Submitted:
23 August 2024
Posted:
27 August 2024
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Cell Culture
2.3. Macrophages Differentiation and Co-Culture Setup
2.4. MTT Assay
2.5. RNA Extraction and Real-Time PCR
2.6. Quantitation of Cytokine Levels by Cytometric Bead Array
2.7. Quantitation of Cytokine Levels by ELISA
2.8. Assessment of Intracellular Reactive Oxygen Species (ROS) by Flow Cytometry
2.9. Statistical Analysis
3. Results
3.1. Differentiation, Polarization of Macrophages, and a Co-Culture of Endometriotic 12Z Cells and M1-Polarized THP-1 Cells
3.2. Effect of Resveratrol and Its Derivatives on 12Z Cell and THP-1-Derived Macrophage Proliferation
3.3. Effect of Resveratrol and Its Derivatives on the Expression of Genes Related to the Inflammatory and Oxidative Profile of Macrophages Co-Cultured with Endometriotic Cells
3.4. Effect of Resveratrol and Its Derivatives on the Cytokine/Chemokine Secretion in an Inflamed Co-Culture Model of Macrophages and Endometriotic Cells
3.5. Effect of Resveratrol and Its Derivatives on the Intracellular Reactive Oxygen Species (ROS) Generation in an Inflamed Co-Culture Model of Macrophages and Endometriotic Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Critchley, H.O.D.; Babayev, E.; Bulun, S.E.; Clark, S.; Garcia-Grau, I.; Gregersen, P.K.; Kilcoyne, A.; Kim, J.-Y.J.; Lavender, M.; Marsh, E.E.; et al. Menstruation: Science and Society. Am J Obstet Gynecol 2020, 223, 624–664. [Google Scholar] [CrossRef] [PubMed]
- Chambers, M.; Rees, A.; Cronin, J.G.; Nair, M.; Jones, N.; Thornton, C.A. Macrophage Plasticity in Reproduction and Environmental Influences on Their Function. Front Immunol 2021, 11, 607328. [Google Scholar] [CrossRef] [PubMed]
- Greaves, E.; Temp, J.; Esnal-Zufiurre, A.; Mechsner, S.; Horne, A.W.; Saunders, P.T.K. Estradiol Is a Critical Mediator of Macrophage-Nerve Cross Talk in Peritoneal Endometriosis. Am J Pathol 2015, 185, 2286–2297. [Google Scholar] [CrossRef]
- Yang, H.-L.; Zhou, W.-J.; Chang, K.-K.; Mei, J.; Huang, L.-Q.; Wang, M.-Y.; Meng, Y.; Ha, S.-Y.; Li, D.-J.; Li, M.-Q. The Crosstalk between Endometrial Stromal Cells and Macrophages Impairs Cytotoxicity of NK Cells in Endometriosis by Secreting IL-10 and TGF-β. Reproduction 2017, 154, 815–825. [Google Scholar] [CrossRef] [PubMed]
- Gołąbek, A.; Kowalska, K.; Olejnik, A. Polyphenols as a Diet Therapy Concept for Endometriosis-Current Opinion and Future Perspectives. Nutrients 2021, 13, 1347. [Google Scholar] [CrossRef]
- Malaguarnera, L. Influence of Resveratrol on the Immune Response. Nutrients 2019, 11, 946. [Google Scholar] [CrossRef]
- Meng, T.; Xiao, D.; Muhammed, A.; Deng, J.; Chen, L.; He, J. Anti-Inflammatory Action and Mechanisms of Resveratrol. Molecules 2021, 26, 229. [Google Scholar] [CrossRef]
- Donnez, J.; Binda, M.M.; Donnez, O.; Dolmans, M.-M. Oxidative Stress in the Pelvic Cavity and Its Role in the Pathogenesis of Endometriosis. Fertility and Sterility 2016, 106, 1011–1017. [Google Scholar] [CrossRef]
- Murias, M.; Jäger, W.; Handler, N.; Erker, T.; Horvath, Z.; Szekeres, T.; Nohl, H.; Gille, L. Antioxidant, Prooxidant and Cytotoxic Activity of Hydroxylated Resveratrol Analogues: Structure–Activity Relationship. Biochemical Pharmacology 2005, 69, 903–912. [Google Scholar] [CrossRef]
