Preprint
Article

This version is not peer-reviewed.

In Vitro Utilization of Prebiotics by Listeria monocytogenes

Submitted:

14 August 2024

Posted:

16 August 2024

You are already at the latest version

Abstract
Listeria monocytogenes is an emerging pathogen responsible for the serious foodborne disease, listeriosis. The commensal gut microbiota is the first line of defense against pathogen internalization. The gut microbiome can be modified by prebiotic substrates, which are frequently added to food products and dietary supplements. Prebiotics should selectively support the growth of beneficial microbes and thus improve host health. Nevertheless, little is known about their effect on the growth of L. monocytogenes. The aim of this study was to evaluate the growth ability of four L. monocytogenes strains, representing the most common serotypes, on prebiotic oligosaccharides (beta-(1,3)-D-glucan, inulin, fructooligosaccharides, galactooligosaccharides, lactulose, raffinose, stachyose, and 2´-fucosyllactose and a mixture of human milk oligosaccharides) as a sole carbon source. The results showed that only beta-(1,3)-D-glucan was metabolized by L. monocytogenes. Therefore, the safety of beta-(1,3)-D-glucan with respect to listeriosis development should be further studied.
Keywords: 
;  ;  ;  ;  ;  

1. Introduction

Listeria monocytogenes is a ubiquitous Gram-positive, facultative anaerobic, non-spore-forming bacterium. This organism is an opportunistic intracellular pathogen responsible for the foodborne disease listeriosis. Despite the fact that the disease is relatively rare, it is characterized by severe symptoms and a high mortality rate (it accounts for 20-30 % of the deaths of infected individuals worldwide). In most cases, ingestion of highly contaminated food (approx. 109 cells) is associated with mild to severe febrile gastroenteritis. By contrast, in the case of high-risk individuals such as children, the elderly and immunocompromised people, the disease is characterized by sepsis, meningitidis and meningoencephalitides [1,2,3]. Pregnant women are also a highly endangered group because L. monocytogens crosses the fetoplacental barrier and causes infection in the fetus, resulting in fetal death, premature birth or complications to pregnancy [4]. The infectious dose for these groups is as low as 100 to 1000 cells [1,2,3]. In general, listeriosis is the fifth most reported zoonosis in the EU. Despite strict hygiene precaution and regular food control, around 2,000 people become infected in the EU annually. Around 50 % of cases result in hospitalization and 10 % percent of those infected die, which is a much higher rate compared to other foodborne and zoonotic diseases [5]. L. monocytogenes can be subclassified into 13 known serotypes, among which 1/2a, 1/2b, 1/2c and 4b are the most common serotypes in food and are associated with 95 % of all listeriosis outbreaks. However, serotype 4b alone accounts for 50 % of cases [1,6,7].
Listeriosis can be treated with various antibiotics such as benzylpenicillin, ampicillin, erythromycin, meropenem, moxifloxacin, linezolid and trimethoprim-sulfamethoxazole (EUCAST, 2023). Nevertheless, antibiotic treatment cannot be applied to all patients, especially to pregnant women. In general, the best form of protection is prevention. One of the most important prophylactic approaches is to avoid consumption of Listeria-contaminated food, e.g., raw meat, soft ripened cheeses and uncooked fish products [8]. However, due to the ubiquitous dispersal of L. monocytogenes, the risk of ingestion and disease outbreak cannot be fully excluded even in foods such as fresh vegetable or fruits [9,10].
Aside from the intestinal epithelial barrier, the primary defense against invasion of L. monocytogenes into the host's body is the commensal intestinal microbiota. These beneficial microbes limit pathogen growth and translocation by competing for nutrients and adhesion sites on the intestinal mucosa, as well as secreting selective antimicrobial molecules. Partly due to the ongoing spread of antibiotic-resistant pathogenic strains, there remains an opportunity to support the viability and metabolic activity of the commensal intestinal microbiota with novel dietary approaches. This effort can be supported by the administration of prebiotics, which can selectively nourish beneficial microbes [11,12,13].
As outlined above, prebiotics are defined as substrates that are selectively utilized by host microorganisms to confer a host health benefit. The most commonly used prebiotics in the food industry or the pharmaceutical sector are mainly non-digestive nonstarch polysaccharides and oligosaccharides [14]. The most popular prebiotics are inulin, beta-glucans, fructooligosaccharides (FOSs), galactooligosaccharides (GOSs), xylooligosaccharides (XOSs), isomaltooligosaccharides (IMOs), raffinose series oligosaccharides (RSOs) and lactulose. The best prebiotics for infants are human milk oligosaccharides (HMOs), which are found in breast milk [15,16]. Although prebiotics should only be metabolized by beneficial bacteria, it was found that even undesirable bacteria can grow on these substrates [17,18].
Aa s ubiquitous organisms, L. monocytogenes has the capacity to survive and growth in a diverse range of natural environments, such as soil or vegetation, as a saprophyte or in the cytosol of mammalian cells as an intracellular pathogen and is able to metabolized different substrates as sources of the main elements for its growth. Its nutrient requirements are strain-specific and may vary depending on the strain’s origin [19]. This organism requires amino acids (leucine, isoleucine, valine, histidine, arginine, glutamine and methionine) and organically bound sulfur for its growth, but it can also metabolize peptides or complex proteins [19,20]. In the absence of these substances in the environment, bacteria utilize hexose-phosphate or glycerol as alternative energy sources. In particular, bacteria apply this mechanism when acting as intracellular pathogens, when there is a lack of amino acids in the cytosol [19]. The growth is improved by various saccharides, especially glucose. L. monocytogenes can ferment various mono- and oligosaccharides, e.g., fructose, lactose, mannose, trehalose, cellobiose, L-rhamnose and maltose [21,22,23,24]. It is known that L. monocytogenes can also utilize some polysaccharides such as maltodextrin [22], and is endowed with functional chitinolytic system and with active lytic polysaccharide monooxygenase, which are the mechanisms associated with the ability to cleave chitin and cellulose [25,26].
To the best of our knowledge, there are no studies focused on the ability of L. monocytogenes to metabolize prebiotics. Therefore, the aim of this work was to investigate the growth properties of the most common serotypes of L. monocytogenes in media containing different prebiotics as the sole source of energy and to evaluate the safety of the prebiotic oligosaccharides used in foodstuffs and dietary supplements with respect to the possible support of L. monocytogenes growth.

2. Materials and Methods

2.1. Isolation, Identification and Characterization of Strains

Listeria strains were isolated from foodstuffs purchased on the market in the Czech Republic and from a swab taken from a work surface in a food processing plant according to ISO 11290-1:2017 standard. Subsequently, presumptive L. monocytogenes colonies were taken, aseptically transferred into brain–heart infusion broth (Oxoid, UK) and cultivated at 37 °C for 24 hours. Freshly grown isolates were checked for purity using a phase-contrast microscope (Nikon Eclipse E200LED MV RS, Japan) and identified using MALDI-TOF mass spectrometry (Bruker Daltonik GmbH, Germany) as described by Salmonová et al. [27] to the genus level. Listeria spp. were then identified through 16S rDNA sequencing. Briefly, genomic DNA was isolated from fresh overnight cultures using the PrepMan Ultra kit (Applied Biosystems, USA) according to the manufacturer's instructions. Amplification of the 16S rRNA gene was performed using fD1 [5' AGAGTTTGATCCTGGCTCAG 3'] and rP2 [5' ACGGCTACCTTGTTACGACTT 3'] primers [28] under the conditions described by Salmonová et al. [27]. The amplified PCR products were verified through electrophoresis on 1 % agarose gel, purified with E.Z.N.A.® Cycle Pure kit (Omega Bio-tek, USA) and sequenced using the Sanger method (GATC Biotech, Germany). Sequencing data were analyzed using the ClustalX package in BioEdit [29,30] and compared with sequences available in the GenBank nucleotide databases in NCBI [31] and EZ Biocloud [32]. The sequences were deposited in GenBank via the BankIt program at the NCBI website (https://www.ncbi.nlm.nih.gov/WebSub/?tool=genbank).
L. monocytogenes serotype was determined with the slide agglutination method using commercial antisera according to the manufacturer's instructions (Merck Group, Germany). Pathogenicity was explored in vitro by hemolysis testing and in silico by internalin B testing. First, the hemolytic activity was detected. Cultures were spread on Columbia blood agar (Oxoid, UK) supplemented with 5 % sheep blood (v/v) and incubated for 24 h at 37 °C. Next, the presence of the gene for internalin B, a surface protein responsible for adhesion and invasion to the host cells, was detected via the PCR method using primers lmo2821-F [5' TGTAACCCCGCTTACACAGTT 3'] and lmo2821-R [5' TTACGGCTGGATTGTCTGTG 3'] [33].
Four hemolytic and internalin B-positive strains of different origin and serotype were selected for substrate preference testing. Strain LM1 (serotype 4b, Access. No. OR725603) was isolated from salami, LM11 (serotype 1/2b, Access. No. OR725605) from a swab from a work surface in the food industry, LM56 (serotype 1/2a, Access. No. OR725613) from raw beef meat and LM79 (serotype 1/2c, Access. No. OR725613) from veggie minced meat.

