCAGCTTATC |
|
| CXCL8 | C-X-C motif chemokine ligand 8 | NM_213867.1 | F: TGCACTTACTCTTGCCAGAACTG R: CAAACTGGCTGTTGCCTTCTT |
|
| IL10 | Interleukin 10 | NM_214041.1 | F: GCCTTCGGCCCAGTGAA R: AGAGACCCGGTCAGCAACAA |
|
| IL17 | Interleukin 17 | NM_001005729.1 | F: CCCTGTCACTGCTGCTTCTG R: TCATGATTCCCGCCTTCAC |
|
| IL22 | Interleukin 22 | XM_001926156.1 | F: GATGAGAGAGCGCTGCTACCTGG R: GAAGGACGCCACCTCCTGCATGT |
|
| TNF | Tumour Necrosis Factor | NM_214022.1 | F: TGGCCCCTTGAGCATCA R: CGGGCTTATCTGAGGTTTGAGA |
|
| FOXP3 | Forkhead box P3 | NM_001128438.1 | F: GTGGTGCAGTCTCTGGAACAAC R: AGGTGGGCCTGCATAGCA |
|
| Tight junctions | ||||
| TJP1 | Tight Junction Protein 1 | XM_021098827.1 | F: TGAGAGCCAACCATGTCTTGAA R: CTCAGACCCGGCTCTCTGTCT |
|
| CLDN1 | Claudin 1 | NM 001244539.1 | F: CTGGGAGGTGCCCTACTTTG R: TGGATAGGGCCTTGGTGTTG |
|
| Toll like receptors | ||||
| TLR4 | Toll-like Receptor 4 | NM_001293317.1 | F: TGCATGGAGCTGAATTTCTACAA R: GATAAATCCAGCACCTGCAGTTC |
|
| Mucins | ||||
| MUC2 | Mucin 2 | AK231524 | F: CAACGGCCTCTCCTTCTCTGT R: GCCACACTGGCCCTTTGT |
|
| Reference genes | ||||
| H3F3A | Histone H3.3 | NM_213930.1 | F: CATGGCTCGTACAAAGCAGA R: ACCAGGCCTGTAACGATGAG |
|
| YWHAZ | Tyrosine 3-Monooxygenase/tyrtophan 5-monooxygenase Activation Protein Zeta | NM_001315726.1 | F: GGACATCGGATACCCAAGGA R: AAGTTGGAAGGCCGGTTAATTT |
|
| ACTB | Actin Beta | XM_001927228.1 | F:GGACATCGGATACCCAAGGA R:AAGTTGGAAGGCCGGTTAATTT |
|
| Treatments* | P Values | |||||||||||||
| Dried standard CP | OA-preserved standard CP | Dried low CP | OA-preserved low CP | SEM | Grain | Protein | Grain x Protein | Time | Time x Grain x Protein | |||||
| D0-15 | D15-35 | D0-15 | D15-35 | D0-15 | D15-35 | D0-15 | D15-35 | |||||||
| ADFI (g/DM/day) | 397 | 853 | 401 | 877 | 413 | 780 | 403 | 844 | 0.019 | 0.214 | 0.196 | 0.700 | <.0001 | 0.162 |
| ADG (g/d) | 325 | 657 | 396 | 649 | 362 | 560 | 366 | 630 | 0.022 | 0.055 | 0.127 | 0.888 | <.0001 | 0.009 |
| FCR** | 1.29 | 1.30 | 1.04 | 1.38 | 1.20 | 1.42 | 1.12 | 1.36 | 0.053 | 0.049 | 0.591 | 0.841 | <.0001 | 0.032 |
| BW (kg) | 12.27 | 23.59 | 13.13 | 24.83 | 12.82 | 22.65 | 12.90 | 24.23 | 0.538 | 0.048 | 0.513 | 0.812 | <.0001 | 0.304 |
| FS | 2.24 | - | 2.23 | - | 2.18 | - | 2.19 | - | 0.027 | 0.967 | 0.050 | 0.582 | <.0001 | 0.929 |
| Treatment* | SEM | P Values | ||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Grain | Protein | Grain x Protein | |
| Dietary crude protein level | Standard | Standard | Low | Low | ||||
| DM | 0.851ab |
0.843a |
0.845ab |
0.853b |
0.0035 | 0.953 |
0.464 |
0.023 |
| OM | 86.81ab |
85.97a | 86.30ab | 87.08b | 0.3409 |
0.920 |
0.371 |
0.019 |
| Ash | 59.47 | 60.00 |
57.70 |
60.18 |
0.6719 |
0.026 |
0.223 | 0.141 |
