Preprint
Article

This version is not peer-reviewed.

Impact of Reduced Dietary Crude Protein and Propionic Acid Preservation on Intestinal Health and Growth Performance in Post-Weaned Pigs

A peer-reviewed version of this preprint was published in:
Animals 2025, 15(5), 702. https://doi.org/10.3390/ani15050702

Submitted:

12 December 2024

Posted:

14 December 2024

You are already at the latest version

Abstract

This study investigated whether organic acid (OA)-preserved grain could mitigate the negative effects of low crude protein (CP) diets on growth performance, intestinal health, and the coefficient of total tract digestibility (CATTD) of nutrients in weaned piglets. The grain was either conventionally dried or preserved post-harvest with 4 kg of OA per tonne. Ninety-six piglets (28 days old) were assigned to one of four diets in a 2 × 2 factorial design: (1) dried standard CP diet, (2) OA-preserved standard CP diet, (3) dried low CP diet, and (4) OA-preserved low CP diet. Standard and low CP diets contained 21% and 19% CP during the first 15 days, reducing to 19% and 17.5% CP thereafter. Faecal scores (FS) were assessed twice a day while microbial composition, inflammatory markers, colonic volatile fatty acid concentrations and intestinal morphology were measured on the 8th day post-weaning. Performance metrics were measured over the 35-day experimental period. Low CP diets consistently reduced FS (P<0.05) and increased colonic molar butyrate proportions (P<0.01) but increased duodenal IL1B expression compared to standard CP diets (P<0.05). The OA-preserved grain enhanced beneficial microbial populations (Lactobacillus, Roseburia) while lowering pro-inflammatory cytokines (IL1A, IL17) (P<0.05). While dried grain with low CP diets reduced average daily gain (ADG), colonic short-chain fatty acids (SCFA) concentrations, and nitrogen digestibility, OA-preserved grain with low CP maintained these parameters and improved final body weight (P<0.05). Overall, OA-preserved grain mitigated the performance decline associated with low CP diets by enhancing gut health, nutrient digestibility, and reducing inflammation, presenting a promising alternative nutritional strategy for post-weaned piglets.

Keywords: 
;  ;  ;  ;  ;  ;  ;  ;  

1. Introduction

Commercial weaning practices precede the complete maturation of the pig digestive tract and associated immune responses [1]. Weaning reduces feed intake [2], impairs intestinal barrier function, increases inflammation [3] and alters the gut microbiome [4]. These stressors combined with the piglet’s immature systems increase pathogen proliferation, reduces growth and promotes post-weaning diarrhoea (PWD) [5]. Zinc oxide (ZnO) and in-feed antimicrobials have successfully reduced PWD in pigs [6]. However, concerns over antibiotic resistance and environmental impact led the EU to ban these in 2022 [7] ; [Commission Implementing Decision of June 2017, C (2017) 4529 Final; Regulation (EU) June 2019]. As a result, new dietary strategies to support gastrointestinal health in piglets are needed.
Weaned pig diets typically require a crude protein (CP) content of 20-23% for growth and development [8]. However, piglets struggle to digest protein due to its high acid-binding capacity and their limited secretion of gastric HCL and digestive enzymes [9]. Reduced HCL increases pathogen survival [10], while undigested protein ferments in the colon, producing harmful metabolites such as amines and ammonia, contributing to PWD [11]. Piglets are especially vulnerable to PWD during the initial 14 days post-weaning [12]. Although lowering dietary CP reduces diarrhoea [13,14], levels below 20% can impair piglet growth and intestinal health [15,16].
Organic acids (OA), specifically propionic acid are highly effective feed preservatives, inhibiting microbial growth while also preserving grain quality [17,18]. In temperate climates, grain moisture can reach 20-25% at harvest [19], thereby optimizing conditions for mycotoxin production [20]. To prevent this, moisture levels must be quickly reduced to 12-14% [21], typically through mechanical drying, an energy-intensive process that produces significant emissions [22,23,24]. Organic acid supplementation may improve protein digestion by lowering the gastric pH, stimulating gastric proteases and reducing the buffering capacity of feed [25]. This may also reduce the amount of undigested protein reaching the colon by increasing protein digestion and increasing nutrient availability for the pig. Additionally, the lower gastric pH associated with OA supplementation reduces the survival of ingested pathogens [9]. However, there is a paucity of research examining the effects of OA-preserved grain on protein utilisation in post-weaned piglets. The OA-based grain preservation may offer a dual benefit for weaned pigs by improving grain quality, reducing microbial load, and enhancing gut health and growth performance through better nutrient absorption and pathogen control [26].
This study aimed to evaluate the impact of varying dietary crude protein (CP) levels on the growth performance and intestinal health of newly weaned piglets. The experiment compared piglets offered conventional standard CP diets versus low CP diets, while also investigating the effects of conventional grain and organic acid (OA)-preserved grain. Several markers of growth and intestinal function were used to assess these impacts. The primary hypothesis was that reducing dietary CP levels in post-weaning diets would decrease the incidence of post-weaning diarrhoea (PWD), as indicated by lower faecal scores. Additionally, it was hypothesised that the inclusion of OA-preserved grain would improve protein digestion efficiency, thereby allowing for a reduction in dietary CP levels without compromising overall growth performance.

2. Materials and Methods

All experimental procedures conducted in the present study were approved under University College Dublin Animal Research Ethics Committee (AREC-22-02-ODoherty) and were conducted in accordance with Irish legislation (SI no. 543/2012) and the EU directive 2010/63/EU for animal experimentation.

2.1. Grain Management and Quality

Winter wheat (cv. JB Diego) and spring barley (cv. SY Errigal) grains sourced from McAuley Feeds (Burtonstown, Co. Meath, Ireland) were utilised in this study and were subject to the same management and preservation practices outlined by Maher et al. [26]. The grain was grown and harvested during the 2021 growing season. The winter wheat was sown in October 2020, with the recommended practices of a three-spray fungicide programme and a three-split nitrogen application rate of 180kg nitrogen/ha followed. The winter wheat was harvested in August 2021 in appropriate weather conditions, which resulted in a moisture content of 180g/kg. The spring barley was sown in March 2021 and followed the recommended practices including a two-spray fungicide program and a two-split nitrogen application rate of 140kg/ha. The spring barely was harvested with a moisture content of 181g/kg in August 2021. Prior to storage, both the wheat and barley were divided into two groups, with one group subject to drying using a continuous flow-type grain dryer (Cimbria, Thisted, Denmark) at 65°C for 3 hours before a 2-hour cooling period. The moisture content of the wheat and barley after drying was 140g/kg and 140.5g/kg respectively. The second grain group was preserved with a propionic acid mould inhibitor (OA), specifically a liquid surfactant (MycoCURB© ES Liquid; propionic acid (650g/kg), ammonium propionate (70g/kg), glycerol polyethyleneglycol ricinoleate (17.5g/kg) and a carrier), sourced from Adesco Nutricines, Dungarvan, Co. Waterford, Ireland. The propionic acid mould inhibitor was applied at an inclusion level of 4g/kg using spray action. To ensure even distribution of the acid, a mixing auger was used. The grain was ventilated and stored before diet manufacture.
Before diet manufacture, 20 representative samples of the wheat and barley were collected using the grab sample technique and analysed for dry matter (DM), ash gross energy (GE), CP, crude fat, starch, mycotoxins and total mould count (TMC). The colony count technique (ISO21527-2:2008) was used to determine the TMC of the wheat and barley and are previously detailed by Laca et al. [27]. Liquid chromatography-mass spectrometry was used to determine the mycotoxin presence of aflatoxin B1, B2, fumonisin B1 and B2, G1 and G2, T-2 Toxin, HT-Toxin, DON, OTA and ZEN as described by Soleimany et al. [28]. The chemical and mycotoxin analyses of the wheat and barley post-storage are presented in Table 1.

2.2. Experimental Design and Diets

This study was a 2 × 2 factorial design. Ninety-six newly weaned piglets (progeny of Meatline Hermitage boar (Sion Road, Kilkenny, Ireland) × (Large White × Landrace sow)) were selected from a commercial farm with an average body weight of 7.4 kg (SD ±0.82kg). The piglets were blocked on live weight, sex and litter of origin and assigned to one of four dietary stage 1 diets for the first 15 days of the experiment. The stage 1 diets were comprised of 478g/kg of grain, with 32g/kg being either dried or OA preserved wheat and 150g/kg being dried or OA preserved barley. The rest of the composition (522g/kg) consisted of either a standard protein concentrate or a low protein concentrate obtained from Cargill (Naas, Co. Kildare, Ireland), as outlined in Table 2. The stage 1 diets were as follows: (1) dried standard CP diet (21% CP); (2) OA-preserved standard CP diet (21% CP); (3) dried low CP diet (19% CP); and (4) OA-preserved low CP diet (19% CP). After 15 days, the piglets were offered a corresponding stage 2 diet for the remainder of the experimental period (D15-35). The diets were comprised of 553g/kg of grain, with 403g/kg being either dried or OA preserved wheat and 150g/kg being dried or OA preserved barley. The rest of the composition (44g/kg) consisted of either a standard CP concentrate or a low CP concentrate obtained from Cargill (Naas, Co. Kildare, Ireland), as outlined in Table 2. The stage 2 diets were as follows: (1) dried standard CP diet (19% CP); (2) OA-preserved standard CP diet (19% CP); (3) dried low CP diet (17.5% CP); and (4) OA-preserved low CP diet (17.5% CP). Celite (5g/kg) was added to the stage 2 diets during manufacture to measure the coefficient of apparent total tract digestibility (CATTD) using the acid-insoluble ash (AIA) method described by McCarthy et al. [29]. The stage 1 diets were formulated to contain similar levels of standard ileal digestible lysine (13.0g/kg) and net energy (11.0 MJ/kg). The stage 2 diets were also formulated to contain similar levels of standard ileal digestible lysine (12.0g/kg) and net energy (10.8 MJ/kg). The levels of amino acids (AA) were formulated to meet or exceed NRC requirements [8]. The standard and low CP diets were supplemented with synthetic lysine, methionine, threonine, tryptophan and valine to meet amino acid requirements [8]. All diets were milled on-site and offered in meal form. The chemical and microbial analysis of the treatments are presented in Table 3.

2.3. Animal Management

The piglets were housed in groups of three in fully slatted pens (1.68 × 1.22m). The house temperature was thermostatically controlled at 30°C for the first week and reduced by 2°C per week thereafter. Humidity was maintained at 65%. Feed in the form of meal was provided ad-libitum from two-space feeders alongside water from nipple drinkers. The piglets were weighed initially at the beginning of the experiments (day 0) and then every 7 days for the calculation of average daily gain (ADG). Offered feed was also weighed back every 7 days for the calculation of average daily feed intake (ADFI) and individual feed conversion ratio (FCR). Faecal scoring was conducted twice a day, every day by the same individual using a scale ranging from 1-5: 1 = hard, firm faeces; 2 = slightly soft faeces; 3 = soft, partially formed faeces; 4 = loose, semi-liquid faeces; and 5 = watery, mucous-like faeces, as previously described by Walsh et al. [30].