2.2. Tested Prebiotics and Cultivation Media Composition

The growth characteristics were determined in vitro in a basal medium containing 5 g/L of tryptone (Oxoid, UK) and 9 g/L NaCl, which was prepared anaerobically using the Hungate technique [34]. For testing, the most commonly used prebiotics for human and livestock nutrition were selected in the form of food supplements: beta-(1,3)-D-glucan (purity of 100 % yeast beta-glucans, of which > 86.6 % beta-(1,3)-D-glucan, Brainway Inc., USA), inulin (purity > 90 %, Frutafit, Hages, SK), fructooligosaccharides (FOSs; purity of 95 %, Nutri-Extract, CZ), galactooligosaccharides (GOSs; purity of 95 %, Nutri-Extract, CZ) and 2´-fucosyllactose (purity > 94 %, RAW´s, CZ). Other frequently used prebiotics, such as lactulose (purity > 95 %, Sigma-Aldrich, CZ), and less common prebiotics, such as raffinose (purity > 99 %, Sigma-Aldrich, CZ) and stachyose (purity > 98 %, Sigma-Aldrich, CZ), were purchased in pure form. All supplements were used as received without further purification. Finally, the ability of Listeria strains to grow on a mixture of human milk oligosaccharides (HMOs) isolated from human milk according Rockova et al. [35] was studied. All tested prebiotics are fully soluble in water except beta-1,3-D-glucan, which is only partially water-soluble. Concentrated stock solutions of water-soluble substrates (20 g/L) were filter-sterilized using syringe PES filters with a 0.22 μm pore size membrane (Rotilabo®, Germany). Vials with 9 mL of basal medium were supplemented with a solution of each substrate to obtain a final concentration of 2 g/L. Due to the partial solubility of beta-(1,3)-D-glucan in water and its heat resistance [36,37], this prebiotic was added directly to the basal medium and sterilized by autoclaving at 121 °C for 15 min. An amount of residual or released glucose after autoclaving was verified spectrophotometrically using the Glucose Test (Supelco, Canada) and measured with Reflectoquant® RQflex 10 (Sigma-Aldrich, Germany). The resulting amount of glucose in the medium with beta-(1,3)-D-glucan after autoclaving was as low as 2 mg/L.
As a positive control, glucose at a concentration of 2 g/L was used as a sole carbohydrate source. Due to the incomplete purity and residual content of undefined monosaccharides in the tested substrates, a control with 0.1 g/L of glucose was also included (residual control). The medium without any carbohydrate source was tested as a negative control (basal medium). The control media were sterilized via autoclaving.

2.3. Testing of Bacterial Growth

Fresh overnight cultures grown under aerobic conditions at 37 °C in brain–heart infusion broth (Oxoid, UK) were checked for purity and washed twice with sterile saline. The media were inoculated with bacteria suspension to a final density of 3 x 106 CFU/mL and cultivated anaerobically at 37 °C for 24 h. All experiments were performed in triplicate. Bacterial growth was determined spectrophotometrically at 620 nm using a UV/VIS SPEKOL 1300 spectrometer (Analytik Jena GmbH, Germany), and calculated as a difference in optical density (OD) at the time of inoculation and after 24 hours of cultivation. Since the medium with beta-(1,3)-D-glucan showed high density (OD=0,4) in the beginning of the experiment, it was not possible to use the same method to evaluate the bacteria growth as for other substrates. Therefore, bacterial counts were evaluated with the agar plate count technique [38] using BHI agar after 24 h cultivation under aerobic conditions at 37 °C. The growth of L. monocytogenes strains for beta-(1,3)-D-glucan was analyzed by subtracting the initial log colony-forming unit (CFU) values per 1 mL from the final values.
The pH values of the cultivation media were measured using an HI98100 pH tester Checker® Plus (Hanna instruments, USA) at the time of inoculation and after 24 hours of cultivation.
Growth curves were constructed for strains showing growth and/or pH changes (statistically significant) on the tested carbohydrates. Optical density (CFU/mL for beta-(1,3)-D-glucan), as described above, was measured in one-hour intervals during bacterial growth.
The specific growth rates were calculated for individual samples according to Rada et al. (2008) [18] using the following formula:
μ = (ln x – ln x0)/(t – t0)
where x and x0 are optical densities or CFU/mL measured within the exponential growth phase at time t and t0, respectively.

2.4. Enzymatic Assay

To identify the enzymes that may be responsible for substrate degradation, the tested L. monocytogenes strains were screened for enzymatic activity using an API-ZYM kit (BioMerieux, France). Enzymes were determined according to the manufacturer’s instructions. Briefly, fresh overnight cultures grown under aerobic conditions at 37 °C in brain–heart infusion broth (Oxoid, UK) were checked for purity and used for testing. Bacterial suspensions were optimized to the required 5-6 McFarland density with API® suspension media and 65 μl of each inoculum was dispensed into the wells of API-ZYM strip microtubes and incubated for 4 hours at 37 °C. After incubation, a drop of ZYM A (Ref 70494) and ZYM B (Ref 70493) reagents was added. Color intensities were read according to the API-ZYM reading color scale, which ranges from 0 (negative reaction) to 5 (maximum positive reaction); approximately, scale 1 corresponds to 5 nmols, 2 to 10 nmols, 3 to 20 nmols, 4 to 30 nmols and 5 to 40 nmols or more of each API-ZYM substrate metabolized by the strains [39].

2.5. Statistical Analyses

The averages and standard deviations of the bacterial growth and growth rates were calculated. First, the normality of all data sets was tested (Kolmogorov–Smirnov and Lilliefors tests). All data were then analyzed via ANOVA comparison followed by the Tuckey post-hoc test in Statistica 12 software (StatSoft, USA). The criterion for significance was p < 0.05.

3. Results

3.1. Utilization of Water-Soluble Prebiotics

The results of Listeria strain growth on water-soluble prebiotics are summarized in Table 1. The growth of all tested strains in the positive control (2 g/L glucose) was significantly (P < 0.05) higher than on the tested carbohydrates. Slightly increased bacterial densities, which were significantly (P < 0.05) higher than in the negative control (no saccharides), were observed on inulin, FOSs and in the residual control (0.1 g/L glucose). Slightly increased density was also observed in GOSs. The GOSs values were similar to both negative and residual control. Other prebiotics were not utilized, and the optical density values of all strains were similar to the negative control. Strain-specific utilization was found for GOSs, stachyose and the mixture of HMOs. Listeria growth in the negative controls was also strain-specific.

3.2. Utilization of Beta-(1,3)-D-glucan (Partially Water-Soluble Prebiotic)

The growth of L. monocytogenes on beta-(1,3)-D-glucan is summarized in Table 2. The bacterial cell counts in media containing beta-(1,3)-D-glucan were in line with counts determined in the positive control. The growth in the negative control was significantly (P < 0.05) lower than on the above-mentioned purchased media.

3.3. Changes in pH Values in the Fermentation System

Bacterial growth was accompanied by a decrease in the pH of the culture medium (Table 3). The initial pH value was 6.9 in all batches. In the positive control and beta-(1,3)-D-glucan batches, the pH decreased to 5.7. The pH decreased to 6.3 in the inulin experiments and to pH 6.6 in the residual control, FOSs and GOSs. The values of pH did not change in media with saccharides, where bacterial growth was not detected.

3.4. Growth Curves and Rates

Growth curves were constructed and specific growth rates were calculated for the positive control, residual control, beta-(1,3)-D-glucan, inulin, FOSs and GOSs. The growth curves during the cultivation of L. monocytogenes on water-soluble prebiotics are shown in Figure 1. The specific growth rates are summarized in Table 4. Although the same specific growth rates of L. monocytogenes on prebiotics and controls were found, the maximal optical density value was significantly higher in the positive control than in the prebiotic case. The growth curves show that for bacteria cultured on a medium with the residual control, inulin, FOSs and GOSs the exponential phase lasted around 3 hours, and growth was terminated at OD values between 0.028 and 0.047. A longer exponential phase (8 hours) was observed during the cultivation in the positive control, where the growth terminated at OD 0.128. As in the case of bacterial growth ability, strain-specific growth rates were found for residual control, inulin, FOSs and GOSs in this case.
The growth curves of bacteria cultivated in media with the positive control and beta-(1,3)-D-glucan are presented in Figure 2, and the calculated specific growth rates are shown in Table 5. No statistically significant difference (P ≥ 0.05) was found for the specific growth rates obtained for these two media, although the shapes of the growth curves were different with a maximal count of 3.5 x 108 CFU/mL after 9 hours of cultivation in the positive control and 2.8 x 108 CFU/mL after 8 hours of cultivation in media with beta-(1,3)-D-glucan.

