Prerpints.org logo
Preprint
Article

This version is not peer-reviewed.

Development of Rice Lines by Pyramiding of Major Blast Resistance Genes

Submitted:

14 June 2024

Posted:

17 June 2024

Read the latest preprint version here

Abstract
Rice blast is the most harmful disease caused by Magnaporthe oryzae, leading to yield loss. The aim of the work is to improve resistance of rice to blast by introducing and pyramiding genes using conventional breeding technique and modern MAS analysis. Pyramiding is the combination of several resistance genes in one genotype, in this case it improves the resistance of rice to pathogens. MAS analysis revealed that 3 out of 4 studied domestic high-yielding rice cultivars (Bakanasski, Aisaule and Aru) contain 1 blast resistance gene (Pi-2). It was discovered 7 pyramidal lines with the introduction of a combination of 2 blast resistance genes (Pi-1 and Pi-ta) into 6 hybrids and 3 genes (Pi-1, Pi-33 and Pi-ta) into 1 line. Phytopathological test of local cultivars and pyramidal lines of rice showed that 3 out of 7 pyramidal lines have moderate resistance: 2 lines (F2 Bakanasski/7667 (var. vulgaris Koern.) and F2 Aisaule/7664 (var. italica Alef.)), containing 2 resistance genes (Pi-1 and Pi-ta) and 1 line – F2 Aisaule/7689 (var. zeravschanica Brsch.), carrying 3 genes (Pi-1, Pi-33 and Pi-ta), while the local cultivars Bakanasski, Aisaule and Aru are susceptible. As a result, the blast resistance of rice was improved by creating pyramidal lines. Pyramided lines can be used for germplasm exchange and in rice breeding programs to improve blast resistance in rice.
Keywords: 
Rice
;  
hybrid
;  
Magnaporthe oryzae
;  
resistance
;  
Marker Assisted Selection (MAS)
;  
gene pyramiding
;  
phytopathology
Subject: 
Biology and Life Sciences  -   Biology and Biotechnology

1. Introduction

Rice blast is one of the most dangerous diseases [1-2], the causative agent of which is the parasitic fungus Magnaporthe oryzae. The defeat of rice by pathogen in the early stages of development leads to a decrease in seed germination, sparseness of crops and death of seedlings. Blast causes the greatest harm during heading and flowering, which is associated with the formation of underdeveloped or feeble seeds, which significantly reduces grain quality [3]. Blast reduces rice production in the world, causing crop losses from 15-40% and reaching up to 80-100% in epiphytotic years [4].
Global climate change affects the evolution of pathogen biotypes, which challenges breeders and forces them to increase rice productivity by creating and introducing new cultivars resistant to changing races or isolates of Magnaporthe oryzae [5]. Currently, more than 100 blast resistance genes have been discovered [5, 6] [7-15]. Most of them with broad spectrum resistance to pathogen [5-6, 16-19], there are some major genes with a wide spectrum of resistance, such as: Pi-z5 (Pi-2) [20], Pi-9 (t) [21], Pi-ta [22], Pi-1 and Pi- 33 [7-14, 23], which serve as indicators of blast resistance gene clusters, which is important when choosing parent pairs for hybridization. Most blast resistance genes are dominant, some of them are quantitative [24]. Moreover, many resistance genes are clustered on chromosomes 6, 9, 11, and 12 [25-26]. Disease resistance is controlled by one or two [27-28], three [29] or more pairs of genes [30]. Typically, rice has one or two dominant resistance genes that are effective against one race of the fungus [31].
Determination of resistance genes in genetically different rice material is important for identifying new sources of resistance to blast. DNA markers are used to identify resistance genes [26]. The most effective way to combat blast is cultivate resistant cultivars of rice. However, cultivar lost resistance after a few years due to the high variability of rice pathogens [32-33]. The selection of disease-resistant cultivars based on conventional breeding methods is complicated due to the difficulty of determining the presence of the desired allele of a particular gene. The use of molecular markers closely linked to genes that provide resistance to a pathogen greatly facilitates breeding work [34]. Therefore, the main factor in rice breeding for resistance to blast is the selection of resistance donors based on the identification of genes that control this trait in rice and the creation of new cultivars with a high level of resistance [35].
Success to combat with rice blast was achieved by introducing and pyramiding of major blast resistant genes using Marker Assisted Selection (MAS) [6-14]. Most resistance genes ensure that rice is immune only to certain races of the pathogen. It is known that such genes, when pyramided in one genotype, can provide stable resistance to the disease.
Pyramiding is the combination of several pathogen resistance genes in one genotype. Pyramiding multiple resistance genes in a single genotype is the most efficient strategy in breeding for resistance to a variable population of Magnaporthe oryzae. Cultivars that combine combinations of 3-5 resistance genes are more resistant, as they show an increase and expansion of the spectrum of resistance to blast. Thus, the most promising is the introduction of genes by combining (pyramiding) several blast resistance genes in one genotype [7-14, 35]. Screening cultivars for the presence of resistance genes to Magnaporthe oryzae, as well as introducing and pyramiding of resistance genes to the pathogen contributes to a significant reduction in the time for creation rice cultivars. Introducing resistance genes into cultivar is the preferred strategy in a rice breeding program to prevent disease.
The aim of the work is to improve resistance of rice to Magnaporthe oryzae based on the introducing and pyramiding of major blast resistance genes using MAS.