2.4. Sample Collection

On the 8th day post-weaning, one pig from each pen (n=8) was humanely sacrificed for the collection of samples. The piglets received a lethal injection of pentobarbitone sodium (Euthanal solution, 200mg/ml; Chanelle Pharma, Galway, Ireland) at a rate of 0.7ml/kg body weight to the cranial vena cava. Euthanasia was completed by a trained individual in a separate room, out of sight and sound of the other piglets. The intact intestinal tract was promptly removed. Sections from the duodenum (10cm from the stomach), the jejunum (60cm from the stomach) and the ileum (15cm from the caecum) were excised and fixed in 10% phosphate-buffered formalin.
Tissue samples (1cm) were dissected from the duodenum, jejunum and ileum to establish relative gene expression of a range of functional categories, including nutrient transporters, cytokines, mucins and pathogen recognition receptors using QPCR. The samples were dissected along the mesentery, emptied and rinsed using sterile phosphate buffered saline (Oxoid, Hampshire, UK). The tissue samples were stripped of the overlying smooth muscle before storage in 5mL of RNAlater® solution (Applied Biosystems, Foster City, CA, USA) overnight at 4°C. The RNAlater® was removed before storing the samples at -80°C. Digesta from the ileum and colon was collected and stored in sterile containers (Sarstedt, Wexford, Ireland) on dry ice before storage at -80°C for 16s rRNA sequencing and volatile fatty acid (VFA) analysis. Faecal samples were collected on day 30 of the experiment to determine the CATTD of nutrients. The CATTD was calculated using the internal marker AIA [29]. The following equation was utilised: CATTD of nutrient = (1 – [nutrient in faeces/nutrient in diet] x [AIA-diet/AIA-faeces]), where the nutrient concentrations in faeces and diet refer to the nutrient content (g/kg) in the DM of the faeces and diet, respectively. Similarly, AIA-diet and AIA-faeces represent the concentrations of acid-insoluble ash (AIA) in the dry matter of the diet and faeces [31].

2.5. Feed and Faecal Analysis

Representative samples were collected from the stage 1 and stage 2 diet of each dietary treatment at the time of diet formulation. Faecal samples were collected from every pen on day 30 PW and immediately frozen at -20°C. The feed and faeces samples were then dried at 55°C for 72 hr to determine the DM content. The dried feed and faeces samples were then milled through a 1mm screen (Christy and Norris Hammer Mill, Chelmsford, UK). Weighed samples were ignited at 550°C for 6 hr in a muffle furnace (Nabertherm, Bremen, Germany) to determine the crude ash content. The GE content of the feed and faeces was determined using an adiabatic bomb calorimeter (Parr Instruments, St Moline, IL, USA). Dietary crude fat levels were determined using light petroleum ether and Soxtec instrumentation (Tecator, Hillerod, Sweden). The nitrogen content of the diets and the faeces was determined using the Leco FP 528 instrument (Leco Instruments, Stockport, UK Ltd). A HPLC was utilised to assess the dietary amino acid concentrations as detailed by Iwaki et al. [32]. Dietary crude fibre content was determined according to the AOAC (1990 methodology (number 978.10)). The neutral detergent fibre (NDF) content of the feed was determined using the Ankom 220 Fibre Analyser (Ankom Technology, USA) in accordance with [33]. The chemical analysis of the dietary treatments is presented in Table 3.

2.6. Gut Morphological Analysis

The small intestine tissue was prepared for gut morphological analysis using standard paraffin embedding techniques as previously detailed by Rattigan et al [34]. The tissue samples were cut at a thickness of 5μm before being stained using haematoxylin and eosin A light microscope with an image analyser (Image-Pro Plus; Media Cybernetics, Oxon, UK) was used to measure villus height (VH) and crypt depths (CD). The VH was determined by measuring from the tip of the villus down to the junction of the crypt and villus. The VH was measured from the base of the crypt to the junction of the crypt and villus. A minimum of 15 measurements of intact and well orientated villi and crypt were taken from each tissue section.

2.7. Gene Expression in the Small Intestine

2.7.1. RNA Extraction and cDNA Synthesis

Total RNA was extracted from 100mg of tissue using TRIreagant (Sigma-Aldrich, St Louis, MS, USA) according to the manufacturer’s instructions. The crude RNA was further purified using the GenElute Mammalian Total RNA miniprep kit (Sigma-Aldrich, St Louis, MO, USA). A DNase step was incorporated using an on-column DNase 1 Digestion set (Thermo Scientific, Waltham, MA, USA). The quantity and purity of the total RNA was assessed by determining the ratio of the absorbance at 260nm and 280nm on a Nanodrop-ND1000 spectrophotometer (Thermo Scientific). Total RNA (2µg) was reversed transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and random primers in a final reaction volume of 40µL. The cDNA was then made up to a volume of 400µL using nuclease-free water.

2.7.2. Quantitative Real-Time Polymerase Chain Reaction (QPCR)

The quantitative PCR (QPCR) reaction mix (20µL) consisted of GoTaq QPCR Master Mic (10µL) (Promega, Madison, WI, USA), forward and reverse primers (5µM)(1.2µL), nuclease-free water (3.8µL) and cDNA (5µL). All QPCR reactions were conducted in duplicate on the 7500 ABI Prism Sequence detection System (Applied Biosystems, Foster City, CA, USA). The cycling conditions included a denaturation step of 95°C for 10min, followed by 40 cycles of 95°C for 15s and then 60°C for 1 min. All the primers were designed using the Primer Express Software (Applied Biosystems, Foster City, CA, USA) and synthesised by Eurofins (Milton Keynes, UK). Dissociation curves were created to verify the specificity of the subsequent PCR products.
The QPCR assay efficiencies were determined by plotting the cycling threshold (CT) values resulting from four-fold serial dilutions of cDNA against log of their arbitrary quantities, only assays demonstrating 90-110% efficiency and single products were accepted in this analysis. Normalised relative quantities were determined using the software, qbase PLUS (Biogazelle, Ghent, Belgium) from stable reference genes H3F3, YWAZ and ACTB. These reference genes were selected based on their M value (<1.5) generated by the GeNorm algorithm within GeNorm. The primer sequences utilised in the gene expression of the small intestine are presented in Table 4. These include FABP2, SLC15A1, SLC2A1, CLDN1, TJP1, MUC2, IL1A, IL1B, IL6, CXCL8, IL17, IL22, TNF, FOXP3 and TLR4.

2.8. Microbiological Analysis

2.8.1. Microbial DNA Extraction

The microbial genomic DNA from the ileal and colonic digesta was extracted using QIAamp Powerfecal Pro DNA kit (Qiagen, West Sussex, UK) according to the manufacturer’s instructions. A Nanodrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) was used to assess the quality and quantity of the resulting DNA.

2.8.2. Illumina Sequencing

An Illuminia MiSeq platform was used to sequence the V3-V5 hypervariable region of bacterial 16s rRNA gene in accordance with the service providers protocol (Eurofins Genomic, Eberberg, Germany). Universal primers containing adapter overhang nucleotide sequences for forward and reverse index primers were used to PCR-amplify the V3-V5 region. Amplicons were purified with the use of AMPure XP beads (Beckman Coulter, Indianapolis, IN) and arranged for Index PCR using Nextera XT index primers (Illumna, San Diego CA). The indexed samples were purified using the AMPure XP beads before quantification using a fragment analyser (Agilent, Santa Clara, CA). Equal quantities from each were pooled and the Bioanalyser 7500 DNA kit (Agilent, Santa Clara, CA) was used to quantified them before sequencing using the v3 chemistry (2 × 300 bp paired end reads).

2.8.3. Bioinformatics

Eurofins Genomics (Eberberg, Germany) completed the bioinformatic analysis using the Quantitative Insights into Microbial Ecology (Version 1.9.1) open source package [35]. Raw reads which passed the standard Illumina chastity filter were then demultiplexed in accordance to their index sequences (read quality >30). The primer sequences were cut at the start of the raw forward and reverse reads. Primer sequences which did not match perfectly were removed to retain only high-quality reads. The paired-end reads were merged in order to form a single, longer read which covers the entire target region using the FLASH 2.200 software [36]. A minimum overlap size of 10bp was required in order to reduce false-positive merges. Forward reads were only retained for subsequent assessment when merging was impossible. The merged reads were quality filtered according to the expected and known length variations in the V3-V5 region. Forward reads that were retained were clipped at the end to a total length of 300bp to eliminate low-quality bases. The retained and merged reads that contained ambiguous reads were removed. These filtered reads were used to generate the microbiome profile. The de-novo algorithm of UCHIME [37] was used to detect and remove chimeric reads as implemented in the VSEARCH package [38]. The resulting collection of high-quality reads were processed using minimum entropy decomposition (MED) which sorted reads into operational taxonomic units (OTU) [39]. DC-MEGABLAST alignments of representative cluster sequences to the NCBI nucleotide sequence data base was used for the taxonomic assignment of each OTU. A sequence identity of 70% across a minimum of 80% of the representative sequence was required to be considered a reference sequence. The bacterial taxonomic units were normalised using linear-specific copy numbers of appropriate marker genes to enhance estimates [40]. The data matrix comprises of the normalised OTU table in combination with the phenotype metadata and phylogenetic tree. This was imported into the phyloseq package in R (Version 3.5.0). Differential abundance testing was performed on the tables from phyloseq at phylum, family and genus level.
The microbiome richness and diversity dynamics were computed using the observed, the Fisher, the Shannon and the Simpson indices. The diversity indices allocate different weights to various parameters of richness and evenness. Richness in a count of the differently observed taxa within and sample but does not take into account how frequently they are observed. The evenness of a samples compared the similarity of the population size of each species present within each individual sample [41,42].
The alpha diversity metrics were computed to determine the dynamics of richness and diversity in both ileal and colonic microbiomes. These included observed richness, Fisher, Shannon and Simpson indices. These metrics have differing emphasis on richness and evenness. Richness measures the quantity of different taxa in each sample but does not measure how often they occur. While the evenness of a sample depicts the similarity between the population sizes of each species [41]. The observed alpha diversity measures the species richness as opposed to the Fisher, Shannon and Simpson indices which measure both richness and evenness [41,42]. The differentiation in the phylogenetic structure of OTUs between samples is assessed by Beta diversity measurements. The data was normalised to enable the comparison of taxonomic feature counts across the different samples. The Bray Curtis non-phylogenetic distance metric was then conducted using phyloseq in R [40,43].

2.9. Volatile Fatty Acid Analysis

The VFA concentrations of the colonic digesta was determined using gas-liquid chromatography as previously described by Clarke et al. [31]. One gram of digesta was diluted with distilled water (2.5 × sample weight) and centrifuged at 1400 × g for 10 minutes using a Sorvall GLC-2B centrifuge (DuPont, Wilmington, DE, USA). One mL of the resulting supernatant and 1mL of internal standard (0.05 % 3-methyl-n-valeric acid in 0.15 M oxalic acid dihydrate) were mixed with 3mL of distilled water and then centrifuged for 10 minutes at 500 × g. The supernatant was filtered through a syringe filter (0.45 polytetrafluoroethylene (TFE)) into a chromatographic sample vial. An injection volume of 1µL was injected into a Varian 3800 GC (Markham, ON, Canada) with an ECTM 1000 Grace column (15m × 0.53mm I.D) with a film thickness of 1.20µm. The temperature program was set to the range 75-95°C, which increased by 3°C/min and 95-200°C, and by 20°C/min, and this was held for 50 min. The detector and injector temperature were 280°C and 240°C respectively, the total analysis time was 12.42 min.