3.5. Enzymatic Assay

The enzymatic activities of all examined L. monocytogenes isolates are shown in Table 6. All isolates were positive for esterase, acid phosphatase, naphtol-AS-BI-phosphohydrolase and β-glucosidase. Negative responses were observed consistently for lipase, cystine aminopeptidase, alkaline, phosphatase, chymotrypsin, N-acetyl glucosaminidase, valine aminopeptidase, trypsin, alpha-galactosidase, beta-galactosidase, beta-glucuronidase, alpha-mannosidase and alpha-fucosidase. Variable responses were noted for esterase-lipase, leucine aminopeptidase and alpha-glucosidase.

4. Discussion

Prebiotic saccharides should selectively stimulate the growth of health-promoting (probiotic) bacteria, suppress the occurrence of pathogenic bacteria and confer benefit(s) upon host health [14,17]. However, it has been noted that some prebiotics can be utilized by undesirable bacteria as well [17,18]. Listeria monocytogenes, as a foodborne pathogen, can also occur in the digestive tract, where it can use various nutrients for its growth, including several specific saccharides [19,20]. The ability of bacteria to utilize different saccharides depends on the bacteria's genetic predisposition [19,40,41]. In general, it is known that L. monocytogenes has a large number of transporter genes devoted to saccharide transport through the phosphoenolpyruvate-dependent phosphotransferase systems, particularly beta-glucosides [42] To the best of our knowledge, there are no studies focused on the ability of L. monocytogenes to metabolize prebiotics. Therefore, the aim of this study was to evaluate the growth of the most common L. monocytogenes serotypes on several prebiotics supplements with a purity of 90-100 %, depending on the product, in order to better understand prebiotic–pathogenic potential–host relationships.
The results showed that lactulose, raffinose, stachyose, 2´-fucosyllactose and the mixture of HMOs were unable to promote L. monocytogenes growth, and even residual substrates present in the tested supplements did not affect the results. A slight increase in cell numbers was observed for supplements containing inulin, FOSs and GOSs. Inulin and FOSs are prebiotics composed of linear chains of fructose units, linked by β-(2,1) glycosidic bonds, and terminated by a non-reducing sucrose end. The difference between these two prebiotics is in the length of the chain: FOSs comprise 3 – 7 fructose units, whereas inulin is mainly built from 10 – 60 units [11,43]. L. monocytogenes is capable of utilizing fructose [24], but it seems that it is not able to cleave the β-(1,2) glycosidic bond that connects individual fructose units. Galactooligosaccharides are composed of two – eight galactose units linked together with β-(1,6) glycosidic bonds and one molecule of terminal glucose connected by a β-(1,3) or β-(1,4) glycosidic bond [44]. This prebiotic saccharide does not promote the growth of L. monocytogenes, because galactose is not among the substrates that provide a source of carbon for Listeria growth [23]. The bacterial growth and specific growth rate on these prebiotic supplements were comparable to the growth in the residual control. Therefore, we assume that the growth of L. monocytogenes strains was caused by the presence of residual monosaccharides in the prebiotic supplements, which constituted 5 % of FOSs and GOSs supplements and ≤ 10 % of inulin supplements. The higher growth on inulin than on FOSs and GOSs could be affected by the higher content of monosaccharides. Strain-specific growth of L. monocytogenes on certain substrates is known [19,41], which was also shown in our study. Although a statistically significant strain-specific growth was observed, no comparable growth of L. monocytogenes strains to that in the positive control was found.
Beta-(1,3)-D-glucan was the only prebiotic supplement on which a comparable growth of L. monocytogenes strains to that on the positive control was found. This polysaccharide is generally considered effective and is a widely applied prebiotic, used to protect the body against various pathogens, cancer and high LDL cholesterol level and for its antioxidant effects, which support the host's overall health [45]. Beta-(1,3)-D-glucan belongs to the group of beta-glucans composed only from monomers of glucose that are linked by β-(1,3) glycosidic bonds [46,47]. They are the main structural components of plants and fungi, and include, among others, the major biopolymer cellulose [41,42]. The beta-glucans used in this study were of S. cerevisiae origin, and, in addition to beta-(1,3)-glucans, also contain less than 15 % beta-(1,6)-glucans [45]. The results of the enzymatic tests showed that all strains were positive for the beta-glucosidase enzyme, which was also confirmed in a study by Corral and Buchanan [48]. Beta-glucosidases are a heterogeneous group of hydrolytic enzymes that cleave beta-glycosidic bonds in a wide spectrum of substrates [49]. Currently, two widely acknowledged classifications of beta-glucosidases can be used: one based on substrate specificity and the other on the structural features of beta-glucosidase. Beta-glucosidases with broad substrate specificity hydrolyze a wide range of substrates with different bonds, e.g., β(1→3), β(1→4) or β(1→6). Beta-glucosidases include, among others, beta-glucanases (glucan-beta-glucosidases), resulting in successive removal of glucose units from beta-glucans chains [50]. Unfortunately, the API-ZYM kit cannot identify specific beta-glucosidase enzymes, but according to the fermentation assay, it can be assumed that L. monocytogenes produce beta-glucanases and is be able to cleave both above-mentioned beta-glucans in the tested prebiotic food supplement. Also, it has previously been demonstrated that L. monocytogenes is able to utilize cellulose [25,26], which is structurally similar to beta-(1,3)-D-glucan, but the glucose units in the cellulose chain are linked by β-(1,4) glycosidic bonds [51]. This ability is due to the multi-enzymatic complex, called the cellulosome, that is coded by gen CelD [42]. The complex comprises saccharide-active enzymes, which cleave cellulose and other similar polysaccharides and, among others, include beta-1,3-glucanase, which cleaves the above-mentioned beta-1,3-D-glucans [52,53]. Considering the enzymes detected in this study and based on the available literature, it can be assumed that the beta-glucan chains are completely degraded to free glucose units followed with classic glucose metabolism, leading to the formation of lactate, acetate, formate, ethanol and carbon dioxide in anaerobic conditions [54]. The pH values in the fermentation assay for beta-(1,3)-D-glucan and glucose were similar (pH 5.67-5.73), which also indicate identical metabolites.
Compared to the growth of previously studied Lactobacillus, Bifidobacterium and commensal Clostridium strains in the presence of selected prebiotics, the growth of L. monocytogenes in this study was lower on both glucose and beta-glucan [18,55,56]. This is most likely affected by the medium composition. The media used for probiotics/commensals testing are composed of fastidious bacteria and contain complex nutritional mixtures, except for their energy source. L. monocytogenes can utilize some of these nutrients for its growth even without the presence of saccharides; therefore, a nutrient-poor medium is required for this organism [18,55,56].
Regarding the growth curve, some differences were observed between the course of L. monocytogenes growth on beta-(1,3)-D-glucan and the positive control. Slightly lower cell counts on beta-(1,3)-D-glucan could be easily explained by the fact that part of the energy that could have been used for reproduction was spent on substrate cleavage. It could also be result of gradual or incomplete cleavage. The decrease in the number of viable cells on beta-(1,3)-D-glucan was slower compared to the positive control, probably due to the gradual release of glucose from the beta-glucan chain.
There are various natural sources of beta-glucans, e.g., yeast, barley, bacteria, seaweed, fungi and dahlia tuber. They differ not only in origin but also in glycosidic bond position as well as in their other characteristic, such as solubility in water or alkalis. Along with β-(1,3)-, β-(1,4)- and β-(1,6)- glucans are also found in supplements [56,57,58]. The origin may be one of the factors that affect the ability of bacteria to metabolize beta-glucans as has been demonstrated e.g. for Bifidobacterium sp. [56]. The ability of L. monocytogenes to cleave prebiotics also depends on the amount of substrate in the environment, because beta-1,4-glucanase is dynamic in response to the type and concentration of available saccharides [59]. In general, the environmental conditions and the amount and composition of available nutrition in the environment can affect L. monocytogenes metabolism, i.e. substrate preferences [19,21].
There are other types of prebiotics, such as mannooligosaccharides (MOS), xylooligosaccharides (XOS), isomaltooligosaccharides (IMO) and pectic oligosaccharides (POS), which were not included in the experiment but may be the subject of further investigation [60,61,62]. Considering that some L. monocytogenes strains produce alpha-glucosidase [48], it can be assumed that L. monocytogenes could cleave other prebiotics that are glucose oligomers with alpha-D-(1,6)-linkages such as isomaltooligosaccharides. Conversely, since Listeria spp. do not produce alpha-mannosidase [48], it can be assumed that L. monocytogenes will not be able to cleave mannooligosaccharides. The enzymatic assay shows that L. monocytogenes isolates also produce other enzymes, but these are not suitable for saccharide cleavage.
Regardless of whether the L. monocytogenes is able to utilize these prebiotics or not, effects against pathogens, such as supporting the individual's immunity, the growth of beneficial microbes and a reduced adherence ability of pathogens in general, have been reported for these substances [63,64,65,66]. Cumulative evidence obtained from animal models and human intervention studies strongly suggest immunostimulatory effects of beta-glucans as well as effective inhibition of pathogen proliferation, reduction of adhesion to the digestive tract wall and suppression of L. monocytogenes infection [67,68,69]. In addition, beta-glucans are metabolized by commensal and probiotic intestinal bacteria which leads to competition for substrate. Short-chain fatty acids (SCFAs), which are formed through microbial metabolite cross-feeding, suppress L. monocytogenes growth and support the body's disease defense. Health-promoting bacteria also produce other substances that act against L. monocytogenes, such as bacteriocins [70,71,72,73,74,75,76,77]. All these mechanisms in the gastrointestinal tract generally inhibit L. monocytogenes activity. The fact that L. monocytogenes is able to utilize beta-(1,3)-D-glucan is therefore not alarming. Finally, the question arises of how else prebiotics can affect the metabolism and behavior of this pathogen, because different saccharides have been found to affect the pathogenic potential [78,79,80,81]; biofilm formation potential [79]; and resistance to antimicrobial substances [21], heat or acids [79]. To the best of our knowledge, there are no studies focusing on these topics for the prebiotics used in our study.
In conclusion, the definition of prebiotics should be discussed. The first definition of prebiotics was introduced by Glenn Gibson and Marcel Roberfroid in 1995 “Prebiotic are a non-digestible food ingredient that beneficially affects the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the colon, and thus improves host health” [82]. In time, the definition of prebiotics was revised. As was mentioned in the introduction, current definition of prebiotics from 2016 is: “Prebiotics are substrates that are selectively utilized by host microorganisms to confer a health benefit”[14]. This topic, especially the word “selectively” is widely debated, and the goal is to define prebiotics as best as possible [60,83,84]. Our study provides other prove that the definition of prebiotic is not accurate at the present form. Despite the absence of a consensus definition, the important is that prebiotics contribute to the host well-being.

