Preprint
Article

This version is not peer-reviewed.

Identification of Rice RRM1 Gene Family and Its Resistance to Rice Blast

Submitted:

23 August 2023

Posted:

24 August 2023

You are already at the latest version

Abstract
In order to enhance understanding of RNA-binding proteins in rice, a comprehensive investigation was conducted on the RRM1 gene family of rice, encompassing genome-wide identification and exploration of its role in rice blast resistance. Physical and chemical properties of the OsRRM1 gene family in rice was analyzed, including conserved domain, motif, location information, gene structure, phylogenetic tree, collinearity analysis, cis-acting elements, GO, and KEGG. Furthermore, the expression patterns of the OsRRM1 gene were examined at different time intervals following rice blast treatment. Furthermore, the alterations in expression patterns of selected OsRRM1 genes were assessed using quantitative real-time PCR(qRT-PCR). A total of 212 members of the OsRRM1 gene family were identified, which were dispersed across 12 chromosomes. Many of these genes exhibit multiple exons and introns, all of which encompass the conserved RRM1 domain and share analogous motifs. This observation suggests a high degree of conservation within the encoded sequence domain of these genes. Phylogenetic analysis revealed the existence of five subfamilies within the OsRRM1 gene family. Furthermore, the investigation of the promoter region identified homeopathic elements that are involved in nucleic acid binding and interaction with multiple transcription factors. By employing GO and KEGG analysis, four RRM1 genes were tentatively identified as crucial contributors to plant immunity, while the RRM1 gene family was also found to have a significant involvement in the complex of alternative splicing. Additionally, gene expression analysis indicated that the majority of OsRRM1 genes exhibited constitutive expression. The results of the qRT-PCR analysis revealed distinct temporal changes in the expression pattern of the OsRRM1 gene following rice blast treatment. These findings contribute to the existing knowledge of the OsRRM1 gene family, establish a foundation for further investigation into the role of the OsRRM1 gene in response to rice blast infection, and hold theoretical significance for future studies on the functionality of the OsRRM1 gene.
Keywords: 
;  ;  ;  

1. Introduction

Gene expression must abide by strict laws, and each step needs to be strictly regulated, which is often regulated at the transcription level through DNA cis-acting elements and transcription factor binding[1,2]. Studies have shown that post-transcriptional regulation plays an important role in regulating gene expression of plant. Post-transcriptional regulation involves multiple processes, namely alternative splicing, RNA editing, RNA transport from the nucleus to the cytoplasm, RNA stabilization, and translation, which require the help of RNA binding proteins (RBPs) [1,3]. In order to achieve sequence-specific recognition of regulation in different levels and regulatory targets, there are several RNA binding domains with conserved characteristics in RBPs, such as RRM (RNA Recognition motif) domains[4,5].
The RNA recognition motif (RRM), also known as the RNA binding domain (RBD) or ribonucleoprotein domain (RNP), is one of the most abundant protein domains in eukaryotes and was first identified in the late 1980s[6,7,8,9]. The RNA recognition motif (RRM) domain is an important player in the regulation of development, signaling, gene expression, and cell differentiation[10,11,12,13]. RRM is a structurally conserved region consisting of about 80-90 amino acids, consisting of two short consensus sequences: RNP1 (hexapeptide) and RNP2 (octapeptide) [14]. It folds into a αβ sandwich with a typical β1α1β2β3α2β4 topology that forms a four-stranded antiparallel β-sheet packed against two α-helices[15]. The specificity of RNA binding is determined by multiple exposures to surrounding amino acids[14,16]. In some cases, a third helix is present during RNA binding[17]. The largest single-stranded RNA-binding proteome is the eukaryotic RNA recognition motif (RRM) family, which contains eight amino acid RRM1 consensus sequences[8,18]. RRM proteins have a variety of RNA-binding preferences and functions, including heteroribonucleo proteins (hnRNPs), proteins associated with alternative splicing regulation (SR, U2AF, Sxl), protein components of small ribonucleoproteins (U1 and U2 snRNPs), and proteins that regulate RNA stability and translation (PABP) [18,19,20]. The RRM in the heterodimer splicing factor U2 snRNP cofactor (U2AF) appears to have two RRM-like domains with special features for protein recognition[21]. This motif also appears in some single-stranded DNA-binding proteins[16].
Rice (Oryza sativa Japonica) is one of the main food crops in the world, which plays an irreplaceable role in China’s food security and is also an important model crop selected by biological research. However, there are few reports on OsRRM1 gene family. Previously unknown RRM1 transcription factors have been identified that interact directly with NLR to activate plant defense, establishing a direct link between transcriptional activation of immune responses and NRL-mediated pathogen perception[22]. Although the rice genome encodes a large number of OsRRM1 proteins, the exact number and function of these gene families in rice remains unclear.
Magnaporthe Oryza is one of the most widespread and harmful worldwide fungal diseases caused by rice blast fungus. It may infect rice at all stages of growth and development, seriously affecting the yield and quality of rice, and thus threatening the global food security. Although the traditional chemical control means can quickly and effectively control diseases and pests, long-term use of pesticide will not only bring severe environmental problems, but also increase economic costs, which is not conducive to the sustainable development of agriculture[23]. The resistance of germplasm resources has a wide range of genetic variation, and thus the host plant’s own resistance is the most effective, economical and environmentally friendly method to against Magnaporthe Oryza [24]. Many of studies have shown that the adaptability of rice blast fungus to the host changes frequently, and the resistance of rice varieties can only be maintained for 3 to 5 years[23,25,26]. Plant genomes express a large number of RRM-containing proteins, but only a few RRM proteins have been elucidated for their roles in plants, including immunity in plants, possibly through RNA processing[27,28,29,30]. Some researchers have identified possible members of the RRM transcription factor family, but have not predicted the role of all RRM genes in transcriptional activation in rice and other plants[31]. Therefore, it is necessary to further study the regulation of gene network during rice blast occurrence and to explore and identify new blast resistance genes, which has important theoretical and practical significance for the breeding of new varieties resistant to rice blast.
In this study, bioinformatics was used to identify and characterize the whole genome of RRM1 gene family in rice. The gene structure, physical and chemical properties, domain and phylogenetic characteristics of RRM1 gene family in rice were studied. In addition, RNA-seq was used to analyze the expression patterns of RRM1 gene family in different time periods after rice blast fungus treatment. At the same time, the expression changes of RRM1 family genes in response to stress resistance were analyzed by quantitative real-time PCR. This study increased the understanding of OsRRM1 gene family, and provided a basis for further investigation of the function of OsRRM1 gene under infection of rice blast fungus, and played a certain theoretical role for the subsequent study of the function of OsRRM1 gene family.