2. Materials and Methods

2.1. Plant Materials

The objects of research were 35 parental genotypes of local and foreign selection from the rice collection of Institute of Plant Biology and Biotechnology: 04636, 19-14, 57-14, 03-27, 04468, 04470, 04469, 95-06, 25-14, 04888, 212-05, 7653, 7662, 7663, 7664, 7666, 7667, 7668, 7679, 7683, 7684, 7686, 7689, 7690, 7695, 7698, 7701, 7702, 7712, 7824, Don 7712, Bakanasski, Fatima, Aisaule, Aru and obtained by crossing 54 hybrid lines of generation F2 (F2 Bakanasski/7668 (var. subuzbekistanica Kond.), F2 Bakanasski / 04470 (var. vulgaris Koern.), F2 Bakanasski/7653 (var. subuzbekistanica Kond.), F2 Bakanasski/7653 (var. subjanthoseros Brsch.), F2 Bakanasski/7684 (var. subvulgaris Brsch.), F2 Bakanasski/7684 (var. vulgaris Koern.), F2 7824/Aisaule (var. italica Alef.), F2 7824/Aisaule (var. subuzbekistanica Kond.), F2 Aru/04468 (var. subvulgaris Brsch.), F27698/Bakanasski (var. subvulgaris Brsch.), F2 7698/Bakanasski (var. italica Alef.), F2 Aru/7701 (var. vulgaris Koern.), F2 Bakanasski/0327 (var. vulgaris Koern.), F2 Aisaule/7679 (var. subvulgaris Brsch.), F2 7698/Aisaule (var. italica Alef.), F2 7698/Aisaule (var. suberythroseros Kan.), F2 Aru/7702 (var. erythroceros Koern.), F2 Aisaule/7689 (var. zeravschanica Brsch.), F2 Aru/0327 (var. vulgaris Koern.), F2 Aru/0327 (var. subpyrocarpa Alef.), F2 Bakanasski/7667 (var. subjanthoseros Brsch.), F2 Bakanasski/7667 (var. vulgaris Koern.), F2 Bakanasski/7701 (var. vulgaris Koern.), F2 Aisaule/7664 (var. italica Alef.), F2 Aisaule/7664 (var. subvulgaris Brsch.), F2 Aisaule/04470 (var. subvulgaris Brsch.), F2 Aisaule/04470 (var. italica Alef.), F2 Aisaule/Don 7712 (var. sundensis Koern.), F2 Aisaule/Don 7712 (var. italica Alef.), F2 Fatima/7695 (var. italica Alef.), F2 Fatima/7695 (var. breviaristata Vav.), F2 Bakanasski/7683 (var. subjanthoseros Brsch.), F2 7698/Aru (var. erythroceros Koern.), F2 7698/Aru (var. suberythroseros Kan.), F2 Bakanasski/Don 7712, F2 Bakanasski/Don 7712 (var. Desvauxii Koern.), F2Aru/212-05 (var. vulgaris Koern.), F2 Aru/7668 (var. vulgaris Koern.), F2 Aisaule/04468 (var. italica Alef.), F2 Aru/04636 (var. vulgaris Koern.), F2 Bakanasski/7690 (var. subjanthoseros Brsch.), F2 Bakanasski/7690 (var. vulgaris Koern.), F2 Bakanasski/04468 (var. subvulgaris Brsch.), F2 Bakanasski/04468 (var. vulgaris Koern.), F2 Aru/7666 (var. suberythroseros Kan.), F2Fatima/7653 (var. persica Kan.), F2 Fatima/7689 (var. italica Alef.), F2 Aru/Don 7712 (var. erythroceros Koern.), F2 Aru/Don 7712 (var. Desvauxii Koern.), F2 Aru/Don 7712 (var. vulgaris Koern.), F2 Aru/Don 7712 (var. Desvauxii Koern.) semi-awned, F2 ♀ Aru/7683 (var. janthoceros Koern.), F2 Aru/7683 (var. vulgaris Koern.), F2 Aisaule/7663 (var. italica Alef.)).

2.2. Hybridization Method

Hybridization was carried out using pneumocastration (three-channel pneumocastrator) and the "TWEL" plant pollination method [36]. 31 genotypes were used as donors, the genome of which contains genes of resistance to rice blast (Pi-1, Pi-2, Pi-33 and Pi-ta), and the recipients were highly productive zoned local cultivars, such as Bakanasski, Fatima, Aisaule and Aru.

2.3. Plant Genomic DNA Isolation

Genomic DNA isolation from two-week-old seedlings was performed according to the CTAB method [37] by CTAB reagent (PanReac, AppliChem, Germany).

2.4. Multiplex PCR Analysis

PCR was performed on a T100 amplifier (BioRad, Germany). Multiplex PCR analysis allows to determine the presence of two or more genes in the genotype. SSR (simple sequence repeat) markers were used to identify genes. The list of SSR markers (Syntol, Russia) for Pi complex genes is given in Table 1. The annealing temperature is the same for all primers, 65º C.
The following genotypes were used as differentiator cultivars that are carriers of resistance genes: C101-Lac (+) for Pi-1, Pi-33 genes, C101-A51 (+) for Pi-2 gene and IR 36 (+) for Pi-ta gene. The cultivar Flagman (-) was used as a negative control for all studied genes.

2.5. Gel Electrophoresis

Separation of amplification products with microsatellite primers was carried out by using 8% polyacrylamide gel in vertical electrophoresis chamber (Helicon, Russia) based on 1× TRIS borate electrode buffer. The gels were studied using a gel documentation system (BioRad, USA). DNA marker 100 bp (Syntol, Russia) was used in this work.

2.6. Phytopathological Screening

The test of 54 hybrid rice lines for resistance to populations Magnaporthe oryzae was carried out in 2023 in an artificial infectious nursery at the FSBSI “FSRC” in accordance with the methodological guidelines [38]. The rice cultivar Pobeda 65 was used as a susceptible control, and the rice cultivar Avangard was used as a resistant control.
Rice plants was infected with a culture of the fungus M. oryzae in the booting phase by spraying a suspension of a conidial mixture.
The degree of plant damage (in percentage) was taken into account on the 14th day after inoculation, according to the express method for assessing rice varietal resistance to blast. The assessment was carried out taking into account the type of reaction (in points) on a ten-point scale of the International Rice Research Institute, using the designations: resistant lines - R, moderately resistant - MR and susceptible - S.

2.7. Analysis of Structural Elements of Yield of Hybrid Rice Lines

Evaluation of productivity of hybrid lines in comparison with standard cultivar Bakanasski was carried out according to biometric parameters of yield structure elements (“bushiness, pc”, “plant height, cm”, “panicle length, cm”, “number of grains from the main panicle, pc”, “weight of seeds from the main panicle, g”, “weight of 1000 seeds, g” and etc.) [39]

2.8. Statistical Analyses

To characterize the productivity of hybrid lines in comparison with Bakanasski cultivar, which is the standard for Almaty region, we used such statistical parameters as mean value, standard deviation for main trait characterizing rice productivity “weight of 1000 seeds, g”. Analysis of variance (one-way ANOVA) was performed to compare the mean values of the data groups. Data processing was carried out in Microsoft Excel 2021 using a data analysis package.

3. Results and Discussion

3.1. Screening of Parental Rice Genotypes for Blast Resistance Genes Pi-1 and Pi-2

In the electropherogram of Figure 1 (A), the Pi-1 gene is present in one 7668 sample (19 well) in a homozygous state. Several homozygous samples were found for the Pi-2 gene: 03-27 (6 well), 04468 (7 well), 04470 (8 well) and 7662 (14 well).
Figure 1 (B) shows that samples 7679 (5 well), 7683 (6 well), 7684 (7 well), 7689 (8 well), 7695 (10 well) turned out to be homozygous for the Rm224 and Rm144 loci, which indicates presence of a dominant rice blast resistance gene Pi-1, because they repeat the DNA profile of the positive control C101-Lac. Samples 7702 (12 well) and 7712 (13 well) are heterozygous for this gene.
For the Rm527 and SSR140 loci, samples 7684 (7 well), 7690 (9 well), Bakanasski (16 well), Aisaule (18 well) and Aru (19 well) showed identical DNA profile similarity with the differentiator cultivar C101-A51, which indicates presence of the Pi-2 gene. All other samples taken for PCR analysis showed the presence of recessive genes of resistance in their genotypes.