2.10. Statistical Analysis

The growth parameters, faecal scores, small intestinal morphology and gene expression data was checked for normality with the Shapiro-Wilk test in the UNIVARIATE procedure of SAS® software version 9.4 (SAS Institute, Inc.). The data was transformed when deemed necessary. The growth parameters (ADFI, ADG, FCR and BW) as well as FS were analysed by repeated measures using the PROC MIXED procedure. The data was divided into two time periods for the analysis: day 0-15 and day 15-35. The statistical model used included grain preservation method, crude protein level, time of weighing and their associated two- and three-way interactions. The initial weight was used as a covariate. For this experiment, the pen was the experimental unit.
Small intestinal morphology, VFA concentrations in digesta, gene expression data (Bonferroni adjusted P<0.05) and bacterial alpha diversity were analysed using the SAS PROC GLM procedure. The statistical model incorporated grain preservation method, crude protein levels and their associated interactions. PROC GLIMMIX was used to generate least-square means with Benjamini-Hochberg adjusted P-values for nonparametric data associated with the microbial populations of ileal and colonic digesta. The results are presented as least-square means with their standard errors of the mean. When there was no interaction between the grain preservation method and dietary CP level, the results are presented as main effects. Significance was denoted as P <0.05, with P-values between 0.05 ≤ P 0.10 defined as numerical tendency.

3. Results

3.1. Grain Quality

The chemical and microbial analysis of the dried and OA-preserved wheat and barley at the time of diet manufacture is presented in Table 1. The OA-preserved wheat and barley had lower DM content compared to the dried wheat and barley. The OA-preserved barley had reduced levels of T-2 Toxin and HT-2 Toxin compared to the dried barley. The OA-preserved wheat and barley had reduced levels of OTA compared to the dried wheat and barley.

3.2. Growth Performance and Faecal Scores

The effects of grain preservation method and dietary CP levels during the PW period (d 0-15, d 15-35) are presented in Table 5.
There were interactions between grain preservation method, CP levels and time on ADG and FCR (P<0.0.5); During the first period (d 0-15), the OA-preserved grain diet with standard CP increased ADG compared to the dried grain diet with standard CP. There was no effect of grain preservation method on ADG in the low CP diets. During the second period (d 15-35), the OA-preserved grain diet with low CP increased ADG compared to the dried grain diet with low CP, however, there was no effect of grain preservation method on ADG in the standard CP diets. During the first period (d 0-15), the OA-preserved grain with standard CP improved FCR compared to the dried grain with standard CP. There was no effect of grain preservation method on FCR in the low CP diets. During the second period (d 15-35), there was no effect of grain preservation on FCR in the standard CP and the low CP diets.
Piglets offered OA-preserved grain had higher final BW compared to dried grain (24.5 vs 23.1, SEM 0.256; P<0.05). There was no grain x CP interaction on FS. During the first 15 days, piglets offered low CP diets had reduced FS compared to piglets offered standard CP diets (2.24 vs 2.19 SEM 0.0192; P<0.05).

3.3. Coefficient of Apparent Total Tract Digestibility

The effects of grain preservation method and dietary CP on the CATTD of nutrients on day 30 post-weaning are presented in Table 6. There were grain x CP interactions on the CATTD of DM, OM, N and GE (P<0.05); Piglets offered the OA-preserved grain with low CP had increased CATTD of DM, OM and GE compared to the OA-preserved grain with standard CP, but there was no difference in the CATTD of DM, OM and GE between the dried grain with standard CP and the dried grain with low CP. Piglets offered the dried grain with low CP had reduced CATTD of N compared to the dried grain with standard CP, however there was no difference in the CATTD of N between the OA-preserved grain with low CP and the OA-preserved grain with standard CP. Piglets offered OA-preserved grain had increased CATTD of ash compared to those offered dried grain (60.09 vs 58.59, SEM 0.460; P<0.05).

3.4. Small Intestinal Morphology

The effects of grain preservation method and dietary CP levels on small intestinal morphology are presented in Table 7. There was no effect of grain preservation method, dietary CP level or grain × CP interaction on duodenal, jejunal or ileal VH, CD or VH:CD ratio.

3.5. Gene Expression Analysis

The effect of grain preservation method and dietary CP level on the relative expression of selected genes in the small intestine are presented in Table 8.
In the duodenum, piglets offered OA-preserved grain had reduced expression of IL1A relative to dried grain (0.89 vs 1.35, SEM 0.152; P<0.05). Piglets offered low CP diets had increased expression of IL1B compared to piglets offered standard CP diets (1.80 vs 0.95, SEM 0.287; P<0.05). In the jejunum, piglets offered OA-preserved grain had reduced expression of IL17 compared to dried grain (0.88 vs 2.13, SEM 0.405; P<0.05). While, in the ileum, piglets offered OA-preserved grain had reduced expression of IL17 compared to dried grain (0.82 vs 1.45, SEM 0.167; P<0.05). There was no interaction between grain preservation method and dietary CP on the expression of genes in the duodenum, jejunum or ileum.
IL1A, interleukin 1A; IL1B, interleukin 1B; IL17, interleukin 17; A total of eight replicates were used per treatment group.

3.6. Differential Bacterial Abundance Analysis

3.6.1. Bacterial Richness and Diversity

There was no effect of grain preservation method or dietary CP levels on the Observed, Fisher, Shannon or Simpson index diversity measures in the digesta collected from the ileum and colon (P>0.05) (data not shown). Similarly, there were no differences in Beta diversity in the ileal and colonic microbiome based on visualisation using the Bray Curtis distance matrix and multi-dimensional scaling (data not shown).

3.6.2. Differently Abundant Phlya

The effects of grain preservation method and dietary CP level on the relative abundance of bacterial phyla is presented in Table 9.
In the ileum, the predominant phyla were Firmicutes (~94.11%). There was no effect of grain preservation method, CP levels or grain preservation × CP interaction on the relative abundance of bacterial phlya in the ileum (P>0.05).
In the colon, the predominant phyla were Firmicutes (~76.21%), Bacteroidetes (~11.49%), Actinobacteria (~3.88%), Tenericutes (~0.73%) and Spirochaetes (~0.63%). There was an interaction between grain preservation method and CP levels on the relative abundance of Tenericutes; Piglets offered the OA-preserved grain with low CP had increased relative abundance of Tenericutes compared to the OA-preserved grain with standard CP, but there was no difference in the relative abundance of Tenericutes between the dried grain with standard CP and the dried grain with low CP (P=0.05). Piglets offered OA-preserved grain had increased relative abundance of Bacteroidetes compared to dried grain (14.76 vs 7.98, SEM 0.968; P<.0001). The low CP diets had increased relative abundance of Bacteroidetes (12.26 vs 9.60, SEM 0.904) and Spirochaetes (0.88 vs 0.17, SEM 0.255) compared to the standard CP diets (P<0.05).

3.6.3. Differently Abundant Families

The effect of grain preservation method and dietary CP level on the relative abundance of bacterial families is presented in Table 10.
In the ileum, there were interactions between grain preservation method and dietary CP levels on the relative abundance of Clostridiaceae and Streptococcaceae (P<0.01); The OA-preserved grain with standard CP diet had reduced relative abundance of Clostridiaceae compared to the dried grain with standard CP diet, but there was no effect of grain preservation method on Clostridiaceae in the low CP diets. The OA-preserved grain with standard CP diet had reduced relative abundance of Streptococcaceae compared to the dried grain with standard CP diet, however the OA-preserved grain with low CP diet had increased Streptococcaceae compared to the dried grain with low CP diet. Piglets offered OA-preserved grain had increased relative abundance of Lactobacillaceae compared to dried grain (82.21 vs 66.99, SEM 2.76; P<0.001). Piglets offered low CP diets had reduced relative abundance of Lactobacillaceae compared to the standard CP diets (70.32 vs 78.32, SEM 2.66; P<0.05).
In the colon, there were interactions between grain preservation method and dietary CP levels on the relative abundance of Lachnospiraceae, Propionibacteriaceae, Spiroplasmataceae, Rikenellaceae and Christensenellaceae (P<0.05); Piglets offered the OA-preserved grain with low CP diet had reduced relative abundance of Lachnospiraceae and Christensenellaceae compared to the dried grain with low CP diet, however there was no effect of grain preservation method on the abundance of Lachnospiraceae and Christensenellaceae in the standard CP diets. Piglets offered the OA-preserved grain with low CP diet had increased relative abundance of Spiroplasmataceae and Rikenellaceae compared to the dried grain with low CP diet, however there was no effect of grain preservation method on the abundance of Spiroplasmataceae and Rikenellaceae in the standard CP diets. Piglets offered the dried grain diet with low CP had increased relative abundance of Propionibacteriaceae compared to the dried grain diet with standard CP, but there was no difference in the abundance of Propionibacteriaceae between the OA-preserved grain diet with low CP and the OA-preserved grain diet with standard CP.
Piglets offered OA-preserved grain had reduced relative abundance of Lactobacillaceae compared to piglets offered dried grain (8.81 vs 12.99, SEM 0.962; P<0.01). Piglets offered OA-preserved grain had increased relative abundance of Eubacteriacea (3.15 vs 1.95, SEM 0.454) Veillonellaceae (0.70 vs 0.12, SEM 0.218) and Prevotellaceae (12.48 vs 6.48, SEM 0.884) compared to dried grain (P<0.05). Piglets offered the low CP diets had reduced relative abundance of Lactobacillaceae compared to the standard CP diets (7.66 vs 14.95, SEM 1.012; P<0.0001). Piglets offered the low CP diets had increased relative abundance of Eubacteriaceae (3.63 vs 1.68, SEM 0.480) and Spirochaetaceae (0.91 vs 0.17, SEM 0.260) compared to the standard CP diets (P<0.05).

3.6.4. Differently Abundant Genera

The effects of grain preservation method and dietary CP level on the relative abundance of bacterial genera is presented in Table 11.
In the ileum, there was an interaction between grain preservation method and CP level on the relative abundance of Clostridium and Streptococcus (P<0.05); Piglets offered low CP diets reduced the relative abundance of Clostridium in the dried grain diet, however the lowering of protein had no effect on the relative abundance of Clostridium in the OA-preserved grain diet. Piglets offered the OA-preserved grain with low CP diet had increased relative abundance of Streptococcus compared to the OA-preserved grain with standard CP diet, but there was no difference in the abundance of Streptococcus between the dried grain with low CP diet and the dried grain with standard CP diet. Piglets offered OA-preserved grain had increased relative abundance of Lactobacillus compared to dried grain (82.57 vs 68.25, SEM 2.761; P<0.001).
In the colon, there were significant interactions between grain preservation method and CP levels on the relative abundance of Faecalibacterium, Clostridium, Spiroplasma, Anaerocella, Dorea, Prevotella and Christensenella (P<0.05); Piglets offered the OA-preserved grain with standard CP diet had increased relative abundance of Faecalibacterium and Prevotella compared to the dried grain with standard protein diet, however there was no effect of grain preservation method on Faecalibacterium and Prevotella in the low CP diets. Piglets offered the OA-preserved grain with low CP diet had increased relative abundance of Clostridium and Spiroplasma compared to the dried grain with low CP, but there was no effect of grain preservation method on Clostridium and Spiroplasma in the standard CP diets. Piglets offered the OA-preserved grain with low CP diet had increased relative abundance of Anareocella compared to the OA-preserved grain with standard CP diet, however there was no difference in the abundance of Anaerocella between the dried grain with low CP diet and the dried grain with standard CP diet. Piglets offered the dried grain with low CP diet had increased relative abundance of Dorea compared to the dried grain with standard CP diet, however there was no difference in the abundance of Dorea between the OA-preserved grain with low CP diet and the OA-preserved grain with standard CP diet.