5. Conclusions

Our study attempted to evaluate the L. monocytogenes ability to grow on different prebiotics. The results showed that inulin, fructooligosaccharides, galactooligosaccharides, lactulose, raffinose, stachyose, 2´-fucosyllactose and a mixture of human milk oligosaccharides are not used by L. monocytogenes as a nutrient or energy source. Therefore, these prebiotics can be considered health-safe with respect to the possible support of L. monocytogenes growth. Beta-(1,3)-D-glucan was the only prebiotic utilized by L. monocytogenes. Even though the results showed that beta-(1,3)-D-glucan supports the growth of L. monocytogenes, available studies highlight its suppressive effects on listeriosis. Therefore, the exact role of beta-(1,3)-D-glucan with respect to listeriosis development should be further studied.

Author Contributions

Conceptualization, Kodešová, T. and Šubrtová Salmonová, H..; methodology, Kodešová, T., Šubrtová Salmonová, H. and Musilová Š.; validation, Kodešová, T.; formal analysis, Kodešová, T.; investigation, Kodešová, T., Mašlejová, A. and Horváthová, K.; resources, Vlková, E.; writing— original draft, Kodešová, T.; writing— review and editing, Šubrtová Salmonová, H. and Vlková, E.; visualization, Kodešová, T.; supervision, Šubrtová Salmonová. H.; funding acquisition, Vlková, E. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the NutRisk Centre, Ministry of Education, Youth and Sports of the Czech Republic [CZ.02.1.01/0.0/0.0/16_019/0000845, 2019-2023], and METROFOOD-CZ research infrastructure project [MEYS Grant No: LM2023064] including access to its facilities.

