Submitted:
22 May 2024
Posted:
23 May 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Material and Methods
2.1. Samples
2.2. Whole Genome Sequencing (WGS)
2.3. Mitogenome Assembly and Annotation
2.4. Mitogenome Identity Assessment
2.5. Alternative CRB Marker Development to Identify the Original CRB Population that Invaded Guam
2.6. Mitogenome Analysis
3. Results
3.1. Mitochondrial Genome Analysis
3.2. Alternative Primers to Identify the Original Invasive CRB Population Present in Guam
3.3. Phylogeny
4. Discussion
Supplementary Materials
Acknowledgements
Conflicts of Interest
References
- Anderson, C.J.; Tay, W.T.; McGaughran, A.; et al. Population structure and gene flow in the global pest, Helicoverpa armigera. Molecular Ecology 2016, 25, 5296–5311. [Google Scholar] [CrossRef] [PubMed]
- Anderson, C.J.; Oakeshott, J.G.; Tay, W.T.; et al. Hybridization and gene flow in the mega-pest lineage of moth, Helicoverpa. Proceedings of the National Academy of Sciences U.S.A. 2018, 115, 5034–5039. [Google Scholar] [CrossRef] [PubMed]
- Anggraini, E.; Vadamalai, G.; Lih, L.K.; et al. Variants in the mitochondrial genome sequence of Oryctes rhinoceros (Coleoptera: Scarabaeidae) infected with Oryctes rhinoceros nudivirus in oil palm and coconut plantations. Scientific Reports 2023, 13, 16850. [Google Scholar] [CrossRef] [PubMed]
- Arnemann, J.A.; Roxburgh, S.; Walsh, T.; et al. Multiple incursion pathways for Helicoverpa armigera in Brazil show its genetic diversity spreading in a connected world. Scientific Reports 2018, 9, 19380. [Google Scholar] [CrossRef] [PubMed]
- Ayivi, S.P.G.; Tong, Y.; Storey, K.B.; et al. The mitochondrial genomes of 18new Pleurosticti (Coleoptera: Scarabaeidae) exhibit a novel trnQ-NCR-trnI-trnM gene rearrangement and clarify phylogenetic relationships of subfamilies within Scarabaeidae. Insects 2021, 12, 1025. [Google Scholar] [CrossRef] [PubMed]
- Bedford, G.O. Biology, Ecology, and control of palm rhinoceros beetles. Annual Review of Entomology 1980, 25, 209–229. [Google Scholar] [CrossRef]
- Behere, B.T.; Tay, W.T.; Russell, D.A.; et al. Mitochondrial DNA analysis of field populations of Helicoverpa armigera (Lepidoptera: Noctuidae) and of its relationship to H. zea. BMC Evolutionary Biology 2007, 7, 117. [Google Scholar] [CrossRef] [PubMed]
- Bernt, M.; Donath, A.; Jühling, F.; et al. MITOS: Improved de novo Metazoan Mitochondrial Genome Annotation. Molecular Phylogenetics and Evolution 2013, 69, 313–319. [Google Scholar] [CrossRef] [PubMed]
- Benelli, G.; Lucchi, A.; Anfora, G.; et al. European grapevine moth, Lobesia botrana. Part I: Biology and ecology. Entomologia Generalis 2023, 43, 261–280. [Google Scholar] [CrossRef]
- Caasi, J.A.S.; Guerrero, A.L.; Yoon, K.; et al. A mathematical model of invasion and control of coconut rhinoceros beetle Oryctes rhinoceros (L.) in Guam. Journal of Theoretical Biology 2023, 570, 11525. [Google Scholar] [CrossRef]
