Preprint
Article

This version is not peer-reviewed.

Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701

A peer-reviewed version of this preprint was published in:
Plants 2024, 13(16), 2197. https://doi.org/10.3390/plants13162197

Submitted:

03 July 2024

Posted:

04 July 2024

You are already at the latest version

Abstract
Puccinia graminis f. sp. tritici (Pgt), the causal agent of wheat stem rust, poses a significant threat to global wheat production. Genetic resistance offers a cost-effective and sustainable solution. The durum wheat landrace PI 94701 was previously hypothesized to carry two stem rust resistance (Sr) genes, but their chromosomal locations were unknown. In this study, we mapped and characterized an all-stage Sr gene in PI 94701, temporarily designated as SrPI94701. In seedling tests, SrPI94701 was effective against all six Pgt races tested. Using a large segregating population (2,302 gametes), we mapped SrPI94701 within a 0.17-cM region flanked by markers pku69124 and pku69228, corresponding to 1.04- and 2.15-Mb genomic regions in the Svevo and Chinese Spring reference genomes. Within the candidate region, eight genes exhibited differential expression between the Pgt-inoculated resistant and susceptible plants. Among them, two NLR genes, TraesCS5B03G1334700 and TraesCS5B03G1335100, showed high polymorphism between parental lines, with upregulation observed in the resistant F4 line compared to its susceptible sister line. However, the flanking and completely linked markers developed in this study could not accurately predict the presence of SrPI94701 in uncharacterized wheat genotypes. SrPI94701 holds promise as a valuable component in breeding programs aimed at enhancing resistance against Pgt.
Keywords: 
;  ;  ;  ;  ;  

1. Introduction

Wheat stem rust, a damaging fungal disease caused by Puccinia graminis f. sp. tritici (Pgt), has historically caused significant yield losses in wheat worldwide. In China, wheat stem rust currently occurs sporadically under natural conditions [1]. Historically, it has been a major problem in wheat production across Africa, Asia, Australia, Europe, and the Americas [2]. Losses are often severe, ranging from 50% to 90%, particularly when there is substantial disease pressure during grain filling. In some instances, individual fields can be destroyed in regions conducive to disease development, making it impossible to grow susceptible cultivars [3,4]. Growing resistant wheat cultivars stands as the most cost-effective and environmentally sustainable method for controlling this disease [5].
Highly virulent races of Pgt have emerged, overcoming numerous widely deployed resistance genes present in elite wheat cultivars globally. In 1998, a Pgt race TTKSK (also known as Ug99) was identified in Uganda, exhibiting virulence against the widely deployed Sr genes, Sr31 and Sr38 (Pretorius et al., 2000). Subsequent to the deployment of Sr24 in Kenya [6], further selection for virulence resulted in the identification of races TTKST, TTTSK (Sr36 virulence) [7], and more recently TTKTT and TTKTK (SrTmp virulence) [8]. To date, a total of 15 variants within the Ug99 race group have been documented across at least 13 countries, highlighting the adaptability and widespread dissemination of Pgt [9,10]. Recently, Ug99 has been detected in Nepal [11].
In addition to the Ug99 lineage, several other highly virulent Pgt races have also been identified in stem rust outbreaks, including JRCQC, TKTTF, and TRTTF. The non-Ug99 race JRCQC was identified in Ethiopia [12]. This race exhibits combined virulence against Sr9e and Sr13b, which are commonly deployed in durum wheat [12,13]. Race TKTTF caused severe stem rust epidemics in Ethiopia during 2013-2014, affecting the widely grown Ug99-resistant wheat cultivar “Digalu” [14]. Subsequently, TKTTF was detected in at least ten countries [15,16]. Race TRTTF was observed in various countries, including Iran, Yemen, Ethiopia, and Pakistan [17,18]. This race defeated the resistance conferred by Sr genes Sr36, SrTmp, and Sr1RSAmigo, which are effective against the original Ug99 race TTKSK [12]. This continual evolution of the pathogen highlights the ongoing necessity to explore new effective Pgt resistance genes for wheat breeding programs.
To date, more than 60 stem rust resistance genes have been formally catalogued in bread and durum wheats as well as their wild relatives [19,20]. Among these, tetraploid wheat (Triticum turgidum ssp.) has contributed multiple Sr genes (or alleles), such as Sr2, Sr9d/Sr9e/Sr9g, Sr11, Sr12, Sr13a/Sr13b/Sr13c/Sr13d, Sr14, and Sr17 [4,13,21,22,23]. All of these genes from tetraploid wheat are all-stage resistance (ASR) genes, with the exception of Sr2, which is an adult plant resistance (APR) gene [24]. ASR genes typically confer high levels of resistance throughout all plant growth and developmental stages, but they are often specific to pathogen races. In contrast, APR genes tend to provide only partial resistance later in plant development, and a single APR gene is often inadequate for achieving satisfactory levels of plant protection [25]. Due to the large and complex nature of the polyploid wheat genome, only two ASR Sr genes (Sr9 and Sr13) have been successfully cloned so far in durum wheat [13,23].
The durum wheat landrace PI 94701, collected in Palestine, was previously postulated to carry two temporarily designated Sr genes (Srdp1 and Srdp2) based on the observed segregation of resistance against Pgt race 11-SS2 [26]. Plants carrying only Srdp1 displayed resistant infection types (ITs = 0;1+), and plants carrying only Srdp2 showed moderate resistance (ITs = 1+2-) [26]. Initially, Srdp2 was proposed to be allelic to Sr13, a gene located on chromosome arm 6AL. However, subsequent studies revealed that Srdp2 is distinct from Sr13 based on pathogenic variability investigations and sequencing of polymerase chain reaction (PCR) products of diagnostic markers for Sr13 [13]. Despite these finding, the chromosomal locations of Srdp1 and Srdp2 remained unknown. The primary objectives of the present study were to: (1) assess whether PI 94701 confers resistance to Chinese Pgt races; (2) genetically map the stem rust resistance genes present in PI 94701; and (3) identify the corresponding regions within sequenced wheat genomes and predict potential candidate genes.

2. Results

2.1. Characterization of Stem Rust Resistance in Durum Wheat Accession PI 94701

Durum wheat accessions PI 94701 and Rusty were challenged with six Pgt races, comprising five from China and one from North American (Table S1). PI 94701 displayed high resistance [infection types (ITs) = 1 or 1+] to all tested Pgt races, whereas Rusty exhibited susceptible infection types ranging from 3+ to 4 (Figure 1). The F1 plants resulting from the cross between PI 94701 and Rusty exhibited resistance against Pgt race 34MKGQM. A subset of 143 F2 plants derived from this cross was evaluated for their reactions to Pgt race 34MKGQM. Within this subset, 105 plants showed resistance (ITs =1 to 2-), while 38 plants were susceptible (ITs =3 to 4). Chi-squared analysis of the phenotyping data revealed a segregation ratio of 3:1 consistent with a single dominant gene (χ2 = 0.19, P = 0.66), which is henceforth referred to as SrPI94701. Among the 143 F2:3 families evaluated, 32 were homozygous resistant, 73 were segregating, and 38 were homozygous susceptible. This distribution matched the expected 1:2:1 segregation ratio (χ2 = 0.57, P = 0.75).
Based on their resistance or susceptibility to Pgt race 34MKGQM, ten homozygous resistant and ten homozygous susceptible F2:3 families were selected from the PI 94701 × Rusty cross. These families were further tested against five additional Pgt races: BCCBC, 34MTGSM, 21C3CTTTM, 34C3RTGQM, and 34C3RKGQM, and were grown in five separate growth chambers. The ten families exhibiting resistance to 34MKGQM also demonstrated robust resistance to other Pgt races, while the ten 34MKGQM-susceptible families showed consistent susceptibility (Figure S1). These results suggest that the resistance of PI 94701 to races BCCBC, 34MTGSM, 21C3CTTTM, 34C3RTGQM, and 34C3RKGQM is linked to the SrPI94701 genomic region.