3.7. Volatile Fatty Analysis

The effects of grain preservation method and dietary CP levels on the molar proportions and total concentrations of VFAs in the colon are presented in Table 12. There was an interactions between grain preservation method and CP levels total VFA concentration (P<0.05); Piglets offered the dried grain with low CP diet had reduced total VFA concentrations compared to the dried grain with standard CP diet, however there was no difference in total VFA concentrations between the OA-preserved grain with low CP diet and the OA-preserved grain with standard CP diet. Piglets offered low CP diets had increased molar propionate (0.336 vs 0.281, SEM 0.0056) and butyrate proportions (0.187 vs 0.153, SEM 0.0085) compared to standard CP diets (P<0.01). Piglets offered low CP diets had reduced molar acetate proportions compared to those offered standard CP diets (0.422 vs 0.505, SEM 0.0114; P<0.001).

4. Discussion

This study examined the effects of low CP diets on growth performance, and gut health in post-weaned piglets, and whether OA-preserved grain could mitigate the negative impacts of CP reduction. The results showed that low CP diets consistently reduced FS and enhanced colonic butyrate levels compared to standard CP diets, suggesting improved intestinal function. During the first 15 days post-weaning, piglets offered OA-preserved grain with standard CP exhibited better FCR than those offered dried grain with the same CP level. However, in low CP diets, OA-preserved grain did not provide additional FCR benefits. From days 15 to 35, piglets offered dried grain with low CP showed reduced ADG compared to those on dried grain with standard CP. In contrast, piglets offered OA-preserved grain with low CP maintained ADG comparable to those on OA-preserved grain with standard CP. By the end of the study, OA-preserved grain led to higher final BW compared to dried grain, indicating its potential to support growth and intestinal health in low CP diets.
Pigs are generally offered high CP diets post-weaning to maximise growth and FCR [44]. However, their immature digestive systems are susceptible to colonic protein fermentation processes, which can worsen post-weaning diarrhoea (PWD) [45,46]. Reducing dietary CP has been proposed to limit the undigested protein available for fermentation and mitigate PWD [47]. Although no PWD was observed in this study, low CP diets reduced FS, consistent with previous research [48,49,50]. This improvement may be linked to microbial shifts induced by low CP diets. Given the relationship between gut microbiota and PWD [51], it is likely that increased populations of beneficial bacteria contributed to the improved FS observed in this study. This effect may be more pronounced in commercial swine production settings rather than in research environments, due to increased bacterial load and social stress.
Dietary CP levels are known to influence gut microbiome composition. High CP diets increase the abundance of proteolytic bacteria such as Clostridium, Propionibacterium, and Streptococcus, while reducing populations of beneficial bacteria like Eubacterium, Ruminococcus, Butyrivibrio, and Blautia [52,53]. In this study, low CP diets increased the abundance of Eubacterium and Faecalibacterium, particularly Faecalibacterium prausnitzii, a key butyrate producer known for its anti-inflammatory influence and role in maintaining gut barrier integrity [54,55]. Consistent with this microbial profile, low CP diets enhanced colonic butyrate concentrations. SCFAs, including butyrate, are essential for nutrient absorption, anti-inflammatory responses, and energy production, meeting 10–13% of a pig’s energy needs [56,57]. Butyrate supports intestinal development, inhibits enteric pathogens [58], reduces pro-inflammatory cytokines [59], and promotes regulatory T cell (Treg) activation [60]. Despite these benefits, low CP diets increased duodenal expression of the pro- inflammatory cytokine IL1B, consistent with findings from Rattigan et al. [61]. Weaning is often associated with increased pro-inflammatory cytokine expression, compromising intestinal integrity and contributing to PWD [62]. The replacement of dietary CP with synthetic amino acids in mice has been shown to reduce regulatory T cell (Treg) production and exacerbate inflammation, due to the inability of synthetic amino acids to bind to immune cells [63]. These findings suggest that while low CP diets modulate the microbiome and improve intestinal health, amino acid supplementation may exacerbate inflammation, contributing to the inconsistent growth responses observed in low CP diets.
While low CP diets often reduce growth performance due to challenges in meeting amino acid requirements [64,65], OA supplementation may help address these issues. The inclusion of OAs may present a viable solution to overcome the challenges associated with amino acid supplementation. Organic acids have been shown to improve protein utilisation, reduce inflammation, and enhance growth performance [66,67,68]. In this study, OA-preserved grain had reduced total mycotoxin contamination compared to dried grain, while OA-preserved barley had lower HT-2 toxin levels compared to dried barley. Mycotoxins are harmful fungal metabolites that can contaminate grain following harvest or during storage [69]. Specifically, HT-2 toxin stimulates the production of pro-inflammatory cytokines while suppressing anti-inflammatory cytokines [70]. Mycotoxin exposure can alter the intestinal microbiome (Guerre, 2020) and reduce feed intake [69] . Therefore, the reduced mycotoxin burden in OA-preserved grain may have contributed to the improved growth performance and microbial changes observed in piglets fed preserved grain.
Piglets fed OA-preserved grain with standard CP achieved the best FCR during the first 15 days. On day 8 post-weaning, this group exhibited higher relative abundances of beneficial microbes, including Lactobacillus in the ileum, and Faecalibacterium, Roseburia, and Prevotella in the colon. These microbes play key roles in gut health. Lactobacillus promotes antimicrobial peptide production, mucus secretion, and tight junction function [71]. Prevotella and Lactobacillus metabolise plant polysaccharides, aiding dietary adaptation and increasing SCFA production [72,73]. Roseburia and Faecalibacterium are butyrate producers with anti-inflammatory properties, supporting immune regulation [54,74]. All these bacteria are associated with improved FCR [75,76,77]. The increased abundance of these microbes in piglets offered OA-preserved grain likely explains the reduced pro-inflammatory cytokines, and enhanced growth performance. Piglets offered OA-preserved grain had reduced duodenal IL1A and jejunal and ileal IL17 expression compared to dried grain. The upregulation of IL1A and IL17 can drive inflammation in the gut [78,79] which in turn diverts nutrients away from growth and towards the immune system [80]. These effects likely contributed to the improved FCR observed during the first 15 days in piglets fed OA-preserved grain.
From days 15 to 35, OA-preserved grain effectively supported low CP diets. While dried grain with low CP reduced ADG and colonic SCFA concentrations, the inclusion of OA-preserved grain in low-CP diets maintained ADG and SCFA levels similar to those seen in pigs fed standard CP diets. This improvement in growth may be attributed to enhanced N utilisation in piglets consuming OA-preserved grain, as reflected by the increased CATTD of nitrogen. Low CP diets are typically associated with reduced growth performance due to issues meeting amino acid requirements [[64,65]. In this study, although the NRC guidelines [8] were met, the levels of branched-chain amino acids (BCAAs) and non-essential amino acids (NEAAs) were lower in the low-CP diets compared to the standard CP diets. This reduction in amino acid levels likely contributed to the decreased performance observed during this period. While NEAAs have traditionally been considered non-essential, they are now recognised as conditionally essential for the growth and development of weaned pigs [81]. The inclusion of OAs appears to be a promising solution to the challenges posed by amino acid supplementation in low-CP diets. In support of this, Maher et al. [26] demonstrated that post-weaned pigs consuming OA-preserved grain showed higher ileal N digestibility. This suggests that OA-preserved grain improves N efficiency, allowing for reduced dietary CP levels without compromising growth. Furthermore, the decrease in SCFA production in the dried grain, low-CP diet aligns with findings from Luise et al. [82], who observed a link between lower dietary CP and reduced SCFA production. Given that SCFAs serve as essential energy sources [83], maintaining their production likely played a role in preserving growth performance in the OA-preserved grain group.

5. Conclusions

Organic acid-preserved low crude protein diets effectively improved intestinal health and maintained growth performance post-weaning. Low crude protein diets reduced faecal scores, promoted beneficial microbial shifts and enhanced colonic butyrate levels but increased duodenal IL1B expression. Organic acid-preserved grain enhanced performance by reducing intestinal inflammation, stimulating beneficial microbes, and improving nitrogen digestibility. These findings highlight the potential of organic acid-preserved low crude protein diets to support piglet growth and gut health. These findings suggest that organic acid-preserved low crude protein diets are a promising strategy to support piglet growth and gut health post-weaning. However, further studies are recommended to validate these benefits in more challenging, stress-inducing environments.