3.2. Screening of Parental Genotypes for the Presence of Pi-33 and Pi-ta Genes

The electropherogram of Figure 2A shows that samples 7662 (16 well) and 7663 (17 well) were identified as carriers of a homozygous dominant allele of the Pi-33 resistance gene, as these genotypes repeat the carrier profile of the C101-Lac resistance gene.
For the Pi-ta gene, a heterozygous state of the gene was found in genotypes 03-27 (8 well) and 04468 (9 well), genotypes 25-14 (12 well) and 7664 (18 well) were homozygous for this locus (Fig. 2 A), because these genotypes match the DNA of the positive control sample IR36.
According to the results (Figure 2 B), the Pi-33 resistance gene is shown in a homozygous state in genotypes 7668 (6 well), 7679 (7 well), 7684 (9 well), 7686 (10 well), 7689 (11 well) and in 7690 (12 well) compared to C101-Lac.
In genotypes 7686 (10 well) and 7701 (15 well), a locus was identified that co-segregates with the dominant resistance gene Pi-ta (Figure 2 B), and genotype 7667 (5 well) showed a heterozygous state of the Pi-ta gene, since repeats the bands of both IR36 and C101-Lac.
Figure 2C shows that local rice cultivars do not have Pi-33 and Pi-ta resistance genes in their genotypes.
According to the data of electropherograms of 4 analyzed local released high-yielding cultivars used as maternal lines in crosses, it turned out that three cultivars Bakanasski, Aisaule and Aru contain Pi-2 gene. It should be noted, that all four local genotypes do not contain the other three studied genes (Pi-1, Pi-33 and Pi-ta). Consequently, we further conducted experiments to introduce and pyramid these genes into local cultivars using hybridization and MAS analysis methods to improve rice resistance to blast.

3.3. Screening of Rice Hybrids for the Presence of Pi-1 and Pi-2 Genes

Figure 3A shows that 4 hybrids 7824/Aisaule (var. italica Alef.) (11 well), 7824/Aisaule (var. subuzbekistanica Kond.) (12 well), 7698/Bakanasski (var. subvulgaris Brsch.) (14 well), 7698/Bakanasski (var. italica Alef.) (15 well) are heterozygotes for Pi-2.
According to Figure 3B, the following 13 hybrids showed to contain Pi-1 gene in homozygous state in their genotypes: 7698/Aisaule (var. suberythroseros Kan.) (5 well), Aru/7702 (var. erythroceros Koern.) (6 well), Aisaule/7689 (var. zeravschanica Brsch.) (7 well), Aru/0327 (var. vulgaris Koern.) (8 well), Aru/0327 (var. subpyrocarpa Alef.) (9 well), Bakanasski/7667 (var. subjanthoseros Brsch.) (10 well), Bakanasski/7667 (var. vulgaris Koern.) (11 well), Bakanasski/7701 (var. vulgaris Koern.) (12 well), Aisaule/7664 (var. italica Alef.) (13 well), Aisaule/04470 (var. subvulgaris Brsch.) (15 well), Aisaule/04470 (var. italica Alef.) (16 well), Aisaule/Don 7712 (var. sundensis Koern.) (17 well), Aisaule/Don 7712 (var. italica Alef.) (18 well).
The DNA profiles of the above hybrid lines are similar to those of differentiator cultivars C101-Lac and C101-A51, indicating successful transfer of blast resistance genes.
The electropherogram of Figure 3B demonstrates the heterozygous state of the hybrid Bakanasski/7683 (var. subjanthoseros Brsch.) for the Pi-1. The dominant homozygote for this gene was the hybrid line Aru/04636 (var. vulgaris Koern.).

3.4. Screening of Rice Hybrids for the Presence of Pi-33 and Pi-ta Genes

Figure 4A shows that the hybrid Bakanasski/7684 (var. subvulgaris Brsch.) (9 well) has the target Pi-33 gene in the genotype in homozygous state. Line Bakanasski/7668 (var. subuzbekistanica Kond.) (5 well) showed the presence of a dominant Pi-ta resistance gene.
The electropherogram of Figure 4B shows that the hybrid line Aisaule/7689 (var. zeravschanica Brsch.) (7 well) is heterozygous for the Pi-33 resistance gene. According to Figure 4B, the heterozygous state of the Pi-ta allele was found in 6 hybrid lines: 7698/Aisaule (var. suberythroseros Kan.) (5 well), Aru/7702 (var. erythroceros Koern.) (6 well), Aisaule/7689 (var. zeravschanica Brsch.) (7 well), Bakanasski/7667 (var. vulgaris Koern.) (9 well), Bakanasski/7701 (var. vulgaris Koern.) (10 well), Aisaule/7664 (var. italica Alef.) (11 well).
Electropherogram Figure 4C demonstrates that the line Aisaule/7663 (var. italica Alef.) (18 well) is heterozygous for the Pi-33 gene. Lines Aru/7666 (var. suberythroseros Kan.) (13 well), Aru/Don 7712 (var. Desvauxii Koern.) semi-awned (15 well), Aru/0327 (var. subpyrocarpa Alef.) (19 well) are heterozygous for the Pi-ta blast resistance gene.
Electropherogram Figure 4D shows that the lines Bakanasski/Don 7712 (5 well), Aru/04468 (var. subvulgaris Brsch.) (7 well), Bakanasski/7667 (var. subjanthoseros Brsch.) (8 well) and Aru/Don 7712 (var. erythroceros Koern.) (13 well) have a heterozygous state of the Pi-ta allele in their genotypes. Consequently, on electrophoresis of PCR products of the Pi-33 and Pi-ta genes, the presence of both homozygous and heterozygous lines is observed in the hybrid offspring. All other analyzed samples showed compliance of the DNA profile with the negative control cultivar Flagman, that is, they showed the presence of a recessive allele of the Pi-33 and Pi-ta genes, respectively.
According to electropherograms of PCR products, 29 hybrid lines were found, the genotypes of which contain genes for resistance to blast disease. Of these, 7 hybrids are pyramidal: 6 hybrids 7698/Aisaule (var. suberythroseros Kan.), Aru/7702 (var. erythroceros Koern.), Bakanasski/7667 (var. subjanthoseros Brsch.), Bakanasski/7667 (var. vulgaris Koern.), Bakanasski/7701 (var. vulgaris Koern.), Aisaule/7664 (var. italica Alef.) have 2 resistance genes to blast Pi-1 and Pi-ta. In the hybrid Aisaule/7689 (var. zeravschanica Brsch.) 3 genes are pyramided - Pi-1, Pi-33 and Pi-ta. The remaining hybrids have one of the studied genes.

3.5. Phytopathological Test of Cultivars and Pyramided Lines for Resistance to Blast Disease

Phytopathological test of local cultivars used as maternal lines showed that the cultivars Bakanasski, Aisaule and Aru are susceptible, and the cultivar Fatima is moderately resistant. Test of the resistance of hybrid lines allowed us to identify hybrids with high, medium and low resistance to the phytopathogen. Among the selected 7 pyramided lines, 1 line did not grow under the conditions of an infectious nursery. In results, of the remaining 6 pyramided lines, 3 lines – Bakanasski/7667 (var. vulgaris Koern.) and Aisaule/7664 (var. italica Alef.) (carrying 2 resistance genes Pi-1 and Pi-ta) and 1 line – Aisaule/7689 (var. zeravschanica Brsch.) (carrying 3 genes – Pi-1, Pi-33 and Pi-ta) showed moderate resistance (MR) were developed.

3.6. Assessment of the Productivity of Pyramided Rice Lines

The evaluation of the productivity created 6 lines of rice from 7 selected lines (1 line not grown under the infectious diseases nursery) (Aru/7702 (var. erythroceros Koern.), Aisaule/7689 (var. zeravschanica Brsch.), Bakanasski/7667 (var. vulgaris Koern.), Bakanasski/7667 (var. subjanthoseros Brsch.), Bakanasski/7701 (var. vulgaris Koern.), Aisaule/7664 (var. italica Alef.)) performed by analysis of yield structure elements. The lines were evaluated based on mane productivity trait, such as “1000 grain weight, g.” Analysis of variance showed that pyramidal lines were inferior to the standard in yield characterization, since there was significant difference between the groups, p-value < 0.001 (Table 2).
According to the characteristic of yield productivity pyramidal lines are lower in comparison with the control cultivar Bakanasski, which is highly productive for Almaty region.