2.2. Genetic mapping of SrPI94701 on Chromosome Arm 5BL

For the initial mapping, Bulked segregant RNA-Seq (BSR-seq) was performed on the F2:3 mapping population evaluated with Pgt race 34MKGQM, revealing 32,708 single nucleotide polymorphisms (SNPs) between PI 94701 and Rusty. Based on SNP index analysis, 160 SNPs within the genomic region spanning from 673.5 to 699.9 Mb (Svevo Rel.1.0) on the long arm of chromosome 5B exhibited significant association with the phenotype (Figure 2, Table S2). This result indicates that SrPI94701 was located on chromosome arm 5BL.
To verify the mapping location, we specifically selected SNPs surrounding the region of interest on chromosome arm 5BL and developed 14 5B-genome specific Cleaved Amplified Polymorphic Sequence (CAPS) markers (Table 1). Subsequently, these markers were used to genotype the 143 F2:3 families, resulting in the construction of a genetic linkage map for SrPI94701 (Figure 3A,B). Based on the linkage results, SrPI94701 was found to be completely linked to marker pku69187, and mapped within a 1.4 cM interval flanked by markers pku69119 and pku69231 (Figure 3B).
To precisely determine the position of SrPI94701, an additional 1008 F4 plants from six selected segregating F3 families were screened for recombinants between markers pku69119 and pku69231. This screening identified ten plants carrying recombination events between these two markers. Using these ten recombinants detected in this screening and one previously identified recombinant in 143 F3 families, the genetic distance between markers pku69119 and pku69231 was recalculated to be 0.48 cM (Figure 3C). We evaluated the progeny of these plants carrying informative recombination events with Pgt race 34MKGQM. Using these recombinants and four new PCR markers developed within this genomic region (Table 1), SrPI94701 was further mapped to a 0.17-cM interval flanked by CAPS markers pku69124 and pku69228, and was completely linked to markers pku69187, pku69211, and pku69227 (Figure 3C). PCR amplifications with six CAPS markers are showcased in Figure 4.

2.3. Candidate Genes for SrPI94701 within Tetraploid and Hexaploid Wheat Genomes

The 0.17-cM candidate region delimited by PCR markers pku69124 and pku69228 spans a 1.04-Mb genomic region in the T. durum reference genome of Svevo (691.24 – 692.28 Mb, Figure 3D) and a 2.15-Mb genomic region in the T. aestivum reference genome of Chinese Spring (CS; 702.56 – 704.71 Mb). These candidate regions contain 65 annotated genes in Svevo (TRITD5Bv1G248710TRITD5Bv1G249360; Table S3) and 28 high-confidence genes in CS (TraesCS5B03G1334300TraesCS5B03G1340200; Table S4). These annotated genes include one typical NBS-LRR (NLR) genes in Svevo and seven in CS, which is particularly noteworthy for this study since NLRs are the predominant gene class association with disease resistance in plants [23,27,28,29]. In addition to these NLR genes, we identified one protein kinase in Svevo and six in CS (Tables S3, S4) as potential candidates due to their known roles in disease resistance across various plant species [30,31,32,33,34].
Subsequently, we analyzed the transcript levels of the candidate genes using published RNAseq studies compiled in the wheat expVIP database (http://www.wheat-expression.com/). Of the 28 high-confidence genes annotated in the candidate gene region in the CS genome, only 16 high-confidence genes were found to be expressed in wheat leaves (Table S4).

2.4. Identification of Differentially Expressed Genes (DEGs) within the SrPI94701 Mapping Interval

Transcript levels of the candidate genes were analyzed using RNA-seq data from the F4 sister lines S73 and R32, selected from the PI 94701 × Rusty cross. Given the identification of numerous NLR and kinase genes in the colinear regions of CS (Table S4), we focused on analyzing the 28 annotated genes within the candidate interval in CS. Among these candidate genes, eight exhibited differential expression between the Pgt-inoculated resistant and susceptible plants (Figure 5). Seven DEGs showed significant upregulation in R32 plants compared to S73 plants, whereas only one DEG displayed downregulation (Table S5). These upregulated DEGs included four NLR genes: TraesCS5B03G1334700, TraesCS5B03G1335000, TraesCS5B03G1335100, and TraesCS5B03G1335600, making them strong candidate genes.
We used whole-genome resequencing reads from PI 94701 and Rusty to assemble genomic contigs containing the identified NLR DEGs. Upon comparison of these contigs between PI 94701 and Rusty, we observed that these NLRs were either absent in Rusty or partially deleted (Figure S2). Among them, we excluded TraesCS5B03G1335000 and TraesCS5B03G1335600 as candidate genes due to the identical nature (100% match) of their coding and promoter regions between PI 94701 and CS. However, CS exhibited susceptibility to Pgt races 34MTGSM, 34C3RTGQM, 21C3CTTTM, 34MKGQM, and 34C3RKGQM at the seedling stage, suggesting the absence of SrPI94701.
To validate the RNA-seq findings, we measured the expression levels of the candidate genes TraesCS5B03G1334700 and TraesCS5B03G1335100 relative to ACTIN using quantitative real-time PCR (qRT-PCR). The results confirmed a significant upregulation (P < 0.05) of these candidate genes between the two groups (Figure S3), supporting the conclusions from the RNA-seq analysis.

2.5. Validation of SrPI94701-Linked Markers in Uncharacterized Wheat Accessions

To assess the significance of the haplotype defined by the two flanking and three completely linked markers (Figure 3C and Figure 4), we used these markers to evaluate 53 T. dicoccon and 51 T. aestivum accessions. Among the 53 T. dicoccon genotypes, 29 accessions (54.7%) exhibited an identical haplotype to the resistant parent PI 94701 (Table S6). Nevertheless, certain accessions with the SrPI94701 haplotype, like PI 273980 and PI 197489, were susceptible to Pgt race 34MKGQM (Table S6), indicating that these markers could not accurately predict the presence of SrPI94701 in uncharacterized T. dicoccon genotypes.
Among the 51 tested hexaploid wheat accessions, the SrPI94701 haplotype was detected in 8 accessions (15.7%; Table S6). Similarly, two accessions carrying the SrPI94701 haplotype (Huaimai40 and Luyuan502) showed susceptibility to Pgt race 34MKGQM, suggesting that these markers were ineffective in predicting the presence of SrPI94701 in hexaploid wheat.