Data Availability Statement

The original contributions presented in this study are included in the article/supplementary material; further inquiries can be directed to the corresponding author/s.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Bhunia, A.K. Foodborne Microbial Pathogens, Mechanisms and Pathogenesis; 2018; ISBN 978-1-4939-7347-7.
  2. Farber, J.M.; Peterkin, P.I. Listeria Monocytogenes, a Food-Borne Pathogen. Microbiol Rev 1991, 55, 476–511, doi:10.1128/MR.55.3.476-511.1991. [CrossRef]
  3. Shamloo, E.; Hosseini, H.; Moghadam, A.Z.; Larsen, H.M.; Haslberger, A.; Alebouyeh, M. Importance of Listeria Monocytogenes in Food Safety: A Review of Its Prevalence, Detection, and Antibiotic Resistance. Iran J Vet Res 2019, 20, 241.
  4. Azari, S.; Johnson, L.J.; Webb, A.; Kozlowski, S.M.; Zhang, X.; Rood, K.; Amer, A.; Seveau, S. Hofbauer Cells Spread Listeria Monocytogenes among Placental Cells and Undergo Pro-Inflammatory Reprogramming While Retaining Production of Tolerogenic Factors. mBio 2021, 12, doi:10.1128/MBIO.01849-21/ASSET/AF596A8D-3D9F-4F02-BD95-CA0CC4DB8AFE/ASSETS/IMAGES/MEDIUM/MBIO.01849-21-T001.GIF. [CrossRef]
  5. European Food Safety Authority; European Centre for Disease Prevention and Control The European Union One Health 2020 Zoonoses Report. EFSA Journal 2021, 19, doi:10.2903/J.EFSA.2021.6971. [CrossRef]
  6. Das, S.; Surendran, P.K.; Thampuran, N. Detection and Differentiation of Listeria Monocytogenes and Listeria Innocua by Multiplex PCR. Fishery Technology 2010, 47, 91–94.
  7. Nadon, C.A.; Woodward, D.L.; Young, C.; Rodgers, F.G.; Wiedmann, M. Correlations between Molecular Subtyping and Serotyping of Listeria Monocytogenes. J Clin Microbiol 2001, 39, 2704, doi:10.1128/JCM.39.7.2704-2707.2001. [CrossRef]
  8. Bortolussi, R. Public Health: Listeriosis: A Primer. CMAJ : Canadian Medical Association Journal 2008, 179, 795, doi:10.1503/CMAJ.081377. [CrossRef]
  9. Miceli, A.; Settanni, L. Influence of Agronomic Practices and Pre-Harvest Conditions on the Attachment and Development of Listeria Monocytogenes in Vegetables. Annals of Microbiology 2019 69:3 2019, 69, 185–199, doi:10.1007/S13213-019-1435-6. [CrossRef]
  10. Simonetti, T.; Peter, K.; Chen, Y.; Jin, Q.; Zhang, G.; LaBorde, L.F.; Macarisin, D. Prevalence and Distribution of Listeria Monocytogenes in Three Commercial Tree Fruit Packinghouses. Front Microbiol 2021, 12, 652708, doi:10.3389/FMICB.2021.652708/BIBTEX. [CrossRef]
  11. Gibson, G.R.; Probert, H.M.; Loo, J. Van; Rastall, R.A.; Roberfroid, M.B. Dietary Modulation of the Human Colonic Microbiota: Updating the Concept of Prebiotics. Nutr Res Rev 2004, 17, 259–275, doi:10.1079/NRR200479. [CrossRef]
  12. Khan, R.; Petersen, F.C.; Shekhar, S. Commensal Bacteria: An Emerging Player in Defense Against Respiratory Pathogens. Front Immunol 2019, 10, 1203, doi:10.3389/FIMMU.2019.01203. [CrossRef]
  13. Roberfroid, M.; Gibson, G.R.; Hoyles, L.; McCartney, A.L.; Rastall, R.; Rowland, I.; Wolvers, D.; Watzl, B.; Szajewska, H.; Stahl, B.; et al. Prebiotic Effects: Metabolic and Health Benefits. Br J Nutr 2010, 104 Suppl 2, doi:10.1017/S0007114510003363. [CrossRef]
  14. Gibson, G.R.; Hutkins, R.; Sanders, M.E.; Prescott, S.L.; Reimer, R.A.; Salminen, S.J.; Scott, K.; Stanton, C.; Swanson, K.S.; Cani, P.D.; et al. Expert Consensus Document: The International Scientific Association for Probiotics and Prebiotics (ISAPP) Consensus Statement on the Definition and Scope of Prebiotics. Nat Rev Gastroenterol Hepatol 2017, 14, 491–502, doi:10.1038/NRGASTRO.2017.75. [CrossRef]
  15. Charalampopoulos, D.; Rastall, R.A. Prebiotics in Foods. Curr Opin Biotechnol 2012, 23, 187–191, doi:10.1016/J.COPBIO.2011.12.028. [CrossRef]
  16. Musilova, S.; Rada, V.; Vlkova, E.; Bunesova, V. Beneficial Effects of Human Milk Oligosaccharides on Gut Microbiota. Benef Microbes 2014, 5, 273–283, doi:10.3920/BM2013.0080. [CrossRef]
  17. Bunešová, V.; Vlková, E.; Rada, V.; Kňazovická, V.; Ročková, Š.; Geigerová, M.; Božik, M. Growth of Infant Fecal Bacteria on Commercial Prebiotics. Folia Microbiol (Praha) 2012, 57, 273–275, doi:10.1007/S12223-012-0123-8. [CrossRef]
  18. Rada, V.; Nevoral, J.; Trojanová, I.; Tománková, E.; Šmehilová, M.; Killer, J. Growth of Infant Faecal Bifidobacteria and Clostridia on Prebiotic Oligosaccharides in in Vitro Conditions. Anaerobe 2008, 14, 205–208, doi:10.1016/J.ANAEROBE.2008.05.003. [CrossRef]
  19. Sauer, J.-D.; Herskovits, A.A.; O’Riordan, M.X.D. Metabolism of the Gram-Positive Bacterial Pathogen Listeria Monocytogenes. Microbiol Spectr 2019, 7, doi:10.1128/MICROBIOLSPEC.GPP3-0066-2019. [CrossRef]
  20. Friedman, M.E.; Roessler, W.G. GROWTH OF LISTERIA MONOCYTOGENES IN DEFINED MEDIA. J Bacteriol 1961, 82, 528, doi:10.1128/JB.82.4.528-533.1961. [CrossRef]
  21. Balay, D.R.; Gänzle, M.G.; McMullen, L.M. The Effect of Carbohydrates and Bacteriocins on the Growth Kinetics and Resistance of Listeria Monocytogenes. Front Microbiol 2018, 9, 347, doi:10.3389/FMICB.2018.00347/BIBTEX. [CrossRef]
  22. Gopal, S.; Berg, D.; Hagen, N.; Schriefer, E.M.; Stoll, R.; Goebel, W.; Kreft, J. Maltose and Maltodextrin Utilization by Listeria Monocytogenes Depend on an Inducible ABC Transporter Which Is Repressed by Glucose. PLoS One 2010, 5, doi:10.1371/JOURNAL.PONE.0010349. [CrossRef]
  23. Pine, L.; Malcolm, G.B.; Brooks, J.B.; Daneshvar, M.I. Physiological Studies on the Growth and Utilization of Sugars by Listeria Species. Can J Microbiol 1989, 35, 245–254, doi:10.1139/M89-037. [CrossRef]
  24. Schardt, J.; Jones, G.; Müller-Herbst, S.; Schauer, K.; D’Orazio, S.E.F.; Fuchs, T.M. Comparison between Listeria Sensu Stricto and Listeria Sensu Lato Strains Identifies Novel Determinants Involved in Infection. Sci Rep 2017, 7, doi:10.1038/S41598-017-17570-0. [CrossRef]
  25. Bae, D.; Seo, K.S.; Zhang, T.; Wang, C. Characterization of a Potential Listeria Monocytogenes Virulence Factor Associated with Attachment to Fresh Produce. Appl Environ Microbiol 2013, 79, 6855, doi:10.1128/AEM.01006-13. [CrossRef]
  26. Paspaliari, D.K.; Loose, J.S.M.; Larsen, M.H.; Vaaje-Kolstad, G. Listeria Monocytogenes Has a Functional Chitinolytic System and an Active Lytic Polysaccharide Monooxygenase. FEBS J 2015, 282, 921–936, doi:10.1111/FEBS.13191. [CrossRef]
  27. Salmonová, H.; Killer, J.; Bunešová, V.; Geigerová, M.; Vlková, E. Cultivable Bacteria from Pectinatella Magnifica and the Surrounding Water in South Bohemia Indicate Potential New Gammaproteobacterial, Betaproteobacterial and Firmicutes Taxa. FEMS Microbiol Lett 2018, 365, doi:10.1093/FEMSLE/FNY118. [CrossRef]
  28. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S Ribosomal DNA Amplification for Phylogenetic Study. J Bacteriol 1991, 173, 697–703, doi:10.1128/JB.173.2.697-703.1991. [CrossRef]
  29. Hall, T.; Biosciences, I.; Carlsbad, C. BioEdit: An Important Software for Molecular Biology. GERF Bull Biosci 2011, 2, 60–61.
  30. Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X Windows Interface: Flexible Strategies for Multiple Sequence Alignment Aided by Quality Analysis Tools. Nucleic Acids Res 1997, 25, 4876–4882, doi:10.1093/NAR/25.24.4876. [CrossRef]
  31. McGinnis, S.; Madden, T.L. BLAST: At the Core of a Powerful and Diverse Set of Sequence Analysis Tools. Nucleic Acids Res 2004, 32, W20–W25, doi:10.1093/NAR/GKH435. [CrossRef]
  32. Yoon, S.H.; Ha, S.M.; Kwon, S.; Lim, J.; Kim, Y.; Seo, H.; Chun, J. Introducing EzBioCloud: A Taxonomically United Database of 16S RRNA Gene Sequences and Whole-Genome Assemblies. Int J Syst Evol Microbiol 2017, 67, 1613–1617, doi:10.1099/IJSEM.0.001755/CITE/REFWORKS. [CrossRef]