- Cheng, C.-T.; Jeng, M.-L.; Tsai, J.-F.; et al. Two mitochondrial genomes of Taiwanese rhinoceros beetles, Oryctes rhinoceros and Eophileurus chinensis (Coleoptera: Scarabaeidae). Mitochondrial DNA B Resources 2021, 6, 2260–2262. [Google Scholar] [CrossRef] [PubMed]
- Cock, M.J.W.; Beseh, P.K.; Buddie, A.G.; et al. Molecular methods to detect Spodoptera frugiperda in Ghana, and implications for monitoring the spread of invasive species in developing countries. Scientific Reports 2017, 7, 4103. [Google Scholar] [CrossRef] [PubMed]
- Crozier, R.H. From population genetics to phylogeny: Uses and limits of mitochondrial DNA. Aust. Syst. Biol. 1990, 3, 111–124. [Google Scholar] [CrossRef]
- Datt, N.; Gosai, R.C.; Ravuiwasa, K.; Timote, V. Key transboundary plant pests of Coconut [Cocos nucifera] in the Pacific Island countries – a biosecurity perspective. Plant Pathology & Quarantine 2020, 10, 152–171. [Google Scholar]
- De Barro, P.J.; Liu, S.-S.; Boykin, L.M.; Dinsdale, A.B. Bemisia tabaci: a statement of species status. Annual Review of Entomology 2011, 56, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Etebari, K.; Hereward, J.; Sailo, A.; et al. Examination of population genetics of the coconut rhinoceros beetle (Oryctes rhinoceros) and the incidence of its biocontrol agent (Oryctes rhinoceros nudivirus) in the South Pacific Islands. Current Research in Insect Science 2021, 1, 100015. [Google Scholar] [CrossRef] [PubMed]
- Elfekih, S.; Tay, W.T.; Gordon, K.; et al. Standardized molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex. Pest Management Science 2018, 74, 170–173. [Google Scholar] [CrossRef] [PubMed]
- Elfekih, S.; Tay, W.T.; Polaszek, A.; et al. On species delimitation, hybridization and population structure of cassava whitefly in Africa. Scientific Reports 2021, 11, 7923. [Google Scholar] [CrossRef] [PubMed]
- Filipović, I.; Hereward, J.; Rašić, G.; et al. The complete mitochondrial genome sequence of Oryctes rhinoceros (Coleoptera: Scarabaeidae) based on long-read on nanopore sequencing. PeerJ 2021, 9, e10552. [Google Scholar] [CrossRef]
- Goergen, G.; Lava-Kumar, P.; Sankung, S.B.; et al. First report of outbreaks of the fall armyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a new alien invasive pest in West and Central Africa. PLoS ONE 2016, 11, e0165632. [Google Scholar] [CrossRef]
- HDOA (Hawaii Department of Agriculture) Coconut rhinoceros beetle information. Posted on 15 January 2014. https://hdoa.hawaii.gov/pi/main/crb/ (last accessed on 10 April 2024).
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; et al. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B 2003, 270, 313–322. [Google Scholar] [CrossRef] [PubMed]
- Hebert, P.D.N.; Penton, E.H.; Burns, J.M.; et al. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 14812–14817. [Google Scholar] [CrossRef] [PubMed]
- Hoang, D.T.; Chernomor, Q.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, B.D.; Blas, A.; Tay, W.T. Biosecurity interceptions of Coconut Rhinoceros Beetle Oryctes rhinoceros. Management of Biological Invasions. in press.