3. Discussion

Initially, the durum wheat landrace PI 94701 was reported to carry a single Sr gene conferring resistance to Pgt race 15B [35]. Later, PI 94701 was proposed to carry two provisionally designated Sr genes (Srdp1 and Srdp2) based on the segregation of resistance against Pgt race 11-SS2 [26]. However, the precise chromosomal locations of Srdp1 and Srdp2 remained unknown. In this study, using Chinese Pgt races, we successfully mapped a stem rust resistance gene SrPI94701 within a 0.17 cM region on the long arm of chromosome 5B. However, the lack of chromosomal locations and genetic maps for Srdp1 and Srdp2 has limited our ability to establish the mapping relationship between SrPI94701 and Srdp1/Srdp2.
The clustering of NLR genes promotes the generation of new variants through duplication, recombination, and conversion events, enhancing NLR genes diversity [13,36]. Using the reference genomes of tetraploid and hexaploid wheat, we defined the SrPI94701 candidate region to a 1.04-Mb region in T. durum wheat Svevo and a 2.15-Mb region in hexaploid wheat CS, which includes a cluster of typical NLR genes. However, NLR genes identified within the colinear regions of Svevo and CS reference genomes display copy number variations (Tables S3 and S4). Similar to the SrPI94701 candidate region, reports of copy number and structural variations of NLR genes have been documented for previously isolated disease resistance genes in wheat and its wild relatives [13,23,28,36,37]. Considering that many cloned R genes in plants encode intracellular NLR proteins [27,29], these NLR genes within the mapped region are strong candidates for SrPI94701.
In addition to the NLR genes, several protein kinases were also identified in the SrPI94701 mapping region (Tables S3 and S4). This gene family frequently linked to disease resistance in various plant species [38,39]. Six cloned rust resistance genes, Sr60 [30], Sr62 [40], Sr43 [41], Yr36 [31], Yr15 [34], and Lr9/Lr58 [42], encode proteins with kinase domains. These NLRs and protein kinases have been prioritized for functional characterization to explore their potential as the causal gene for SrPI94701. However, we cannot rule out the possibility of additional NLRs or protein kinases present in PI 94701 that are absent in the reference genomes.
The wheat stem rust resistance genes, Sr49 and Sr56, were previously mapped close to SrPI94701 on the long arm of chromosome 5B [43,44]. Sr56, known for conferring adult plant resistance, was mapped in a Swiss winter wheat cultivar Arina and demonstrated a 12-15% reduction in stem rust severity under field conditions [44]. Sr56 was flanked by SSR markers sun209 and sun215 [44], corresponding to a genomic region ranging from 705196548 bp to 705764022 bp in the CS RefSeq v2.1 reference genome. These results suggest that SrPI94701 is distinct from the Sr56 gene. The ASR gene Sr49 was mapped in the hexaploid wheat landrace AUS28011 and showed effectiveness against all commercially important Australian Pgt races that were examined, displaying mesothetic resistant (ITs = 2-) infection types [43]. The location of Sr49 was delimited by SSR markers sun479 and sun209, spanning a genetic region from 702174220 bp to 705196462 bp (CS RefSeq v2.1) which includes our candidate gene region (702.56 – 704.71 Mb, Table S4). However, there are three differences between SrPI94701 and Sr49. First, SrPI94701 was discovered in durum (tetraploid) wheat, while Sr49 was identified in hexaploid wheat. Second, wheat plants carrying SrPI94701 (ITs = 1 or 1+) showed better resistance compared to those with Sr49 (ITs = 2-). Third, AUS28011 (Sr49) and PI 94701 (SrPI94701) showed different haplotypes when genotyped with the flanking and completely linked markers of SrPI94701. Nonetheless, due to their co-location within overlapping genetic intervals, SrPI94701 and Sr49 may be the same gene.
Previously, a haplotype containing both flanking marker alleles sun479 and sun209 was not identified in the screening 152 Australian and Nordic wheat lines. Nevertheless, six wheat lines carried the Sr49-linked sun479200bp allele and seven harbored the Sr49-linked sun209148bp allele [43]. The Sr49 locus was also detected in a Genome-Wide Association Study (GWAS) involving a panel of 283 durum lines challenged with various East African stem rust isolates [45]. These two markers (sun479 and sun209) were detected with a minor allele frequency average of 0.053, indicating the rarity of Sr49 within this germplasm panel [45]. In this study, the genotypes of the flanking and completely linked markers of SrPI94701 revealed that 54.7% T. dicoccon and 15.7% T. aestivum accessions showed the SrPI94701-linked resistant haplotype. The notable differences in allele frequencies observed could be attributed to the diversity among the germplasm sources. Alternatively, it is possible that represent distinct genes, which explain the obvious differences in allele frequencies detected.
SrPI94701 confers resistance against multiple Pgt races in China, making it a potentially valuable genetic resource in wheat breeding. However, as SrPI94701 only provides intermediate levels of resistance when used alone, it needs to be combined with other Sr genes to provide economically useful levels of resistance. Some potentially valuable Sr genes that could enhance resistance include Sr35 [46], Sr13 [13], Sr22a/Sr22b [47,48], and Sr26 [49]. Despite this limitation, SrPI94701 can provide an additional layer of resistance against various Pgt races and contribute to diversifying the sources of resistance used in wheat breeding programs.

4. Materials and Methods

4.1. Plant Materials and Mapping Populations

The Pgt-resistant Triticum turgidum ssp. durum (2n = 4x =28, AABB) wheat accession PI 94701 was crossed with the highly susceptible durum wheat genotype Rusty [13,50]. For the initial mapping, we evaluated a population of 143 F2 plants derived from the PI 94701 × Rusty cross inoculated with Chinese Pgt race 34MKGQM (isolate 20IAL06). To construct a high-density genetic map, six F2 plants (plants 15R, 37R, 75R, 90R, 118R, and 126R) heterozygous for the SrPI94701 region, identified using flanking molecular markers, were selected. These plants generated a secondary population consisting of 1008 F3 individuals. These F3 plants were genotyped with SrPI94701 flanking markers to identify plants with recombination events within the candidate gene region. The recombinants and their corresponding F4 progeny (~25 plants per family) were challenged with Pgt race 34MKGQM. As a source of Sr49, we used the bread wheat landrace AUS28011 (Mahmoudi) from Tunisia, which exhibited good resistance to five Australian Pgt pathotypes [43]. Finally, we used a collection of 53 accessions of T. turgidum ssp. dicoccon and 51 accessions of T. aestivum to determine the value of the SrPI94701-linked markers developed in the present study for marker-assisted selection.

4.2. Evaluation for Stem Rust Resistance

Stem rust seedling assays for both the parental lines and the segregating populations were conducted at the Peking University Institute of Advanced Agricultural Sciences following previously described procedures [51,52]. Six Chinese and North American Pgt races, namely BCCBC, 34MTGSM, 34C3RTGQM, 21C3CTTTM, 34MKGQM, and 34C3RKGQM [53], were evaluated for virulence against parental lines PI 94701 and Rusty. The avirulence/virulence profiles of these Pgt races are detailed in Supplementary Table S1. Pgt urediniospores, stored at − 80 °C, were subjected to heat shock at 42 °C for 3 minutes. Subsequently, a urediniospore/talc suspension was applied to seedlings at the three-leaf stage using the shaking off method [54]. Following inoculation, the plants were kept in a dark dew chamber overnight and then transferred back to growth chamber conditions maintained at 22–24 °C with a 16-h photoperiod. Pgt infection types (ITs) were recorded 12-14 dpi using the Stakman 0–4 scale indicating levels of immunity to susceptibility [55]. For plants carrying recombination events within the candidate region, progeny tests were conducted using approximately 25 plants from each F2:3 family.