2. Materials and Methods

2.1. Identification and physicochemical properties of RRM1 gene family members in rice

Rice(Oryza sativa Japonica) genome sequence, annotation files, protein sequences, and gene structure file were downloaded from the Ensembl Plants database (http://plants.ensembl.org/index.html). Download the HMM (Hidden Marov Model) PF00076.24 (RRM1 domain) of the RRM1 gene family from the Pfam database (http://pfam.xfam.org/). Using HMM SEARCH tool sequence in HMMER3.2 software to search and analyze, RRM1 gene family in rice was predicted, and the E-value was less than 1×10-5. Domain analysis of identified RRM1 candidate sequences was performed using conserved RRM1 domain sequences in Pfam database (PF00076.24) and SMART online analysis software (http://smart.embl.de/). Using ExPASy (https://www.expasy.org/protparam/) online tools to predict protein isoelectric point, molecular size, length of protein sequences of amino acids. Use the Cell-PLoc 2.0 (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/) online tools for protein subcellular localization prediction analysis.

2.2. Chromosome location of OsRRM1 gene family and construction of phylogenetic tree

The position of RRM1 gene on chromosome was analyzed through the rice gene sequence file downloaded from the Ensembl Plants database, and the chromosome location map was drawn by TBtools software. The NJ (neighbor-joining method) phylogenetic tree of RRM1 protein was constructed using MEGA11.0(Molecular Evolutionary genetics Analysis11.0) with the Bootstrap value of 1000 and use default for other parameters, and then the online software Itol(https://itol.embl.de/) was used to beautify the tree.

2.3. Analysis of conserved domain, gene structure and motif of OsRRM1 gene family

Conserved domains of the identified gene families were analyzed using the online tool Pfam (https://pfam.xfam.org/), and visualized by TBtools[32].
Through the plant genome database Ensembl plant rice gene structure annotation files downloaded (http://plants.ensembl.org/), the structure information of the members of the RRM1 gene family identified were analyzed using TBtools software for drawing genetic structure.
The conserved motif location of the identified RRM1 gene family was predicted using online MEME (https://meme-suite.org/meme/doc/meme). The parameter was set to 10 motifs and the other parameters were default. The prediction results were plotted using TBtools software.

2.4. Interspecies collinearity analysis of OsRRM1 gene family

The collinearity analysis and prediction of RRM1 gene in rice and Arabidopsis Thaliana were carried out, and the collinearity map was drawn by TBtools software.