4. Discussion

MAS analysis facilitates the identification of genes, their introduction and pyramiding into new lines [40, 41], that significantly speeds up rice breeding. The combination of several genes in one genotype showed the greatest effect, indicating the effectiveness of the strategy of durable rice resistance to blast [7-14, 35]. Rice lines carrying both individual resistance genes [40, 42] and lines with pyramided genes (containing combinations genes) with a broad spectrum of resistance to Magnaporthe oryzae were created [41, 43]. Thus, as a result of molecular screening of parental samples for the presence of genes, it was shown that the resistance of local zoned rice cultivars Bakanasski, Fatima, Aisaule and Aru, out of the four genes studied, only one gene Pi-2 is present and only in the cultivars Bakanasski, Aisaule and Aru. The introgression of blast resistance genes from differentiating cultivars into local zoned cultivars was successful. Three pyramidal lines were identified: 2 lines F2 Bakanasski /7667 (var. vulgaris Koern.) and F2 Aisaule /7664 (var. italica Alef.), containing 2 resistance genes (Pi-1 and Pi-ta) and 1 line F2 Aisaule /7689 (var. zeravschanica Brsch.), carrying 3 gene (Pi-1, Pi-33 and Pi-ta). The results of the phytopathological test showed that these three lines with pyramided 2 and 3 resistance genes showed moderate resistance to a mixture of fungal conidia of different races of M. oryzae, while 3 local cultivars (Bakanasski, Aisaule and Aru), containing 1 resistance gene (Pi-2) – susceptible to phytopathogen. Thus, the disease resistance of rice was improved by creating pyramidal lines.

5. Conclusions

The main idea of this work is to develop pyramided rice lines resistant to Magnaporthe oryzae for the breeding of local rice cultivars s adapted to the soil and climatic conditions of rice-growing regions. The use of modern MAS technologies guarantees the acceleration of rice breeding, and hence the introduction to the market of competitive rice cultivars with durable immunity to disease. The created new pyramided lines of rice that are resistant to phytopathogens will be used in rice breeding to create cultivars, which increases the yield and competitiveness of rice in the market and promotes the export of rice products. These pyramidal lines will be used as a source of resistance genes in the breeding process and for germplasm exchange.

Author Contributions

Supervision, project administration and funding acquisition, U.B.; Conceptualization and writing-original draft preparation, M.D., A.A. and D.E.; Investigation and methodology, M.D. and B.Kh.; Software, Z.Z. and M.D.; Writing review and editing, A.A. and Zh.Zh. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