- Yan, W.; Ren, D.; Feng, X.; Huang, J.; Wang, D.; Li, T.; Zhang, D. Neuroprotective and Anti-Inflammatory Effect of Pterostilbene Against Cerebral Ischemia/Reperfusion Injury via Suppression of COX-2. Frontiers in Pharmacology 2021, 12. [Google Scholar] [CrossRef]
- Ravagnan, G.; De Filippis, A.; Cartenì, M.; De Maria, S.; Cozza, V.; Petrazzuolo, M.; Tufano, M.A.; Donnarumma, G. Polydatin, A Natural Precursor of Resveratrol, Induces β-Defensin Production and Reduces Inflammatory Response. Inflammation 2013, 36, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Potdar, S.; Parmar, M.S.; Ray, S.D.; Cavanaugh, J.E. Protective Effects of the Resveratrol Analog Piceid in Dopaminergic SH-SY5Y Cells. Arch. Toxicol. 2018, 92, 669–677. [Google Scholar] [CrossRef] [PubMed]
- Smith, M.P.; Young, H.; Hurlstone, A.; Wellbrock, C. Differentiation of THP1 Cells into Macrophages for Transwell Co-Culture Assay with Melanoma Cells. Bio Protoc 2015, 5, e1638. [Google Scholar] [CrossRef]
- Genin, M.; Clement, F.; Fattaccioli, A.; Raes, M.; Michiels, C. M1 and M2 Macrophages Derived from THP-1 Cells Differentially Modulate the Response of Cancer Cells to Etoposide. BMC Cancer 2015, 15, 577. [Google Scholar] [CrossRef]
- Olejnik, A.; Rychlik, J.; Kidoń, M.; Czapski, J.; Kowalska, K.; Juzwa, W.; Olkowicz, M.; Dembczyński, R.; Moyer, M.P. Antioxidant Effects of Gastrointestinal Digested Purple Carrot Extract on the Human Cells of Colonic Mucosa. Food Chem. 2016, 190, 1069–1077. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, K.; Dembczyński, R.; Gołąbek, A.; Olkowicz, M.; Olejnik, A. ROS Modulating Effects of Lingonberry (Vaccinium Vitis-Idaea L.) Polyphenols on Obese Adipocyte Hypertrophy and Vascular Endothelial Dysfunction. Nutrients 2021, 13, 885. [Google Scholar] [CrossRef]
- Golabek, A.; Kaczmarek, M.; Dondajewska, E.; Sakrajda, K.; Mackiewicz, A.; Dams-kozlowska, H. Application of a Three-dimensional (3D) Breast Cancer Model to Study Macrophage Polarization. Experimental and Therapeutic Medicine 2021, 21, 1–11. [Google Scholar] [CrossRef]
- Hogg, C.; Horne, A.W.; Greaves, E. Endometriosis-Associated Macrophages: Origin, Phenotype, and Function. Front. Endocrinol. 2020, 11. [Google Scholar] [CrossRef]
- Scutiero, G.; Iannone, P.; Bernardi, G.; Bonaccorsi, G.; Spadaro, S.; Volta, C.A.; Greco, P.; Nappi, L. Oxidative Stress and Endometriosis: A Systematic Review of the Literature. Oxid Med Cell Longev 2017, 2017, 7265238. [Google Scholar] [CrossRef]
- Oală, I.E.; Mitranovici, M.-I.; Chiorean, D.M.; Irimia, T.; Crișan, A.I.; Melinte, I.M.; Cotruș, T.; Tudorache, V.; Moraru, L.; Moraru, R.; et al. Endometriosis and the Role of Pro-Inflammatory and Anti-Inflammatory Cytokines in Pathophysiology: A Narrative Review of the Literature. Diagnostics 2024, 14, 312. [Google Scholar] [CrossRef]
- Ding, S.; Guo, X.; Zhu, L.; Wang, J.; Li, T.; Yu, Q.; Zhang, X. Macrophage-Derived Netrin-1 Contributes to Endometriosis-Associated Pain. Annals of Translational Medicine 2021, 9, 29–29. [Google Scholar] [CrossRef]
- Woo, J.-H.; Yang, Y.-I.; Ahn, J.-H.; Choi, Y.S.; Choi, J.-H. Interleukin 6 Secretion from Alternatively Activated Macrophages Promotes the Migration of Endometriotic Epithelial Cells. Biol Reprod 2017, 97, 660–670. [Google Scholar] [CrossRef] [PubMed]