Author Contributions

Conceptualization, K.R.C. and J.V.O.; methodology, K.R.C. and J.V.O.; formal analysis, K.R.C., J.V.O. and S.V.; investigation, K.R.C.; resources, J.V.O. and T.S.; data curation, K.R.C. and M.T.R.; writing—original draft preparation K.R.C.; writing—review and editing, K.R.C., J.V.O., T.S. and S.V.; supervision, J.V.O.; funding acquisition, J.V.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Department of Agriculture, Food and the Marine (DAFM), grant number 2019R51.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of University College Dublin (AREC-20-22-O’Doherty).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors wish to thank Dr. Maria Markiewicz-Keszycka, Ms Denise Cunningham, Mr John Ryan and Mr Kevin Thornton for their help with the analysis of digesta, feed and tissue samples.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Pluske, J.R.; Miller, D.W.; Sterndale, S.O.; Turpin, D.L. , “Associations between gastrointestinal-tract function and the stress response after weaning in pigs,” Anim. Prod. Sci., vol. 59, no. 11, p. 2015, 2019. [CrossRef]
  2. Lallès, J.-P.; et al. , “Gut function and dysfunction in young pigs: physiology,” Anim. Res., vol. 53, no. 4, pp. 301–316, Jul. 2004. [CrossRef]
  3. Pluske, J.R.; Turpin, D.L.; Kim, J.-C. , “Gastrointestinal tract (gut) health in the young pig,” Anim. Nutr., vol. 4, no. 2, pp. 187–196, Jun. 2018. [CrossRef]
  4. Guevarra, R.B.; et al. , “The dynamics of the piglet gut microbiome during the weaning transition in association with health and nutrition,” J. Anim. Sci. Biotechnol., vol. 9, no. 1, p. 54, Dec. 2018. [CrossRef]
  5. Han, X.; Hu, X.; Jin, W.; Liu, G. , “Dietary nutrition, intestinal microbiota dysbiosis and post-weaning diarrhea in piglets,” Anim. Nutr., vol. 17, pp. 188–207, Jun. 2024. [CrossRef]
  6. Pejsak, Z.; Kaźmierczak, P.; Butkiewicz, A.F.; Wojciechowski, J.; Woźniakowski, G. , “Alternatives to zinc oxide in pig production,” Pol. J. Vet. Sci., pp. 319–330, Mar. 2023. [CrossRef]
  7. Bonetti, A.; Tugnoli, B.; Piva, A.; Grilli, E. , “Towards Zero Zinc Oxide: Feeding Strategies to Manage Post-Weaning Diarrhea in Piglets,” Animals, vol. 11, no. 3, p. 642, Feb. 2021. [CrossRef]
  8. NRC, Nutritional Requirements of Swine. Washington DC: National Academcic Press, 2012.
  9. Suiryanrayna, M.V.A.N.; Ramana, J.V. , “A review of the effects of dietary organic acids fed to swine,” J. Anim. Sci. Biotechnol., vol. 6, no. 1, p. 45, Dec. 2015. [CrossRef]
  10. O’Doherty, J.V.; Bouwhuis, M.A.; Sweeney, T. , “Novel marine polysaccharides and maternal nutrition to stimulate gut health and performance in post-weaned pigs,” Anim. Prod. Sci., vol. 57, no. 12, p. 2376, 2017. [CrossRef]
  11. Heo, J.M.; Opapeju, F.O.; Pluske, J.R.; Kim, J.C.; Hampson, D.J.; Nyachoti, C.M. , “Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds: Feeding strategies without using in-feed antibiotics,” J. Anim. Physiol. Anim. Nutr., vol. 97, no. 2, pp. 207–237, Apr. 2013. [CrossRef]
  12. Eriksen, E.Ø.; et al. , “Post-weaning diarrhea in pigs weaned without medicinal zinc: risk factors, pathogen dynamics, and association to growth rate,” Porc. Health Manag., vol. 7, no. 1, p. 54, Dec. 2021. [CrossRef]
  13. Heo, J.M.; Kim, J.C.; Hansen, C.F.; Mullan, B.P.; Hampson, D.J.; Pluske, J.R. , “Feeding a diet with decreased protein content reduces indices of protein fermentation and the incidence of postweaning diarrhea in weaned pigs challenged with an enterotoxigenic strain of Escherichia coli1,” J. Anim. Sci., vol. 87, no. 9, pp. 2833–2843, Sep. 2009. [CrossRef]
  14. Gao, J.; et al. , “Protein Level and Infantile Diarrhea in a Postweaning Piglet Model,” Mediators Inflamm., vol. 2020, pp. 1–15, 20. 20 May. [CrossRef]
  15. Yun, H.M.; Lei, X.J.; Cheong, J.Y.; Kang, J.S.; Kim, I.H. , “Effect of different levels of fiber and protein on growth performance and fecal characteristics in weaning pigs,” Korean J. Agric. Sci., vol. 44, no. 3, 2017. [CrossRef]
  16. Lynegaard, J.C.; Kjeldsen, N.J.; Hansen, C.F.; Williams, A.R.; Nielsen, J.P.; Amdi, C. , “Reduction in Diarrhoea and Modulation of Intestinal Gene Expression in Pigs Allocated a Low Protein Diet without Medicinal Zinc Oxide Post-Weaning,” Animals, vol. 12, no. 8, p. 989, Apr. 2022. [CrossRef]
  17. Khan, S.H.; Iqbal, J. , “Recent advances in the role of organic acids in poultry nutrition,” J. Appl. Anim. Res., vol. 44, no. 1, pp. 359–369, Jan. 2016. [CrossRef]
  18. Jokiniemi, T.; Jaakkola, S.; Turunen, M.; Ahokas, J. , “Energy consumption in different grain preservation methods,” Agron. Res., vol. 12, no. 1, pp. 81–94, 2014.
  19. Burke, J.; Spink, J.; Hackett, R. , “Wheat in the Republic of Ireland,” in The World Wheat Book: A History of Wheat Breeding, vol. Volume 2, Lavoisier Publishing, 2011, pp. 107–118.
  20. Neme, K.; Mohammed, A. , “Mycotoxin occurrence in grains and the role of postharvest management as a mitigation strategies. A review,” Food Control, vol. 78, pp. 412–425, Aug. 2017. [CrossRef]
  21. Matumba, L.; et al. , “Five keys to prevention and control of mycotoxins in grains: A proposal,” Glob. Food Secur., vol. 30, p. 100562, Sep. 2021. [CrossRef]
  22. Coradi, P.C.; Fernandes, C.H.P.; Helmich, J.C.; Goneli, A.L.D. , “Effects of drying air temperature and grain initial moisture content on soybean quality (Glycine Max (L.) Merrill),” Eng. Agríc., vol. 36, no. 5, pp. 866–876, Oct. 2016. [CrossRef]
  23. Jimoh, K.A.; Hashim, N.; Shamsudin, R.; Man, H.C.; Jahari, M.; Onwude, D.I. , “Recent Advances in the Drying Process of Grains,” Food Eng. Rev., vol. 15, no. 3, pp. 548–576, Sep. 2023. [CrossRef]
  24. Menon, A.; Stojceska, V.; Tassou, S.A. , “A systematic review on the recent advances of the energy efficiency improvements in non-conventional food drying technologies,” Trends Food Sci. Technol., vol. 100, pp. 67–76, Jun. 2020. [CrossRef]
  25. Partanen, K.H.; Mroz, Z. , “Organic acids for performance enhancement in pig diets,” Nutr. Res. Rev., vol. 12, no. 1, pp. 117–145, Jun. 1999. [CrossRef]
  26. Maher, S.; et al. , “Organic acid preservation of cereal grains improves grain quality, growth performance, and intestinal health of post-weaned pigs,” Anim. Feed Sci. Technol., p. 116078, Aug. 2024. [CrossRef]
  27. Laca, A.; Mousia, Z.; Dı, M.; Webb, C.; Pandiella, S.S. , “Distribution of microbial contamination within cereal grains,” J. Food Eng., vol. 72, no. 4, pp. 332–338, Feb. 2006. [CrossRef]
  28. Soleimany, F.; Jinap, S.; Abas, F. , “Determination of mycotoxins in cereals by liquid chromatography tandem mass spectrometry,” Food Chem., vol. 130, no. 4, pp. 1055–1060, Feb. 2012. [CrossRef]
  29. McCARTHY, J.F.; Bowland, J.P.; Aherne, F.X. , “INFLUENCE OF METHOD UPON THE DETERMINATION OF APPARENT DIGESTIBILITY IN THE PIG,” Can. J. Anim. Sci., vol. 57, no. 1, pp. 131–135, Mar. 1977. [CrossRef]
  30. Walsh, A.M.; Sweeney, T.; O’Shea, C.J.; Doyle, D.N.; O’Doherty, J.V. , “Effect of dietary laminarin and fucoidan on selected microbiota, intestinal morphology and immune status of the newly weaned pig,” Br. J. Nutr., vol. 110, no. 9, pp. 1630–1638, Nov. 2013. [CrossRef]
  31. Clarke, L.C.; et al. , “Effect of β-glucanase and β-xylanase enzyme supplemented barley diets on nutrient digestibility, growth performance and expression of intestinal nutrient transporter genes in finisher pigs,” Anim. Feed Sci. Technol., vol. 238, pp. 98–110, Apr. 2018. [CrossRef]
  32. Iwaki, K.; Nimura, N.; Hiraga, Y.; Kinoshita, T.; Takeda, K.; Ogura, H. , “Amino acid analysis by reversed-phase high-performance liquid chromatography,” J. Chromatogr. A, vol. 407, pp. 273–279, Jan. 1987. [CrossRef]
  33. Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. , “Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition,” J. Dairy Sci., vol. 74, no. 10, pp. 3583–3597, Oct. 1991. [CrossRef]
  34. Rattigan, R.; Sweeney, T.; Maher, S.; Thornton, K.; Rajauria, G.; O’Doherty, J.V. , “Laminarin-rich extract improves growth performance, small intestinal morphology, gene expression of nutrient transporters and the large intestinal microbial composition of piglets during the critical post-weaning period,” Br. J. Nutr., vol. 123, no. 3, pp. 255–263, Feb. 2020. [CrossRef]
  35. Caporaso, J.G.; et al. , “QIIME allows analysis of high-throughput community sequencing data,” Nat. Methods, vol. 7, no. 5, pp. 335–336, 10. 20 May. [CrossRef]
  36. Magoč, T.; Salzberg, S.L. , “FLASH: fast length adjustment of short reads to improve genome assemblies,” Bioinformatics, vol. 27, no. 21, pp. 2957–2963, Nov. 2011. [CrossRef]
  37. Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. , “UCHIME improves sensitivity and speed of chimera detection,” Bioinformatics, vol. 27, no. 16, pp. 2194–2200, Aug. 2011. [CrossRef]
  38. Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. , “VSEARCH: a versatile open source tool for metagenomics,” PeerJ, vol. 4, p. e2584, Oct. 2016. [CrossRef]
  39. Eren, A.M.; et al. , “Oligotyping: differentiating between closely related microbial taxa using 16S rRNA gene data,” Methods Ecol. Evol., vol. 4, no. 12, pp. 1111–1119, Dec. 2013. [CrossRef]