2.5. GO and KEGG analysis of OsRRM1 gene family

GO and KEGG analysis of the OsRRM1 gene family was performed using PlantRegMap(http://plantregmap.gao-lab.org/) and Kobas(http://kobas.cbi.pku.edu.cn/kobas3/), respectively. All analysis results were calculated with q<0.05. Prism8.0 was used to plot the path name as the ordinate and -log10 (q-value) as the abscissa.

2.6. Analysis of presumptive cis-regulatory elements in the promoter region of OsRRM1 gene

Use TBtools software to predict cis acting elements in the 2000bp upstream gene promoter region of OsRRM1 in the PlantCARE Database (https://bioinformatics.psb.ugent.be/webtools/plantcare/html).

2.7. Expression pattern analysis of RRM1 gene in rice treated with blast fungus

TBtools software was used to map the expression patterns of OsRRM1 gene family members identified under rice blast fungus treatment.

2.8. Plant materials and rice blast stress treatment

The experimental material is rice(O.Sativa L.spp.japonica,var nippobare). The mature seeds were placed in petri dishes, sterilized with 2%NaClO, soaked at 28 ° C for 48 hours, and then placed in perforated PCR plates. PCR plates were isolated by placing 24 seeds as three biological replicates. The treatment group and control group were repeated with two plates. All seedlings were placed in a growth chamber with a photoperiod of 14 h (day) /10 h (night) and a temperature cycle of 28/24 ℃.
For rice blast stress, rice seedlings were cultivated in artificial growth chamber until the three-leaf stage. Finally, suspensions of blast fungus with a concentration of 1*105 times were used as stress treatment. The rice blast strain was guy11. At 0, 12, 24, 36 and 48h after infecting Magnaporthe Oryza (guy11), the young rice leaves were immediately frozen in liquid nitrogen and stored at -80℃ for later use.

2.9. Analysis of OsRRM1 gene expression by qRT-PCR

RNA was extracted from treated plant leaves. Total RNA was extracted using the RNA Total RNA Extraction Kit (Takara). The first strand cDNA was synthesized using PrimeScript First strand cDNA Synthesis Kit (Takara) with a reaction volume of 20 μl, consisting of 1 μg total RNA, 4 μl 5xPrime Script RT premix and RNA-free enzyme ddH2O. The PCR procedure is as follows: 95℃ for 2 minutes, then 35 cycles, 95 ℃ for 5 seconds, 60℃ for 30 seconds.
Quantitative real-time PCR is performed on the ABI 7500 quantitative real-time fluorescent quantitative PCR system according to the manufacturer’s instructions. Primer Premier 5 was used to design specific primers targeting the OsRRM1 gene (Table 1). Actin is used as a reference gene. The qRT-PCR was performed in a final volume of 20 μl and consisted of 2 μl cDNA, 10 μl 2*SYBR green premix (Takara), and 1 μl forward and reverse primers. The amplification procedure is as follows: initial denaturation at 95 ℃ for 5 minutes; 35 cycles, denatured at 95 ℃ for 10 seconds, annealed at 60 ℃ for 20 seconds; And finally extended for 20 seconds at 72 ℃. Three biological replicates and three technical replicates were performed for each cDNA sample. Relative expression values are calculated by the 2 −ΔΔCT method.

3. Results

3.1. Screening and identification of RRM1 gene family members in rice

In this study, domains (Pfam: PF00076.24) predicted that 212 RRM1 genes (all with E values less than 1×10-5) were identified in the whole genome of rice (Oryza sativa Japonica), and their conserved domain was analyzed by Pfam (Figure 1). The results showed that all 212 OsRRM1 genes contained RRM1, but the location in the gene was different. These genes are named OsRRM1-1-OsRRM1-212 based on their physical location on the chromosome (Table 2). Use Expasy (https://web.expasy.org/protparam/) article analyzed 212 OsRRM1 gene molecular weight, length, isoelectric point, amino acids, et al. The results showed that the length of amino acids encoding the 212 rice RRM1 genes ranged from 53aa to 1160aa, the molecular weight ranged from 5837Da to 127816Da, and the theoretical isoelectric point distribution ranged from 3.97 to 12.37, which made the study of the OsRRM1 gene family more difficult. Subcellular localization prediction showed that OsRRM1 was mainly located in the nucleus, followed by the extracellular matrix, mitochondria, chloroplast, cell membrane, and intracytoplasmic matrix. This suggests that these proteins function were mainly in the nucleus. In addition, functional reports of several previously studied genes are listed.