4.3. Bulked Segregant RNA-Seq (BSR-Seq) Analysis

Based on the phenotypic data, 15 homozygous resistant and 15 homozygous susceptible F3 families were selected to constitute the resistant bulk (R-bulk) and susceptible bulk (S-bulk) for RNA extraction. Total RNAs were extracted from the resistant parent PI 94701 and R/S-bulks using the SpectrumTM Plant Total RNA Kit (MilliporeSigma, MA, USA). RNA sequencing was conducted at Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) with 150-base paired-end reads. The raw sequencing data is available at the National Genomics Data Center (NGDC) under the BioProject accession number PRJCA027291. For the susceptible parent Rusty, we used the whole-genome resequencing data described in Wang et al. (2023a) under the BioProject accession number PRJCA017761.
Raw RNA-seq reads were trimmed to remove low-quality nucleotide sequences using Trimmomatic v 0.32 [56]. The trimmed reads were then aligned to the reference genome of the durum wheat cultivar Svevo [57] using STAR v2.5.0c [58]. SNPs were identified using the HaplotypeCaller tool from GATK v3.2-2 [59]. SNP-index and Δ(SNP-index) were calculated across the genome to identify potential regions of interest using the methods described previously [60,61,62].

4.4. Development of PCR Markers

To accelerate the development of PCR markers, we performed whole-genome resequencing for the resistant parent PI 94701 (accession number PRJCA027291). PCR primers were designed using the Primer3 software (https://bioinfo.ut.ee/primer3-0.4.0/primer3/). The identified SNPs within the mapping interval were used to develop CAPS markers [63]. Enzyme cleavage reactions of the CAPS markers were performed according to standard procedures for the corresponding restriction endonucleases (New England Biolabs, Hitchin, UK). PCR reactions were conducted using a Veriti 96-Well Fast Thermal Cycler (Thermo Fisher Scientific Inc., MA, USA). After the PCR amplification, 10 µl of PCR products were digested with the suitable restriction enzyme. Subsequently, 5 µL of digested PCR products were analyzed using agarose gel electrophoresis, and the gels were stained with ethidium bromide.

4.5. qRT-PCR Analysis

From the PI 94701 × Rusty population, a pair of F4 sister lines homozygous for the absence (S73) or presence (R32) of SrPI94701 were developed using PCR markers. The susceptibility/resistance responses for S73 and R32 against Pgt race 34MKGQM were evaluated. Leaves from S73 and R32 inoculated with race 34MKGQM were sampled at 6 dpi, with three biological replicates used for each genotype. RNA sequencing was conducted at Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). The raw sequencing data is available under the same BioProject accession number PRJCA027291. DEGs between the sister lines S73 and R32 were determined using the edgeR software, applying significance thresholds of FDR < 0.05, p-value < 0.05, and |log2foldchange| > 1 [64]. DEGs within the SrPI94701 candidate region were identified, and a heatmap was generated using the pheatmap R package (https://cran.ms.unimelb.edu.au/web/packages/pheatmap/pheatmap.pdf). qRT-PCR reactions were performed using an ABI QuantStudio 5 Real-Time PCR System (Applied Biosystems, CA, USA). Transcript levels were determined in four biological replicates and quantified as fold-ACTIN levels using the 2-ΔCT method [28,36].

4.6. Statistical Analyses

Genetic linkage maps were constructed using polymorphic markers and stem rust resistance scores of F2:3 families using the software MapChart v2.2 (https://www.wur.nl/en/show/Mapchart.htm) [65]. The significance of the differences in transcript levels was evaluated using a two-sided unpaired t-test.

5. Conclusions

In this study, we mapped and characterized SrPI94701, an all-stage stem rust resistance gene in durum wheat landrace PI 94701. The broad efficacy of SrPI94701 in China makes it a desirable target for introgression into Chinese bread wheat cultivars. In summary, the high-resolution genetic map of SrPI94701 and the closely linked PCR markers developed in this study will facilitate map-based cloning of this Sr gene and accelerate its incorporation into modern wheat breeding programs.

Supplementary Materials

The following supporting information can be downloaded at the website of this paper posted on Preprints.org, Figure S1: Infection types to Pgt races BCCBC, 34MTGSM, 21C3CTTTM, 34C3RTGQM, and 34C3RKGQM in F2:3 families selected from the PI 94701 × Rusty cross; Figure S2: Comparison of the whole-genome resequencing reads from Rusty and PI 94701 for the candidate genes using the alignment algorithm BWA-MEM; Figure S3: Transcript levels of the candidate genes TraesCS5B03G1334700 and TraesCS5B03G1335100 in F4 sister lines S73 and R32; Table S1: Avirulence / virulence formulae of the Puccinia graminis f. sp. tritici races used in this study; Table S2: SNPs linked with SrPI94701 and their locations in the Svevo Rel.1.0; Table S3: Predicted genes within the SrPI94701 candidate region based on the genomic sequence of Svevo Rel.1.0; Table S4: Predicted genes in the SrPI94701 candidate region based on the genomic sequence of Chinese Spring (RefSeq v2.1); Table S5: Differentially expressed genes (DEGs) in the SrPI94701 candidate region; Table S6: Genotyping results for markers pku69124, pku69187, pku69211, pku69227, and pku69228.

Author Contributions

Conceptualization, S.C. and H.Y.; methodology, S.C.; software, Hna.L. and S.C.; validation, K.L., Hna.L. and S.C.; formal analysis, S.C. and Hna.L.; investigation, Hyu.L., K.L. and Hna.L.; resources, M.A. and S.C.; data curation, Hyu.L., K.L., Hna.L., C.Y., G.P., G.W., S.L., H.L., S.R., and Y.Z.; writing—original draft preparation, Hyu.L. and Hna.L.; writing—review and editing, S.C.; visualization, S.C.; supervision, S.C. and H.Y.; project administration, S.C.; funding acquisition, S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Provincial Natural Science Foundation of Shandong (ZR2021MC056), the Key R&D Program of Shandong Province (ZR202211070163 and 2023LZGC022), the National Key Research and Development Program of China (2022YFD1201300), and the Young Taishan Scholars Program of Shandong Province.

Data Availability Statement

The raw sequencing data reported in this study are archived at the National Genomics Data Center under BioProject accession number PRJCA027291. Data supporting the findings of this study are within the manuscript or the supplementary file.