  33. Liu, D.; Ainsworth, A.J.; Austin, F.W.; Lawrence, M.L. Characterization of Virulent and Avirulent Listeria Monocytogenes Strains by PCR Amplification of Putative Transcriptional Regulator and Internalin Genes. J Med Microbiol 2003, 52, 1065–1070, doi:10.1099/JMM.0.05358-0. [CrossRef]
  34. Hungate, R.E. Chapter IV A Roll Tube Method for Cultivation of Strict Anaerobes. Methods in Microbiology 1969, 3, 117–132, doi:10.1016/S0580-9517(08)70503-8. [CrossRef]
  35. Rockova, S.; Nevoral, J.; Rada, V.; Marsik, P.; Sklenar, J.; Hinkova, A.; Vlkova, E.; Marounek, M. Factors Affecting the Growth of Bifidobacteria in Human Milk. Int Dairy J 2011, 21, 504–508, doi:10.1016/J.IDAIRYJ.2011.02.005. [CrossRef]
  36. Bai, Y.P.; Zhou, H.M.; Zhu, K.R.; Li, Q. Effect of Thermal Processing on the Molecular, Structural, and Antioxidant Characteristics of Highland Barley β-Glucan. Carbohydr Polym 2021, 271, doi:10.1016/J.CARBPOL.2021.118416. [CrossRef]
  37. Zhao, Y.; Zhou, H.M.; Huang, Z.H.; Zhao, R.Y. Different Aggregation States of Barley β-Glucan Molecules Affects Their Solution Behavior: A Comparative Analysis. Food Hydrocoll 2020, 101, doi:10.1016/J.FOODHYD.2019.105543. [CrossRef]
  38. Jones, G.S.; D’Orazio, S.E.F. Listeria Monocytogenes: Cultivation and Laboratory. Curr Protoc Microbiol 2013, 31, 9B.2.1, doi:10.1002/9780471729259.MC09B02S31. [CrossRef]
  39. Humble, M.W.; King, A.; Phillips, I. API ZYM: A Simple Rapid System for the Detection of Bacterial Enzymes. J Clin Pathol 1977, 30, 275, doi:10.1136/JCP.30.3.275. [CrossRef]
  40. Durica-Mitic*, S.; Göpel*, Y.; Görke, B. Carbohydrate Utilization in Bacteria: Making the Most Out of Sugars with the Help of Small Regulatory RNAs. Microbiol Spectr 2018, 6, doi:10.1128/MICROBIOLSPEC.RWR-0013-2017/ASSET/6C5BDC76-9F0F-46C8-8AC6-96325512130C/ASSETS/GRAPHIC/RWR-0013-2017-FIG5.GIF. [CrossRef]
  41. Gahan, C.G.M.; Hill, C. Listeria Monocytogenes: Survival and Adaptation in the Gastrointestinal Tract. Front Cell Infect Microbiol 2014, 5, 1–7, doi:10.3389/fcimb.2014.00009. [CrossRef]
  42. Liu, S.; Graham, J.E.; Bigelow, L.; Morse, P.D.; Wilkinson, B.J. Identification of Listeria Monocytogenes Genes Expressed in Response to Growth at Low Temperature. Appl Environ Microbiol 2002, 68, 1697–1705, doi:10.1128/AEM.68.4.1697-1705.2002/ASSET/C7E94927-C352-4AF0-91D5-0DE52FFB4AAA/ASSETS/GRAPHIC/AM0421319003.JPEG. [CrossRef]
  43. Lockyer, S.; Stanner, S. Prebiotics – an Added Benefit of Some Fibre Types. Nutr Bull 2019, 44, 74–91, doi:10.1111/NBU.12366. [CrossRef]
  44. Ibrahim, O.O. Functional Oligosaccharides: Chemicals Structure, Manufacturing, Health Benefits, Applications and Regulations. Journal of Food Chemistry and Nanotechnology 2018, 4, 65–76, doi:10.17756/JFCN.2018-060. [CrossRef]
  45. Kim, K.S.; Yun, H.S. Production of Soluble β-Glucan from the Cell Wall of Saccharomyces Cerevisiae. Enzyme Microb Technol 2006, 39, 496–500, doi:10.1016/J.ENZMICTEC.2005.12.020. [CrossRef]
  46. Mudgil, D. The Interaction Between Insoluble and Soluble Fiber. Dietary Fiber for the Prevention of Cardiovascular Disease: Fiber’s Interaction between Gut Micoflora, Sugar Metabolism, Weight Control and Cardiovascular Health 2017, 35–59, doi:10.1016/B978-0-12-805130-6.00003-3. [CrossRef]
  47. Stone, B.A. Chemistry of β-Glucans. Chemistry, Biochemistry, and Biology of 1-3 Beta Glucans and Related Polysaccharides 2009, 5–46, doi:10.1016/B978-0-12-373971-1.00002-9. [CrossRef]
  48. del Corral, F.; Buchanan, R.L. Evaluation of the API-ZYM System for Identification OfListeria. Food Microbiol 1990, 7, 99–106, doi:10.1016/0740-0020(90)90015-A. [CrossRef]
  49. Singhania, R.R.; Patel, A.K.; Sukumaran, R.K.; Larroche, C.; Pandey, A. Role and Significance of Beta-Glucosidases in the Hydrolysis of Cellulose for Bioethanol Production. Bioresour Technol 2013, 127, 500–507, doi:10.1016/J.BIORTECH.2012.09.012. [CrossRef]
  50. Ouyang, B.; Wang, G.; Zhang, N.; Zuo, J.; Huang, Y.; Zhao, X. Recent Advances in β-Glucosidase Sequence and Structure Engineering: A Brief Review. Molecules 2023, 28, doi:10.3390/MOLECULES28134990. [CrossRef]
  51. Synytsya, A.; Novak, M. Structural Analysis of Glucans. Ann Transl Med 2014, 2, 17, doi:10.3978/J.ISSN.2305-5839.2014.02.07. [CrossRef]
  52. Kumar, K.; Correia, M.A.S.; Pires, V.M.R.; Dhillon, A.; Sharma, K.; Rajulapati, V.; Fontes, C.M.G.A.; Carvalho, A.L.; Goyal, A. Novel Insights into the Degradation of β-1,3-Glucans by the Cellulosome of Clostridium Thermocellum Revealed by Structure and Function Studies of a Family 81 Glycoside Hydrolase. Int J Biol Macromol 2018, 117, 890–901, doi:10.1016/J.IJBIOMAC.2018.06.003. [CrossRef]
  53. Ramos, O.S.; Malcata, F.X. Food-Grade Enzymes. Comprehensive Biotechnology, Second Edition 2011, 3, 555–569, doi:10.1016/B978-0-08-088504-9.00213-0. [CrossRef]
  54. Romick, T.L.; Fleming, H.P.; Mcfeeters, R.F. Aerobic and Anaerobic Metabolism of Listeria Monocytogenes in Defined Glucose Medium. Appl Environ Microbiol 1996, 62, 304–307. [CrossRef]
  55. Kunová, G.; Rada, V.; Lisová, I.; Ročková, Š.; Vlková, E. In Vitro Fermentability of Prebiotic Oligosaccharides by Lactobacilli. Czech J. Food Sci 2011, 29, 49–54. [CrossRef]
  56. Zhao, J.; Cheung, P.C.K. Fermentation of β-Glucans Derived from Different Sources by Bifidobacteria: Evaluation of Their Bifidogenic Effect. J Agric Food Chem 2011, 59, 5986–5992, doi:10.1021/JF200621Y. [CrossRef]
  57. Jayachandran, M.; Chen, J.; Chung, S.S.M.; Xu, B. A Critical Review on the Impacts of β-Glucans on Gut Microbiota and Human Health. J Nutr Biochem 2018, 61, 101–110, doi:10.1016/J.JNUTBIO.2018.06.010. [CrossRef]
  58. Shokri, H.; Asadi, F.; Khosravi, A.R.; Shokriy, H.; Khosraviy, A.R. Isolation of β -Glucan from the Cell Wall of Saccharomyces Cerevisiae. http://dx.doi.org/10.1080/14786410701591622 2009, 22, 414–421, doi:10.1080/14786410701591622. [CrossRef]
  59. Kumar, A.; Naraian, R. Differential Expression of the Microbial β-1,4-Xylanase, and β-1,4-Endoglucanase Genes. New and Future Developments in Microbial Biotechnology and Bioengineering: Microbial Genes Biochemistry and Applications 2019, 95–111, doi:10.1016/B978-0-444-63503-7.00006-1. [CrossRef]
  60. Davani-Davari, D.; Negahdaripour, M.; Karimzadeh, I.; Seifan, M.; Mohkam, M.; Masoumi, S.J.; Berenjian, A.; Ghasemi, Y. Prebiotics: Definition, Types, Sources, Mechanisms, and Clinical Applications. Foods 2019, 8, doi:10.3390/FOODS8030092. [CrossRef]
  61. Kaur, A.P.; Bhardwaj, S.; Dhanjal, D.S.; Nepovimova, E.; Cruz-martins, N.; Kuča, K.; Chopra, C.; Singh, R.; Kumar, H.; Șen, F.; et al. Plant Prebiotics and Their Role in the Amelioration of Diseases. Biomolecules 2021, 11, 1–28, doi:10.3390/BIOM11030440. [CrossRef]
  62. Wang, S.; Xiao, Y.; Tian, F.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Rational Use of Prebiotics for Gut Microbiota Alterations: Specific Bacterial Phylotypes and Related Mechanisms. J Funct Foods 2020, 66, 103838, doi:10.1016/J.JFF.2020.103838. [CrossRef]
  63. Buddington, K.K.; Donahoo, J.B.; Buddington, R.K. Dietary Oligofructose and Inulin Protect Mice from Enteric and Systemic Pathogens and Tumor Inducers. J Nutr 2002, 132, 472–477, doi:10.1093/JN/132.3.472. [CrossRef]
  64. Chen, P.; Reiter, T.; Huang, B.; Kong, N.; Weimer, B.C. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection. Pathogens 2017, 6, doi:10.3390/PATHOGENS6040068. [CrossRef]