3.2. Chromosome localization and phylogenetic tree analysis of OsRRM1 gene family

The positions of 212 OsRRM1 genes on chromosomes were mapped using TBtools software (Figure 2). There were 212 OsRRM1 genes distributed on all 12 chromosomes, among which 31 OsRRM1 genes were the most distributed on chromosome 3, and only 8 OsRRM1 genes were the least distributed on chromosome 10. Distinct gene clusters were formed on chromosomes 1, 2, and 3.
In order to study the phylogenetic relationship of OsRRM1 protein, a phylogenetic tree was constructed for 21 OsRRM1 protein sequences in rice (Figure 3). According to the topological structure of the evolutionary tree, 212 OsRRM1 proteins can be divided into 5 groups. The fifth group (Branch marks green) contained the highest amount of OsRRM1 protein and 61 proteins in total; The third group (Branch marks dark green) contained 58 RRM1 proteins, the second group (Branch marks red) and the fourth group (Branch marks blue) contained 33 RRM1 proteins and 53 RRM1 proteins respectively. The first group (Branch marks orange) had the lowest number of RRM1 proteins, seven in total.

3.3. Motif analysis and gene structure analysis of OsRRM1 gene family

The evolution of a family is mainly manifested by the diversity of gene structure and the change of conserved motifs. In order to better understand the structure of OsRRM1 gene, the exon intron structure of OsRRM1 gene was analyzed using annotated information from the rice reference genome (Figure 4). The results showed that 212 OsRRM1 genes had large differences in sequence length and exons and introns, but the same as the clustering results of evolutionary tree, genes in the same group usually had similar structure, but their intron lengths were different. It was also found that exon-intron patterns in the same phylogenetic taxa showed great similarity. This may be the result of replication of these sequences, which may also prove that the classification results are reliable.
Then, the online prediction tool MEME was used to identify the conserved motifs of OsRRM1 protein. Multiple motifs exist in 212 OsRRM1 protein sequences (Figure 4), and the types and numbers of motifs are highly overlapping. In addition, gene families within the same subfamily in the evolutionary tree are composed similarly on the motif.

3.4. Evolutionary analysis of OsRRM1 gene family and collinearity analysis of RRM1 gene family between rice and Arabidopsis Thaliana

Phylogenetic tree was constructed by comparing 212 OsRRM1 and 230 AtRRM1 sequences, with a total of 442 members (Figure A1). According to the topological structure of the evolutionary tree, RRM1 proteins of the two species can be divided into five groups. Most of the RRM1 protein members of rice and Arabidopsis do not cluster into their own clades. Each subfamily contains members of the RRM1 family of Arabidopsis and rice, and the members of each subfamily may have similar functions and domains. According to the phylogenetic relationship of protein sequences, the function of OsRRM1 protein can be predicted by the function of plant RRM1 protein with known function.
In order to further explore the evolutionary relationship of OsRRM1 gene family, collinearity analysis was conducted between rice and Arabidopsis Thaliana. The results showed (Figure 5) that 20 pairs of RRM1 genes in the two species were collinear, and no collinearity was found on chromosomes 8, 9, 10, 11 and 12 of rice and chromosome 4 of Arabidopsis thaliana.

3.5. GO and KEGG analysis of OsRRM1 gene family

GO annotation results showed (Figure 6) that the OsRRM1 gene family plays an important role in biological processes such as innate immune response, immune response, stimulus response, defense response of biological processes, regulatory transcription negative regulation, DNA template negative regulation of gene expression, epigenetic immune system processes, and alternative splicing. These results further confirm the reported functions of RRM1 gene in these aspects. KEGG analysis showed (Figure 6) that OsRRM1 gene family plays an important role in alternative splicing, messenger RNA surveillance pathway, RNA transport, and RNA degradation.

3.6. Characterization of presumptive cis-regulatory elements in the promoter region of OsRRM1 gene

The cis-regulatory elements in the promoter region play an important role in plant response to stress. Using the PlantCARE database, we identified five stress response cy-regulatory elements in the upstream 2000bp of these OsRRM1 genes, including TGACG motif (involved in JA response), CGTCA motif (involved in MeJA response), ABRE motif (involved in abscisic acid stress), TCA element (involved in salicylic acid reactivity), TGACG motif (involved in JA response), and CGTCA motif (involved in salicylic acid reactivity). WUN motif (wound response element). In the OsRRM1 gene family, the element associated with the largest number of stress response elements was ABRE (Figure 7), and ABA was synthesized mainly in response to blast stress. These results indicate that the OsRRM1 gene and stress-related response elements are relatively intact, but the types and amounts of stress-related elements contained in the promoter of each OsRRM1 gene are different, suggesting that members of the OsRRM1 gene family respond differently to rice blast stress.