Acknowledgments

The authors thank Dr. Tianya Li (Shenyang Agricultural University, Shenyang, China) for providing Pgt races.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cao, Y.; Yao, P.; Wu, Y.; Bi, Y.; Yang, J. Discovery and verification of an important inoculum source for Puccinia graminis f. sp. tritici in China. Plant Protection 2001, 28, 294–298. [Google Scholar]
  2. Saari, E.E.; Prescott, J. World distribution in relation to economic losses. In Diseases, distribution, epidemiology, and control; Elsevier: 1985, pp. 259-298.
  3. Amulaka, F.; Maling’a, J.; Pathak, R.; Cakir, M.; Mulwa, R. Yield evaluation of a wheat line with combined resistance to Russian wheat aphid and stem rust race “Ug99” in Kenya. American Journal of Plant Sciences 2013, 4, 1494–1499. [Google Scholar] [CrossRef]
  4. Singh, R.P.; Hodson, D.P.; Huerta-Espino, J.; Jin, Y.; Bhavani, S.; Njau, P.; Herrera-Foessel, S.; Singh, P.K.; Singh, S.; Govindan, V. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu Rev Phytopathol 2011, 49, 465–481. [Google Scholar] [CrossRef] [PubMed]
  5. Singh, R.P.; Hodson, D.P.; Jin, Y.; Lagudah, E.S.; Ayliffe, M.A.; Bhavani, S.; Rouse, M.N.; Pretorius, Z.A.; Szabo, L.J.; Huerta-Espino, J.; et al. Emergence and spread of new races of wheat stem rust fungus: continued threat to food security and prospects of genetic control. Phytopathology 2015, 105, 872–884. [Google Scholar] [CrossRef] [PubMed]
  6. Jin, Y.; Szabo, L.J.; Pretorius, Z.A.; Singh, R.P.; Ward, R.; Fetch, T. Detection of virulence to resistance gene Sr24 within race TTKS of Puccinia graminis f. sp tritici. Plant Dis 2008, 92, 923–926. [Google Scholar] [CrossRef] [PubMed]
  7. Jin, Y.; Szabo, L.J.; Rouse, M.N.; Fetch, T.; Pretorius, Z.A.; Wanyera, R.; Njau, P. Detection of virulence to resistance gene Sr36 within the TTKS race lineage of Puccinia graminis f. sp tritici. Plant Dis 2009, 93, 367–370. [Google Scholar] [CrossRef] [PubMed]
  8. Newcomb, M.; Rouse, O.M.N.; Rouse, M.N.; Szabo, L.J.; Johnson, J.; Gale, S.; Luster, D.G.; Wanyera, R.; Macharia, G.; Bhavani, S.; et al. Kenyan Isolates of Puccinia graminis f. sp tritici from 2008 to 2014: Virulence to SrTmp in the Ug99 race group and implications for breeding programs. Phytopathology 2016, 106, 729–736. [Google Scholar] [CrossRef] [PubMed]
  9. Patpour, M.; Hovmøller, M.; Shahin, A.; Newcomb, M.; Olivera, P.; Jin, Y.; Luster, D.; Hodson, D.; Nazari, K.; Azab, M. First report of the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Egypt in 2014. Plant Dis 2016, 100, 863–863. [Google Scholar]
  10. Terefe, T.G.; Boshoff, W.H.; Park, R.F.; Pretorius, Z.A.; Visser, B. Wheat stem rust surveillance reveals two new races of Puccinia graminis f. sp. tritici in South Africa during 2016 to 2020. Plant Dis 2024, 108, 20–29. [Google Scholar]
  11. Patpour, M.; Justesen, A.F.; Hovmøller, M.S.; Baidya, S.; Thapa, D.; Basnet, R. First report of Ug99 wheat stem rust (Puccinia graminis f. sp. tritici) in South Asia. Plant Dis 2024. [CrossRef]
  12. Olivera, P.; Jin, Y.; Rouse, M.; Badebo, A.; Fetch Jr, T.; Singh, R.; Yahyaoui, A. Races of Puccinia graminis f. sp. tritici with combined virulence to Sr13 and Sr9e in a field stem rust screening nursery in Ethiopia. Plant Dis 2012, 96, 623–628. [Google Scholar] [CrossRef]
  13. Zhang, W.; Chen, S.; Abate, Z.; Nirmala, J.; Rouse, M.N.; Dubcovsky, J. Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group. Proc Natl Acad Sci USA 2017, 114, E9483–9492. [Google Scholar] [CrossRef] [PubMed]
  14. Olivera, P.; Newcomb, M.; Szabo, L.J.; Rouse, M.; Johnson, J.; Gale, S.; Luster, D.G.; Hodson, D.; Cox, J.A.; Burgin, L. Phenotypic and genotypic characterization of race TKTTF of Puccinia graminis f. sp. tritici that caused a wheat stem rust epidemic in southern Ethiopia in 2013–14. Phytopathology 2015, 105, 917–928. [Google Scholar] [CrossRef] [PubMed]
  15. Lewis, C.M.; Persoons, A.; Bebber, D.P.; Kigathi, R.N.; Maintz, J.; Findlay, K.; Bueno-Sancho, V.; Corredor-Moreno, P.; Harrington, S.A.; Kangara, N. Potential for re-emergence of wheat stem rust in the United Kingdom. Commun Biol 2018, 1, 13. [Google Scholar] [CrossRef] [PubMed]
  16. Patpour, M.; Hovmoller, M.; Hansen, J.; Justesen, A.; Thach, T.; Rodriguez-Algaba, J.; Hodson, D.; Randazo, B. Epidemics of yellow rust and stem rust in Southern Italy 2016-2017. In Proceedings of the BGRI 2018 Technical Workshop, 2017; pp. https://www.globalrust.org/content/epidemics-yellow-and-stem-rust-southern-italy-2016-2017.
  17. Fetch, T.; Zegeye, T.; Park, R.; Hodson, D.; Wanyera, R. Detection of wheat stem rust races TTHSK and PTKTK in the Ug99 race group in Kenya in 2014. Plant Dis 2016, 100, 1495–1495. [Google Scholar] [CrossRef]
  18. Li, H.; Luo, J.; Zhang, W.; Hua, L.; Li, K.; Wang, J.; Xu, B.; Yang, C.; Wang, G.; Rouse, M.N. High-resolution mapping of SrTm4, a recessive resistance gene to wheat stem rust. Theor Appl Genet 2023, 136, 120. [Google Scholar] [CrossRef]
  19. Sharma, J.S.; Che, M.; Fetch, T.; McCallum, B.D.; Xu, S.S.; Hiebert, C.W. Identification of Sr67, a new gene for stem rust resistance in KU168-2 located close to the Sr13 locus in wheat. Theor Appl Genet 2024, 137, 30. [Google Scholar] [CrossRef]
  20. Chen, S.; Guo, Y.; Briggs, J.; Dubach, F.; Chao, S.; Zhang, W.; Rouse, M.N.; Dubcovsky, J. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum. Theor Appl Genet 2018, 131, 625–635. [Google Scholar] [CrossRef]
  21. Nirmala, J.; Saini, J.; Newcomb, M.; Olivera, P.; Gale, S.; Klindworth, D.; Elias, E.; Talbert, L.; Chao, S.; Faris, J. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates. G3-Genes Genom Genet 2017, 7, 3481–3490. [Google Scholar] [CrossRef]
  22. Gill, B.K.; Klindworth, D.L.; Rouse, M.N.; Zhang, J.; Zhang, Q.; Sharma, J.S.; Chu, C.; Long, Y.; Chao, S.; Olivera, P.D. Function and evolution of allelic variations of Sr13 conferring resistance to stem rust in tetraploid wheat (Triticum turgidum L.). Plant J 2021, 106, 1674–1691. [Google Scholar] [CrossRef]