  40. Angly, F.E.; Dennis, P.G.; Skarshewski, A.; Vanwonterghem, I.; Hugenholtz, P.; Tyson, G.W. , “CopyRighter: a rapid tool for improving the accuracy of microbial community profiles through lineage-specific gene copy number correction,” Microbiome, vol. 2, no. 1, p. 11, Dec. 2014. [CrossRef]
  41. Kim, B.-R.; et al. , “Deciphering Diversity Indices for a Better Understanding of Microbial Communities,” J. Microbiol. Biotechnol., vol. 27, no. 12, pp. 2089–2093, Dec. 2017. [CrossRef]
  42. Wagner, B.D.; et al. , “On the Use of Diversity Measures in Longitudinal Sequencing Studies of Microbial Communities,” Front. Microbiol., vol. 9, p. 1037, 18. 20 May. [CrossRef]
  43. McMurdie, P.J.; Holmes, S. , “phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data,” PLoS ONE, vol. 8, no. 4, p. e61217, Apr. 2013. [CrossRef]
  44. Collins, C.L.; et al. , “Post-weaning and whole-of-life performance of pigs is determined by live weight at weaning and the complexity of the diet fed after weaning,” Anim. Nutr., vol. 3, no. 4, pp. 372–379, Dec. 2017. [CrossRef]
  45. Jeaurond, E.A.; Rademacher, M.; Pluske, J.R.; Zhu, C.H.; De Lange, C.F.M. , “Impact of feeding fermentable proteins and carbohydrates on growth performance, gut health and gastrointestinal function of newly weaned pigs,” Can. J. Anim. Sci., vol. 88, no. 2, pp. 271–281, Jun. 2008. [CrossRef]
  46. Pluske, J.R.; Pethick, D.W.; Hopwood, D.E.; Hampson, D.J. , “Nutritional influences on some major enteric bacterial diseases of pig,” Nutr. Res. Rev., vol. 15, no. 2, pp. 333–371, Dec. 2002. [CrossRef]
  47. Tang, Q.; et al. , “Nutrition strategies to control post-weaning diarrhea of piglets: From the perspective of feeds,” Anim. Nutr., vol. 17, pp. 297–311, Jun. 2024. [CrossRef]
  48. Kim, H.; Shin, H.; Kim, Y.Y. , “Effects of different levels of dietary crude protein on growth performance, blood profiles, diarrhea incidence, nutrient digestibility, and odor emission in weaning pigs,” Anim. Biosci., vol. 36, no. 8, pp. 1228–1240, Aug. 2023. [CrossRef]
  49. Lynegaard, J.C.; et al. , “Low protein diets without medicinal zinc oxide for weaned pigs reduced diarrhea treatments and average daily gain,” Animal, vol. 15, no. 1, p. 100075, Jan. 2021. [CrossRef]
  50. Marchetti, R.; et al. , “Protein Content in the Diet Influences Growth and Diarrhea in Weaning Piglets,” Animals, vol. 13, no. 5, p. 795, Feb. 2023. [CrossRef]
  51. Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. , “Gut Microbiota Dysbiosis in Postweaning Piglets: Understanding the Keys to Health,” Trends Microbiol., vol. 25, no. 10, pp. 851–873, Oct. 2017. [CrossRef]
  52. Ross, F.C.; et al. , “The interplay between diet and the gut microbiome: implications for health and disease,” Nat. Rev. Microbiol., Jul. 2024. [CrossRef]
  53. Holmes, A.J.; et al. , “Diet-Microbiome Interactions in Health Are Controlled by Intestinal Nitrogen Source Constraints,” Cell Metab., vol. 25, no. 1, pp. 140–151, Jan. 2017. [CrossRef]
  54. He, X.; Zhao, S.; Li, Y. , “Faecalibacterium prausnitzii: A Next-Generation Probiotic in Gut Disease Improvement,” Can. J. Infect. Dis. Med. Microbiol., vol. 2021, pp. 1–10, Mar. 2021. [CrossRef]
  55. Mukherjee, A.; Lordan, C.; Ross, R.P.; Cotter, P.D. , “Gut microbes from the phylogenetically diverse genus Eubacterium and their various contributions to gut health,” Gut Microbes, vol. 12, no. 1, p. 1802866, Nov. 2020. [CrossRef]
  56. Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.N.; Mackay, C.R.; Macia, L. , “The Role of Short-Chain Fatty Acids in Health and Disease,” in Advances in Immunology, vol. 121, Elsevier, 2014, pp. 91–119. [CrossRef]
  57. Bai, Y.; et al. , “Sources of Dietary Fiber Affect the SCFA Production and Absorption in the Hindgut of Growing Pigs,” Front. Nutr., vol. 8, p. 719935, Jan. 2022. [CrossRef]
  58. Bedford, A.; Gong, J. , “Implications of butyrate and its derivatives for gut health and animal production,” Anim. Nutr., vol. 4, no. 2, pp. 151–159, Jun. 2018. [CrossRef]
  59. Chen, J.; Vitetta, L. , “The Role of Butyrate in Attenuating Pathobiont-Induced Hyperinflammation,” Immune Netw., vol. 20, no. 2, p. e15, 2020. [CrossRef]
  60. Salvi, P.S.; Cowles, R.A. , “Butyrate and the Intestinal Epithelium: Modulation of Proliferation and Inflammation in Homeostasis and Disease,” Cells, vol. 10, no. 7, p. 1775, Jul. 2021. [CrossRef]
  61. Rattigan, R.; Sweeney, T.; Maher, S.; Ryan, M.T.; Thornton, K.; O’Doherty, J.V. , “Effects of reducing dietary crude protein concentration and supplementation with either laminarin or zinc oxide on the growth performance and intestinal health of newly weaned pigs,” Anim. Feed Sci. Technol., vol. 270, p. 114693, Dec. 2020. [CrossRef]
  62. Lallès, J.P.; Sève, B.; Pié, S.; Blazy, F.; Laffitte, J.; Oswald, I.P. , “Weaning Is Associated with an Upregulation of Expression of Inflammatory Cytokines in the Intestine of Piglets,” J. Nutr., vol. 134, no. 3, pp. 641–647, Mar. 2004. [CrossRef]
  63. Moreira, T.G.; et al. , “Dietary protein modulates intestinal dendritic cells to establish mucosal homeostasis,” Mucosal Immunol., p. S1933021924000606, Jun. 2024. [CrossRef]
  64. Wang, Y.; Zhou, J.; Wang, G.; Cai, S.; Zeng, X.; Qiao, S. , “Advances in low-protein diets for swine,” J. Anim. Sci. Biotechnol., vol. 9, no. 1, p. 60, Dec. 2018. [CrossRef]
  65. Dugan, M.E.R.; Aalhus, J.L.; Uttaro, B. , “Nutritional Manipulation of Pork Quality: Current Opportunities,” Adv. Pork Prod., vol. 15, no. 237–243, 2004.
  66. Connolly, R.; Sweeney, T.; Maher, S. , “Organic acid and salt treatment of cereal at harvest improves growth performance in the post weaned pig,” Anim.-Sci. Proc., vol. 13, no. 2, p. 204, 2022.
  67. Tugnoli; Giovagnoni; Piva; Grilli, “From Acidifiers to Intestinal Health Enhancers: How Organic Acids Can Improve Growth Efficiency of Pigs,” Animals, vol. 10, no. 1, p. 134, Jan. 2020. [CrossRef]
  68. Ren, C.; et al. , “Immune Response of Piglets Receiving Mixture of Formic and Propionic Acid Alone or with Either Capric Acid or Bacillus Licheniformis after Escherichia coli Challenge,” BioMed Res. Int., vol. 2019, pp. 1–9, Mar. 2019. [CrossRef]
  69. Holanda, D.M.; Kim, S.W. , “Mycotoxin Occurrence, Toxicity, and Detoxifying Agents in Pig Production with an Emphasis on Deoxynivalenol,” Toxins, vol. 13, no. 2, p. 171, Feb. 2021. [CrossRef]
  70. Wojtacha, P.; et al. , “Effects of a Low Dose of T-2 Toxin on the Percentage of T and B Lymphocytes and Cytokine Secretion in the Porcine Ileal Wall,” Toxins, vol. 13, no. 4, p. 277, Apr. 2021. [CrossRef]
  71. Dempsey, E.; Corr, S.C. , “Lactobacillus spp. for Gastrointestinal Health: Current and Future Perspectives,” Front. Immunol., vol. 13, p. 840245, Apr. 2022. [CrossRef]
  72. Cao, G.; et al. , “Effects of Bacillus licheniformis on the Growth Performance, Antioxidant Capacity, Ileal Morphology, Intestinal Short Chain Fatty Acids, and Colonic Microflora in Piglets Challenged with Lipopolysaccharide,” Animals, vol. 13, no. 13, p. 2172, Jul. 2023. [CrossRef]
  73. Kou, X.; et al. , “Exploring the Effect of Gastrointestinal Prevotella on Growth Performance Traits in Livestock Animals,” Animals, vol. 14, no. 13, p. 1965, Jul. 2024. [CrossRef]
  74. Tamanai-Shacoori, Z.; et al. , “Roseburia Spp.: A Marker of Health?,” Future Microbiol., vol. 12, no. 2, pp. 157–170, Feb. 2017. [CrossRef]
  75. Jiang, H.; Fang, S.; Yang, H.; Chen, C. , “Identification of the relationship between the gut microbiome and feed efficiency in a commercial pig cohort,” J. Anim. Sci., vol. 99, no. 3, p. skab045, Mar. 2021. [CrossRef]
  76. Amat, S.; Lantz, H.; Munyaka, P.M.; Willing, B.P. , “Prevotella in Pigs: The Positive and Negative Associations with Production and Health,” Microorganisms, vol. 8, no. 10, p. 1584, Oct. 2020. [CrossRef]
  77. Bergamaschi, M.; et al. , “Gut microbiome composition differences among breeds impact feed efficiency in swine,” Microbiome, vol. 8, no. 1, p. 110, Dec. 2020. [CrossRef]
  78. Beringer, A.; Noack, M.; Miossec, P. , “IL-17 in Chronic Inflammation: From Discovery to Targeting,” Trends Mol. Med., vol. 22, no. 3, pp. 230–241, Mar. 2016. [CrossRef]
  79. Di Paolo, N.C.; Shayakhmetov, D.M. , “Interleukin 1α and the inflammatory process,” Nat. Immunol., vol. 17, no. 8, pp. 906–913, Aug. 2016. [CrossRef]
  80. Rauw, W.M. , “Immune response from a resource allocation perspective,” Front. Genet., vol. 3, 2012. [CrossRef]
  81. Zhang, Q.; Hou, Y.; Bazer, F.W.; He, W.; Posey, E.A.; Wu, G. , “Amino Acids in Swine Nutrition and Production,” in Amino Acids in Nutrition and Health, vol. 1285, G. Wu, Ed., in Advances in Experimental Medicine and Biology, vol. 1285., Cham: Springer International Publishing, 2021, pp. 81–107. [CrossRef]
  82. Luise, D.; Chalvon-Demersay, T.; Lambert, W.; Bosi, P.; Trevisi, P. , “Meta-analysis to evaluate the impact of the reduction of dietary crude protein on the gut health of post-weaning pigs,” Ital. J. Anim. Sci., vol. 20, no. 1, pp. 1386–1397, Jan. 2021. [CrossRef]
  83. Den Besten, G.; Van Eunen, K.; Groen, A.K.; Venema, K.; Reijngoud, D.-J.; Bakker, B.M. , “The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism,” J. Lipid Res., vol. 54, no. 9, pp. 2325–2340, Sep. 2013. [CrossRef]
Table 1. The chemical and microbiological analysis of experimental grain after storage (g/kg) unless otherwise stated.
