Submitted:
30 August 2023
Posted:
30 August 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Experimental design
2.2. Intervention
2.3. Anthropometric and clinic measurements
2.4. Biochemical analysis
2.4.1. Samples
2.4.2. SOD enzyme activity
2.4.3. GPx enzyme activity
2.4.4. Catalase activity
2.4.5. Total oxidant status (TOS)
2.4.6. Total antioxidant status (TAS)
2.4.7. Inflammatory cytokines
2.4.8. Lymphocyte isolation and RNA extraction
2.4.9. Gene expression analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Ageing and health. 2022. Available online: https://www.who.int/news-room/fact-sheets/detail/ageing-and-health.
- Mendoza-Núñez, V.M.; Martínez-Maldonado, M.L.; Vivaldo-Martínez, M. What Is the onset age of human aging and old age? Int J Gerontol 2016, 10, 56. [Google Scholar] [CrossRef]
- Caterson, I.D.; Hubbard, V.; Bray. G.A.; Grunstein, R.; Hansen, B.C.; Hong, Y.; Labarthe, D.; Seidell, J.C.; Smith, S.C. American Heart Association. Prevention Conference VII: Obesity, a worldwide epidemic related to heart disease and stroke: Group III: worldwide comorbidities of obesity. Circulation 2004, 110, e476–e483. [Google Scholar] [CrossRef] [PubMed]
- Soares, R.; Costa, C. Oxidative stress, inflammation and angiogenesis in the metabolic syndrome. Amsterdam, The Netherlands: Springer 2009, 85-121.
- Gouveia, É.R.; Gouveia, B.R.; Marques, A.; Peralta, M.; França, C.; Lima, A.; Campos, A.; Jurema, J.; Kliegel, M.; Ihle, A. Predictors of metabolic syndrome in adults and older adults from Amazonas, Brazil. Int J Environ Res Public Health 2021, 18, 1303. [Google Scholar] [CrossRef] [PubMed]
- Márquez-Sandoval, F.; Macedo-Ojeda, G.; Viramontes-Hörner, D.; Fernández, B.J.D.; Salas, S.J.; Vizmanos, B. The prevalence of metabolic syndrome in Latin America: a systematic review. Public Health Nutr 2011, 14, 1702–1713. [Google Scholar] [CrossRef] [PubMed]
- Eckel, R.H.; Grundy, S.M.; Zimmet, P.Z. The metabolic syndrome. Lancet 2005, 365, 1415–1428. [Google Scholar] [CrossRef]
- Adair, T.H.; Montani, J.P. Angiogenesis. San Rafael (CA): Morgan & Claypool Life Sciences. 2010.
- Vona, R.; Gambardella, L.; Cittadini, C.; Straface, E.; Pietraforte, D. Biomarkers of oxidative stress in metabolic syndrome and associated diseases. Oxid Med Cell Longev 2019, 8267234. [Google Scholar] [CrossRef]
- Sharma, P.; Mishra, S.; Ajmera, P.; Mathur, S. Oxidative stress in metabolic syndrome. Indian J Clin Biochem 2005, 20, 145–149. [Google Scholar] [CrossRef]
- Fernandez-Garcia, J.C; Cardona, F.J.; Tinahones, F. Inflammation, oxidative stress and metabolic syndrome: dietary modulation. Curr Vasc Pharmacol 2013, 11, 906–919. [Google Scholar] [CrossRef]
- Pruchniak, M.P.; Aražna, M.; Demkow, U. Biochemistry of oxidative stress. Adv Exp Med Biol 2016, 878, 9–19. [Google Scholar]
- Krzemińska, J.; Wronka, M.; Młynarska, E.; Franczyk, B.; Rysz, J. Arterial hypertension—oxidative stress and inflammation. Antioxidants 2022, 11, 172. [Google Scholar] [CrossRef]
- Ordonez, A.A.L.; Gomez, J.D.; Vattuone, M.A. Antioxidant activities of Sechium edule (Jacq.) Swartz extracts. Food Chem 2006, 97, 452–458. [Google Scholar] [CrossRef]