  23. Zhang, J.; Nirmala, J.; Chen, S.; Jost, M.; Steuernagel, B.; Karafiatova, M.; Hewitt, T.; Li, H.; Edae, E.; Sharma, K. Single amino acid change alters specificity of the multi-allelic wheat stem rust resistance locus SR9. Nat Commun 2023, 14, 7354. [Google Scholar] [CrossRef] [PubMed]
  24. Yu, L.-X.; Barbier, H.; Rouse, M.N.; Singh, S.; Singh, R.P.; Bhavani, S.; Huerta-Espino, J.; Sorrells, M.E. A consensus map for Ug99 stem rust resistance loci in wheat. Theor Appl Genet 2014, 127, 1561–1581. [Google Scholar] [CrossRef]
  25. Bariana, H.S.; Hayden, M.J.; Ahmed, N.; Bell, J.; Sharp, P.; McIntosh, R. Mapping of durable adult plant and seedling resistances to stripe rust and stem rust diseases in wheat. Aust J Aer Res 2001, 52, 1247–1255. [Google Scholar] [CrossRef]
  26. Rondon, M.; Gough, F.; Williams, N.D. Inheritance of stem rust resistance in Triticum aestivum ssp. vulgare ‘Reliance’and PI 94701 of Triticum durum 1. Crop Sci 1966, 6, 177–179. [Google Scholar]
  27. Ellis, J.; Dodds, P.; Pryor, T. Structure, function and evolution of plant disease resistance genes. Curr Opin Plant Biol 2000, 3, 278–284. [Google Scholar] [CrossRef] [PubMed]
  28. Li, H.; Hua, L.; Zhao, S.; Hao, M.; Song, R.; Pang, S.; Liu, Y.; Chen, H.; Zhang, W.; Shen, T.; et al. Cloning of the wheat leaf rust resistance gene Lr47 introgressed from Aegilops speltoides. Nat Commun 2023, 14, 6072. [Google Scholar] [CrossRef] [PubMed]
  29. Marone, D.; Russo, M.A.; Laidò, G.; De Leonardis, A.M.; Mastrangelo, A.M. Plant nucleotide binding site-leucine-rich repeat (NBS-LRR) genes: active guardians in host defense responses. Int J Mol Sci 2013, 14, 7302–7326. [Google Scholar] [CrossRef] [PubMed]
  30. Chen, S.; Rouse, M.N.; Zhang, W.; Zhang, X.; Guo, Y.; Briggs, J.; Dubcovsky, J. Wheat gene Sr60 encodes a protein with two putative kinase domains that confers resistance to stem rust. New Phytol 2020, 225, 948–959. [Google Scholar] [CrossRef] [PubMed]
  31. Fu, D.; Uauy, C.; Distelfeld, A.; Blechl, A.; Epstein, L.; Chen, X.; Sela, H.; Fahima, T.; Dubcovsky, J. A kinase-START gene confers temperature-dependent resistance to wheat stripe rust. Science 2009, 323, 1357–1360. [Google Scholar] [CrossRef]
  32. Martin, G.B.; Brommonschenkel, S.H.; Chunwongse, J.; Frary, A.; Ganal, M.W.; Spivey, R.; Wu, T.; Earle, E.D.; Tanksley, S.D. Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 1993, 262, 1432–1436. [Google Scholar] [CrossRef]
  33. Hurni, S.; Scheuermann, D.; Krattinger, S.G.; Kessel, B.; Wicker, T.; Herren, G.; Fitze, M.N.; Breen, J.; Presterl, T.; Ouzunova, M.; et al. The maize disease resistance gene Htn1 against northern corn leaf blight encodes a wall-associated receptor-like kinase. Proc Natl Acad Sci USA 2015, 112, 8780–8785. [Google Scholar] [CrossRef]
  34. Klymiuk, V.; Yaniv, E.; Huang, L.; Raats, D.; Fatiukha, A.; Chen, S.; Feng, L.; Frenkel, Z.; Krugman, T.; Lidzbarsky, G. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat Commun 2018, 9, 3735. [Google Scholar] [CrossRef] [PubMed]
  35. Heermann, R.; Smith, G.; Briggle, L.; Schwilghamer, E. Inheritance of reaction to stem rust in certain durum and emmer wheats. In Proceedings of the Report of the Third International Wheat Rust Conference; 1956; pp. 82–83. [Google Scholar]
  36. Chen, S.; Zhang, W.; Bolus, S.; Rouse, M.N.; Dubcovsky, J. Identification and characterization of wheat stem rust resistance gene Sr21 effective against the Ug99 race group at high temperature. PLoS Genet 2018, 14, e1007287. [Google Scholar] [CrossRef] [PubMed]
  37. Li, H.; Hua, L.; Rouse, M.N.; Li, T.; Pang, S.; Bai, S.; Shen, T.; Luo, J.; Li, H.; Zhang, W. Mapping and characterization of a wheat stem rust resistance gene in durum wheat “Kronos”. Front Plant Sci 2021, 12, 751398. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, Y.; Hou, S.; Chen, S. Kinase fusion proteins: intracellular R-proteins in plant immunity. Trends Plant Sci 2023, 29, 278–282. [Google Scholar] [CrossRef] [PubMed]
  39. Brueggeman, R.; Rostoks, N.; Kudrna, D.; Kilian, A.; Han, F.; Chen, J.; Druka, A.; Steffenson, B.; Kleinhofs, A. The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases. Proc Natl Acad Sci USA 2002, 99, 9328–9333. [Google Scholar] [CrossRef]
  40. Yu, G.; Matny, O.; Champouret, N.; Steuernagel, B.; Moscou, M.J.; Hernández-Pinzón, I.; Green, P.; Hayta, S.; Smedley, M.; Harwood, W.; et al. Aegilops sharonensis genome-assisted identification of stem rust resistance gene Sr62. Nat Commun 2022, 13, 1607. [Google Scholar] [CrossRef] [PubMed]
  41. Yu, G.; Matny, O.; Gourdoupis, S.; Rayapuram, N.; Aljedaani, F.R.; Wang, Y.L.; Nürnberger, T.; Johnson, R.; Crean, E.E.; Saur, I.M.-L. The wheat stem rust resistance gene Sr43 encodes an unusual protein kinase. Nat Genet 2023, 55, 921–926. [Google Scholar] [CrossRef] [PubMed]
  42. Wang, Y.; Abrouk, M.; Gourdoupis, S.; Koo, D.-H.; Karafiátová, M.; Molnár, I.; Holušová, K.; Doležel, J.; Athiyannan, N.; Cavalet-Giorsa, E. An unusual tandem kinase fusion protein confers leaf rust resistance in wheat. Nat Genet 2023, 55, 914–920. [Google Scholar] [CrossRef]
  43. Bansal, U.K.; Muhammad, S.; Forrest, K.L.; Hayden, M.J.; Bariana, H.S. Mapping of a new stem rust resistance gene Sr49 in chromosome 5B of wheat. Theor Appl Genet 2015, 128, 2113–2119. [Google Scholar] [CrossRef]
  44. Bansal, U.; Bariana, H.; Wong, D.; Randhawa, M.; Wicker, T.; Hayden, M.; Keller, B. Molecular mapping of an adult plant stem rust resistance gene Sr56 in winter wheat cultivar Arina. Theor Appl Genet 2014, 127, 1441–1448. [Google Scholar] [CrossRef] [PubMed]
  45. Megerssa, S.H.; Ammar, K.; Acevedo, M.; Brown-Guedira, G.; Ward, B.; Degete, A.G.; Randhawa, M.S.; Sorrells, M.E. Multiple-race stem rust resistance loci identified in durum wheat using genome-wide association mapping. Front Plant Sci 2020, 11, 1934. [Google Scholar] [CrossRef]