| N | 81.10a | 80.50ab | 78.81b | 80.84a | 0.6764 | 0.275 | 0.142 | 0.049 |
| GE | 84.24ab |
83.45a | 83.68ab | 84.72b |
0.3920 |
0.740 | 0.353 | 0.021 |
| Grain preservation method | Crude protein level | P Values | |||||||
| Dried | OA-preserved | SEM | Standard | Low | SEM | Grain | Protein | Grain x Protein | |
| Duodenum | |||||||||
| VH μm | 288.82 | 307.62 | 16.567 | 309.76 | 286.68 | 16.297 | 0.440 | 0.329 | 0.810 |
| CD μm | 127.41 | 134.54 | 6.600 | 131.90 | 130.04 | 6.551 | 0.466 | 0.843 | 0.595 |
| VH:CD | 2.38 | 2.31 | 0.147 | 2.41 | 2.28 | 0.144 | 0.755 | 0.532 | 0.577 |
| Jejunum | |||||||||
| VH μm | 304.50 | 299.40 | 18.641 | 302.81 | 301.10 | 18.337 | 0.852 | 0.948 | 0.507 |
| CD μm | 124.27 | 107.77 | 9.696 | 111.02 | 121.03 | 9.538 | 0.250 | 0.468 | 0.585 |
| VH:CD | 2.60 | 2.85 | 0.199 | 2.84 | 2.61 | 0.196 | 0.389 | 0.430 | 0.387 |
| Ileum | |||||||||
| VH μm | 315.95 | 295.16 | 12.932 | 312.51 | 298.60 | 12.722 | 0.276 | 0.450 | 0.157 |
| CD μm | 99.16 | 92.52 | 4.117 | 93.42 | 98.26 | 4.050 | 0.275 | 0.409 | 0.805 |
| VH:CD | 3.24 | 3.34 | 0.206 | 3.44 | 3.13 | 0.202 | 0.746 | 0.292 | 0.541 |
| Grain preservation method | Crude protein level | P Values | |||||||||||||||||
| Dried | OA-preserved | SEM | Standard | Low | SEM | Grain | Protein | Grain x Protein | |||||||||||
| Duodenum | |||||||||||||||||||
| IL1A | 1.35 |
0.89 |
0.152 |
0.98 |
1.26 |
0.152 |
0.037 | 0.205 |
0.375 |
||||||||||
| IL1B | 1.38 |
1.36 |
0.287 |
0.95 |
1.80 |
0.287 |
0.955 |
0.046 | 0.492 |
||||||||||
| Jejunum | |||||||||||||||||||
| IL17 | 2.13 |
0.88 |
0.405 |
1.45 |
1.56 |
0.405 |
0.036 | 0.847 |
0.520 |
||||||||||
| Ileum | |||||||||||||||||||
| IL17 | 1.45 | 0.82 | 0.167 | 1.10 | 1.17 | 0.167 | 0.013 | 0.773 | 0.891 | ||||||||||
| Phylum | Treatments* | P Values | ||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Protein | Grain x Protein |
| Crude Protein Levels | Standard | Standard | Low | Low | ||||
| Ileum | ||||||||
| Firmicutes | 92.68 |
94.57 |
99.56 |
91.20 |
4.989 |
0.460 |
0.698 |
0.244 |
| Colon | ||||||||
| Firmicutes | 79.46 |
77.58 |
76.98 |
70.84 |
3.152 |
0.197 |
0.142 |
0.471 |
| Bacteroidetes | 7.46 |
12.36 |
8.53 |
17.63 |
1.484 |
<.0001 | 0.035 | 0.325 |
| Actinobacteria | 3.59 |
3.73 |
4.65 |
3.65 |
0.815 |
0.581 |
0.516 |
0.450 |
| Tenericutes |
0.50a |
0.17a |
0.48a |
1.71b |
0.462 |
0.864 |
0.069 |
0.049 |
| Spirochaetes |
0.26 |
0.11 |
1.59 |
0.49 |
0.446 |
0.179 |
0.031 |
0.801 |
| Family | Treatments* | P Values | |||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Protein | Grain x Protein | |
| Crude Protein Content | Standard | Standard | Low | Low | |||||
| Ileum | |||||||||
| Lactobacillaceae |
69.95 | 87.69 | 64.15 | 77.07 | 3.926 | <0.001 | 0.041 | 0.670 | |