- MinJin, K.; YouChul, C.; SangSuk, K.; ChanKyu, L.; KyungJin, P.; YoungHun, C.; Taejin, P.; SeungYoung, K.; ChangGu, H. Anti-inflammatory effect of Sechium edule extract in LPS-stimulated RAW 264.7 cells via p-JNK and p-p38 down-regulation. KSBB J 2019, 34, 99–106. [Google Scholar]
- Lombardo-Earl, G.; Roman-Ramos, R.; Zamilpa, A.; Herrera-Ruiz, M.; Rosas-Salgado, G.; Tortoriello, J.; Jiménez-Ferrer, E. Extracts and fractions from edible roots of Sechium edule (Jacq.) Sw. with antihypertensive activity. ECAM 2014, 594326. [Google Scholar]
- Arista-Ugalde, T.L.; Santiago-Osorio, E.; Monroy-García, A.; Rosado-Pérez, J.; Aguiñiga-Sánchez, I.; Cadena-Iñiguez, J.; Gavia-García, G.; Mendoza-Núñez, V.M. Antioxidant and anti-inflammatory effect of the consumption of powdered concentrate of Sechium edule var. nigrum spinosum in mexican older adults with metabolic syndrome. Antioxidants (Basel) 2022, 11, 1076. [Google Scholar] [PubMed]
- Gavia-García, G.; Rosado-Pérez, J.; Arista-Ugalde, T.L.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. The consumption of Sechium edule (chayote) has antioxidant effect and prevents telomere attrition in older adults with metabolic syndrome. Redox Rep 2023, 28, 2207323. [Google Scholar] [CrossRef]
- NCEP. Executive summary of the third report of the National Cholesterol Education Program (NCEP) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult treatment panel III). JAMA 2001, 285, 2486–2497. [Google Scholar] [CrossRef] [PubMed]
- Secretaría de Salud. Toma de medidas clínicas y antropométricas en el adulto mayor. Mexico City, (Mexico): Subsecretaría de prevención y protección de la salud; 2002.
- Secretaría de Salud. Norma Oficial Mexicana NOM-030-SSA-1999. Para la prevención, tratamiento y control de la hipertensión arterial. Mexico City, (Mexico): Secretaría de Salud; 1999.
- Aebi, H. Catalase in vitro. Methods Enzymol 1984, 105, 121–126. [Google Scholar] [PubMed]
- Primer-BLAST-NCBI-NIH (Primer-BLAST; https://www.ncbi.nlm.nih.gov/tools/primer-blast/).
- Agbabiaka, T.; Wider, B.; Watson, L.K.; Goodman, C. Concurrent use of prescription drugs and herbal medicinal products in older adults: A systematic review. Drugs Aging 2017, 34, s40017–s40266. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.H.; Ou, T.T.; Chang, C.H.; Chang, X.Z.; Yang, M.Y.; Wang, C.J. The polyphenol extract from Sechium edule shoots inhibits lipogenesis and stimulates lipolysis via activation of AMPK signals in HepG2 cells. J Agric Food Chem 2014, 62, 750–759. [Google Scholar] [CrossRef]
- Yang, S.H.; Kim, J.; Lee, M.J.; Kim, Y. Abnormalities of plasma cytokines and spleen in senile APP/PS1/Tau transgenic mouse model. Sci Rep 2015, 5, 15703. [Google Scholar] [CrossRef]
- Millar, C.L.; Duclos, Q.; Blesso, C.N. Effects of dietary flavonoids on reverse cholesterol transport, HDL metabolism, and HDL function. Adv Nutr 2017, 8, 226–239. [Google Scholar] [CrossRef] [PubMed]