Table 1. The chemical and microbiological analysis of experimental grain after storage (g/kg) unless otherwise stated.
Cereal crop type Wheat Barley
Grain preservation method Dried OA-preserved Dried OA-preserved
Analysis post storage (g/kg)
DM 873.5 840.5 873.5 848.5
Ash 16.2 15.8 19.5 19.0
GE (MJ/kg) 15.9 15.2 16.1 15.6
Crude protein 89.0 84.5 103.5 87.5
Crude fibre 25.5 23.5 57.5 52.0
Starch 626.5 608.5 530.0 504.0
Fat 14.5 14.0 15.5 14.0
TMC (cfu/g) 37000 3800 27000 2400
Mycotoxin levels (μg/kg)a
Deoxynivalenol <75 <75 <75 <75
T-2 Toxin <4.00 <4.00 6.96 <4.00
HT-2 Toxin <4.00 <4.00 30.1 8.66
Zearalenone <10 <10 <10 <10
Ochratoxin A 3.2 <1.00 1.8 <1.0
Abbreviations: DM, dry matter; GE, gross energy; NDF, neutral detergent fibre; TMC, total mould count a The following mycotoxins were below detectable levels: Aflatoxin B1, B2, G1 and G2.
Table 2. Ingredients and chemical composition of experimental stage 1 and stage 2 diets (g/kg unless otherwise stated).
Table 2. Ingredients and chemical composition of experimental stage 1 and stage 2 diets (g/kg unless otherwise stated).
Dietary Treatments*
Stage 1 Diets Stage 2 Diets
Grain preservation method Dried OA-preserved Dried OA-preserved Dried OA-preserved Dried OA-preserved
Crude protein level Standard Standard Low Low Standard Standard Low Low
Ingredients (g/kg)
Wheat 328 328 328 328 403 403 403 403
Barley 150 150 150 150 150 150 150 150
Maize 95 95 170 170 80.75 80.75 144.5 144.5
Full fat soya 170 170 140 140 144.5 144.5 119 119
Soya bean meal 95 95 70 70 80.75 80.75 59.5 59.5
Soya bean concentrate 40 40 60 60 34 34 51 51
Whey powder 50 50 50 50 42.5 42.5 42.5 42.5
Soya oil 30 30 30 30 25.5 25.5 25.5 25.5
Starch 4.7 4.7 - - 4.7 4.7 - -
Salt 2 2 2 2 2 2 2 2
Mono calcium phosphate 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2
Calcium carbonate 4.5 4.5 4.5 4.5 4.5 4.5 4.5 4.5
Lysine HCl 2.5 2.5 4.9 4.9 2.5 2.5 4.9 4.9
DL-Methionine 2 2 2.5 2.5 2 2 2.5 2.5
L-Threonine 1.8 1.8 2.7 2.7 1.8 1.8 2.7 2.7
Tryptophan 0.3 0.3 0.7 0.7 0.3 0.3 0.7 0.7
Valine - - 0.5 0.5 - - 0.5 0.5
*Treatments: Stage 1 diets were offered for the first 15 days of the experiment: (1) Dried standard CP (21% CP); OA-preserved standard CP (21% CP); (3) Dried low CP (19% CP); and (4) OA-preserved low CP (19% CP). After 15 days piglets were offered a corresponding stage 2 diet for the remainder of the experiment: (1) Dried standard CP (19% CP); (2) OA-preserved standard CP (19% CP); (3) Dried low CP (17.5% CP); and (4) OA-preserved low CP (17.5% CP).
Table 3. The analysed composition of experimental stage 1 and stage 2 diets (g/kg unless otherwise stated).
Table 3. The analysed composition of experimental stage 1 and stage 2 diets (g/kg unless otherwise stated).
Dietary Treatments*
Stage 1 Diets Stage 2 Diets
Grain preservation method Dried OA-preserved Dried OA-preserved Dried OA-preserved Dried OA-preserved
Crude protein level Standard Standard Low Low Standard Standard Low Low
Ingredients (g/kg)
DM 895.0 886.0 896.0 882.5 894.0 878.5 892.5 888.0
Ash 45.5 44.5 39.5 36.5 43.0 39.5 33.5 32.0
GE (MJ/kg) 17.06 16.74 16.65 16.74 16.86 16.58 16.68 16.47
Crude fat 63.0 61.0 58.5 57.0 57.0 56.0 54.0 53.0
Crude protein 193.5 191.5 185.0 182.5 188.5 187.5 172.5 175.0
Crude fibre 28.5 25.5 25.0 23.5 28.5 23.5 25.5 22.0
NDF 111.5 100.5 107.0 98.0 112.5 98.0 106.5 95.0
ADF 33.5 28.5 31.0 28.5 34.0 28.5 30.5 27.0
Starch 319.0 299.0 354.0 350.0 340.0 336.5 383.5 375.5
Lysine 15.67 15.65 15.57 15.55 14.07 14.06 14.24 14.25
Threonine 11.01 11.04 10.71 10.70 10.98 10.10 9.99 9.96
Methionine and cysteine 10.29 10.31 10.03 10.01 9.67 9.70 9.55 9.53
Leucine 19.37 19.35 17.49 17.45 14.04 14.06 14.27 14.30
Iso-Leucine 10.88 10.86 9.53 9.56 9.87 9.84 8.72 8.76
Arginine 14.34 14.37 12.05 12.06 13.05 13.08 11.10 11.07
Histidine 5.92 5.95 5.18 5.20 5.45 5.44 4.79 4.78
Phenylalanine 11.24 11.27 9.73 9.76 10.30 10.33 9.02 9.04
Tyrosine 7.51 7.53 6.56 6.54 6.87 6.90 6.09 6.07
Alanine 10.37 10.35 9.33 9.36 9.40 9.44 8.53 8.55
Aspartic 22.48 22.45 19.75 19.78 19.97 19.95 17.74 17.77
Glutaminc 46.99 47.1 41.92 41.90 44.2 44.6 40.05 40.01
Glycine 9.00 9.03 7.81 7.78 8.35 8.36 7.33 7.30
Serine 11.41 11.40 9.93 9.96 10.51 10.50 9.23 9.23
Proline 15.63 15.60 14.32 14.34 14.88 14.86 13.75 13.78
Tryptophan 2.72 2.74 2.73 2.74 2.56 2.55 2.62 2.60
Valine 12.02 12.04 10.62 10.66 8.62 8.63 7.83 7.80
TMC (cfu/g) 6200 3700 4800 3300 4300 3700 5600 4000
Mycotoxin levels (mg/kg)a
Deoxynivalenol <75 <75 <75 <75 <75 <75 <75 <75
T-2 Toxin 5.62 <4.00 <4.00 <4.00 <4.00 <4.00 <4.00 <4.00
HT-2 toxin 23.1 13.3 14.1 11.3 <15.7 <10.8 <10.7 <10.6
Zearalenone 35 37 30 27 39 31 23 25
Ochratoxin 1.09 <1.0 2.39 <1.00 <1.65 <1.00 <1.60 <1.00
*Treatments: Stage 1 diets were offered for the first 15 days of the experiment: (1) Dried standard CP (21% CP); (2) OA-preserved standard CP (21% CP); (3) Dried low CP (19% CP); and (4) OA-preserved low CP (19% CP). After 15 days piglets were offered a corresponding stage 2 diet for the remainder of the experiment: (1) Dried standard CP (19% CP); (2) OA-preserved standard CP (19% CP); (3) Dried low CP (17.5% CP) and (4) OA-preserved low CP (17.5% CP). Abbreviations: DM, dry matter; GE, gross energy; NDF, neutral detergent fibre; ADF, acid detergent fibre. aThe following mycotoxins were below the listed detectable levels :Aflatoxin B1, B2, G1 and G2 (<1μg/kg); Fumonisin B1 (<125μg/kg) and Fumonisin B2 (<50μg/kg).
Table 4. Panel of primer sequences for QPCR analysis.
Table 4. Panel of primer sequences for QPCR analysis.
Target gene Gene name Accession no. Forward primer (5’-3’)
Reverse primer (5’-3’)
Nutrient transporters
FABP2 Fatty Acid Binding Protein 2 NM_001031780.1 F: CAGCCTCGCAGACGGAACTGAA
R: GTGTTCTGGGCTGTGCTCCAAGA
SLC2A1 Solute Carrier family 2 Member 1 XM_003482115.1 F: TGCTCATCAACCGCAATGA
R: GTTCCGCGCAGCTTCTTC
SLC15A1 Solute Carrier Family 15 Member 1 NM_214347.1 F: GGATAGCCTGTACCCCAAGCT
R: CATCCTCCACGTGCTTCTTGA
Inflammatory markers
IL1A Interleukin 1A NM_214029.1 F: CAGCCAACGGGAAGATTCTG
R: ATGGCTTCCAGGTCGTCAT
IL1B Interleukin 1B NM_001005149.1 F: TTGAATTCGAGTCTGCCCTGT
R: CCCAGGAAGACGGGCTTT
IL6 Interleukin 6 NM_214399.1 F: GACAAAGCCACCACCCCTAA
R:CTCGTTCTGTGACTGCAGCTTATC
CXCL8 C-X-C motif chemokine ligand 8 NM_213867.1 F: TGCACTTACTCTTGCCAGAACTG
R: CAAACTGGCTGTTGCCTTCTT
IL10 Interleukin 10 NM_214041.1 F: GCCTTCGGCCCAGTGAA
R: AGAGACCCGGTCAGCAACAA
IL17 Interleukin 17 NM_001005729.1 F: CCCTGTCACTGCTGCTTCTG
R: TCATGATTCCCGCCTTCAC
IL22 Interleukin 22 XM_001926156.1 F: GATGAGAGAGCGCTGCTACCTGG
R: GAAGGACGCCACCTCCTGCATGT
TNF Tumour Necrosis Factor NM_214022.1 F: TGGCCCCTTGAGCATCA
R: CGGGCTTATCTGAGGTTTGAGA
FOXP3 Forkhead box P3 NM_001128438.1 F: GTGGTGCAGTCTCTGGAACAAC
R: AGGTGGGCCTGCATAGCA
Tight junctions
TJP1 Tight Junction Protein 1 XM_021098827.1 F: TGAGAGCCAACCATGTCTTGAA
R: CTCAGACCCGGCTCTCTGTCT
CLDN1 Claudin 1 NM 001244539.1 F: CTGGGAGGTGCCCTACTTTG
R: TGGATAGGGCCTTGGTGTTG
Toll like receptors
TLR4 Toll-like Receptor 4 NM_001293317.1 F: TGCATGGAGCTGAATTTCTACAA
R: GATAAATCCAGCACCTGCAGTTC
Mucins
MUC2 Mucin 2 AK231524 F: CAACGGCCTCTCCTTCTCTGT
R: GCCACACTGGCCCTTTGT
Reference genes
H3F3A Histone H3.3 NM_213930.1 F: CATGGCTCGTACAAAGCAGA
R: ACCAGGCCTGTAACGATGAG
YWHAZ Tyrosine 3-Monooxygenase/tyrtophan 5-monooxygenase Activation Protein Zeta NM_001315726.1 F: GGACATCGGATACCCAAGGA
R: AAGTTGGAAGGCCGGTTAATTT
ACTB Actin Beta XM_001927228.1 F:GGACATCGGATACCCAAGGA
R:AAGTTGGAAGGCCGGTTAATTT
Table 5. The effect of dietary treatment on pig growth performance and faecal scores (least-square means with their standard errors).
Table 5. The effect of dietary treatment on pig growth performance and faecal scores (least-square means with their standard errors).
Treatments* P Values
Dried standard CP OA-preserved standard CP Dried low CP OA-preserved low CP SEM Grain Protein Grain x Protein Time Time x Grain x Protein
D0-15 D15-35 D0-15 D15-35 D0-15 D15-35 D0-15 D15-35
ADFI (g/DM/day) 397 853 401 877 413 780 403 844 0.019 0.214 0.196 0.700 <.0001 0.162
ADG (g/d) 325 657 396 649 362 560 366 630 0.022 0.055 0.127 0.888 <.0001 0.009
FCR** 1.29 1.30 1.04 1.38 1.20 1.42 1.12 1.36 0.053 0.049 0.591 0.841 <.0001 0.032
BW (kg) 12.27 23.59 13.13 24.83 12.82 22.65 12.90 24.23 0.538 0.048 0.513 0.812 <.0001 0.304
FS 2.24 - 2.23 - 2.18 - 2.19 - 0.027 0.967 0.050 0.582 <.0001 0.929
Treatments: BW, body weight; ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio; FS, faecal score. * A total of eight replicates were used per treatment group (replicate =pen, 3 pigs/pen) **FCR calculated on a dry matter basis (Kg/kg/DM).
Table 6. The effect of dietary treatment on the coefficient of apparent total tract digestibility of dry matter (DM), organic matter (OM), ash, nitrogen (N) and gross energy (GE) on day 30 post-weaning (Least-square means with their SEM).
Table 6. The effect of dietary treatment on the coefficient of apparent total tract digestibility of dry matter (DM), organic matter (OM), ash, nitrogen (N) and gross energy (GE) on day 30 post-weaning (Least-square means with their SEM).
Treatment* SEM P Values
Grain preservation method Dried OA-preserved Dried OA-preserved Grain Protein Grain x Protein
Dietary crude protein level Standard Standard Low Low
DM 0.851ab
0.843a
0.845ab
0.853b
0.0035 0.953
0.464
0.023
OM 86.81ab
85.97a 86.30ab 87.08b 0.3409