  65. Karakan, T.; Tuohy, K.M.; Janssen-van Solingen, G. Low-Dose Lactulose as a Prebiotic for Improved Gut Health and Enhanced Mineral Absorption. Front Nutr 2021, 8, 672925, doi:10.3389/FNUT.2021.672925/BIBTEX. [CrossRef]
  66. Sangwan, V.; Tomar, S.K.; Ali, B.; Singh, R.R.B.; Singh, A.K. Galactooligosaccharides Reduce Infection Caused by Listeria Monocytogenes and Modulate IgG and IgA Levels in Mice. Int Dairy J 2015, 41, 58–63, doi:10.1016/J.IDAIRYJ.2014.09.010. [CrossRef]
  67. Kupfahl, C.; Geginat, G.; Hof, H. Lentinan Has a Stimulatory Effect on Innate and Adaptive Immunity against Murine Listeria Monocytogenes Infection. Int Immunopharmacol 2006, 6, 686–696, doi:10.1016/J.INTIMP.2005.10.008. [CrossRef]
  68. Li, W.; Yajima, T.; Saito, K.; Nishimura, H.; Fushimi, T.; Ohshima, Y.; Tsukamoto, Y.; Yoshikai, Y. Immunostimulating Properties of Intragastrically Administered Acetobacter-Derived Soluble Branched (1,4)-β-D-Glucans Decrease Murine Susceptibility to Listeria Monocytogenes. Infect Immun 2004, 72, 7005–7011, doi:10.1128/IAI.72.12.7005-7011.2004/ASSET/FAA091FE-69E9-48F9-9FCB-A2C1C19F9160/ASSETS/GRAPHIC/ZII0120444520007.JPEG. [CrossRef]
  69. Torello, C.O.; De Souza Queiroz, J.; Oliveira, S.C.; Queiroz, M.L.S. Immunohematopoietic Modulation by Oral β-1,3-Glucan in Mice Infected with Listeria Monocytogenes. Int Immunopharmacol 2010, 10, 1573–1579, doi:10.1016/J.INTIMP.2010.09.009. [CrossRef]
  70. Alonso, V.P.P.; Harada, A.M.M.; Kabuki, D.Y. Competitive and/or Cooperative Interactions of Listeria Monocytogenes With Bacillus Cereus in Dual-Species Biofilm Formation. Front Microbiol 2020, 11, 177, doi:10.3389/FMICB.2020.00177/BIBTEX. [CrossRef]
  71. Amézquita, A.; Brashears, M.M. Competitive Inhibition of Listeria Monocytogenes in Ready-to-Eat Meat Products by Lactic Acid Bacteria. J Food Prot 2002, 65, 316–325, doi:10.4315/0362-028X-65.2.316. [CrossRef]
  72. Corr, S.C.; Gahan, C.G.M.; Hill, C. Impact of Selected Lactobacillus and Bifidobacterium Species on Listeria Monocytogenes Infection and the Mucosal Immune Response. FEMS Immunol Med Microbiol 2007, 50, 380–388, doi:10.1111/J.1574-695X.2007.00264.X. [CrossRef]
  73. da Silva Sabo, S.; Converti, A.; Todorov, S.D.; Domínguez, J.M.; de Souza Oliveira, R.P. Effect of Inulin on Growth and Bacteriocin Production by Lactobacillus Plantarum in Stationary and Shaken Cultures. Int J Food Sci Technol 2015, 50, 864–870, doi:10.1111/IJFS.12711. [CrossRef]
  74. García, M.J.; Ruíz, F.; Asurmendi, P.; Pascual, L.; Barberis, L. Searching Potential Candidates for Development of Protective Cultures: Evaluation of Two Lactobacillus Strains to Reduce Listeria Monocytogenes in Artificially Contaminated Milk. J Food Saf 2020, 40, e12723, doi:10.1111/JFS.12723. [CrossRef]
  75. Hascoët, A.S.; Ripolles-avila, C.; Cervantes-huamán, B.R.H.; Rodríguez-jerez, J.J. In Vitro Preformed Biofilms of Bacillus Safensis Inhibit the Adhesion and Subsequent Development of Listeria Monocytogenes on Stainless-Steel Surfaces. Biomolecules 2021, 11, 1–16, doi:10.3390/BIOM11030475. [CrossRef]
  76. Shao, X.; Fang, K.; Medina, D.; Wan, J.; Lee, J.L.; Hong, S.H. The Probiotic, Leuconostoc Mesenteroides, Inhibits Listeria Monocytogenes Biofilm Formation. J Food Saf 2020, 40, e12750, doi:10.1111/JFS.12750. [CrossRef]
  77. Tran, T.D.; Cid, C. Del; Hnasko, R.; Gorski, L.; McGarvey, J.A. Bacillus Amyloliquefaciens ALB65 Inhibits the Growth of Listeria Monocytogenes on Cantaloupe Melons. Appl Environ Microbiol 2020, 87, 1–10, doi:10.1128/AEM.01926-20. [CrossRef]
  78. Aké, F.M.D.; Joyet, P.; Deutscher, J.; Milohanic, E. Mutational Analysis of Glucose Transport Regulation and Glucose-Mediated Virulence Gene Repression in Listeria Monocytogenes. Mol Microbiol 2011, 81, 274–293, doi:10.1111/J.1365-2958.2011.07692.X. [CrossRef]
  79. Crespo Tapia, N.; Dorey, A.L.; Gahan, C.G.M.; den Besten, H.M.W.; O’Byrne, C.P.; Abee, T. Different Carbon Sources Result in Differential Activation of Sigma B and Stress Resistance in Listeria Monocytogenes. Int J Food Microbiol 2020, 320, 108504, doi:10.1016/J.IJFOODMICRO.2019.108504. [CrossRef]
  80. Jaradat, Z.W.; Bhunia, A.K. Glucose and Nutrient Concentrations Affect the Expression of a 104-Kilodalton Listeria Adhesion Protein in Listeria Monocytogenes. Appl Environ Microbiol 2002, 68, 4876–4883, doi:10.1128/AEM.68.10.4876-4883.2002. [CrossRef]
  81. Park, S.F.; Kroll, R.G. Expression of Listeriolysin and Phosphatidylinositol-Specific Phospholipase C Is Repressed by the Plant-Derived Molecule Cellobiose in Listeria Monocytogenes. Mol Microbiol 1993, 8, 653–661, doi:10.1111/J.1365-2958.1993.TB01609.X. [CrossRef]
  82. Gibson, G.R.; Roberfroid, M.B. Dietary Modulation of the Human Colonic Microbiota: Introducing the Concept of Prebiotics. J Nutr 1995, 125, 1401–1412, doi:10.1093/JN/125.6.1401. [CrossRef]
  83. Hutkins, R.W.; Krumbeck, J.A.; Bindels, L.B.; Cani, P.D.; Fahey, G.; Goh, Y.J.; Hamaker, B.; Martens, E.C.; Mills, D.A.; Rastal, R.A.; et al. Prebiotics: Why Definitions Matter. Curr Opin Biotechnol 2016, 37, 1–7, doi:10.1016/J.COPBIO.2015.09.001. [CrossRef]
  84. Bindels, L.B.; Delzenne, N.M.; Cani, P.D.; Walter, J. Towards a More Comprehensive Concept for Prebiotics. Nat Rev Gastroenterol Hepatol 2015, 12, 303–310, doi:10.1038/NRGASTRO.2015.47. [CrossRef]
Figure 1. The growth curves of Listeria monocytogenes strains cultivated on water-soluble prebiotics (2 g/L). All data for individual strains are averages from triplicates. Positive control = 2 g/L glucose. Residual control = 0.1 g/L glucose. OD = optical density. A: Data show average of 4 strains—LM1 (serotype 4b), LM11 (serotype 1/2b), LM56 (serotype 1/2a) and LM79 (serotype 1/2c). B: The growth of individual strains in positive control (2 g/L glucose). C: The growth of individual strains in residual control (0.1 g/L glucose). D: The growth of individual strains on inulin (2 g/L). E: The growth of individual strains on fructooligosaccharides (2 g/L). F: The growth of individual strains on galactooligosaccharides (2 g/L).
Figure 1. The growth curves of Listeria monocytogenes strains cultivated on water-soluble prebiotics (2 g/L). All data for individual strains are averages from triplicates. Positive control = 2 g/L glucose. Residual control = 0.1 g/L glucose. OD = optical density. A: Data show average of 4 strains—LM1 (serotype 4b), LM11 (serotype 1/2b), LM56 (serotype 1/2a) and LM79 (serotype 1/2c). B: The growth of individual strains in positive control (2 g/L glucose). C: The growth of individual strains in residual control (0.1 g/L glucose). D: The growth of individual strains on inulin (2 g/L). E: The growth of individual strains on fructooligosaccharides (2 g/L). F: The growth of individual strains on galactooligosaccharides (2 g/L).
Preprints 115266 g001
Figure 2. The growth curves of Listeria monocytogenes strains on beta-(1,3)-D-glucan (partially water-soluble prebiotic) and positive control. All data for individual strains are averages from triplicates. CFU—colony-forming units. A: Data show mean of 4 strains—LM1 (serotype 4b), LM11 (serotype 1/2b), LM 56 (serotype 1/2a) and LM 79 (serotype 1/2c). B: The growth of individual strains in positive control (2 g/L glucose). C: The growth of individual strains on beta-(1,3)-D-glucan (2 g/L).
Figure 2. The growth curves of Listeria monocytogenes strains on beta-(1,3)-D-glucan (partially water-soluble prebiotic) and positive control. All data for individual strains are averages from triplicates. CFU—colony-forming units. A: Data show mean of 4 strains—LM1 (serotype 4b), LM11 (serotype 1/2b), LM 56 (serotype 1/2a) and LM 79 (serotype 1/2c). B: The growth of individual strains in positive control (2 g/L glucose). C: The growth of individual strains on beta-(1,3)-D-glucan (2 g/L).