- Sekulovski, N.; Whorton, A.E.; Shi, M.; MacLean, J.A.; Hayashi, K. Endometriotic Inflammatory Microenvironment Induced by Macrophages Can Be Targeted by Niclosamide†. Biol Reprod 2019, 100, 398–408. [Google Scholar] [CrossRef] [PubMed]
- Kämpfer, A.A.M.; Urbán, P.; Gioria, S.; Kanase, N.; Stone, V.; Kinsner-Ovaskainen, A. Development of an in Vitro Co-Culture Model to Mimic the Human Intestine in Healthy and Diseased State. Toxicology in Vitro 2017, 45, 31–43. [Google Scholar] [CrossRef]
- Talib, W.H.; Alsayed, A.R.; Farhan, F.; Al Kury, L.T. Resveratrol and Tumor Microenvironment: Mechanistic Basis and Therapeutic Targets. Molecules 2020, 25, 4282. [Google Scholar] [CrossRef]
- Ramírez-Pavez, T.N.; Martínez-Esparza, M.; Ruiz-Alcaraz, A.J.; Marín-Sánchez, P.; Machado-Linde, F.; García-Peñarrubia, P. The Role of Peritoneal Macrophages in Endometriosis. Int J Mol Sci 2021, 22, 10792. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Liu, Y.; Zhong, Z.; Wei, C.; Liu, Y.; Zhu, X. Peritoneal Immune Microenvironment of Endometriosis: Role and Therapeutic Perspectives. Front. Immunol. 2023, 14. [Google Scholar] [CrossRef]
- Sinreih, M.; Anko, M.; Kene, N.H.; Kocbek, V.; Rižner, T.L. Expression of AKR1B1, AKR1C3 and Other Genes of Prostaglandin F2α Biosynthesis and Action in Ovarian Endometriosis Tissue and in Model Cell Lines. Chemico-Biological Interactions 2015, 234, 320–331. [Google Scholar] [CrossRef]
- Lai, Z.-Z.; Yang, H.-L.; Ha, S.-Y.; Chang, K.-K.; Mei, J.; Zhou, W.-J.; Qiu, X.-M.; Wang, X.-Q.; Zhu, R.; Li, D.-J.; et al. Cyclooxygenase-2 in Endometriosis. Int J Biol Sci 2019, 15, 2783–2797. [Google Scholar] [CrossRef]
- Connolly, T.P. Cyclooxygenase-2 Inhibitors in Gynecologic Practice. Clin Med Res 2003, 1, 105–110. [Google Scholar] [CrossRef]
- Tassinari, V.; Smeriglio, A.; Stillittano, V.; Trombetta, D.; Zilli, R.; Tassinari, R.; Maranghi, F.; Frank, G.; Marcoccia, D.; Di Renzo, L. Endometriosis Treatment: Role of Natural Polyphenols as Anti-Inflammatory Agents. Nutrients 2023, 15, 2967. [Google Scholar] [CrossRef] [PubMed]
- Ziętek, A.; Futyma, K.; Nowakowski, Ł.; Gogacz, M.; Rechberger, T. Progress on Macrophage’s Proinflammatory Products as Markers of Acute Endometriosis. Journal of Acute Disease 2015, 4, 169–172. [Google Scholar] [CrossRef]
- Lousse, J.-C.; Van Langendonckt, A.; González-Ramos, R.; Defrère, S.; Renkin, E.; Donnez, J. Increased Activation of Nuclear Factor-Kappa B (NF-kappaB) in Isolated Peritoneal Macrophages of Patients with Endometriosis. Fertil Steril 2008, 90, 217–220. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, J.; Zhang, X. An Update on the Multifaceted Role of NF-kappaB in Endometriosis. Int J Biol Sci 2022, 18, 4400–4413. [Google Scholar] [CrossRef] [PubMed]
- Sharif, O.; Bolshakov, V.N.; Raines, S.; Newham, P.; Perkins, N.D. Transcriptional Profiling of the LPS Induced NF-κB Response in Macrophages. BMC Immunol 2007, 8, 1. [Google Scholar] [CrossRef]
- Kolahdouz-Mohammadi, R.; Shidfar, F.; Khodaverdi, S.; Arablou, T.; Heidari, S.; Rashidi, N.; Delbandi, A. Resveratrol Treatment Reduces Expression of MCP-1, IL-6, IL-8 and RANTES in Endometriotic Stromal Cells. J. Cell. Mol. Med. 2021, 25, 1116–1127. [Google Scholar] [CrossRef] [PubMed]