0.920
0.371
0.019
Ash 59.47 60.00
57.70
60.18
0.6719
0.026
0.223 0.141
N 81.10a 80.50ab 78.81b 80.84a 0.6764 0.275 0.142 0.049
GE 84.24ab
83.45a 83.68ab 84.72b
0.3920
0.740 0.353 0.021
*A total of eight replicates were used per treatment group; SEM, standard error of the mean. a, b, c Mean values within a row with different superscript letters were significantly different.
Table 7. The effect of grain preservation method and dietary crude protein levels on small intestinal morphology (Least-square means with their standard errors).
Table 7. The effect of grain preservation method and dietary crude protein levels on small intestinal morphology (Least-square means with their standard errors).
Grain preservation method Crude protein level P Values
Dried OA-preserved SEM Standard Low SEM Grain Protein Grain x Protein
Duodenum
VH μm 288.82 307.62 16.567 309.76 286.68 16.297 0.440 0.329 0.810
CD μm 127.41 134.54 6.600 131.90 130.04 6.551 0.466 0.843 0.595
VH:CD 2.38 2.31 0.147 2.41 2.28 0.144 0.755 0.532 0.577
Jejunum
VH μm 304.50 299.40 18.641 302.81 301.10 18.337 0.852 0.948 0.507
CD μm 124.27 107.77 9.696 111.02 121.03 9.538 0.250 0.468 0.585
VH:CD 2.60 2.85 0.199 2.84 2.61 0.196 0.389 0.430 0.387
Ileum
VH μm 315.95 295.16 12.932 312.51 298.60 12.722 0.276 0.450 0.157
CD μm 99.16 92.52 4.117 93.42 98.26 4.050 0.275 0.409 0.805
VH:CD 3.24 3.34 0.206 3.44 3.13 0.202 0.746 0.292 0.541
VH, villus height; CD, crypt depth; VH:CD villus height to crypt depth ratio; * a total of eight replicates were used per treatment group.
Table 8. The effect of grain preservation and dietary crude protein level on the relative expression of genes involved in inflammation in the small intestine (Least-square means with their standard errors).
Table 8. The effect of grain preservation and dietary crude protein level on the relative expression of genes involved in inflammation in the small intestine (Least-square means with their standard errors).
Grain preservation method Crude protein level P Values
Dried OA-preserved SEM Standard Low SEM Grain Protein Grain x Protein
Duodenum
IL1A 1.35
0.89
0.152
0.98
1.26
0.152
0.037 0.205
0.375
IL1B 1.38
1.36
0.287
0.95
1.80
0.287
0.955
0.046 0.492
Jejunum
IL17 2.13
0.88
0.405
1.45
1.56
0.405
0.036 0.847
0.520
Ileum
IL17 1.45 0.82 0.167 1.10 1.17 0.167 0.013 0.773 0.891
Table 9. The effect of dietary treatment on the relative abundance of selected bacterial phyla in the ileal and colonic digesta (mean % relative abundance with their standard errors).
Table 9. The effect of dietary treatment on the relative abundance of selected bacterial phyla in the ileal and colonic digesta (mean % relative abundance with their standard errors).
Phylum Treatments* P Values
Grain preservation method Dried OA-preserved Dried OA-preserved SEM Grain Protein Grain x Protein
Crude Protein Levels Standard Standard Low Low
Ileum
Firmicutes 92.68
94.57
99.56
91.20
4.989
0.460
0.698
0.244
Colon
Firmicutes 79.46
77.58
76.98
70.84
3.152
0.197
0.142
0.471
Bacteroidetes 7.46
12.36
8.53
17.63
1.484
<.0001 0.035 0.325
Actinobacteria 3.59
3.73
4.65
3.65
0.815
0.581
0.516
0.450
Tenericutes
0.50a
0.17a
0.48a
1.71b
0.462
0.864
0.069
0.049
Spirochaetes
0.26
0.11
1.59
0.49
0.446
0.179
0.031
0.801
* A total of eight replicates were used per treatment group. a b Mean values within a row with unlike superscripts letters were significantly different (P<0.05).
Table 10. The effect of dietary treatments on the relative abundance of selected bacterial families in the ileal and colonic digesta (mean % relative abundance with their standard errors).
Table 10. The effect of dietary treatments on the relative abundance of selected bacterial families in the ileal and colonic digesta (mean % relative abundance with their standard errors).
Family Treatments* P Values
Grain preservation method Dried OA-preserved Dried OA-preserved SEM Grain Protein Grain x Protein
Crude Protein Content Standard Standard Low Low
Ileum
Lactobacillaceae
69.95 87.69 64.15 77.07 3.926 <0.001 0.041 0.670
Clostridiaceae 17.17b 6.15a 4.77a 6.15a 1.566 0.031 0.001 0.001
Streptocaccaeceae 5.11a 0.61b 0.39b 4.43a 1.052 0.743 0.531 <0.001
Colon
Lactobacillaceae 19.96 11.19 8.46 6.94 1.689 0.002 <.0001 0.104
Lachnospiraceae 11.92ab 13.19ab 16.11a 10.76b 1.419 0.355 0.624 0.017
Erysipelotrichaceae 0.83 0.70 0.35 0.66 0.344 0.621 0.330 0.399
Eubacteriaceae 1.22 2.31 3.07 4.29 0.733 0.049 0.003 0.532
Ruminococcaceae 28.73 36.17 37.23 34.12 2.157 0.249 0.111 0.014
Clostridiaceae 3.83 2.62 2.59 3.59 0.692 0.894 0.856 0.091
Propionibacteriaceae 1.52a 3.50ab 4.32b 3.36ab 0.786 0.190 0.028 0.019
Streptococcaceae 0.57 0.37 0.14 0.67 0.288 0.382 0.520 0.137
Oscillospiraceae 1.95 1.56 2.06 2.15 0.519 0.719 0.466 0.603
Spiroplasmataceae 0.54a 0.18a 0.45a 1.70b 0.460 0.846 0.090 0.049
Rikenellaceae 1.57a 0.68a 1.22a 4.51b 0.751 0.455 0.014 0.002
Hungateiclostridiaceae 2.75 2.30 1.53 3.22 0.630 0.250 0.608 0.066
Muribaculaceae 0.51 0.26 0.32 0.45 0.253 0.775 0.951 0.388
Acidaminococcaceae 0.55 0.97 0.59 1.01 0.355 0.198 0.902 0.974
Veillonellaceae 0.08 0.62 0.19 0.78 0.313 0.042 0.490 0.682
Prevotellaceae 5.92 11.63 7.11 13.40 1.294 <.0001 0.192 0.863
Christensenellaceae 1.69ab 2.78ab 3.65a 1.09b 0.675 0.184 0.757 0.003
Spirochaetaceae 0.27 0.12 1.66 0.50 0.456 0.161 0.029 0.810
* A total of eight replicates were used per treatment group. a b Mean values within a row with unlike superscript letters were significantly different (P<0.05).
Table 11. The effect of dietary treatment on the relative abundance of selected bacterial genera in the ileal and colonic digesta (mean % relative abundance with their standard errors).
Table 11. The effect of dietary treatment on the relative abundance of selected bacterial genera in the ileal and colonic digesta (mean % relative abundance with their standard errors).
Genus Treatments* P Values
Grain preservation method Dried OA-preserved Dried OA-preserved SEM Grain Protein Grain x Protein
Crude Protein Content Standard Standard Low Low
Ileum
Lactobacillus 70.56 87.69 66.01 77.75 3.943 <0.001 0.071 0.589
Clostridium 17.80b 6.15a 4.82a 6.24a 1.595 0.025 <0.001 <0.001
Streptococcus 2.09a 0.61a 0.39a 8.51b 1.305 0.064 0.326 <0.001
Colon
Lactobacillus 20.20 11.22 8.75 7.01 1.699 <0.001 <.0001 0.114
Collinsella 1.96 0.20 0.46 0.16 0.529 0.018 0.216 0.359
Anaerobutyricum 0.08 0.53 0.20 0.06 0.256 0.741 0.584 0.152
Catenibacterium 0.26 0.04 0.15 0.13 0.182 0.401 0.813 0.469
Gemmiger 8.87 5.80 7.09 5.27 1.053 0.015 0.261 0.649
Ruminococcus 2.41 0.76 2.14 1.21 0.517 0.009 0.574 0.347
Faecalibacterium 15.26a 24.88b 24.44b 24.63b 1.755 0.003 0.006 0.004
Butyricicoccus 1.89 1.33 1.03 0.81 0.486 0.375 0.103 0.868
Holdemanella 1.16 0.19 0.20 0.25 0.381 0.254 0.289 0.151
Clostridium 1.97ab 1.28ab 0.85a 2.69b 0.580 0.248 0.879 0.016
Streptococcus 0.57 0.37 0.14 0.66 0.288 0.390 0.519 0.136
Oscillibacter 1.95 1.55 2.13 2.16 0.519 0.678 0.417 0.647
Spiroplasma 0.54a 0.18a 0.46a 1.71b 0.462 0.853 0.087 0.049
Anaerocella 1.56ab 0.69a 1.22ab 3.19b 0.631 0.827 0.052 0.009
Pseudobutyrivibrio 0.14 0.48 0.46 0.71 0.297 0.207 0.240 0.550
Eubacterium 1.22 2.31 3.16 3.45 0.702 0.149 0.001 0.270
Dorea 1.26a 2.71ab 4.14b 1.10a 0.720 0.306 0.598 <0.001
Prevotella 4.63a 10.71b 6.30a 7.70ab 1.157 <0.001 0.933 0.027
Phascolarctobacterium 0.55 0.91 0.58 0.65 0.338 0.497 0.753 0.662
Roseburia 1.64 4.08 1.72 2.68 0.715 0.009 0.448 0.335
Fournierella 0.48 0.71 0.58 0.96 0.369 0.327 0.591 0.910
Megasphaera 0.02 0.07 0.13 0.49 0.247 0.422 0.230 0.951
Agathobacter 0.81 1.61 1.11 1.34 0.448 0.198 0.832 0.459
Blautia 2.31 1.04 3.13 1.09 0.626 0.003 0.541 0.659
Christensenella 1.48ab 2.78a 2.14ab 1.09b 0.589 0.932 0.319 0.027
Pseudoflavonifractor 1.25 0.54 1.77 0.68 0.503 0.028 0.465 0.880
Hungateiclostridium 0.31 0.18 0.14 0.07 0.197 0.563 0.385 0.938
Treponema 0.17 0.11 1.48 0.46 0.430 0.306 0.029 0.622
Dialister 0.05 0.02 0.06 0.11 0.127 0.949 0.616 0.664
* A total of eight replicates were used per treatment group. a b Mean values within a row with unlike superscript letters were significantly different (P<0.05).
Table 12. The effect of dietary treatment on the molar and total concentrations of VFA in mmol/g of digesta in the colon (Least-square means with their standard errors).
Table 12. The effect of dietary treatment on the molar and total concentrations of VFA in mmol/g of digesta in the colon (Least-square means with their standard errors).
Treatment* P Values
Grain preservation method Dried OA-preserved Dried OA-preserved SEM Grain Protein Grain x Protein
Crude Protein Level Standard Standard Low Low
Colon
Acetate 0.499 0.512 0.422 0.423 0.0161 0..667 <0.001 0.735
Propionate 0.281 0.281 0.332 0.339 0.0079 0.643 <0.001 0.666
Butyrate 0.161 0.145 0.190 0.184 0.0120 0.358 0.008 0.689
Valerate 0.038 0.032 0.033 0.026 0.0044 0.145 0.235 0.944
Isobutyrate 0.011 0.015 0.012 0.015 0.0021 0.103 0.703 0.977
Isovalerate 0.011 0.017 0.012 0.013 0.0024 0.126 0.568 0.352
BCFA 0.059 0.054 0.063 0.052 0.0057 0.168 0.846 0.666
Total 220.05a 207.18a 162.47b 196.79a 10.5124 0.316 0.003 0.033
VFA, volatile fatty acids; BCFA, branched-chain fatty acids. *A total of eight replicates were used per treatment group.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.