Submitted:
05 October 2023
Posted:
05 October 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Greenhouse Tests
2.3. Isolation of Genomic DNA
2.4. Bulked Segregant Analysis
2.5. STS and SSR Genotyping
2.6. SNP Genotyping
2.7. Deletion Bin Mapping of Linked Markers
2.8. Data Analysis
3. Results
3.1. Inheritance Studies
3.2. Molecular Mapping
3.3. Deletion Mapping of Flanking Markers
3.4. Saturation of Chromosome 2BL using SNP Markers
3.5. Validation of YrAW4 Linked Markers
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wellings, C.R. Global status of stripe rust: a review of historical and current threats. Euphytica 2011, 179, 129-141. [CrossRef]
- Stubbs, R.W. Stripe rust. In The Cereal Rusts Vol Il, Roelfs, A.P., Bushnell, W.R., Eds.; Academic Press: Orlando, Florida, USA, 1985; pp. 61-101.
- O'Brien, L.; Brown, J.S.; Young, R.M.; Pascoe, I. Occurrence and Distribution of Wheat Stripe Rust in Victoria and Susceptibility of Commercial Wheat Cultivars. Australasian Plant Pathology 1980, 9, 14. [CrossRef]
- O'Brien, L.; Brown, J.S.; Young, R.M.; Pascoe, I. Occurrence and distribution of wheat stripe rust in Victoria and susceptibility of commercial wheat cultivars. Aust Plant Pathol 1980, 9, 14. [CrossRef]
- Wellings, C.R.; Wright, D.G.; Keiper, F.; Loughman, R. First detection of wheat stripe rust in Western Australia: evidence for a foreign incursion. Australasian Plant Pathology 2003, 32, 321-322. [CrossRef]
- Murray, G.M.; Ellison, P.J.; Watson, A. Effects of stripe rust on the wheat plant. Australasian Plant Pathology 1995, 24, 261-270, doi:Doi 10.1071/App9950261.
- Murray, G.M.; Brennan, J.P. Estimating disease losses to the Australian wheat industry. Australasian Plant Pathology 2009, 38, 558-570, doi:Doi 10.1071/App9950261.8.
- Wellings, C.R.; McIntosh, R.A. Puccinia striiformis f.sp. tritici in Australasia: pathogenic changes during the first 10 years. Plant Pathol 1990, 39, 316-325. [CrossRef]
- Edae, E.A.; Olivera, P.D.; Jin, Y.; Poland, J.A.; Rouse, M.N. Genotype-by-sequencing facilitates genetic mapping of a stem rust resistance locus in Aegilops umbellulata, a wild relative of cultivated wheat. BMC genomics 2016, 17, 1039. [CrossRef]
- Akbari, M.; Wenzl, P.; Caig, V.; Carling, J.; Xia, L.; Yang, S.; Uszynski, G.; Mohler, V.; Lehmensiek, A.; Kuchel, H.; et al. Diversity arrays technology (DArT) for high-throughput profiling of the hexaploid wheat genome. Theor Appl Genet 2006, 113, 1409-1420. [CrossRef]
- Jaccoud, D.; Peng, K.; Feinstein, D.; Kilian, A. Diversity arrays: a solid state technology for sequence information independent genotyping. Nucleic Acids Res 2001, 29, E25. [CrossRef]
- Xue, S.; Zhang, Z.; Lin, F.; Kong, Z.; Cao, Y.; Li, C.; Yi, H.; Mei, M.; Zhu, H.; Wu, J.; et al. A high-density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theor Appl Genet 2008, 117, 181-189. [CrossRef]
- Sun, C.; Dong, Z.; Zhao, L.; Ren, Y.; Zhang, N.; Chen, F. The Wheat 660K SNP array demonstrates.
- great potential for marker-assisted selection in polyploid wheat. Plant Biotechnol J 18:1354-1360.
- Eversole, K.; Feuillet, C.; Mayer, K.F.; Rogers, J. Slicing the wheat genome. Introduction. Science 2014, 345, 285-287. [CrossRef]
- Bariana, H.S.; Bansal, U.K.; Schmidt, A.; Lehmensiek, A.; Kaur, J.; Miah, H.; Gill, M.B.; Howes, N.; McIntyre, C.L. Molecular mapping of adult plant stripe rust resistance in wheat and identification of pyramided QTL genotypes. 2010 Euphytica 176:251-260. Euphytica 2010, 176, 251-260.
- Zakeri , A.; McIntosh, R.A.; Hovmoller, M.S.; Wellings, C.R.; Shariflou, M.R.; Hayden, M.; Bariana, H.S. Recombination of Yr15 and Yr24 in chromosome 1BS. In Proceedings of the Proceedings of 10th International Wheat Genetics Symposium, Paestum, Rome, Italy, 1-5 September 2003, 2003; pp. 417- 420.
- Miller, T.; Reader, S.; Ambrose, M. The Watkins wheat collection. Annu Wheat Newsl 2000, 46, 172.
- Daetwyler, H.D.; Bansal, U.K.; Bariana, H.S.; Hayden, M.J.; Hayes, B.J. Genomic prediction for rust resistance in diverse wheat landraces. Theor Appl Genet 2014, 127, 1795-1803. [CrossRef]
- Bansal, U.K.; Kazi, A.G.; Singh, B.; Hare, R.A.; Bariana, H.S. Mapping of durable stripe rust resistance in a durum wheat cultivar Wollaroi. Mol Breeding 2014, 33, 51-59. [CrossRef]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols, Misener, S., Krawetz, S., Eds.; Methods in Molecular Biology™; Humana Press: Totowa, NJ, 1999; Volume 132, pp. 365-386.
- Somers, D.J.; Isaac, P.; Edwards, K. A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.). Theor Appl Genet 2004, 109, 1105-1114. [CrossRef]
- Randhawa, M.; Bansal, U.; Valarik, M.; Klocova, B.; Dolezel, J.; Bariana, H. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat. Theor Appl Genet 2014, 127, 317-324. [CrossRef]
- Endo, T.R.; Gill, B.S. The deletion stocks of common wheat. Journal of Heredity 1996, 87, 295-307, doi:DOI 10.1093/oxfordjournals.jhered.a023003.
- Manly, K.F.; Cudmore, R.H., Jr.; Meer, J.M. Map Manager QTX, cross-platform software for genetic mapping. Mammalian genome : official journal of the International Mammalian Genome Society 2001, 12, 930-932. [CrossRef]
- Kosambi, D.D. The estimation of map distances from recombination values. Ann Eugenic 1944, 12, 172-175.
- Voorrips, R.E. MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered 2002, 93, 77-78. [CrossRef]
- Zhang, P.; McIntosh, R.A.; Hoxha, S.; Dong, C. Wheat stripe rust resistance genes Yr5 and Yr7 are allelic. Theor Appl Genet 2009, 120, 25-29. [CrossRef]
- Chen, X.M.; Soria, M.A.; Yan, G.P.; Sun, J.; Dubcovsky, J. Development of sequence tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust resistance gene Yr5. Crop Sci 2003, 43, 2058-2064, doi:DOI 10.2135/cropsci2003.2058.
- Cheng, P.; Chen, X.M. Molecular mapping of a gene for stripe rust resistance in spring wheat cultivar IDO377s. Theor Appl Genet 121, 195–204 (2010). [CrossRef]
- Xu, L.S.; Wang, M.N.; Cheng, P.; Kang, Z.S.; Hulbert, S.H.; Chen, X.M. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat. Theor Appl Genet 2013, 126, 523-533. [CrossRef]
- Yaniv, E.; Raats, D.; Ronin, Y.; Korol, A.; Grama, A.; Bariana, H.; Dubcovsky, J.; Schulman, A.; Fahima, T. Evaluation of marker-assisted selection for the stripe rust resistance gene Yr15, introgressed from wild emmer wheat. Mol Breeding 2015, 35, 1-12. [CrossRef]
- Randhawa, M.S.; Bariana, H.S.; Mago, R.; Bansal, U.K. Mapping of a new stripe rust resistance locus Yr57 on chromosome 3BS of wheat. Mol Breeding 2015, 35, 1-8, doi:ARTN 65 10.1007/s11032-015-0270-0.
- Lagudah, E.S.; Krattinger, S.G.; Herrera-Foessel, S.; Singh, R.P.; Huerta-Espino, J.; Spielmeyer, W.; Brown-Guedira, G.; Selter, L.L.; Keller, B. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet 2009, 119, 889-898. [CrossRef]
- Uauy, C.; Brevis, J.C.; Chen, X.; Khan, I.; Jackson, L.; Chicaiza, O.; Distelfeld, A.; Fahima, T.; Dubcovsky, J. High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein content locus Gpc-B1. Theor Appl Genet 2005, 112, 97-105. [CrossRef]
- Herrera-Foessel, S.A.; Singh, R.P.; Lillemo, M.; Huerta-Espino, J.; Bhavani, S.; Singh, S.; Lan, C.; Calvo-Salazar, V.; Lagudah, E.S. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat. Theor Appl Genet 2014, 127, 781-789. [CrossRef]



| Stripe Rust Response | Infection Type | No of lines | χ² | (1:2:1) or (1:1) |
|---|---|---|---|---|
| Observed | Expected | |||
| F3 AUS27507/AUS27229 | ||||
| Homozygous Resistant | 23C to 3C | 24 | 24.8 | 0.00 |
| Segregating | 23C-3C, 3+ | 58 | 49.5 | 1.50 |
| Homozygous Susceptible | 3+ | 17 | 24.8 | 2.40 |
| Total | 99 | 99.0 | 3.90 | |
| F3 AUS27894/AUS27229 | ||||
| Homozygous Resistant | 23C to 3C | 19 | 19.3 | 0.00 |
| Segregating | 23C-3C, 3+ | 44 | 38.5 | 0.80 |
| Homozygous Susceptible | 3+ | 14 | 19.3 | 1.40 |
| Total | 77 | 77.1 | 2.20 | |
| AUS27507/AUS27229 RIL populations | ||||
| Homozygous Resistant | 53 | 51.0 | 0.08 | |
| Homozygous Susceptible | 49 | 51.0 | 0.08 | |
| Total | 102 | 102.0 | 0.16 |
| STS Markers | DArT- Markers | Forward a | Reverse |
|---|---|---|---|
| sun481 | wPt-665550 | GGCCAAGGTATGTTGATCGT | TCCAAATGAAACCAGGAAGG |
| sun482 | wPt-7161 | GCTCCTCTCGTTGATTGAG | GATGCAAAGGGAGAAAGCTG |
| sun483 | wPt-2397 | CAGTAGCATCCAACCCACT | GGGACGGATGATGAGACAGA |
| SNPs | Allele 1 a | Allele 2 b | Common Primer |
|---|---|---|---|
| IWB49793 | CCATGTTCAAGGGTCTCAATTA | CCATGTTCAAGGGTCTCAATTC | TCGCCTGATATATTCACAACCTTT |
| IWB56941 | AGGAGGAATGGAAGTTTGATACT | AGGAGGAATGGAAGTTTGATACG | TGCAGAAAATGACAGCCTGA |
| IWB20875 | AGAGTAGCATGCGAGTCTT | AGAGTAGCATGCGAGTCTC | CAAGCACTTTACAGGTTTCCG |
| IWB12294 | TCCTCCGGCATTCCTCT | TCCTCCGGCATTCCTCG | AGCGTGCTGTACTTCGCC |
| IWB69000 | TGTTCTAGCTAACCAGGCAA | CTGTTCTAGCTAACCAGGCAG | CGAGCCAGAGTCTGAGACCA |
| IWB45530 | GAAACCAGCCGCAGAGTAT | TGAAACCAGCCGCAGAGTAC | GCAGTCAAGTTTTGGAACTGG |
| IWB56941 | AAGGAGGAATGGAAGTTTGATACT | AAGGAGGAATGGAAGTTTGATACG | TGCAGAAAATGACAGCCTGA |
| IWB10417 | TTTTCTTGTAGGAGGCAAAGATTTCAA | TTCTTGTAGGAGGCAAAGATTTCAC | TGATAATGTAAGCAGGAGTGTGCAATGTA |
| Cultivar and RIL | sun481 (bp) | IWB12294 (G:T) |
|---|---|---|
| AUS27507 and HR RIL | 240 | G |
| AUS27229 and HS RIL | 100 | T |
| Calingiri | 100 | T |
| Carnamah | 250+120+100 | T |
| Derrimut | 120+100 | T |
| DiamondBird | 250+100 | T |
| EGA Bellaroi (durum) | 120+100 | T |
| EGA BonnieRock | 130+120+100 | T |
| EGA Gregory | 250+130+100 | T |
| EmuRock | 250+120+100 | T |
| Espada | 250+120 | T |
| Forest | 250+120+100 | T |
| Giles | 255+100 | T |
| Gladius | 250+120+100 | T |
| Hyperno (durum) | 250+100 | T |
| Magenta | 250+120+100 | T |
| Merlin | 250+120+100 | T |
| Orion | 250+120+100 | T |
| Scout | 120+100 | T |
| Spitfire | 250+120+100 | T |
| Sunvale | 255+250+100 | T |
| Ventura | 100 | T |
| Wyalkatchem | 250+100 | T |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).