- Taguchi, A.; Wada-Hiraike, O.; Kawana, K.; Koga, K.; Yamashita, A.; Shirane, A.; Urata, Y.; Kozuma, S.; Osuga, Y.; Fujii, T. Resveratrol Suppresses Inflammatory Responses in Endometrial Stromal Cells Derived from Endometriosis: A Possible Role of the Sirtuin 1 Pathway. J Obstet Gynaecol Res 2014, 40, 770–778. [Google Scholar] [CrossRef]
- Didziokaite, G.; Biliute, G.; Gudaite, J.; Kvedariene, V. Oxidative Stress as a Potential Underlying Cause of Minimal and Mild Endometriosis-Related Infertility. Int J Mol Sci 2023, 24, 3809. [Google Scholar] [CrossRef]
- Mulgund, A.; Doshi, S.; Agarwal, A. Chapter 25 - The Role of Oxidative Stress in Endometriosis. In Handbook of Fertility; Watson, R.R., Ed.; Academic Press: San Diego, 2015; pp. 273–281. ISBN 978-0-12-800872-0. [Google Scholar]
- Ekarattanawong, S.; Tanprasertkul, C.; Somprasit, C.; Chamod, P.; Tiengtip, R.; Bhamarapravatana, K.; Suwannarurk, K. Possibility of Using Superoxide Dismutase and Glutathione Peroxidase as Endometriosis Biomarkers. Int J Womens Health 2017, 9, 711–716. [Google Scholar] [CrossRef]
- Gołąbek-Grenda, A.; Olejnik, A. In Vitro Modeling of Endometriosis and Endometriotic Microenvironment – Challenges and Recent Advances. Cellular Signalling 2022, 110375. [Google Scholar] [CrossRef]
- Laganà, A.S.; Salmeri, F.M.; Ban Frangež, H.; Ghezzi, F.; Vrtačnik-Bokal, E.; Granese, R. Evaluation of M1 and M2 Macrophages in Ovarian Endometriomas from Women Affected by Endometriosis at Different Stages of the Disease. Gynecological Endocrinology 2020, 36, 441–444. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, H.; Imanaka, S. Understanding the Molecular Mechanisms of Macrophage Polarization and Metabolic Reprogramming in Endometriosis: A Narrative Review. Reproductive Medicine and Biology 2022, 21, e12488. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.T.Y.; Hudson, T.S.; Wang, T.-C.; Remsberg, C.M.; Davies, N.M.; Takahashi, Y.; Kim, Y.S.; Seifried, H.; Vinyard, B.T.; Perkins, S.N.; et al. Differential Effects of Resveratrol on Androgen-Responsive LNCaP Human Prostate Cancer Cells in Vitro and in Vivo. Carcinogenesis 2008, 29, 2001–2010. [Google Scholar] [CrossRef]
- Feng, L.; Yasmeen, R.; Schoene, N.W.; Lei, K.Y.; Wang, T.T.Y. Resveratrol Differentially Modulates Immune Responses in Human THP-1 Monocytes and Macrophages. Nutr Res 2019, 72, 57–69. [Google Scholar] [CrossRef] [PubMed]







| Gene | Accession | No. sequence (5’-3’) | Amplicon (bp) |
|---|---|---|---|
| CCL2 | NM_002982.4 | F: AGAATCACCAGCAGCAAGTGTCC R: TCCTGAACCCACTTCTGCTTGG |
98 |
| CXCL10 | NM_001565.4 | F: GAACTGTACGCTGTACCTGCA R: TTGATGGCCTTCGATTCTGGA |
172 |
| GAPDH | NM_002046.7 | F: GTCTCCTCTGACTTCAACAGCG R:ACCACCCTGTTGCTGTAGCCAA |
131 |
| GPX1 | NM_000581.4 | F: GTGCTCGGCTTCCCGTGCAAC R: CTCGAAGAGCATGAAGTTGGGC |
123 |
| IL1B | NM_000576.3 | F: CCACAGACCTTCCAGGAGAATG R: GTGCAGTTCAGTGATCGTACAGG |
131 |
| IL6 | NM_000600.5 | F: AGACAGCCACTCACCTCTTCAG R: TTCTGCCAGTGCCTCTTTGCTG |
132 |
| IL8 | NM_001354840.3 | F: GAGAGTGATTGAGAGTGGACCAC R: CACAACCCTCTGCACCCAGTTT |
112 |
| NFKB1 | NM_003998.4 | F: GCAGCACTACTTCTTGACCACC R: TCTGCTCCTGAGCATTGACGTC |
130 |
| PTGS2 | NM_000963.4 | F: CGGTGAAACTCTGGCTAGACAG R: GCAAACCGTAGATGCTCAGGGA |
156 |
| SOD1 | NM_000454.5 | F: CTCACTCTCAGGAGACCATTGC R: CCACAAGCCAAACGACTTCCAG |
129 |
| TNF | NM_000594.4 | F: CTCTTCTGCCTGCTGCACTTTG R: ATGGGCTACAGGCTTGTCACTC |
135 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).