Preprints 115266 g002
Table 1. Listeria monocytogenes growth on selected water-soluble prebiotic saccharides.
Table 1. Listeria monocytogenes growth on selected water-soluble prebiotic saccharides.
Strain code LM1 LM11 LM56 LM79 Average ± SD
Serotype 4b 1/2b 1/2a 1/2c -
Positive control (2 g/L glucose) 0.156 ± 0.036Aa 0.140 ± 0.027Aa 0.127 ± 0.032Aa 0.130 ± 0.030Aa 0.138 ± 0.032A
Residual control (0.1 g/L glucose) 0.028 ± 0.002Ba 0.029 ± 0.001BCa 0.028 ± 0.001BCa 0.026 ± 0.001BCa 0.028 ± 0.002B
Negative control (no saccharides) 0.016 ± 0.015Ba -0.006 ± 0.026Cb 0.008 ± 0.008BCab 0.005 ± 0.005Cab 0.006 ± 0.017C
Inulin 0.027 ± 0.006Ba 0.028 ± 0.004BCa 0.047 ± 0.013Ba 0.043 ± 0.005Ba 0.036 ± 0.012B
Fructooligosaccharides 0.026 ± 0.031Ba 0.029 ± 0.008BCa 0.034 ± 0.011BCa 0.016 ± 0.005BCa 0.027 ± 0.016B
Galactooligosaccharides 0.008 ± 0.018Bb 0.046 ± 0.006Ba 0.018 ± 0.002BCb 0.011 ± 0.007BCb 0.021 ± 0.018BC
Lactulose 0.014 ± 0.040Ba 0.010 ± 0.014BCa -0.001 ± 0.005BCa -0.005 ± 0.001Ca -0.001 ± 0.010C
Raffinose 0.004 ± 0.006Ba 0.006 ± 0,002BCa 0.004 ± 0.006BCa -0.003 ± 0.007Ca 0.003 ± 0.006C
Stachyose 0.032 ± 0.005Ba 0.011 ± 0.009BCb 0.015 ± 0.005BCb 0.003 ± 0.005BCb 0.015 ± 0.012BC
2´-fucosyllactose 0.019 ± 0.002Ba 0.013 ± 0.003BCa 0.015 ± 0.004BCa 0.011 ± 0.006BCa 0.014 ± 0.005BC
Mixture of HMOs 0.028 ± 0.014Ba 0.010 ± 0.007BCab 0.016 ± 0.007BCab -0.006 ± 0.010Cb 0.012 ± 0.015BC
Data are expressed as differences in OD at the time of inoculation and after 24 hours of cultivation measured at 620 nm. All data for individual strains are average from triplicates ± SD. OD—optical density. SD—standard deviation. HMOs—human milk oligosaccharides. ABC—data with different superscripts differ (P < 0.05) in column. ab—data with different superscripts differ (P < 0.05) in line.
Table 2. Listeria monocytogenes growth on beta-(1,3)-D-glucan (partially water-soluble prebiotic).
Table 2. Listeria monocytogenes growth on beta-(1,3)-D-glucan (partially water-soluble prebiotic).
Strain code LM1 LM11 LM56 LM79 Average ± SD
Serotype 4b 1/2b 1/2a 1/2c -
Positive control (2 g/L glucose) 1.56 ± 0.72A 1.2 ± 0.04A 0.95 ± 0.01A 1.24 ± 0.15A 1.24 ± 0.39A
Negative control (no saccharides) 0.33 ± 0.06B 0.49 ± 0.12B 0.16 ± 0.02B 0.24 ± 0.11B 0.31 ± 0.15B
Beta-(1-3)-D-glucan 1.05 ± 0.09A 1.43 ± 0.67A 0.96 ± 0.07A 1.48 ± 0.72A 1.23 ± 0.48A
Data are expressed as differences in log CFU/mL at the time of inoculation and after 24 hours of cultivation. All data for individual strains are averages from triplicates ± SD. CFU—colony-forming units. SD—standard deviation. AB—data with different superscripts differ (P < 0.05) in column. No statistically significant differences (P ≥ 0.05) in line were found.
Table 3. pH changes in batch cultures during 24 h of in vitro fermentation of different saccharides by L. monocytogenes.
Table 3. pH changes in batch cultures during 24 h of in vitro fermentation of different saccharides by L. monocytogenes.
Strain code LM1 LM11 LM56 LM79 Average ± SD
Serotype 4b 1/2b 1/2a 1/2c -
Positive control (2 g/L glucose) 5.70± 0.02Aab 5.68 ± 0.01Aa 5.73 ± 0.02Ac 5.71 ± 0.01Abc 5.70 ± 0.03A
Residual control (0.1 g/L glucose) 6.63 ± 0.01Cab 6.62 ± 0.00Ca 6.63 ± 0.01Dab 6.64 ± 0.00Cb 6.63 ± 0.01C
Negative control (no saccharides) 6.91 ± 0.01Db 6.90 ± 0.00Da 6.91 ± 0.01Eab 6.90± 0.01Da 6.90 ± 0.01D
Beta-(1,3)-D-glucan 5.73± 0.01Ab 5.67 ± 0.02Aa 5.73 ± 0.01Ab 5.69 ± 0.02Aab 5.71 ± 0.03A
Inulin 6.34 ± 0.02Bb 6.31 ± 0.01Ba 6.29 ± 0.01Ba 6.30 ± 0.00Ba 6.31 ± 0.03B
Fructooligosaccharides 6.63 ± 0.02Cb 6.59 ± 0.02Ca 6.60 ± 0.02Cab 6.63 ± 0.01Cab 6.61 ± 0.02C
Galactooligosaccharides 6.65 ± 0.04Ca 6.60± 0.00Ca 6.62 ± 0.02CDa 6.62 ± 0.03Ca 6.63 ± 0.03C
Lactulose 6.90 ± 0.00Da 6.89 ± 0.02Da 6.91 ± 0.01Eab 6.92 ± 0.01Eb 6.91 ± 0.02D
Raffinose 6.90 ± 0.00Da 6.91 ± 0,01Dc 6.90 ± 0.01Eb 6.90 ± 0.00Da 6.90 ± 0.01D
Stachyose 6.89 ± 0.01Da 6.90 ± 0.01Da 6.90 ± 0.00Ea 6.90 ± 0.00Da 6.90 ± 0.01D
2´-fucosyllactose 6.90 ± 0.00Da 6.90 ± 0.00Da 6.90 ± 0.01Ea 6.91 ± 0.01DEa 6.90 ± 0.01D
Mixture of HMOs 6.89 ± 0.01Da 6.90 ± 0.01Dab 6.90 ± 0.00Eb 6.90 ± 0.01Dab 6.90 ± 0.01D
Data are expressed as final pH values after 24 h of cultivation. The initial pH values in the media were 6.90 ± 0.01. All data for individual strains are averages from triplicates ± SD. SD—standard deviation. HMOs—human milk oligosaccharides. ABCDE—data with different superscripts differ (P < 0.05) in column. abc—data with different superscripts differ (P < 0.05) in line.
Table 4. Specific growth rates of Listeria monocytogenes on water-soluble prebiotic saccharides.
Table 4. Specific growth rates of Listeria monocytogenes on water-soluble prebiotic saccharides.
Strain code LM1 LM11 LM56 LM79 Average ± SD
Serotype 4b 1/2b 1/2a 1/2c -
Positive control (2 g/L glucose) 0.42 ± 0.21Aa 0.63 ± 0.04Aa 0.49 ± 0.02BCa 0.64 ± 0.10Aa 0.55 ± 0.14A
Residual control (0.1 g/L glucose) 0.48 ± 0.07Aa 0.32 ± 0.03Ba 0.40 ± 0.08Ca 0.55 ± 0.20ABa 0.44 ± 0.14A
Inulin 0.35 ± 0.02Ab 0.63 ± 0.12Aa 0.68 ± 0.03ABa 0.51 ± 0.04ABab 0.54 ± 0.11A
Fructooligosaccharides 0.38 ± 0.10Ac 0.67 ± 0.12Aab 0.70 ± 0.09Aa 0.47 ± 0.09ABbc 0.55 ± 0.20A
Galactooligosaccharides 0.19 ± 0.05Ab 0.66 ± 0.03Aa 0.73 ± 0.18ABa 0.28 ± 0.13Bb 0.46 ± 0.19A
Data are expressed as changes in biomass concentration per hour (h-1). All data for individual strains are averages from triplicates ± SD. SD—standard deviation. ABC—data with different superscripts differ (P < 0.05) in column. abc—data with different superscripts differ (P < 0.05) in line.
Table 5. Specific growth rates of Listeria monocytogenes on beta-(1,3)-D-glucan (partially water-soluble).
Table 5. Specific growth rates of Listeria monocytogenes on beta-(1,3)-D-glucan (partially water-soluble).
Strain code LM1 LM11 LM56 LM79 Average ± SD
Serotype 4b 1/2b 1/2a 1/2c -
Positive control (2 g/L glucose) 0.53 ± 0.01 0.53 ± 0.01 0.52 ± 0.01 0.47 ± 0.16 0.51 ± 0.07
Beta-(1,3)-D-glucan 0.53 ± 0.01 0.54 ± 0.01 0.53 ± 0.01 0.52 ± 0.01 0.53 ± 0.01
Data are expressed as changes in biomass concentration per hour (h-1). All data for individual strains are averages from triplicates ± SD. SD—standard deviation. No statistically significant differences (P ≥ 0.05) were found.
Table 6. Enzymatic profiles of tested Listeria monocytogenes isolates determined using the API-ZYM kit.
Table 6. Enzymatic profiles of tested Listeria monocytogenes isolates determined using the API-ZYM kit.
Strain code Serotype Enzyme*
Esterase (C4) Esterase lipase (C8) Leucine
aminopeptidase
Acid
phosphatase
Naphtol- AS-BI-
-phosphohydrolase
Alpha-
glucosidase
Beta-
glucosidase
LM1 4b 5 1 2 3 3 1 5
LM11 1/2b 4 1 2 3 2 0 4
LM56 1/2a 5 0 0 4 4 1 5
LM79 1/2c 4 0 0 4 4 0 5
Testing was performed in one repetition. The scale of the API-ZYM test was used for enzymatic quantification: 0 = no enzyme; 1 = 5 nmol; 2 = 10 nmol; 3 = 20 nmol; 4 = 30 nmol; and 5 = 40 nmol or more of metabolized API-ZYM substrate. *All isolates were negative for lipase, cystine aminopeptidase, alkaline, phosphatase, chymotrypsin, N-acetyl glucosaminidase, valine aminopeptidase, trypsin, alpha-galactosidase, beta-galactosidase, beta-glucuronidase, alpha-mannosidase and alpha-fucosidase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

© 2026 MDPI (Basel, Switzerland) unless otherwise stated

Accessibility

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings