Submitted:
31 August 2023
Posted:
05 September 2023
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Results
2.1. Phenotypic evaluation of cultivars
2.2. Differential expression of candidate and defense genes in the CDRK cultivar inoculated with race 73 of C. lindemuthianum
2.3. Differential expression of candidate and defense genes in CDRK cultivar inoculated with P. griseola race 63-39
3. Discussion
4. Materials and Methods
4.1. Plant material and growth conditions
4.2. Pathogenesis assays
4.3. Total RNA extraction and cDNA synthesis
4.4. Target genes and primer design
4.5. Quantitative PCR (qPCR) and data analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Padder, B.A.; Sharma, P.N.; Awale, H.E.; Kelly, J.D. Colletotrichum lindemuthianum, the causal agent of bean anthracnose. J. Plant Pathol. 2017, 99, 317–330. [Google Scholar] [CrossRef]
- Crous, P.W.; Liebenberg, M.M.; Braun, U.; Johannes, Z.; Groenewald, J.Z. Re-evaluating the taxonomic status of Phaeoisariopsis griseola, the causal agent of angular leaf spot of bean. Stud. Mycol. 2006, 55, 163–173. [Google Scholar] [CrossRef] [PubMed]
- Miklas, P.N.; Kelly, J.D.; Beebe, S.E.; Blair, M.W. Common bean breeding for resistance against biotic and abiotic stresses: From classical to MAS breeding. Euphytica 2006, 147, 105–131. [Google Scholar] [CrossRef]
- Singh, S.P.; Schwartz, H.F. Breeding common bean for resistance to diseases: A review. Crop Sci. 2010, 50, 2199–2223. [Google Scholar] [CrossRef]
- Guzman, P. Characterization of variability in the fungus Phaeoisariopsis griseola suggests coevolution with the common bean (Phaseolus vulgaris). Phytopathology. 1995, 85, 600. [Google Scholar] [CrossRef]
- Pastor-Corrales, M.A. Jara, C.E. La evolución de Phaeoisariopsis griseola con el frijol común en América Latina. Fitop Colomb. 1995, 19, 15–24. [Google Scholar]
- Pastor-Corrales, M.A.; Jara, C.; Singh, S.P. Pathogenic variation in, sources of, and breeding for resistance to Phaeoisariopsis griseola causing angular leaf spot in common bean. Euphytica 1998, 103, 161–171. [Google Scholar] [CrossRef]
- Stenglein, S.A.; Balatti, P.A. Genetic diversity of Phaeoisariopsis griseola in Argentina as revealed by pathogenic and molecular markers. Physiol. Mol. Plant Pathol. 2006, 68, 158–167. [Google Scholar] [CrossRef]
- Gonçalves-Vidigal, M.C.; Cruz, A.S.; Garcia, A.; Kami, J.; Vidigal Filho, P.S.; Sousa, L.L.; McClean, P.; Gepts, P.; Pastor-Corrales, M.A. Linkage mapping of the Phg-1 and Co-14 genes for resistance to angular leaf spot and anthracnose in the common bean cultivar AND 277. Theor. Appl. Genet. 2011, 122, 893–903. [Google Scholar] [CrossRef]
- Zuiderveen, G.H.; Padder, B.A.; Kamfwa, K.; Song, Q.; Kelly, J.D. Genome-wide association study of anthracnose resistance in Andean beans (Phaseolus vulgaris). PLoS One 2016, 11, e0156391. [Google Scholar] [CrossRef]
- Chen, M.; Wu, J.; Wang, L.; Mantri, N.; Zhang, X.; Zhu, Z.; Wang, S. Mapping and genetic structure analysis of the anthracnose resistance locus Co-1HY in the common bean (Phaseolus vulgaris L.). PLoS One 2017, 12, e0169954. [Google Scholar] [CrossRef] [PubMed]
- Lima, L.R.L.; Gonçalves-Vidigal, M.C.; Vaz Bisneta, M.; Valentini, G.; Vidigal Filho, P.S.; Martins, V.S.R., Souza, T.L.P.O. Genetic fine-mapping of anthracnose disease-resistance allele Co-14 present in the Andean common bean cultivar AND 277. Crop Sci. 2023, 1–14. [CrossRef]
- Richard, M.M.S.; Pflieger, S.; Sevignac, M.; Thareau, V.; Blanchet, S.; Li, Y.; Jackson, S.A.; Jackson, S.A.; Geffroy, V. Fine mapping of Co-x, an anthracnose resistance gene to a highly virulent strain of Colletotrichum lindemuthianum in common bean. Theor. Appl. Genet. 2014, 127, 1653–1666. [Google Scholar] [CrossRef] [PubMed]
- Gilio, T.A.S.; Hurtado-Gonzales, O.P.; Gonçalves-Vidigal, M.C.; Valentini, G.; Elias, J.C.F.; Song, Q.; Pastor-Corrales, M.A. Fine mapping of an anthracnose-resistance locus in Andean common bean cultivar Amendoim Cavalo. PLoS One 2020, 15, e0239763. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves-Vidigal, M.C.; Gilio, T.A.S.; Valentini, G.; Vaz Bisneta, M.; Vidigal Filho, P.S.; Song, Q.; Oblessuc, P.R.; Melotto, M. (2020). New Andean source of resistance to anthracnose and angular leaf spot: Fine-mapping of disease-resistance genes in California Dark Red Kidney common bean cultivar. PLoS One. 15, e0235215. [CrossRef]
- Oblessuc, P.R.; Baroni, R.M.; Garcia, A.A.F.; Chioratto, A.F.; Carbonell, S.A.M.; Camargo, L.E.A.; Benchimol, L.L. Mapping of angular leaf spot resistance QTL in common bean (Phaseolus vulgaris L.) under different environments. BMC Genet. 2012, 13, 50. [Google Scholar] [CrossRef]
- Keller, B.; Manzanares, C.; Jara, C.; Lobaton, J. D.; Studer, B.; Raatz, B. Fine-mapping of a major QTL controlling angular leaf spot resistance in common bean (Phaseolus vulgaris L.). Theor. Appl. Genet. 2015, 128, 813–826. [CrossRef]
- Sartorato, A.; Nietsche, S.; Barros, E.G.; Moreira, M.A. Inheritance of angular leaf spot resistance and RAPD markers linked to disease resistance gene in common beans. Ann. Rep. Bean Improv. Coop. 1999, 42, 21–22. [Google Scholar]
- Gonçalves-Vidigal, M.C.; Cruz, A.S.; Lacanallo, G.F.; Vidigal Filho, P.S.; Sousa, L. L.; Pacheco, C.M.N.A.; McClean, P.; Gepts, P.; Pastor-Corrales, M.A. Co-segregation analysis and mapping of the anthracnose Co-10 and angular leaf spot Phg-ON disease-resistance genes in the common bean cultivar Ouro Negro. Theor. Appl. Genet. 2013, 126, 2245–2255. [Google Scholar] [CrossRef]
- Oblessuc, P.R.; Perseguini, J.M.K.C.; Baroni, R.M.; Chiorato, A.F.; Carbonell, S.A. M.; Mondego, J.M.C.; Vidal, R.O.; Camargo, L.E.A.; Benchimol-Reis, L.L. Increasing the density of markers around a major QTL controlling resistance to angular leaf spot in common bean. Theor. Appl. Genet. 2013, 126, 2451–2465. [Google Scholar] [CrossRef]
- Nay, M. M.; Souza, T.L.P.O.; Raatz, B.; Mukankusi, C.M.; Gonçalves-Vidigal, M.C.; Abreu, A.F.B.; Melo, L.C.; Pastor-Corrales, M.A. A review of angular leaf spot resistance in common bean. Crop Sci. 2019, 59, 1376. [Google Scholar] [CrossRef] [PubMed]
- Mahiya-Farooq; Padder, B.A.; Bhat, N.N.; Shah, M.D.; Shikari, A.B.; Awale, H.E.; Kelly, J.D. Temporal expression of candidate genes at the Co-1 locus and their interaction with other defense related genes in common bean. Physiol. Mol. Plant Pathol. 2019, 108, 101424. [CrossRef]
- Richard, M.M.S.; Gratias, A.; Diaz, J.C.A.; Thareau, V.; Pflieger, S.; Meziadi, C.; Blanchet, S.; Marande, W.; Bitocchi, E.; Papa, R.; Miklas, P.N.; Geffroy, V. A common bean truncated CRINKLY4 kinase controls gene-for-gene resistance to the fungus Colletotrichum lindemuthianum. J. Exp. Bot. 2021, 72, 3569–3581. [Google Scholar] [CrossRef] [PubMed]
- McClean, P.E.; Myers, J.R.; Hammond, J.J. Coefficient of parentage and cluster analysis of North American dry bean cultivars. Crop Sci. 1993, 33, 190–197. [Google Scholar] [CrossRef]
- Boller, T.; Felix, G. A renaissance of elicitors, perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 2009, 60, 379–406. [Google Scholar] [CrossRef]
- Vaz Bisneta, M.; Gonçalves-Vidigal, M.C. Integration of anthracnose resistance loci and RLK and NBS-LRR-encoding genes in the Phaseolus vulgaris L. genome. Crop Sci. 2020, 60, 2901–2918. [Google Scholar] [CrossRef]
- Aleman, F.; Yazaki. J.; Lee, M.; Takahashi, Y.; Kim, A.Y.; Li. Z.; Kinoshita, T.; Ecker, J.R.; Schroeder, J.I. ABA-increased interaction of the PYL6 ABA receptor with MYC2 transcription factor: a putative link of ABA and JA signaling. Sci. Rep. 2016, 6, 28941. [Google Scholar] [CrossRef]
- García-Andrade, J.; González, B.; Gonzalez-Guzman, M.; Rodriguez, P. L.; Vera, P. The role of ABA in plant immunity is mediated through the PYR1 receptor. Int. J. Mol. Sci. 2020, 21, 5852. [Google Scholar] [CrossRef]
- Ng, A.; Xavier, R.J. Leucine-rich repeat (LRR) proteins: integrators of pattern recognition and signaling in immunity. Autophagy. 2011, 7, 1082–1084. [Google Scholar] [CrossRef]
- Li, X.; Kapos, P.; Zhang, Y. NLRs in plants. Curr. Opin. in Immunol. 2015, 32, 114–121. [Google Scholar] [CrossRef]
- Yuan, Y.; Teng, Q.; Zhong, R.; Haghighat, M.; Richardson, E.A.; Ye, Z-H. Mutations of Arabidopsis TBL32 and TBL33 affect Xylan acetylation and secondary wall deposition. PLoS ONE. 2016, 11, e0146460. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Teng, Q.; Zhong, R.; Ye, Z-H. The Arabidopsis DUF231 Domain-Containing Protein ESK1 Mediates 2-O- and 3-O-Acetylation of Xylosyl Residues in Xylan. Plant Cell Physiol. 2013, 54, 1186–1199. [Google Scholar] [CrossRef] [PubMed]
- Padder, B.A.; Kamfwa, K.; Awale, H.E.; Kelly, J. D. Transcriptome profiling of the Phaseolus vulgaris - Colletotrichum lindemuthianum pathosystem. PLoS One. 2016, 11. [Google Scholar] [CrossRef] [PubMed]
- Shams, E.; Javan-Nikkhah, M.; Mirzadi Gohari, A. Dissecting molecular events and gene expression signatures involved in Colletotrichum lindemuthianum-Phaseolus vulgaris pathosystem in compatible and incompatible interactions. Eur. J. Plant Pathol. 2020, 156, 925–937. [Google Scholar] [CrossRef]
- Pastor-Corrales, M. A.; Otoya, M. M.; Molina, A.; Singh, S.P. Resistance to Colletotrichum lindemuthianum isolates from middle America and Andean South America in different common bean races. Plant Dis. 1995, 79, 63–67. [Google Scholar] [CrossRef]
- Mathur, R.S.; Barnett, H.l.; Lilly, V.G. Sporulation of Colletotrichum lindemuthianum in culture. Phytopathol. 1950, 40, 104–114. [Google Scholar]
- Sanglard, D.A.; Balbi, B.P.; Barros, E.G.; Moreira, M.A. An efficient protocol for isolation, sporulation and maintenance of Pseudocercospora griseola. Ann. Rep. Bean Improv. Coop. 2009, 52, 62–63. [Google Scholar]
- Cárdenas, F.; Adams, M.W.; Andersen, A. The genetic system for reaction of field beans (Phaseolus vulgaris L. ) to infection by three physiologic races of Colletotrichum lindemuthianum. Euphytica, 1964, 13, 178–186. [Google Scholar] [CrossRef]
- de Almeida, C. P.; Arruda, N.; de Carvalho Paulino, J. F.; de Freitas, G.M.; Bonfante, G.F.J.; Bajay, M.M. , Deus, B.C.; Patrício, F.R.A.; Carbonell, S.A.M.; Chiorato, A.F.; Benchimol-Reis, L.L. Genetic diversity of Pseudocercospora griseola resistance loci in common beans. Trop. Plant Pathol. 2021, 46, 129–138. [Google Scholar] [CrossRef]
- Castellanos, G.; Jara, C.; Mosquera, G. (2015). Bean pathogens: Practical guide for lab and greenhouse work. Cali, Colombia: Centro Internacional de Agricultura Tropical (CIAT).
- Inglis, D.A.; Hagedorn, J.; Rand, R.E. Use of dry inoculum to evaluate beans for resistance to anthracnose and angular leaf spot. Plant Dis. 1988, 72, 771–774. [Google Scholar] [CrossRef]
- Borges, A.; Melotto, M.; Tsai, S.M.; Caldas, D.G.G. Changes in spatial and temporal gene expression during incompatible interaction between common bean and anthracnose pathogen. J. Plant Physiol. 2012, 169, 1216–1220. [Google Scholar] [CrossRef] [PubMed]
- Farrell, R.E. RNA Methodologies: Laboratory guide for isolation and characterization, 5th ed.; Elsevier: Amsterdam, Netherlands, 2017; pp. 1–855. [Google Scholar]
- Borges, A.; Tsai, S.M.D.G.G. Validation of reference genes for RT-qPCR normalization in common bean during biotic and abiotic stresses. Plant Cell Rep. 2012, 31, 827–838. [Google Scholar] [CrossRef] [PubMed]
- Goodstein, D.M. , Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; Rokhsar, D.S. Phytozome: a comparative platform for green plant genomics. Nucleic. Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. BioTechniques. 2000, 28, 1102–1104. [Google Scholar] [CrossRef]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M. The MIQE Guidelines: minimum information for publication of quantitative real-time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Bustin, S.; Huggett, J. qPCR primer design revisited. Biomol. Detect. Quantif. 2017, 14, 19–28. [Google Scholar] [CrossRef]
- Svec, D.; Tichopad, A. ; Novosadova, V.; Pfaffl, M.W.; Kubista, M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol. Detect. Quantif. 2015, 3, 9–16. [Google Scholar] [CrossRef]
- Rasmussen, R. Quantification on the LightCycler. In Rapid Cycle Real-Time PCR, Meuer, S., Wittwer, C., Nakagawara, K-I., Eds.; Springer: Heidelberg, Berlin, 2001; pp. 21–34. [Google Scholar] [CrossRef]
- Riedel, G.; Rüdrich, U. ; Fekete-Drimusz, N.; Manns, M.P.; Vondran, F.W.R.; Bock, M. An extended ΔCT-method facilitating normalisation with multiple reference genes suited for quantitative RT-PCR analyses of human hepatocyte-like cells. PLoS One. 2014, 9, e93031. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Mendiburu, F.; Yaseen, M. Agricolae: Statistical Procedures for Agricultural Research. 2020, Available: {https://myaseen208.github.io/agricolae/},{https://cran.r-project.org/package=agricolae}.
- R Core Team. R: A language and environment for statistical computing. R Foundation for Statistics Computing: Vienna, Austria. 2020. URL http://www.R-project.org/.
- Galili, T.; O’Callaghan, A.; Sidi, J.; Sievert, C. Heatmaply: an R package for creating interactive cluster heatmaps for online publishing. Wren, J., editor. Bioinformatics 2018, 34, 1600–1602. [Google Scholar] [CrossRef]










| Gene model | Gene | Functional annotation on Phytozome |
|---|---|---|
| Phvul.001G243800 | Co-1 | Serine/Threonine-protein kinase-like protein CCR3- related |
| KTR2/3 | Co-x | Serine/Threonine-protein kinase-like protein CCR3- related |
| Phvul.001G244300 | Co-AC | Clathrin Heavy Chain (CLTC) involved in plant defense signaling |
| Phvul.001G244400 | Co-AC | Unknown function |
| Phvul.001G244500 | Co-AC | Helix-loop-helix DNA-binding domain with possible transcription function |
| Phvul.001G245300 | CoPv01CDRK/ PhgPv01CDRK | Protein tyrosine kinase (pkinase_tyr) //leucine-rich repeat n-terminal domain (lrrnt_2) |
| Phvul.001G246000 | CoPv01CDRK/ PhgPv01CDRK | ATP-dependent RNA helicase ddx55/spb4 [ec:3.6.4.13] (ddx55, spb4) |
| Phvul.001G246100 | CoPv01CDRK/ PhgPv01CDRK | Cation-dependent mannose-6-phosphate receptor |
| Phvul.001G246200 | CoPv01CDRK/ PhgPv01CDRK | Protein trichome birefringence-like 33 |
| Phvul.001G246300 | CoPv01CDRK/ PhgPv01CDRK | Abscisic acid receptor pyl5 |
| Phvul.003G109100 | PR1a | Pathogenesis-related protein Bet v I family |
| Phvul.006G196900 | PR1b | Pathogenesis-related protein 1 |
| Phvul.009G256400 | PR2 | Pathogenesis-related protein 2 |
| Gene | Gene model | C. lindemuthianum race 73 (ANT) | P. griseola race 63-39 (ALS) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 24 hpi | 48 hpi | 72 hpi | 96 hpi | 120 hpi | 24 hpi | 72 hpi | 120 hpi | 168 hpi | 216 hpi | ||
| Co-x | KTR2/3 | 1.4 | 1.3 | 3.1 | 0.5 | 0.5 | 0.2 | 0.8 | 0.8 | -0.1 | -1.4 |
| Co-1 | Phvul.001G243800 | 1.4 | 0.9 | 2.0 | 1.8 | 0.6 | -1.1 | -0.2 | 0.1 | -0.9 | -0.3 |
| Co-AC | Phvul.001G244300 | -0.2 | -0.9 | -0.2 | -1.4 | -1.3 | -0.8 | -0.1 | 0.2 | 0.2 | 0.0 |
| Phvul.001G244400 | 0.0 | 0.0 | -0.7 | -0.4 | -0.2 | -0.2 | -0.2 | -0.3 | -0.7 | -1.0 | |
| Phvul.001G244500 | 0.4 | 0.3 | -0.4 | -0.5 | 0.8 | -2.4 | -2.5 | -2.3 | -2.3 | -2.4 | |
| CoPv01CDRK /PhgPv01CDRK | Phvul.001G245300 | 3.7 | 2.5 | 3.4 | 3.3 | 3.5 | -1.4 | 0.0 | 0.4 | -1.7 | 0.7 |
| Phvul.001G246000 | 0.9 | 0.8 | 0.8 | 0.7 | 0.3 | -0.5 | 0.4 | 0.5 | -0.1 | -0.2 | |
| Phvul.001G246100 | 0.6 | 1.5 | 1.2 | 0.7 | 1.3 | 0.0 | 0.3 | 0.1 | 0.4 | 0.0 | |
| Phvul.001G246200 | 2.7 | 2.6 | 2.6 | 0.5 | 1.6 | 0.0 | 1.5 | 0.1 | -0.4 | -0.2 | |
| Phvul.001G246300 | 7.2 | 7.3 | 7.8 | 7.4 | 6.3 | 1.7 | 8.5 | 6.5 | 1.3 | 6.1 | |
| Pathogenesis-related genes | PR1a | 6.6 | 6.2 | 8.0 | 8.1 | 6.3 | 1.5 | 3.6 | 4.7 | 1.0 | 5.8 |
| PR1b | 13.6 | 13.9 | 14.1 | 14.2 | 16.7 | -1.3 | 0.9 | 3.3 | -1.1 | 4.3 | |
| PR2 | 10.2 | 10.1 | 11.3 | 11.4 | 11.0 | 2.5 | 4.5 | 5.3 | 1.4 | 5.5 | |
| Gene Model a | Reference | Primers Forward (F) and Reverse (R) (5`-3`) | Amplicon(bp) | Tm(°C) | Eb | R² c |
|---|---|---|---|---|---|---|
| Phvul.001G133200 | IDE | F: AAGCAGGTATCTTGGCCATCTC | 126 | 60.16 | 1.04 | 0.99 |
| R: AAAGCAAACTCCAAGCTCCAATC | 59.99 | |||||
| Phvul.008G011000 | ACT | F: GAAGTTCTCTTCCAACCATCC | 154 | 59.67 | 1 | 0.98 |
| R: TTTCCT TGCTCATTCTGTCCG | 58.38 | |||||
| Phvul.001G243800 | Co-1 | F: CCTCAAGGTGGGGCTTTTGAG | 118 | 61.16 | 1.04 | 0.99 |
| R: TCACCGAGAAACTCCCATTGC | 60.61 | |||||
| KTR2/3 | Co-x | F: ATGCACAGGGGAATGGGATG | 279 | 60.11 | 1.04 | 0.98 |
| R: GCCATAGCGAGTGAGAGTGCG | 63.42 | |||||
| Phvul.001G244300 | Co-AC | F: GAAACGTCTCCGCAGAATAGTG | 150 | 59.4 | 1.03 | 0.99 |
| R: GTCTTGTGTTGTTCCTTGGAGTTG | 60.44 | |||||
| Phvul.001G244400 | Co-AC | F: TACAGCAAGAGAGCGGTTAAAGG | 121 | 60.62 | 1.01 | 0.99 |
| R: CCCTTTGTCACTTTGTTTTGAAGC | 59.67 | |||||
| Phvul.001G244500 | Co-AC | F: CAATGCACAGCTCGCAACTC | 141 | 60.45 | 1.09 | 0.97 |
| R: GGAACTGTGAAAGCTCTGCTAAC | 59.81 | |||||
| Phvul.001G245300 | CoPv01CDRK/ PhgPv01CDRK | F: TCTGCTGGAAGGGTGGTAGTC | 93 | 61.17 | 1.07 | 0.98 |
| R: GGACGTTATGTGAACAAGGTTTGC | 61.08 | |||||
| Phvul.001G246000 | CoPv01CDRK/ PhgPv01CDRK | F: ATGAAGCGGATGGATGTCTTG | 132 | 58.43 | 1.01 | 0.97 |
| R: TCTACGAAGCTTAGGCAATTGAG | 58.57 | |||||
| Phvul.001G246100 | CoPv01CDRK/ PhgPv01CDRK | F: CACGGTATCCTCAGCGAAGAC | 119 | 60.53 | 1.05 | 0.99 |
| R: CAGCAGTCAGCACATACTGGAG | 60.99 | |||||
| Phvul.001G246200 | CoPv01CDRK/ PhgPv01CDRK | F: GAAGGAGGCTGTGACGTGTTC | 150 | 61.2 | 1.04 | 0.99 |
| R: CCATCGCCACCGTTGATACTC | 61.13 | |||||
| Phvul.001G246300 | CoPv01CDRK/ PhgPv01CDRK | F: CTTCTTCCCTTCACTTCGATACC | 87 | 58.57 | 1.09 | 0.99 |
| R: GTTGAGAGTGTTTGTGGCAGT | 58.98 | |||||
| Phvul.003G109100 | PR1a | F: GTCCTAACGGAGGATCACTCA | 148 | 58.62 | 1.06 | 0.99 |
| R: CAGGGATTGGCCAGAAGGTAT | 59.5 | |||||
| Phvul.006G196900 | PR1b | F: GGTTTGCCTATGATCCCAATGC | 115 | 59.96 | 1.03 | 0.99 |
| R: TGTTGTGAGCGTTGAGGAAGTC | 61.06 | |||||
| Phvul.009G256400 | PR2 | F: CAGAGGTTCTCATTTGCTGCTTTC | 98 | 60.62 | 1.07 | 0.99 |
| R: ATGCCATAACACACCCCGATTTG | 61.75 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).