  46. Saintenac, C.; Zhang, W.; Salcedo, A.; Rouse, M.N.; Trick, H.N.; Akhunov, E.; Dubcovsky, J. Identifcation of wheat gene Sr35 that confers resistance to Ug99 stem rust race group. Science 2013, 341, 783–786. [Google Scholar] [CrossRef]
  47. Luo, J.; Rouse, M.N.; Hua, L.; Li, H.; Li, B.; Li, T.; Zhang, W.; Gao, C.; Wang, Y.; Dubcovsky, J. Identification and characterization of Sr22b, a new allele of the wheat stem rust resistance gene Sr22 effective against the Ug99 race group. Plant Biotechnol J 2022, 20, 554–563. [Google Scholar] [CrossRef] [PubMed]
  48. Steuernagel, B.; Periyannan, S.K.; Hernández-Pinzón, I.; Witek, K.; Rouse, M.N.; Yu, G.; Hatta, A.; Ayliffe, M.; Bariana, H.; Jones, J.D.G.; et al. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture. Nature biotechnology 2016, 34, 652–655. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, J.; Hewitt, T.C.; Boshoff, W.H.; Dundas, I.; Upadhyaya, N.; Li, J.; Patpour, M.; Chandramohan, S.; Pretorius, Z.A.; Hovmøller, M. A recombined Sr26 and Sr61 disease resistance gene stack in wheat encodes unrelated NLR genes. Nat Commun 2021, 12, 3378. [Google Scholar] [CrossRef] [PubMed]
  50. Klindworth, D.; Miller, J.; Xu, S. Registration of Rusty durum wheat. Crop Sci 2006, 46, 1012–1014. [Google Scholar] [CrossRef]
  51. Chen, S.; Rouse, M.N.; Zhang, W.; Jin, Y.; Akhunov, E.; Wei, Y.; Dubcovsky, J. Fine mapping and characterization of Sr21, a temperature-sensitive diploid wheat resistance gene effective against the Puccinia graminis f. sp. tritici Ug99 race group. Theor Appl Genet 2015, 128, 645–656. [Google Scholar] [CrossRef]
  52. Rouse, M.; Jin, Y. Genetics of resistance to race TTKSK of Puccinia graminis f. sp. tritici in Triticum monococcum. Phytopathology 2011, 101, 1418–1423. [Google Scholar] [CrossRef]
  53. Wang, J.; Li, H.; Shen, T.; Lyu, S.; ur Rehman, S.; Li, H.; Wang, G.; Xu, B.; Wang, Q.; Hu, W.; et al. High-resolution genetic mapping and identification of candidate genes for the wheat stem rust resistance gene Sr8155B1. Crop J 2023, 11, 1852–1861. [Google Scholar] [CrossRef]
  54. Chen, S.; Hegarty, J.; Shen, T.; Hua, L.; Li, H.; Luo, J.; Li, H.; Bai, S.; Zhang, C.; Dubcovsky, J. Stripe rust resistance gene Yr34 (synonym Yr48) is located within a distal translocation of Triticum monococcum chromosome 5AmL into common wheat. Theor Appl Genet 2021, 134, 2197–2211. [Google Scholar] [CrossRef] [PubMed]
  55. Stakman, E.C.; Stewart, D.M.; Loegering, W.Q. Identification of physiologic races of Puccinia graminis var. tritici.; Washington DC, 1962.
  56. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics (Oxford, England) 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
  57. Maccaferri, M.; Harris, N.S.; Twardziok, S.O.; Pasam, R.K.; Gundlach, H.; Spannagl, M.; Ormanbekova, D.; Lux, T.; Prade, V.M.; Milner, S.G.; et al. Durum wheat genome highlights past domestication signatures and future improvement targets. Nat Genet 2019, 51, 885–895. [Google Scholar] [CrossRef] [PubMed]
  58. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: ultrafast universal RNA-seq aligner. Bioinformatics (Oxford, England) 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
  59. McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 2010, 20, 1297–1303. [Google Scholar] [CrossRef]
  60. Bai, S.; Wang, G.; Song, R.; Liu, Y.; Hua, L.; Yang, J.; Zhang, L.; ur Rehman, S.; Hao, X.; Hou, L.; et al. Mutations in wheat TaAPA2 gene result in pleiotropic effects on plant architecture. Sci China Life Sci 2024. [Google Scholar] [CrossRef] [PubMed]
  61. Sun, M.; Liu, Q.; Han, Y.; Liu, G.; Wu, J.; Qi, J.; Ni, F.; Bao, Y. PmSN15218: a potential new powdery mildew resistance gene on wheat chromosome 2AL. Front Plant Sci 2022, 13, 931778. [Google Scholar] [CrossRef]
  62. Takagi, H.; Abe, A.; Yoshida, K.; Kosugi, S.; Natsume, S.; Mitsuoka, C.; Uemura, A.; Utsushi, H.; Tamiru, M.; Takuno, S. QTL-seq: rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. Plant J 2013, 74, 174–183. [Google Scholar] [CrossRef] [PubMed]
  63. Konieczny, A.; Ausubel, F.M. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J 1993, 4, 403–410. [Google Scholar] [CrossRef] [PubMed]
  64. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics (Oxford, England) 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
  65. Voorrips, R. MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered 2002, 93, 77–78. [Google Scholar] [CrossRef]
Figure 1. Infection types of PI 94701 and Rusty in response to Pgt races. Six Pgt races, namely BCCBC, 34MTGSM, 34C3RTGQM, 21C3CTTTM, 34MKGQM, and 34C3RKGQM were used in this study and their avirulence/virulence profiles are detailed in Table S1. Plants were grown in a growth chamber at 22-24 °C with 16 h light/8 h dark. RP, resistant parent; SP, susceptible parent; R, resistant; S, susceptible.
Figure 1. Infection types of PI 94701 and Rusty in response to Pgt races. Six Pgt races, namely BCCBC, 34MTGSM, 34C3RTGQM, 21C3CTTTM, 34MKGQM, and 34C3RKGQM were used in this study and their avirulence/virulence profiles are detailed in Table S1. Plants were grown in a growth chamber at 22-24 °C with 16 h light/8 h dark. RP, resistant parent; SP, susceptible parent; R, resistant; S, susceptible.
Preprints 111169 g001
Figure 2. BSR-Seq analysis of SrPI94701. (A) Δ(SNP-index) were calculated for each SNP across all chromosomes. (B) Δ(SNP-index) were specifically calculated for each SNP on chromosome 5B. SNP-index plotting was conducted following a previously established protocol (Takagi et al. 2013). A total of 160 SNPs within the genomic region spanning from 673.5 to 699.9 Mb (Svevo Rel.1.0; Table S2) on chromosome arm 5BL showed significant association with the phenotype. The mapping region is highlighted by a red arrow.