All data used in this manuscript are presented in the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Khush, G.S.; Jena, K.K. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In Wang G.L., Valent B. (Eds.). Advances in genetics, genomics and control of rice blast disease. Springer, Dordrecht., 2009, 1-10. [CrossRef]
  2. Liu, J.; Wang, X.; Mitchell, T.; Hu, Y.; Liu, X.; Dai, L.; Wang, G.L. Recent progress and understanding of the molecular mechanisms of the rice-Magnaporthe oryzae interaction. Molecular Plant Pathology. 2010, 11, 419–427. [Google Scholar] [CrossRef] [PubMed]
  3. Li, Y.B.; Wu, C.J.; Jiang, G.H.; Wang, L.Q.; He, Y.Q. Dynamic analyses of rice blast resistance for the assessment of genetic and environmental effects. Plant Breeding. 2007, 126, 541–547. [Google Scholar] [CrossRef]
  4. Zhang, T.; Huang, L.; Wang, Y.; Wang, W.; Zhao, X.; Zhang, S.; Zhang, J.; Hu, F.; Fu, B.; Li, Z. Differential transcriptome profiling of chilling stress response between shoots and rhizomes of Oryza longistaminata using RNA sequencing. PLoS One 2017, 12, e0188625. [Google Scholar] [CrossRef]
  5. Xiao, W.; Yang, Q.; Huang, M.; Guo, T.; Liu, Y.; Wang, J.; Yang, G.; Zhou, J.; Yang, J.; Zhu, X.; Chen, Zh.; Wang, H. Improvement of rice blast resistance by developing monogenic lines, two-gene pyramids and three-gene pyramid through MAS. Rice 2019, 12. [Google Scholar] [CrossRef]
  6. Liu, Z.; Zhu, Y.; Shi, H.; Qiu, J.; Ding, X.; Kou, Y. Recent Progress in Rice Broad-Spectrum Disease Resistance. Int. J. Mol. Sci. 2021, 22, 11658. [Google Scholar] [CrossRef] [PubMed]
  7. Miah, G.; Rafii, M.Y.; Ismail, M.R.; Puteh, A.B.; Rahim, H.A.; Latif, M.A. Marker-assisted introgression of broad-spectrum blast resistance genes into the cultivated MR219 rice variety. J. Sci. Food Agric. 2017, 97, 2810–2818. [Google Scholar] [CrossRef] [PubMed]
  8. Jiang, H.; Li, Z.; Liu, J.; Shen, Z.; Gao, G.; Zhang, Q.; He, Y. Development and evaluation of improved lines with broad-spectrum resistance to rice blast using nine resistance genes. Rice. 2019; 12. [Google Scholar] [CrossRef]
  9. Jain, P.; Dubey, H.; Singh, P.K.; Solanke, A.U.; Singh, A.K.; Sharma, T.R. Deciphering signaling network in broad spectrum near isogenic lines of rice resistant to Magnaporthe oryzae. Sci. Rep. 2019, 9, 16939. [Google Scholar] [CrossRef] [PubMed]
  10. Wu, Y.; Xiao, N.; Chen, Y.; Yu, L.; Pan, C.; Li, Y.; Zhang, X.; Huang, N.; Ji, H.; Dai, Z.; Chen, X.; Li, A. Comprehensive evaluation of resistance effects of pyramiding lines with different broad-spectrum resistance genes against Magnaporthe oryzae in rice (Oryza sativa L.). Rice. 2019, 12, 1–13. [Google Scholar] [CrossRef] [PubMed]
  11. Yang, D.; Tang, J.; Yang, D.; Chen, Y.; Ali, J.; Mou, T. Improving rice blast resistance of Feng39S through molecular marker-assisted backcrossing. Rice. 2019, 12, 1–16. [Google Scholar] [CrossRef]
  12. Wang, L.; Zhao, L.; Zhang, X.; Zhang, Q.; Jia, Y.; Wang, G.; Li, S.; Tian, D.; Li, W.H.; Yang, S. Large-scale identification and functional analysis of NLR genes in blast resistance in the Tetep rice genome sequence. Proc. Natl. Acad. Sci. USA. 2019, 116, 18479–18487. [Google Scholar] [CrossRef]
  13. Ramalingam, J.; Palanisamy, S.; Alagarasan, G.; Renganathan, V.G.; Ramanathan, A.; Saraswathi, R. Improvement of stable restorer lines for blast resistance through functional marker in rice (Oryza sativa L.). Genes. 2020, 11, 1266. [Google Scholar] [CrossRef]
  14. Peng, M.; Lin, X.; Xiang, X.; Ren, H.; Fan, X.; Chen, K. Characterization and evaluation of transgenic rice pyramided with the Pi Genes Pib, Pi25 and Pi54. Rice. 2021, 14, 1–14. [Google Scholar] [CrossRef]
  15. Devanna, N.B.; Vijayan, J.; Sharma, T.R. The blast resistance gene Pi54 of cloned from Oryza officinalis interacts with Avr-Pi54 through its novel non-LRR domains. PLoS One. 2014, 9, 104–40. [Google Scholar] [CrossRef]
  16. Deng, Y.; Zhai, K.; Xie, Z.; Yang, D.; Zhu, X.; Liu, J.; Wang, X.; Qin, P.; Yang, Y.; Zhang, G.; Li, Q.; Zhang, J.; Wu, S.; Milazzo, J.; Mao, B.; Wang, E.; Xie, H.; Tharreau, D.; He, Z. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science. 2017, 355, 962–965. [Google Scholar] [CrossRef]
  17. Xie, Z.; Yan, B.; Shou, J.; Tang, J.; Wang, X.; Zhai, K.; Liu, J.; Li, Q.; Luo, M.; Deng, Y.; He, Z. A nucleotide-binding site-leucine-rich repeat receptor pair confers broad-spe;ctrum disease resistance through physical association in rice. Philosophical Transactions of the Royal Society B. 2019, 374, 20180308. [Google Scholar] [CrossRef]
  18. Zhao, H.; Wang, X.; Jia, Y.; Minkenberg, B.; Wheatley, M.; Fan, J.; Jia, M.H.; Famoso, A.; Edwards, J.D.; Wamishe, Y.; Valent, B.; Wang, G.L.; Yang, Y. The rice blast resistance gene Ptr encodes an atypical protein required for broad-spectrum disease resistance. Nat. Commun. 2018, 9, 2039. [Google Scholar] [CrossRef]
  19. Meng, X.; Xiao, G.; Telebanco-Yanoria, M.J.; Siazon, P.M.; Padilla, J.; Opulencia, R.; Bigirimana, J.; Habarugira, G.; Wu, J.; Li, M.; Wang, B.; Lu, G.; Zhou, B. The broad-spectrum rice blast resistance (R) gene Pita2 encodes a novel R protein unique from Pita. Rice. 2020, 13, 1–15. [Google Scholar] [CrossRef]
  20. Chen, D.H.; Zeigler, R.S.; Ahn, S.W.; Nelson, R.J. Phenotypic characterization of the rice blast resistance gene Pi-2(t). Plant Disease. 1996, 80, 52–56. [Google Scholar] [CrossRef]
  21. Amante-Bordeos, A.; Sitch, L.A.; Nelson, R.; Dalmacio, R.D.; Oliva, N.P.; Aswidinnoor, H.; Leung, H. Transfer of bacterial blight and blast resistance from the tetraploid wild rice Oryza minuta to cultivated rice Oryza sativa. Theor. Appl. Genet. 1992, 84, 345–354. [Google Scholar] [CrossRef]
  22. Jia, Y.; Wang, Z.; Singh, P. Development of Dominant Rice Blast Pi-ta Resistance Gene Markers. Crop Sci. 2002, 42, 2145–2149. [Google Scholar] [CrossRef]
  23. Mukhina, Zh.M. The use of DNA markers to study the genetic diversity of plant resources, Krasnodar: Prosveshenie-South, 2008, 98 p.
  24. Xu, X.; Chen, H.; Fujimura, T.; Kawasaki, S. Fine mapping of a strong QTL of field resistance against rice blast, Pikahei-1(t), from upland rice Kahei, utilizing a novel resistance evaluation system in the greenhouse. Theoretical and applied genetics. 2008, 117, 997–1008. [Google Scholar] [CrossRef]