- Hurst, G.D.D.; Jiggins, F.M. Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: the effects of inherited symbionts. Proceedings of the Royal Society Series B 2005, 272, 1525–1534. [Google Scholar] [CrossRef] [PubMed]
- Huson, D.H.; Richter, D.C.; Rausch, C.; Dezulian, T.; Franz, M.; Rupp, R. Dendroscope: an interactive viewer for large phylogenetic trees. BMC Bioinformatics 2007, 8, 460. [Google Scholar] [CrossRef] [PubMed]
- Indriyanti, D.R.; Utami, Z.T.; Setiati, N.; Soesilowati, E.; Slamet, M. Identification of insect pests that attack the coconut plants in Jepara regency. Journal of Physics: Conference Series 2019, 1321, 032030. [Google Scholar] [CrossRef]
- Katoh, K.; Misawa, K.; Kuma, K.-I.; et al. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 2002, 440, 3059–3066. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT Multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Lannucci, A.; Benazzo, A.; Natali, C.; et al. Population structure, genomic diversity and demographic history of Komodo dragons inferred from whole-genome sequencing. Molecular Ecology 2021, 20, 6309–6324. [Google Scholar] [CrossRef]
- Leducq, J.-B.; Henault, M.; Charron, G.; et al. Mitochondrial recombination and introgression during speciation by hybridization. Molecular Biology and Evolution 2017, 38, 1947–1959. [Google Scholar] [CrossRef]
- Leite, N.A.; Alves-Pereira, A.; Corrêa, A.S.; et al. Demographics and genetic variability of the new world bollworm (Helicoverpa zea) and the Old World bollworm (Helicoverpa armigera) in Brazil. PLoS ONE 2014, 9, e113286. [Google Scholar] [CrossRef] [PubMed]
- Li, X.W.; Fu, K.Y.; Guo, W.C.; Wang, T.Z.; Lu, Y.B. The complete mitochondrial genome of Tuta absoluta (Lepidoptera: Gelechiidae) and genetic variation in two newly invaded populations in China. Journal of Asia-Pacific Entomology 2022, 25, 101988. [Google Scholar] [CrossRef]
- Marshall, S.D.G.; Moore, A.; Vaqalo, M.; et al. A new haplotype of the coconut rhinoceros beetle, Oryctes rhinoceros, has escaped biological control by Oryctes rhinoceros nudivirus and is invading Pacific Islands. Journal of Invertebrate Pathology 2017, 149, 127–134. [Google Scholar] [CrossRef] [PubMed]
- Marshall, S.D.G.; Paudel, S.; Mansfield, S.; et al. Coconut rhinoceros beetle in Solomon Islands: a tale of two invasions. Biological Invasions 2023, 25, 2659–2678. [Google Scholar] [CrossRef]
- Nagoshi, R.N.; Goergen, G.; Tounou, K.A.; et al. Analysis of strain distribution, migratory potential, and invasion history of fall armyworm populations in northern Sub-Saharan Africa. Scientific Reports 2018, 8, 3710. [Google Scholar] [CrossRef]
- Nagoshi, R.N.; Dhanani, I.; Asokan, R.; et al. Genetic characterization of fall armyworm infesting South Africa and India indicate recent introduction from a common source population. PLoS ONE 2019, 14, e0217755. [Google Scholar] [CrossRef]
- Otim, M.H.; Tay, W.T.; Walsh, T.K.; et al. Detection of sister-species in invasive populations of the fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) from Uganda. PLoS ONE 2018, 13, e0194571. [Google Scholar] [CrossRef] [PubMed]
- Paudel, S.; Mansfield, S.; Villamizar, L.F.; et al. Can biological control overcome the threat from newly invasive coconut rhinoceros beetle populations (Coleoptera: Scarabaeidae)? A review. Annals of the Entomological Society of America 2023, 114, 247–256. [Google Scholar] [CrossRef]
- Pearce, S.L.; Clarke, D.F.; East, P.D.; et al. Genomic innovation, transcriptional plasticity and gene loss underlying the evolution and divergence of two highly polyphagous and invasive Helicoverpa pest species. BMC Biology 2017, 15, 63. [Google Scholar] [CrossRef]
- Rane, R.; Walsh, T.K.; Lenancker, P.; et al. Complex multiple introductions drive fall armyworm invasions into Asia and Australia. Scientific Reports 2023, 13, 660. [Google Scholar] [CrossRef] [PubMed]
- Reil, J.B.; Doorenweerd, C.; San Jose, M.; et al. Transpacific coalescent pathways of coconut rhinoceros beetle biotypes: Resistance to biological control catalyses resurgence of an old pest. Molecular Ecology 2018, 27, 4459–4474. [Google Scholar] [CrossRef] [PubMed]
- Rugman-Jones, P.F.; Hoddle, C.D.; Hoddle, M.S.; Stouthamer, R. The Lesser of Two Weevils: Molecular-Genetics of Pest Palm Weevil Populations Confirm Rhynchophorus vulneratus (Panzer 1798) as a Valid Species Distinct from R. ferrugineus (Olivier 1790), and Reveal the Global Extent of Both. PLoS ONE 2013, 8, e78379. [Google Scholar] [CrossRef]
- Saville, B.; Kohli, Y.; Anderson, J.B. mtDNA recombination in a natural population. Proceedings of the National Academy of Sciences of the United States of America 1998, 95, 1331–1335. [Google Scholar] [CrossRef] [PubMed]
- Tay, W.T. Rapid molecular DNA identification method for the European invasive grapevine moth Lobesia botrana. 2016. Australia: CSIRO. Available online: https://www.wineaustra- lia.com/getmedia/72f4848c-82c7-45b2-ba10-a179add3d6df/ CSE-1301-Final-Report.