| Clostridiaceae | 17.17b | 6.15a | 4.77a | 6.15a | 1.566 | 0.031 | 0.001 | 0.001 | |
| Streptocaccaeceae | 5.11a | 0.61b | 0.39b | 4.43a | 1.052 | 0.743 | 0.531 | <0.001 | |
| Colon | |||||||||
| Lactobacillaceae | 19.96 | 11.19 | 8.46 | 6.94 | 1.689 | 0.002 | <.0001 | 0.104 | |
| Lachnospiraceae | 11.92ab | 13.19ab | 16.11a | 10.76b | 1.419 | 0.355 | 0.624 | 0.017 | |
| Erysipelotrichaceae | 0.83 | 0.70 | 0.35 | 0.66 | 0.344 | 0.621 | 0.330 | 0.399 | |
| Eubacteriaceae | 1.22 | 2.31 | 3.07 | 4.29 | 0.733 | 0.049 | 0.003 | 0.532 | |
| Ruminococcaceae | 28.73 | 36.17 | 37.23 | 34.12 | 2.157 | 0.249 | 0.111 | 0.014 | |
| Clostridiaceae | 3.83 | 2.62 | 2.59 | 3.59 | 0.692 | 0.894 | 0.856 | 0.091 | |
| Propionibacteriaceae | 1.52a | 3.50ab | 4.32b | 3.36ab | 0.786 | 0.190 | 0.028 | 0.019 | |
| Streptococcaceae | 0.57 | 0.37 | 0.14 | 0.67 | 0.288 | 0.382 | 0.520 | 0.137 | |
| Oscillospiraceae | 1.95 | 1.56 | 2.06 | 2.15 | 0.519 | 0.719 | 0.466 | 0.603 | |
| Spiroplasmataceae | 0.54a | 0.18a | 0.45a | 1.70b | 0.460 | 0.846 | 0.090 | 0.049 | |
| Rikenellaceae | 1.57a | 0.68a | 1.22a | 4.51b | 0.751 | 0.455 | 0.014 | 0.002 | |
| Hungateiclostridiaceae | 2.75 | 2.30 | 1.53 | 3.22 | 0.630 | 0.250 | 0.608 | 0.066 | |
| Muribaculaceae | 0.51 | 0.26 | 0.32 | 0.45 | 0.253 | 0.775 | 0.951 | 0.388 | |
| Acidaminococcaceae | 0.55 | 0.97 | 0.59 | 1.01 | 0.355 | 0.198 | 0.902 | 0.974 | |
| Veillonellaceae | 0.08 | 0.62 | 0.19 | 0.78 | 0.313 | 0.042 | 0.490 | 0.682 | |
| Prevotellaceae | 5.92 | 11.63 | 7.11 | 13.40 | 1.294 | <.0001 | 0.192 | 0.863 | |
| Christensenellaceae | 1.69ab | 2.78ab | 3.65a | 1.09b | 0.675 | 0.184 | 0.757 | 0.003 | |
| Spirochaetaceae | 0.27 | 0.12 | 1.66 | 0.50 | 0.456 | 0.161 | 0.029 | 0.810 | |
| Genus | Treatments* | P Values | ||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Protein | Grain x Protein |
| Crude Protein Content | Standard | Standard | Low | Low | ||||
| Ileum | ||||||||
| Lactobacillus | 70.56 | 87.69 | 66.01 | 77.75 | 3.943 | <0.001 | 0.071 | 0.589 |
| Clostridium | 17.80b | 6.15a | 4.82a | 6.24a | 1.595 | 0.025 | <0.001 | <0.001 |
| Streptococcus | 2.09a | 0.61a | 0.39a | 8.51b | 1.305 | 0.064 | 0.326 | <0.001 |
| Colon | ||||||||
| Lactobacillus | 20.20 | 11.22 | 8.75 | 7.01 | 1.699 | <0.001 | <.0001 | 0.114 |
| Collinsella | 1.96 | 0.20 | 0.46 | 0.16 | 0.529 | 0.018 | 0.216 | 0.359 |
| Anaerobutyricum | 0.08 | 0.53 | 0.20 | 0.06 | 0.256 | 0.741 | 0.584 | 0.152 |
| Catenibacterium | 0.26 | 0.04 | 0.15 | 0.13 | 0.182 | 0.401 | 0.813 | 0.469 |
| Gemmiger | 8.87 | 5.80 | 7.09 | 5.27 | 1.053 | 0.015 | 0.261 | 0.649 |
| Ruminococcus | 2.41 | 0.76 | 2.14 | 1.21 | 0.517 | 0.009 | 0.574 | 0.347 |