  25. Ashkani, S.; Rafii, M.Y.; Rahim, H.A.; Latif, M.A. Genetic dissection of rice blast resistance by QTL mapping approach using an F3 population. Molecular Biology Reports. 2013, 40, 2503–2515. [Google Scholar] [CrossRef] [PubMed]
  26. Ballini, E.; Morel, J.B.; Droc, G.; Price, A.; Courtois, B.; Notteghem, J.L.; Tharreau, D. A genome-wide meta-analysis of rice blast resistance genes and quantitative trait loci provides new insights into partial and complete resistance. Molecular plant-microbe interactions: MPMI 2008, 21, 859–868. [Google Scholar] [CrossRef] [PubMed]
  27. Padmavathi, G.; Ram, T.; Satyanarayana, K.; Mishra, B. Identification of blast (Magnaporthe grisea) resistance genes in rice. Current Science. 2005, 88, 28–630. [Google Scholar]
  28. Sharma, R.C.; Shrestha, S.M.; Pandey, M.P. Inheritance of blast resistance and associated microsatellite markers in rice cultivar ‘Laxmi’. Journal of Phytopathology. 2007, 155, 749–753. [Google Scholar] [CrossRef]
  29. Mohanty, C.R.; Gangopadhyay, S. Testing of blast resistance in F2 rice seedlings in different doses of nitrogen and seasons. Annals of the Phytopathological Society of Japan. 1982, 48(5), 648–658. [Google Scholar] [CrossRef]
  30. Flores-Gaxiola, J.A.; Nuque, F.L.; Crill, J.P.; Khush, G.S. Inheritance of blast Pyricularia oryzae resistance in rice. International Rice Research Newsletter 1983, 8, 5–6. [Google Scholar]
  31. Mackill, D.J.; Bonman, J.M.; Suh, H.S.; Srilingam, R. Genes for resistance to Philippine isolates of the rice blast pathogen. Rice Genetics Newsletter. 1985, 2, 80–81. [Google Scholar]
  32. Bonman, J.M.; Khush, G.S.; Nelson, R.J. Breeding rice for resistance to pests. Annual Review of Phytopathology. 1992, 30, 507–528. [Google Scholar] [CrossRef]
  33. Lang, N.T.; Luy, T.T.; Ha, P.T.T.; Buu, B.C. Monogenic lines resistance to blast disease in rice (Oryza sativa L.) in Vietnam. Int J Genet Mol Biol 2009, 1, 127–136. [Google Scholar]
  34. Hasan, N.; Choudhary, S.; Naaz, N.; Sharma, N.; Laskar, R.A. Recent advancements in molecular marker assisted selection and applications in plant breeding programmes. Journal of Genetic Engineering and Biotechnology. 2021, 19, 128. [Google Scholar] [CrossRef] [PubMed]
  35. Zelensky, G.L. Rice: biological foundations of breeding and agricultural technology. Monography. Krasnodar. KubSAU 2016, 177. [Google Scholar]
  36. Los, G.D. Rice hybridization technique. Rice growing [Los' G. D. Metodika gibridizacii risa. G. D. Los'. Risovodstvo. 2007, 10, 42–51. [Google Scholar]
  37. Williams, C.E.; Ronald, P.C. PCR template-DNA isolated quickly from monocot and dicot leaves without tissue homogenization. Nucleic Acids Research. 1994, 22, 1917–1918. [Google Scholar] [CrossRef] [PubMed]
  38. Li, Y.; Lu, Y.G.; Shi, Y.; Wu, L.; Xu, Y.J.; Huang, F.; Guo, X.Y.; Zhang, Y.; Fan, J.; Zhao, J.Q.; Zhang, H.Y.; Xu, P.Z.; Zhou, J.M. , Wu, X.J., Wang, P.R.; Wang, W.M. Multiple rice microRNAs are involved in immunity against the blast fungus Magnaporthe oryzae. PlantPhysiol. 2013, 164, 1077–92. [Google Scholar] [CrossRef]
  39. 39. Guidelines for the Conduct of Test for Distinctiveness, Uniformity and Stability On (Oryza sativa L.). Plant Variety Journal of India 2007, 1, 25.
  40. Li, W.; Lei, C.L.; Cheng, Z.J.; Jia, Y.L.; Huang, D.Y.; Wang, J.L.; Wang, J.K.; Zhang, X.; Su, N.; Guo, X.P.; Zhai, H.Q.; Wan, J.M. Identification of SSR markers for a broad-spectrum blast resistance gene Pi20(t) for marker-assisted breeding. Mol.Breed. 2008, 22, 141149. [Google Scholar] [CrossRef]
  41. Peng, P.; Jiang, H.; Luo, L.; Ye, C.; Xiao, Y. Pyramiding of Multiple Genes to Improve Rice Blast Resistance of Photo-Thermo Sensitive Male Sterile Line, without Yield Penalty in Hybrid Rice Production. Plants. 2023, 12, 1389. [Google Scholar] [CrossRef]
  42. Ospanova, A.; Mynbayeva, D.; Turganova, Ch.; Usenbekov, B.; Amirova, A.; Berkimbay, Kh.; Zhunusbayeva, Zh.; Utepbergenov, E. Molecular screening for the presence of Magnaporthe oryzae resistance Pi-b gene in rice hybrids. International Scientific Forum “Modern Trends in Sustainable Development of Biological Sciences”. BIO Web of Conferences 2024, 100, 03012. [Google Scholar] [CrossRef]
  43. Amirova, A.; Usenbekov, B.; Berkimbay, Kh.; Mynbayeva, D.; Atabayeva, S.; Baiseitova, G.; Meldebekova, A.; Zhunusbayeva, Zh.; Kenzhebayeva, S.; Mukhambetzhanov, S. Selection of rice breeding lines for resistance to biotic and abiotic stresses. Brazilian Journal of Biology. 2024, 84, e282495. [Google Scholar] [CrossRef]
Preprints 109320 g001
Figure 1. Electropherogram of PCR products of samples for the presence of Pi-1 and Pi-2 genes. (A): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – 04636, 6 – 03-27, 7 – 04468, 8 – 04470, 9 – 04469, 10 – 25-14, 11 – 04888, 12 – 212-05, 13 – 7653, 14 – 7662, 15 – 7663, 16 – 7664, 17 – 7666, 18 – 7667, 19 – 7668. (Б): M – Molecular marker 100bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – 7679, 6 – 7683, 7 – 7684, 8 – 7689, 9 – 7690, 10 – 7695, 11 – 7701, 12 – 7702, 13 – 7712, 14 – 7824, 15 – Don 7712, 16 – Bakanasski, 17 – Fatima, 18 – Aisaule, 19 – Aru.
Figure 1. Electropherogram of PCR products of samples for the presence of Pi-1 and Pi-2 genes. (A): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – 04636, 6 – 03-27, 7 – 04468, 8 – 04470, 9 – 04469, 10 – 25-14, 11 – 04888, 12 – 212-05, 13 – 7653, 14 – 7662, 15 – 7663, 16 – 7664, 17 – 7666, 18 – 7667, 19 – 7668. (Б): M – Molecular marker 100bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – 7679, 6 – 7683, 7 – 7684, 8 – 7689, 9 – 7690, 10 – 7695, 11 – 7701, 12 – 7702, 13 – 7712, 14 – 7824, 15 – Don 7712, 16 – Bakanasski, 17 – Fatima, 18 – Aisaule, 19 – Aru.
Preprints 109320 g001
Preprints 109320 g002
Figure 2. Electropherogram of PCR products of samples for the presence of Pi-33 and Pi-ta genes. (A): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-33); 2 – Flagman (-); 3 – IR36 (+Pi-ta); 4 – Flagman (-); 5 – 04636; 6 – 19-14; 7 – 57-14; 8 – 03-27; 9 – 04468; 10 – 04470; 11 – 04469; 12 – 25-14; 13 – 04888; 14 – 212-05; 15 – 7653; 16 – 7662; 17 – 7663; 18 – 7664; 19 – 7666. (B): M – Molecular marker, 1 – C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR 36 (+Pi-ta), 4 – Flagman (-), 5 – 7667, 6 – 7668, 7 – 7679, 8 – 7683, 9 – 7684, 10 – 7686, 11 – 7689, 12 – 7690, 13 – 7695, 14 – 7698, 15 – 7701, 16 – 7702, 17 – 7712, 18 – 7824. (C): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Don 7712, 6 – Bakanasski, 7 – Fatima, 8 - Aisaule, 9 – Aru.