Figure 2. BSR-Seq analysis of SrPI94701. (A) Δ(SNP-index) were calculated for each SNP across all chromosomes. (B) Δ(SNP-index) were specifically calculated for each SNP on chromosome 5B. SNP-index plotting was conducted following a previously established protocol (Takagi et al. 2013). A total of 160 SNPs within the genomic region spanning from 673.5 to 699.9 Mb (Svevo Rel.1.0; Table S2) on chromosome arm 5BL showed significant association with the phenotype. The mapping region is highlighted by a red arrow.
Preprints 111169 g002
Figure 3. Genetic maps for SrPI94701. (A) Genetic mapping of the resistance locus on chromosome arm 5BL by BSR-seq. The gray rectangle indicates the genomic region spanning from 673.5 to 699.9 Mb (Svevo Rel.1.0). (B) Genetic map for SrPI94701 based on 143 F2:3 families from the PI 94701 × Rusty cross and 14 PCR markers. The values to the left of the markers indicate the genetic distances in centimorgans (cM). (C) High-density map based on 1,151 F2 plants and seven molecular markers; The values to the left of the markers indicate the genetic distances in centimorgans (cM). (D) Colinear genomic region on chromosome 5B of Svevo (Rel.v1.0). The values to the left of the genes are physical locations in megabases (Mb).
Figure 3. Genetic maps for SrPI94701. (A) Genetic mapping of the resistance locus on chromosome arm 5BL by BSR-seq. The gray rectangle indicates the genomic region spanning from 673.5 to 699.9 Mb (Svevo Rel.1.0). (B) Genetic map for SrPI94701 based on 143 F2:3 families from the PI 94701 × Rusty cross and 14 PCR markers. The values to the left of the markers indicate the genetic distances in centimorgans (cM). (C) High-density map based on 1,151 F2 plants and seven molecular markers; The values to the left of the markers indicate the genetic distances in centimorgans (cM). (D) Colinear genomic region on chromosome 5B of Svevo (Rel.v1.0). The values to the left of the genes are physical locations in megabases (Mb).
Preprints 111169 g003
Figure 4. Genotypes of F2 plants derived from the PI 94701 × Rusty cross. F2 plants genotyped with (A) CAPS marker pku69124 (digested with SspI); (B) CAPS marker pku69187 (BbvCI); (C) CAPS marker pku69211 (HpyCH4IV); (D) CAPS marker pku69227 (PvuII); (E) CAPS marker pku69228 (Hpy188III); and (F) CAPS marker pku69231 (BtgI). RP, resistant parent PI 94701; SP, susceptible parent Rusty; A, band corresponds to the resistant allele; B, band corresponds to the susceptible allele; H, heterozygous; M, DNA ladder.
Figure 4. Genotypes of F2 plants derived from the PI 94701 × Rusty cross. F2 plants genotyped with (A) CAPS marker pku69124 (digested with SspI); (B) CAPS marker pku69187 (BbvCI); (C) CAPS marker pku69211 (HpyCH4IV); (D) CAPS marker pku69227 (PvuII); (E) CAPS marker pku69228 (Hpy188III); and (F) CAPS marker pku69231 (BtgI). RP, resistant parent PI 94701; SP, susceptible parent Rusty; A, band corresponds to the resistant allele; B, band corresponds to the susceptible allele; H, heterozygous; M, DNA ladder.
Preprints 111169 g004
Figure 5. A heat map illustrating the differentially expressed genes (DEGs) within the candidate region of SrPI94701. DEGs between homozygous resistant plants (R32-1, R32-2, and R32-1; R) and homozygous susceptible plants (S73-1, S73-2, and S73-3; S) were identified from RNA-seq analysis of Pgt-inoculated RNA samples from R32 and S73. Leaves from S73 and R32 inoculated with race 34MKGQM were sampled at 6 days post-inoculation (dpi). Each genotype was evaluated with three independent biological replicates.
Figure 5. A heat map illustrating the differentially expressed genes (DEGs) within the candidate region of SrPI94701. DEGs between homozygous resistant plants (R32-1, R32-2, and R32-1; R) and homozygous susceptible plants (S73-1, S73-2, and S73-3; S) were identified from RNA-seq analysis of Pgt-inoculated RNA samples from R32 and S73. Leaves from S73 and R32 inoculated with race 34MKGQM were sampled at 6 days post-inoculation (dpi). Each genotype was evaluated with three independent biological replicates.
Preprints 111169 g005
Table 1. Primers used in this study. Band sizes correspond to the PI 94701 allele without digestion. CAPS, Cleaved Amplified Polymorphic Sequence. Ann. T., annealing temperature.
Table 1. Primers used in this study. Band sizes correspond to the PI 94701 allele without digestion. CAPS, Cleaved Amplified Polymorphic Sequence. Ann. T., annealing temperature.
Markers Marker type Forward primer (5’-3’) Reverse primer (5’-3’) Enzyme Expected size (bp) Ann. T. (°C)
pku68299 CAPS GGTTTTAGTGCTGCACCTGGAC GGCTCTCAGTTCTCTTCTGCACC HphI 337 63
pku68425 CAPS ACAGACCCCCTTAAGCCTTTTTCTT AGGGGAGATGTGTGTTGCTTTGTGT BssHII 441 60
pku68823 CAPS ACTCCTACGGATCAAATTATCACCTT GCACGGACATCTTGCTAGTAAGAG ApoI 473 56
pku69013 CAPS CATAATCTTGACGATCCAGGGAC TATATGCAGGCTATTACTGCTGTGG HaeIII 609 58
pku69020 CAPS CCAGTTTTTATCGTCCAAATCTAGAG ATCCATAGGTAGCTGCACATGT HaeIII 511 54
pku69118 CAPS GTATGAAACCGCGAACACTTTACA CGGGTTTCCAAATTTTGTTCTTGAG XmnI 394 57
pku69119 CAPS GGAATTTCACATTTGTTCCCAATC CGGAGATCGTCAACATCTC HhaI 394 55
pku69124 CAPS TCTTTGTATTAAGAGTTTGCACAGCT GCAGATTTCACATACTCAACCATC SspI 376 57
pku69187 CAPS GCGCTGATGAAGATAATCTCAT CGGAGGGAGTACTAGATTATCATG BbvCI 526 57
pku69211 CAPS ATTTGTGTTCATCGATCAAAACAC TAGTAAGATAAACTCTTGCCTCCTTC HpyCH4IV 376 52
pku69227 CAPS GGCACCTTTAAAATAATACACGGA AATGAGTTTGTTGTACCAAGTGCAG PvuII 354 55
pku69228 CAPS CCTTCCCTACGGATATGTTTTTAGA AGAAGTTGGAAGGGTAGATCATCACC Hpy188III 386 55
pku69231 CAPS TGACACTTTCCACTCACTCCTAGG ATTTGGCACGTTGACCTTAACT BtgI 340 56
pku69264 CAPS AAATTCTATCAACACTTGAAGAGAA CCAACCAACTATCATTTAGAAGT BstUI 503 52
pku69384 CAPS ACTCCTTCACGCTTCTCGACA AAATTTCCTGGGTGAGCCATT BanI 496 56
pku69400 CAPS GGTGGTGGAGAACATGCATGC ATGGCGATGACCGTGCAAGG MspI 336 60
pku69560 CAPS CGTGGTCCGTTTCTCAGAAGA CGGGAACAGAAGACACACTATATTT BfuAI 350 56
pku69883 CAPS GTTCATGTTGTTGAGAAGCTAGAC CACCTTACAAACAAGTGGTCAAC BsmAI 600 55
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.