| Faecalibacterium | 15.26a | 24.88b | 24.44b | 24.63b | 1.755 | 0.003 | 0.006 | 0.004 |
| Butyricicoccus | 1.89 | 1.33 | 1.03 | 0.81 | 0.486 | 0.375 | 0.103 | 0.868 |
| Holdemanella | 1.16 | 0.19 | 0.20 | 0.25 | 0.381 | 0.254 | 0.289 | 0.151 |
| Clostridium | 1.97ab | 1.28ab | 0.85a | 2.69b | 0.580 | 0.248 | 0.879 | 0.016 |
| Streptococcus | 0.57 | 0.37 | 0.14 | 0.66 | 0.288 | 0.390 | 0.519 | 0.136 |
| Oscillibacter | 1.95 | 1.55 | 2.13 | 2.16 | 0.519 | 0.678 | 0.417 | 0.647 |
| Spiroplasma | 0.54a | 0.18a | 0.46a | 1.71b | 0.462 | 0.853 | 0.087 | 0.049 |
| Anaerocella | 1.56ab | 0.69a | 1.22ab | 3.19b | 0.631 | 0.827 | 0.052 | 0.009 |
| Pseudobutyrivibrio | 0.14 | 0.48 | 0.46 | 0.71 | 0.297 | 0.207 | 0.240 | 0.550 |
| Eubacterium | 1.22 | 2.31 | 3.16 | 3.45 | 0.702 | 0.149 | 0.001 | 0.270 |
| Dorea | 1.26a | 2.71ab | 4.14b | 1.10a | 0.720 | 0.306 | 0.598 | <0.001 |
| Prevotella | 4.63a | 10.71b | 6.30a | 7.70ab | 1.157 | <0.001 | 0.933 | 0.027 |
| Phascolarctobacterium | 0.55 | 0.91 | 0.58 | 0.65 | 0.338 | 0.497 | 0.753 | 0.662 |
| Roseburia | 1.64 | 4.08 | 1.72 | 2.68 | 0.715 | 0.009 | 0.448 | 0.335 |
| Fournierella | 0.48 | 0.71 | 0.58 | 0.96 | 0.369 | 0.327 | 0.591 | 0.910 |
| Megasphaera | 0.02 | 0.07 | 0.13 | 0.49 | 0.247 | 0.422 | 0.230 | 0.951 |
| Agathobacter | 0.81 | 1.61 | 1.11 | 1.34 | 0.448 | 0.198 | 0.832 | 0.459 |
| Blautia | 2.31 | 1.04 | 3.13 | 1.09 | 0.626 | 0.003 | 0.541 | 0.659 |
| Christensenella | 1.48ab | 2.78a | 2.14ab | 1.09b | 0.589 | 0.932 | 0.319 | 0.027 |
| Pseudoflavonifractor | 1.25 | 0.54 | 1.77 | 0.68 | 0.503 | 0.028 | 0.465 | 0.880 |
| Hungateiclostridium | 0.31 | 0.18 | 0.14 | 0.07 | 0.197 | 0.563 | 0.385 | 0.938 |
| Treponema | 0.17 | 0.11 | 1.48 | 0.46 | 0.430 | 0.306 | 0.029 | 0.622 |
| Dialister | 0.05 | 0.02 | 0.06 | 0.11 | 0.127 | 0.949 | 0.616 | 0.664 |
| Treatment* | P Values | ||||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Protein | Grain x Protein | |
| Crude Protein Level | Standard | Standard | Low | Low | |||||
| Colon | |||||||||
| Acetate | 0.499 | 0.512 | 0.422 | 0.423 | 0.0161 | 0..667 | <0.001 | 0.735 | |
| Propionate | 0.281 | 0.281 | 0.332 | 0.339 | 0.0079 | 0.643 | <0.001 | 0.666 | |
| Butyrate | 0.161 | 0.145 | 0.190 | 0.184 | 0.0120 | 0.358 | 0.008 | 0.689 | |
| Valerate | 0.038 | 0.032 | 0.033 | 0.026 | 0.0044 | 0.145 | 0.235 | 0.944 | |
| Isobutyrate | 0.011 | 0.015 | 0.012 | 0.015 | 0.0021 | 0.103 | 0.703 | 0.977 | |
| Isovalerate | 0.011 | 0.017 | 0.012 | 0.013 | 0.0024 | 0.126 | 0.568 | 0.352 | |
| BCFA | 0.059 | 0.054 | 0.063 | 0.052 | 0.0057 | 0.168 | 0.846 | 0.666 | |
| Total | 220.05a | 207.18a | 162.47b | 196.79a | 10.5124 | 0.316 | 0.003 | 0.033 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).