Figure 2. Electropherogram of PCR products of samples for the presence of Pi-33 and Pi-ta genes. (A): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-33); 2 – Flagman (-); 3 – IR36 (+Pi-ta); 4 – Flagman (-); 5 – 04636; 6 – 19-14; 7 – 57-14; 8 – 03-27; 9 – 04468; 10 – 04470; 11 – 04469; 12 – 25-14; 13 – 04888; 14 – 212-05; 15 – 7653; 16 – 7662; 17 – 7663; 18 – 7664; 19 – 7666. (B): M – Molecular marker, 1 – C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR 36 (+Pi-ta), 4 – Flagman (-), 5 – 7667, 6 – 7668, 7 – 7679, 8 – 7683, 9 – 7684, 10 – 7686, 11 – 7689, 12 – 7690, 13 – 7695, 14 – 7698, 15 – 7701, 16 – 7702, 17 – 7712, 18 – 7824. (C): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Don 7712, 6 – Bakanasski, 7 – Fatima, 8 - Aisaule, 9 – Aru.
Preprints 109320 g002
Preprints 109320 g003aPreprints 109320 g003b
Figure 3. Electropherogram of PCR products of hybrids for the presence of Pi-1 and Pi-2 genes. (A): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – Bakanasski/7668 (var. subuzbekistanica Kond.), 6 – Bakanasski/04470 (var. vulgaris Koern.), 7 –Bakanasski/7653 (var. subuzbekistanica Kond.), 8 – Bakanasski/7653 (var. subjanthoseros Brsch.), 9 – Bakanasski/7684 (var. subvulgaris Brsch.), 10 – Bakanasski/7684 (var. vulgaris Koern.), 11 – 7824/Aisaule (var. italica Alef.), 12 – 7824/Aisaule (var. subuzbekistanica Kond.), 13 – Aru/04468 (var. subvulgaris Brsch.), 14 – 7698/Bakanasski (var. subvulgaris Brsch.), 15 – 7698/Bakanasski (var. italica Alef.), 16 – Aru/7701 (var. vulgaris Koern.), 17 – Bakanasski/0327 (var. vulgaris Koern.), 18 – Aisaule/7679 (var. subvulgaris Brsch.), 19 –7698/Aisaule (var. italica Alef.). (B): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – 7698/Aisaule (var. suberythroseros Kan.), 6 – Aru/7702 (var. erythroceros Koern.), 7 – Aisaule/7689 (var. zeravschanica Brsch.), 8 – Aru/0327 (var. vulgaris Koern.), 9 – Aru/0327 (var. subpyrocarpa Alef.), 10 – Bakanasski/7667 (var. subjanthoseros Brsch.), 11 – Bakanasski/7667 (var. vulgaris Koern.), 12 – Bakanasski/7701 (var. vulgaris Koern.), 13 – Aisaule/7664 (var. italica Alef.), 14 – Aisaule/7664 (var. subvulgaris Brsch.), 15 – Aisaule/04470 (var. subvulgaris Brsch.), 16 – Aisaule/04470 (var. italica Alef.), 17 – Aisaule/Don 7712 (var. sundensis Koern.), 18 – Aisaule/Don 7712 (var. italica Alef.), 19 – Fatima/7695 (var. italica Alef.). (C): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51 (+Pi-2), 4 – Flagman (-), 5 – Fatima/7695 (var. breviaristata Vav.), 6 – Bakanasski/7683 (var. subjanthoseros Brsch.), 7 – 7698/Aru (var. erythroceros Koern.), 8 – 7698/Aru (var. suberythroseros Kan.), 9 – Bakanasski/Don 7712, 10 – Bakanasski/Don 7712 (var. Desvauxii Koern.), 11 – Aru/212-05 (var. vulgaris Koern.), 12 – Aru/7668 (var. vulgaris Koern.), 13 – Aisaule/04468 (var. italica Alef.), 14 – Aru/04636 (var. vulgaris Koern.), 15 – Bakanasski/7690 (var. subjanthoseros Brsch.), 16 – Bakanasski/7690 (var. vulgaris Koern.), 17 – Bakanasski/04468 (var. subvulgaris Brsch.), 18 – Bakanasski/04468 (var. vulgaris Koern.).
Figure 3. Electropherogram of PCR products of hybrids for the presence of Pi-1 and Pi-2 genes. (A): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – Bakanasski/7668 (var. subuzbekistanica Kond.), 6 – Bakanasski/04470 (var. vulgaris Koern.), 7 –Bakanasski/7653 (var. subuzbekistanica Kond.), 8 – Bakanasski/7653 (var. subjanthoseros Brsch.), 9 – Bakanasski/7684 (var. subvulgaris Brsch.), 10 – Bakanasski/7684 (var. vulgaris Koern.), 11 – 7824/Aisaule (var. italica Alef.), 12 – 7824/Aisaule (var. subuzbekistanica Kond.), 13 – Aru/04468 (var. subvulgaris Brsch.), 14 – 7698/Bakanasski (var. subvulgaris Brsch.), 15 – 7698/Bakanasski (var. italica Alef.), 16 – Aru/7701 (var. vulgaris Koern.), 17 – Bakanasski/0327 (var. vulgaris Koern.), 18 – Aisaule/7679 (var. subvulgaris Brsch.), 19 –7698/Aisaule (var. italica Alef.). (B): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51(+Pi-2), 4 – Flagman (-), 5 – 7698/Aisaule (var. suberythroseros Kan.), 6 – Aru/7702 (var. erythroceros Koern.), 7 – Aisaule/7689 (var. zeravschanica Brsch.), 8 – Aru/0327 (var. vulgaris Koern.), 9 – Aru/0327 (var. subpyrocarpa Alef.), 10 – Bakanasski/7667 (var. subjanthoseros Brsch.), 11 – Bakanasski/7667 (var. vulgaris Koern.), 12 – Bakanasski/7701 (var. vulgaris Koern.), 13 – Aisaule/7664 (var. italica Alef.), 14 – Aisaule/7664 (var. subvulgaris Brsch.), 15 – Aisaule/04470 (var. subvulgaris Brsch.), 16 – Aisaule/04470 (var. italica Alef.), 17 – Aisaule/Don 7712 (var. sundensis Koern.), 18 – Aisaule/Don 7712 (var. italica Alef.), 19 – Fatima/7695 (var. italica Alef.). (C): M – Molecular marker 100 bp, 1 – C101-Lac (+Pi-1), 2 – Flagman (-), 3 – C101-A51 (+Pi-2), 4 – Flagman (-), 5 – Fatima/7695 (var. breviaristata Vav.), 6 – Bakanasski/7683 (var. subjanthoseros Brsch.), 7 – 7698/Aru (var. erythroceros Koern.), 8 – 7698/Aru (var. suberythroseros Kan.), 9 – Bakanasski/Don 7712, 10 – Bakanasski/Don 7712 (var. Desvauxii Koern.), 11 – Aru/212-05 (var. vulgaris Koern.), 12 – Aru/7668 (var. vulgaris Koern.), 13 – Aisaule/04468 (var. italica Alef.), 14 – Aru/04636 (var. vulgaris Koern.), 15 – Bakanasski/7690 (var. subjanthoseros Brsch.), 16 – Bakanasski/7690 (var. vulgaris Koern.), 17 – Bakanasski/04468 (var. subvulgaris Brsch.), 18 – Bakanasski/04468 (var. vulgaris Koern.).
Preprints 109320 g003aPreprints 109320 g003b
Preprints 109320 g004