- Weng, C.J.; Chen, MJ, Yeh, CT, Yen, G. C. Hepatoprotection of quercetin against oxidative stress by induction of metallothionein expression through activating MAPK and PI3K pathways and enhancing Nrf2 DNA-binding activity. N Biotechnol 2011, 28, 767–777. [Google Scholar] [CrossRef] [PubMed]
- Dreger, H.; Westphal, K.; Weller, A.; Baumann, G.; Stangl, V.; Meiners, S.; Stangl, K. Nrf2-dependent upregulation of antioxidative enzymes: a novel pathway for proteasome inhibitor-mediated cardioprotection. Cardiovasc Res 2009, 83, 354–361. [Google Scholar] [CrossRef] [PubMed]
- Jaiswal, A.K. Nrf2 signaling in coordinated activation of antioxidant gene expression. Free Radic Biol Med 2004, 36, 1199–1207. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Kotakeyama, Y.; Li, J.; Pan, Y.; Matsuura, A.; Ohya, Y.; Yoshida, M.; Xiang, L.; Qi, J. Cucurbitacin B exerts antiaging effects in yeast by regulating autophagy and oxidative stress. Oxid Med Cell Longev 2019, 2019, 4517091. [Google Scholar] [CrossRef]
- Liu, Z.; Kumar, M.; Kabra, A. Cucurbitacin B exerts neuroprotection in a murine Alzheimer’s disease model by modulating oxidative stress, inflammation, and neurotransmitter levels. Front Biosci 2022, 27, 71. [Google Scholar] [CrossRef]
- Ranjan, A.; Ramachandran, S.; Gupta, N.; Kaushik, I.; Wright, S.; Srivastava, S.; Das, H.; Srivastava, S.; Prasad, S.; Srivastava, S.K. Role of phytochemicals in cancer prevention. Int J Mol Sci 2019, 20, 4981. [Google Scholar] [CrossRef]
- Park, S.Y.; Kim, Y.H.; Park, G. Cucurbitacins attenuate microglial activation and protect from neuroinflammatory injury through Nrf2/ ARE activation and STAT/NF-κB inhibition. Neurosci Lett 2015, 609, 129–136. [Google Scholar] [CrossRef]
- Qin, S.; Chen, J.; Tanigawa, S.; Hou, D.X. Microarray and pathway analysis highlight Nrf2/ARE-mediated expression profiling by polyphenolic myricetin. Mol Nutr Food Res 2013, 57, 435–446. [Google Scholar] [CrossRef]
- Liao, H.H.; Zhu, J.X.; Feng, H.; Ni, J.; Zhang, N.; Chen, S.; Liu, H.J.; Yang, Z.; Deng, W.; Tang, Q.Z. Myricetin possesses potential protective effects on diabetic cardiomyopathy through inhibiting IκBα/NFκB and enhancing Nrf2/HO-1. Oxid Med Cell Longev 2017, 2017, 8370593. [Google Scholar] [CrossRef]
- Ma, C.; Deng Y, Xiao R, Xu, F. ; Li, M.; Gong, Q.; Gao, J.. Anti-fatigue effect of phlorizin on exhaustive exercise-induced oxidative injury mediated by Nrf2/ARE signaling pathway in mice. Eur J Pharmacol 2022, 918, 174563. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Chen, Z.; Huang, L.; Meng, B.; Zhou, X.; Wen, X.; Ren, D. Naringenin reduces oxidative stress and improves mitochondrial dysfunction via activation of the Nrf2/ARE signaling pathway in neurons. Int J Mol Med 2017, 40, 1582–1590. [Google Scholar] [CrossRef] [PubMed]
- Bao, L.; Li, J.; Zha, D.; Zhang, L.; Gao, P.; Yao, T.; Wu, X. Chlorogenic acid prevents diabetic nephropathy by inhibiting oxidative stress and inflammation through modulation of the Nrf2/HO-1 and NF-ĸB pathways. Int Immunopharmacol 2018, 54, 245–253. [Google Scholar] [CrossRef]
- Yeh, C.T.; Yen, G.C. Involvement of p38 MAPK and Nrf2 in phenolic acid-induced P-form phenol sulfotransferase expression in human hepatoma HepG2 cells. Carcinogenesis 2006, 27, 1008–1007. [Google Scholar] [CrossRef]
- Ji, L.L. Exercise-induced modulation of antioxidant defense. Ann N Y Acad Sci 2002, 959, 82–92. [Google Scholar] [CrossRef] [PubMed]
- Jinhwan, L.; Ulrike, L. Oxidative damage increases and antioxidant gene expression decreases with aging in the mouse ovary. Biol Reprod 2011, 84, 775–782. [Google Scholar]
- Rao, G.; Xia, E.; Nadakavukaren, M.J.; Richardson, A. Effect of dietary restriction on the age-dependent changes in the expression of antioxidant enzymes in rat liver. J Nutr 1990, 120, 602–609. [Google Scholar] [CrossRef]
- Ighodaro, O.M.; Akinloye, O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Med J 2018, 54, 287–293. [Google Scholar] [CrossRef]
- Rosado-Pérez, J.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E, Mendoza-Núñez, V. M. Effect of Sechium edule var. nigrum spinosum (Chayote) on oxidative stress and pro-inflammatory markers in older adults with metabolic syndrome: an exploratory study. Antioxidants 2019, 8, 146. [Google Scholar]
- Gavia-García, G.; Rosado-Pérez, J.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. Effect of Sechium edule var. nigrum spinosum (chayote) on telomerase levels and antioxidant capacity in older adults with metabolic syndrome. Antioxidants 2020, 9, 634. [Google Scholar]
- Oh-Ishi, S.; Kizaki, T.; Yamashita, H.; Nagata, N.; Suzuki, K.; Taniguchi, N.; Ohno, H. Alterations of superoxide dismutase iso-enzyme activity, content, and mRNA expression with aging in rat skeletal muscle. Mech Ageing Dev 1995, 84, 65–76. [Google Scholar] [CrossRef] [PubMed]
- Marasco, M.R.; Conteh, A.M.; Reissaus, C.A.; Cupit, J.E. 5th.; Appleman, E.M.; Mirmira, R.G.; Linnemann, A.K. Interleukin-6 reduces β-cell oxidative stress by linking autophagy with the antioxidant response. Diabetes 2018, 67, 1576–1588. [Google Scholar] [CrossRef] [PubMed]
- Matsuoka, Y.; Nakayama, H.; Yoshida, R.; Hirosue, A.; Nagata, M.; Tanaka, T.; Kawahara, K.; Sakata, J.; Arita, H.; Nakashima, H.; Shinriki, S.; Fukuma, D.; Ogi, H.; Hiraki, A.; Shinohara, M.; Toya, R.; Murakami, R. IL-6 controls resistance to radiation by suppressing oxidative stress via the Nrf2-antioxidant pathway in oral squamous cell carcinoma. Br J Cancer 2016, 115, 1234–1244. [Google Scholar] [CrossRef] [PubMed]
- Wruck, C.J.; Streetz, K.; Pavic, G.; Götz, M.E.; Tohidnezhad, M.; Brandenburg, L.O.; Varoga, D.; Eickelberg, O.; Herdegen, T.; Trautwein, C.; Cha, K.; Kan, Y.W.; Pufe, T. Nrf2 induces interleukin-6 (IL-6) expression via an antioxidant response element within the IL-6 promoter. J Biol Chem 2011, 286, 4493–4499. [Google Scholar] [CrossRef]
- Mohamed, G.A.; Ibrahim, S.R. , El-Agamy, D.S.; Elsaed, W.M.; Sirwi, A.; Asfour, H.Z.; Elhady, S.S. Cucurbitacin E glucoside alleviates concanavalin A-induced hepatitis through enhancing SIRT1/Nrf2/HO-1 and inhibiting NF-ĸB/NLRP3 signaling pathways. J Ethnopharmacol 2022, 292, 115223. [Google Scholar] [CrossRef]
- Li, J.; Mao, B.; Tang, X.; Zhang, Q.; Zhao, J.; Zhang, H.; Cui, S. Protective effects of naringenin and apigenin in ameliorating skin damage via mediating the Nrf2 and NF-κB pathways in mice. Foods 2023, 12, 2120. [Google Scholar] [CrossRef]
- Lee, Y.; Shin, D.H.; Kim, J.H.; Hong, S.; Choi, D.; Kim, Y.J.; Kwak, M.K.; Jung, Y. Caffeic acid phenethyl ester-mediated Nrf2 activation and IκB kinase inhibition are involved in NFκB inhibitory effect: structural analysis for NFκB inhibition. Eur J Pharmacol 2010, 643, 21–28. [Google Scholar] [CrossRef]
- Lampiasi, N.; Montana, G. An in vitro inflammation model to study the Nrf2 and NF-κB crosstalk in presence of ferulic acid as modulator. Immunobiology 2018, 223, 349–355. [Google Scholar] [CrossRef]
- Paredes-Gonzalez, X.; Fuentes, F.; Su, Z.Y.; Kong, A.N.T. Apigenin reactivates Nrf2 anti-oxidative stress signaling in mouse skin epidermal JB6 P+ cells through epigenetics modifications. AAPS J 2014, 16, 727–735. [Google Scholar] [CrossRef]
- Wang, X.; Sun, Y.; Li, P.; Wu, Z.; Chen, Y.; Fu, Y.; Wu, H.; Ye, Y.; Wang, J.; Yang, Z.; Zhou, E. The protective effects of myricetin against acute liver failure via inhibiting inflammation and regulating oxidative stress via Nrf2 signaling. Nat Prod Res 2023, 37, 798–802. [Google Scholar] [CrossRef]
- Chi-Tai, Y.; Gow-Chin, Y. Involvement of p38 MAPK and Nrf2 in phenolic acid-induced P-form phenol sulfotransferase expression in human hepatoma HepG 2 cells. Carcinogenesis 2006, 27, 1008–1017. [Google Scholar]
- Granado-Serrano, A.B.; Martín, M.A.; Bravo, L.; Goya, L.; Ramos, S. Quercetin modulates Nrf2 and glutathione-related defenses in HepG2 cells: Involvement of p38. Chem Biol Interact 2012, 195, 154–164. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, Y.; Guo, Y.; Xu, L.; Wang, H. Phlorizin exerts potent effects against aging induced by D-galactose in mice and PC12 cells. Food Funct 2021, 12, 2148–2160. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhou, S.; Zhao, A.; Mi, Y.; Zhang, C. Protective effect of rutin on ferroptosis-induced oxidative stress in aging laying hens through Nrf2/HO-1 signaling. Cell Biol Int 2023, 47, 598–611. [Google Scholar] [CrossRef] [PubMed]
- Shi, A.; Shi, H.; Wang, Y.; Liu, X.; Cheng, Y.; Li, H.; Zhao, H.; Wang, S.; Dong, L. Activation of Nrf2 pathway and inhibition of NLRP3 inflammasome activation contribute to the protective effect of chlorogenic acid on acute liver injury. Int Immunopharmacol 2018, 54, 125–130. [Google Scholar] [CrossRef]
- Varì, R.; D’Archivio, M.; Filesi, C.; Carotenuto, S.; Scazzocchio, B.; Santangelo, C.; Giovannini, C.; Masella, R. Protocatechuic acid induces antioxidant/detoxifying enzyme expression through JNK-mediated Nrf2 activation in murine macrophages. J Nutr Biochem 2011, 22, 409–417. [Google Scholar] [CrossRef]
- Shen, Y.; Song, X.; Li, L.; Sun, J.; Jaiswal, Y.; Huang, J.; Li, C.; Yang, W.; Williams, L.; Zhang, H.; Guan, Y. Protective effects of p-coumaric acid against oxidant and hyperlipidemia-an in vitro and in vivo evaluation. Biomed Pharmacother 2019, 111, 579–587. [Google Scholar] [CrossRef]

| Gene | Primer Name |
Primer sequence |
|---|---|---|
| SOD1 | SOD-F | GGTGGGCCAAAGGATGAAGA |
| SOD-R | ATAGACACATCGGCCACACC | |
| GPX1 | GPX-F | ACACCCAGATGAACGAGCTG |
| GPX-R | CTTCGTTCTTGGCGTTCTCC | |
| CAT | CAT-F | TGAAGATGCGGCGAGACTTT |
| CAT-R | GAGGGGTACTTTCCTGTGGC | |
| NFE2L2 | NRF2-F | AGGTTGCCCACATTCCCAAA |
| NRF2-R | ACGTAGCCGAAGAAACCTCA | |
| IL-6 | IL6-F | CCACCGGGAACGAAAGAGAA |
| IL6-R | GAGAAGGCAACTGGACCGAA | |
| IL-8 | IL8-F | GAAGAGAGCTCTGTCTGGACC |
| IL8-R | TGAATTCTCAGCCCTCTTCAAAAAC | |
| TNF-α | TNF-F | GAAGAGAGCTCTGTCTGGACC |
| TNF-R | TGAATTCTCAGCCCTCTTCAAAAAC | |
| NFKB-p50 | NFKBP50-F | GGAGGCCGAACGCGG |
| NFKBP50-R | AAACATTTGTTCAGGCCTTCCC | |
| NFKB-p65 | NFKB65-F | CAGTGTGTGAAGAAGCGGGA |
| NFKB65-R | CCACGCTGCTCTTCTTGGAA | |
| β-ACTIN | ACTIN-F | GAGCACAGAGCCTCGCC |
| ACTIN-R | CGCGGCGATATCATCATCCA |
| Placebo n = 20 |
Experimental n =26 |
||
|---|---|---|---|
| Parameter | p-Value | ||
| Age (years) | 68.4 ± 5.7 | 67.9 ± 6.6 | |
| SBP (mmHg) | |||
| Baseline | 132.5 ± 15.5 | 141.4 ± 12.1 | |
| 6 months | 132.3 ± 12.1 | 131.2 ± 11.2* | 0.01 |
| DBP (mmHg) | |||
| Baseline | 90.2 ± 9.9 | 95.0 ± 9.8 | |
| 6 months | 85.6 ± 6.4 | 83.8 ± 8.0* | 0.001 |
| Weight (kg) | |||
| Baseline | 76.5 ± 14.6 | 74.4 ± 16.5 | |
| 6 months | 76.2 ± 12.8 | 72.4 ± 16.4* | 0.01 |
| Waist circumference (cm) | |||
| Baseline | 103.6 ± 11.4 | 99.9 ± 12.2 | |
| 6 months | 104.2 ± 11.9 | 102.1 ± 12.1 | 0.55 |
| Placebo n = 20 |
Experimental n = 26 |
||
|---|---|---|---|
| Parameter | p-Value | ||
| Glucose [mg/dL] | |||
| Baseline | 137.3 ± 61.3 | 140.7 ± 48.1 | |
| 6 months | 139.4 ± 69.1 | 140.0 ± 57.3 | 0.91 |
| HDL-c [mg/dL] | |||
| Baseline | 47.8 ± 9.5 | 42.8 ± 7.5 | |
| 6 months | 47.4 ± 7.5 | 47.4 ± 7.4* | 0.01 |
| Triglycerides [mg/dL] | |||
| Baseline | 169.6 ± 36.6 | 174.1 ± 54.8 | |
| 6 months | 125.7 ± 30.4 | 149.2 ± 45.6 | 0.19 |
| Placebo n = 20 |
Experimental n = 26 |
||
|---|---|---|---|
| Parameter | p-Value | ||
| SOD [U/mL] | |||
| Baseline | 176.8 ± 10.3 | 167.1 ± 11.9 | |
| 6 months | 174.6 ± 4.9 | 180.6 ± 7.6* | 0.05 |
| GPx [U/L] | |||
| Baseline | 5740 ± 938 | 5221 ± 822 | |
| 6 months | 5023 ± 1885 | 5559 ± 2007 | 0.33 |
| CAT [U/mL] | |||
| Baseline | 1.2 ± 0.1 | 1.0 ± 0.2 | |
| 6 months | 1.2 ± 0.2 | 1.3 ±0.2* | 0.01 |
| TOS [µmol H2O2 Equiv./L] | |||
| Baseline | 24.5 ± 2.3 | 28.9 ± 3.6 | |
| 6 months | 28.0 ± 3.7 | 23.7 ± 3.4* | 0.01 |
| TAS [mmol/L] | |||
| Baseline | 1.2 ± 0.1 | 11.1 ± 0.1 | |
| 6 months | 1.1 ± 0.2 | 1.4 ± 0.1* | 0.01 |
| OSI | |||
| Baseline | 19.2 ± 2.1 | 24.1 ± 3.8 | |
| 6 months | 26.1 ± 7.0 | 17.7 ± 4.0* | 0.01 |
| Placebo n = 20 |
Experimental n = 26 |
||
|---|---|---|---|
| Parameter | p-Value | ||
| IL-6 [pg/dL] | |||
| Baseline | 10.7 ± 2.1 | 10.7 ± 1.1 | |
| 6 months | 11.0 ± 0.9 | 12.3 ± 2.0* | 0.03 |
| IL-8 [pg/dL] | |||
| Baseline | 27.6 ± 4.4 | 37.7 ± 9.9 | |
| 6 months | 25.8 ± 6.0 | 30.9 ± 11.1 | 0.12 |
| TNF-α [pg/dL] | |||
| Baseline | 8.4 ± 1.2 | 8.2 ± 0.6 | 0.61 |
| 6 months | 8.8 ± 1.6 | 9.2 ± 1.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).