- Tay, W.T.; Beckett, S.J.; De Barro, P.J. (2016). Phosphine resistance in Australian Cryptolestes species (Coleoptera: Laemophloeidae): perspectives from mitochondrial DNA cytochrome oxidase I analysis. Pest Management Science 2016, 72, 1250–1259. [Google Scholar] [CrossRef] [PubMed]
- Tay, W.T.; Walsh, T.K.; Downes, S.; Anderson, C.; et al. Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil. Scientific Reports 2017, 7, 45302. [Google Scholar] [CrossRef] [PubMed]
- Tay, W.T.; Elfekih, S.; Court, L.N.; et al. The trouble with MEAM2: Implications of pseudogenes on species delimitation in the globally invasive Bemisia tabaci (Hemiptera: Aleyrodidae) cryptic species complex. Genome Biology and Evolution 2017, 9, 2732–2738. [Google Scholar] [CrossRef] [PubMed]
- Tay, W.T.; Rane, R.; Padovan, A.; et al. Global population genomic signature of Spodoptera frugiperda (fall armyworm) supports complex introduction events across the Old World. Communications Biology 2022, 5, 297. [Google Scholar] [CrossRef]
- Tay, W.T.; Court, L.N.; Hoffmann, B.D.; et al. Draft mitogenomes of the invasive ant Lepisiota frauenfeldi (Mayr 1855) (Hymenoptera: Formicidae). Mitochondrial DNA Part B 2022, 7, 1183–1185. [Google Scholar] [CrossRef]
- Tay, W.T.; Meagher, R.L., Jr.; Czepak, C.; Groot, A.T. Spodoptera frugiperda: Ecology, evolution and management options of an invasive species. Annual Review of Entomology 2023, 68, 299–317. [Google Scholar] [CrossRef]
- Tay, W.T.; Popa-Baez, A.; Dulla, G.; et al. Mitochondrial COI, ATP6, and COIII complete sequence database for coconut rhinoceros beetles (Oryctes rhinoceros) from native and introduced ranges. CSIRO Data Access Portal 2024. [Google Scholar] [CrossRef]
- The Marshall Islands Journal Rhino beetle takes root. 19 October 2023. Available online: https://marshallislandsjournal.com/rhino-beetle-takes-root/ (accessed on 17 March 2024).
- Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 44, W232–235. [Google Scholar] [CrossRef] [PubMed]
- Valencia-Montoya, W.A.; Elfekih, S.; North, H.L.; Meier, J.I.; et al. Adaptive introgression across semipermeable species boundaries between local Helicoverpa zea and invasive Helicoverpa armigera moths. Molecular Biology and Evolution 2020, 37, 2568–2583. [Google Scholar] [CrossRef] [PubMed]
- Walsh, T.K.; Perera, O.; Anderson, A.; et al. Mitochondrial DNA genomes of five major Helicoverpa pest species from the Old and New Worlds (Lepidoptera: Noctuidae). Ecology and Evolution 2019, 9, 2933–2944. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, F.; Tay, W.T.; et al. Population genomics provides insights into lineage divergence and local adaptation within the cotton bollworm. Molecular Ecology Resources 2022, 22, 1875–1891. [Google Scholar] [CrossRef]

| Sample code | Country | Specimen collection date | Haplotype designation based on partial mtCOI (Marshall et al. 2017) | mtCOI_G1779A | Designation based on partial ATP6 and COIII (this study) | ATP6_T4430C | COIII_C5390T |
|---|---|---|---|---|---|---|---|
| 04-Or5 | Guam | 2014 | CRB-G (clade I) | G | Guam | T | C |
| NZ-20-738 | Guam | 2020 | CRB-G (clade I) | G | Guam | T | C |
| Guam-01_GDoA | Guam | 2022 | CRB-G (clade I) | G | Guam | T | C |
| Guam-02_GDoA | Guam | 2022 | CRB-G (clade I) | G | Guam | T | C |
| Guam-09_GDoA | Guam | 2022 | CRB-G (clade I) | G | Guam | T | C |
| Guam-13_GDoA | Guam | 2022 | CRB-G (clade I) | G | Guam | T | C |
| Guam-17_GDoA | Guam | 2022 | CRB-G (clade I) | G | Guam | T | C |
| MT457815 | Solomon Is. | 2019 | CRB-G (clade I) | G | not Guam | C | T |
| MW632131 | Taiwan | 2002 | CRB-G (clade I) | G | not Guam | C | T |
| MY-A-02 | Malaysia | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| MY-A-04 | Malaysia | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| MY-A-10 | Malaysia | 2022 | CRB-S (clade III) | A | not Guam | C | T |
| ON764800 | Malaysia | 2021 | CRB-S (clade III) | A | not Guam | C | T |
| OP694176 | Malaysia | 2021 | CRB-S (clade III) | A | not Guam | C | T |
| OP694175 | Malaysia | 2021 | CRB-S (clade IV) | A | not Guam | C | T |
| ON764799 | Malaysia | 2020 | CRB-S (clade II) | A | not Guam | C | T |
| ON764801 | Malaysia | 2021 | CRB-S (clade II) | A | not Guam | C | T |
| PALAU-01 | Palau | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| PALAU-02 | Palau | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| PALAU-03 | Palau | 2022 | CRB-G (clade I) | G | not Guam | C | T |
| PALAU-04 | Palau | 2022 | CRB-G (clade I) | G | not Guam | C | T |
| Phil-01 | Philippines | 2022 | CRB-G (clade I) | G | not Guam | C | T |
| Phil-02 | Philippines | 2022 | CRB-G (clade I) | G | not Guam | C | T |
| Phil-05 | Philippines | 2022 | CRB-G (clade I) | G | not Guam | C | T |
| Phil-10 | Philippines | 2022 | CRB-G (clade I) | G | not Guam | C | T |
| IND-H01 | Indonesia | 2021 | CRB-S (clade III) | A | not Guam | C | T |
| IND-H02 | Indonesia | 2021 | CRB-S (clade IV) | A | not Guam | C | T |
| IND-H10 | Indonesia | 2021 | CRB-S (clade III) | A | not Guam | C | T |
| IND-J14 | Indonesia | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| IND-J15 | Indonesia | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| IND-J20 | Indonesia | 2022 | CRB-S (clade IV) | A | not Guam | C | T |
| OK484312 | unspecified | unspecified | Not applicable | T | Not applicable | T | T |
| Nucleotide position | Primer name: primer sequence (5’-3’) | Restriction enzyme | CRB-G (clade I) (Marshall et al. 2017) | Other CRB |
| nt4192-4216 | CRB-ATP6-F: ATGAATTCAAACTTTTAATTGGACC | BpmI (CTCCAG) | T | C |
| nt4685-4663 | CRB-ATP6-R: GGAGTAAAGAGTTCTAAGGATAG | 271+223 bp | 494 bp | |
| nt5017-5039 | CRB-COIII-F: CTTAGCTCCTACAATCGAATTAG | Uncut | C | T |
| nt5485-5462 | CRB-COIII-R: TCTACCTCATCAGTAAATGGAAAT | 469 bp | 469 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).