Figure 4. Electropherogram of PCR products of hybrid samples for the presence of Pi-33 and Pi-ta genes. (А): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Bakanasski/7668 (var. subuzbekistanica Kond.), 6 – Bakanasski/04470 (var. vulgaris Koern.), 7 – Bakanasski/7653 (var. subuzbekistanica Kond.), 8 – Bakanasski/7653 (var. subjanthoseros Brsch.), 9 – Bakanasski/7684 (var. subvulgaris Brsch.), 10 – Bakanasski/7684 (var. vulgaris Koern.), 11 – 7824/Aisaule (var. italica Alef.), 12 – 7824/Aisaule (var. subuzbekistanica Kond.), 13 – 7698/Bakanasski (var. subvulgaris Brsch.), 14 – 7698/Bakanasski (var. italica Alef.), 15 – Aru/7701 (var. vulgaris Koern.), 16 – Bakanasski/0327 (var. vulgaris Koern.), 17 – Aisaule/7679 (var. subvulgaris Brsch.), 18 – 7698/Aisaule (var. italica Alef.). (В): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – 7698/Aisaule (var. suberythroseros Kan.), 6 – Aru/7702 (var. erythroceros Koern.), 7 – Aisaule/7689 (var. zeravschanica Brsch.), 8 – Aru/0327 (var. vulgaris Koern.), 9 – Bakanasski/7667 (var. vulgaris Koern.), 10 – Bakanasski/7701 (var. vulgaris Koern.), 11 – Aisaule/7664 (var. italica Alef.), 12 – Aisaule/7664 (var. subvulgaris Brsch.), 13 – Aisaule/04470 (var. subvulgaris Brsch.), 14 – Aisaule/04470 (var. italica Alef.), 15 – Aisaule/Don 7712 (var. sundensis Koern.), 16 – Aisaule/Don 7712 (var. italica Alef.), 17 – Fatima/7695 (var. breviaristata Vav.), 18 – Bakanasski/7683 (var. subjanthoseros Brsch.). (С): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Aru/212-05 (var. vulgaris Koern.), 6 – Aru/7668 (var. vulgaris Koern.), 7 – Aisaule/04468 (var. italica Alef.), 8 – Aru/04636 (var. vulgaris Koern.), 9 – Bakanasski/7690 (var. subjanthoseros Brsch.), 10 – Bakanasski/7690 (var. vulgaris Koern.), 11 – Bakanasski/04468 (var. subvulgaris Brsch.), 12 – Bakanasski/04468 (var. vulgaris Koern.), 13 – Aru/7666 (var. suberythroseros Kan.), 14 – Fatima/7653 (var. persica Kan.), 15 – Aru/Don 7712 (var. Desvauxii Koern.) semi-awned, 16 – Aru/7683 (var. janthoceros Koern.), 17 – Aru/7683 (var. vulgaris Koern.), 18 – Aisaule/7663 (var. italica Alef.), 19 – Aru/0327 (var. subpyrocarpa Alef.). (D): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Bakanasski/Don 7712, 6 – Fatima/7689 (var. italica Alef.), 7 – Aru/04468 (var. subvulgaris Brsch.), 8 –Bakanasski/7667 (var. subjanthoseros Brsch.), 9 – Bakanasski/Don 7712 (var. Desvauxii Koern.), 10 – Aru/Don 7712 (var. vulgaris Koern.), 11 – 7698/Aru (var. erythroceros Koern.), 12 – 7698/Aru (var. suberythroseros Kan.), 13 – Aru/Don 7712 (var. erythroceros Koern.), 14 – Aru/Don 7712 (var. Desvauxii Koern.).
Figure 4. Electropherogram of PCR products of hybrid samples for the presence of Pi-33 and Pi-ta genes. (А): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Bakanasski/7668 (var. subuzbekistanica Kond.), 6 – Bakanasski/04470 (var. vulgaris Koern.), 7 – Bakanasski/7653 (var. subuzbekistanica Kond.), 8 – Bakanasski/7653 (var. subjanthoseros Brsch.), 9 – Bakanasski/7684 (var. subvulgaris Brsch.), 10 – Bakanasski/7684 (var. vulgaris Koern.), 11 – 7824/Aisaule (var. italica Alef.), 12 – 7824/Aisaule (var. subuzbekistanica Kond.), 13 – 7698/Bakanasski (var. subvulgaris Brsch.), 14 – 7698/Bakanasski (var. italica Alef.), 15 – Aru/7701 (var. vulgaris Koern.), 16 – Bakanasski/0327 (var. vulgaris Koern.), 17 – Aisaule/7679 (var. subvulgaris Brsch.), 18 – 7698/Aisaule (var. italica Alef.). (В): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – 7698/Aisaule (var. suberythroseros Kan.), 6 – Aru/7702 (var. erythroceros Koern.), 7 – Aisaule/7689 (var. zeravschanica Brsch.), 8 – Aru/0327 (var. vulgaris Koern.), 9 – Bakanasski/7667 (var. vulgaris Koern.), 10 – Bakanasski/7701 (var. vulgaris Koern.), 11 – Aisaule/7664 (var. italica Alef.), 12 – Aisaule/7664 (var. subvulgaris Brsch.), 13 – Aisaule/04470 (var. subvulgaris Brsch.), 14 – Aisaule/04470 (var. italica Alef.), 15 – Aisaule/Don 7712 (var. sundensis Koern.), 16 – Aisaule/Don 7712 (var. italica Alef.), 17 – Fatima/7695 (var. breviaristata Vav.), 18 – Bakanasski/7683 (var. subjanthoseros Brsch.). (С): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Aru/212-05 (var. vulgaris Koern.), 6 – Aru/7668 (var. vulgaris Koern.), 7 – Aisaule/04468 (var. italica Alef.), 8 – Aru/04636 (var. vulgaris Koern.), 9 – Bakanasski/7690 (var. subjanthoseros Brsch.), 10 – Bakanasski/7690 (var. vulgaris Koern.), 11 – Bakanasski/04468 (var. subvulgaris Brsch.), 12 – Bakanasski/04468 (var. vulgaris Koern.), 13 – Aru/7666 (var. suberythroseros Kan.), 14 – Fatima/7653 (var. persica Kan.), 15 – Aru/Don 7712 (var. Desvauxii Koern.) semi-awned, 16 – Aru/7683 (var. janthoceros Koern.), 17 – Aru/7683 (var. vulgaris Koern.), 18 – Aisaule/7663 (var. italica Alef.), 19 – Aru/0327 (var. subpyrocarpa Alef.). (D): M – Molecular marker 100 bp, 1 - C101-Lac (+Pi-33), 2 – Flagman (-), 3 – IR36 (+Pi-ta), 4 – Flagman (-), 5 – Bakanasski/Don 7712, 6 – Fatima/7689 (var. italica Alef.), 7 – Aru/04468 (var. subvulgaris Brsch.), 8 –Bakanasski/7667 (var. subjanthoseros Brsch.), 9 – Bakanasski/Don 7712 (var. Desvauxii Koern.), 10 – Aru/Don 7712 (var. vulgaris Koern.), 11 – 7698/Aru (var. erythroceros Koern.), 12 – 7698/Aru (var. suberythroseros Kan.), 13 – Aru/Don 7712 (var. erythroceros Koern.), 14 – Aru/Don 7712 (var. Desvauxii Koern.).
Preprints 109320 g004
Table 1. List of tested SSR primers for Pi genes of the blast resistance complex.
Table 1. List of tested SSR primers for Pi genes of the blast resistance complex.
Gene Localization on chromosome Name of a marker
 Forward primer (5′-3′)
Reverse sequence (5′-3′)
Pi-1 11 Rm 224 F - аtсgаtсgаtсttсасgаgg
R - tgctataaaaggcattcggg
Rm144 F - tgccctggcgcaaatttgatcc
R - gctagaggagatcagatggtagtgcatg
Pi-2 6 Rm 527 F - ggctcgatctagaaaatccg
R - ttgcacaggttgcgatagag
SSR 140 F - aaggtgtgaaacaagctagcaa
R - ttctaggggaggggtgtgaa
Pi-33 8 Rm 310 F - ссggсgаtаааасааtgаg
R - gсаtсggtссtаасtааggg
Rm 72 F - ссggсgаtаааасааtgаg
R - gсаtсggtссtаасtааggg
Pi-ta 12 Pita F1 - gссgtggсttсtаtсtttасatg
R1 - аtссааgtgttаgggссаасаttс
F2 - ttgасасtсtсаааggасtgggаt
R2 - tсааgtсаggttgааgаtgсаtсgа
Table 2. Analyses of the productivity of pyramided rice lines by One-way ANOVA.
Table 2. Analyses of the productivity of pyramided rice lines by One-way ANOVA.
SS df MS F P-value F crit
Between 367,1166333 6 61,18610556* 27,07338195 0,000000000000421.97 3,254124603
Within 97,18041667 43 2,26000969
df: Degrees of Freedom. MS = Mean Square. Significance at *p-value < 0.001.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
bsky
MDPI Initiatives
Important Links
Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2025 MDPI (Basel, Switzerland) unless otherwise stated