3.7. Expression pattern of RRM1 gene family in rice after treatment with blast fungus

Using RNA-seq data, heat maps of 212 OsRRM1 genes represented by log2foldchange values were constructed at different time periods after infecting Magnaporthe Oryza(Figure 8). All OsRRM1 genes were expressed, and three major clusters of expression patterns were distinguished according to the expression specificity at different time periods after treatment. The RRM1 gene in two clusters showed an obvious up-regulation trend.

3.8. Expression analysis of OsRRM1 gene in response to biological stress

In order to further explore the expression changes of OsRRM1 gene in response to biological stress, qRT-PCR was performed on 4 OsRRM1 genes through the analysis of GO and KEGG results combined with the expression heat map to measure the transcription level of OsRRM1 gene. There were differences in the expression levels of four OsRRM1 genes under rice blast stress, all of which were up-regulated after treatment (Figure 9), indicating that four OsRRM1 genes played a certain role in the development of rice blast.

4. Discussion

Rice is one of the most important food crops and a monocotyledonous plant. In this study, bioinformatics was used to analyze the whole genome of rice OsRRM1 gene family. The length of amino acids encoded by 212 OsRRM1 genes ranges from 53aa to 1160aa, while Antoine Cler’s study indicated that the length of RRM is 90 amino acids, which is because there are a large number of introns in the RRM1 gene in rice, and these introns are largely discarded during transcription and translation. Therefore, the RRM1 protein encoded by the RRM1 gene actually has only about 90 amino acids (Figure 4)[54]. It is now clear that RRM1 is an important domain that needs to be further understood and that further biochemical and structural studies are needed to obtain a complete model of its role in cells[16]. The RRM1 gene family is distributed in many species, 230 of which have been identified in Arabidopsis and 212 in rice. One study investigated the complete Arabidopsis genome containing proteins containing RRM and KH RNA binding domains, and the Arabidopsis genome encodes 196 RRM proteins[55]. The phylogenetic tree analysis of RRM1 protein in rice and Arabidopsis showed that there were multiple pairs of RRM1 homologous genes in rice and Arabidopsis, suggesting that these genes have similar amino acid sequences in rice and Arabidopsis and may have similar functions. Since rice is a monocotyledonous plant and Arabidopsis is a dicotyledonous plant, it can be inferred that the time of RRM1 gene evolution may be earlier than the time of species differentiation. Subcellular localization prediction showed that OsRRM1 gene was mainly located in the nucleus, followed by the extracellular matrix, mitochondria, chloroplast, cell membrane, and intracytoplasmic matrix, indicating that the above proteins mainly function in the nucleus. According to subcellular localization prediction tools, 23 Arabidopsis RRM proteins were reported to be located in chloroplasts and 10 in mitochondria[56]. This result may be due to the fact that the main site of DNA replication is in the nucleus, with a small amount of DNA replication in mitochondria and chloroplasts. In chromosome localization, 212 RRM1 genes were found to be distributed on 12 chromosomes. In addition, there were multiple gene clusters on some chromosomes, which may be attributed to tandem duplication, resulting in gene amplification, which is of great significance in evolution. Among 212 OsRRM1 gene sequences, CDS and introns had different numbers and large spans. However, analysis of 10 amino acid conserved motifs of 212 OsRRM1 family proteins showed that the conserved sequences of OsRRM1 were mostly similar, especially in homologous sequences (Figure 4).
RRM1 gene was enriched by analysis of GO and KEGG, and this family gene was mainly enriched in biological processes related to stress resistance, such as rice blast immune pathway. As previous studies have shown, the RRM protein in plant organelles is involved in various RNA processes, regulating plant development (such as flowering) and plant stress response[57]. Moreover, this gene family is highly enriched in alternative splicing and mRNA assembly processes[58]. Studies have shown that both PSRP2 and ORRM5 have RNA-binding activity, and it is speculated that RRM proteins increase their RNA-binding energy as RNA chaperone under stress conditions[59,60,61]. They are also involved in plant development and stress responses, sometimes acting as proteins or RNA-binding proteins[62,63]. In addition, several RRM proteins have been reported to be involved in plant development and stress response[59,64,65,66]. It can be inferred that this gene family may be involved in immunity of rice by regulating downstream gene alternative splicing. The cis-regulatory elements in the promoter region play an important role in plant response to stress. We identified five stress response cis-regulatory elements (Figure 7) in the upstream 2000bp of these OsRRM1 genes, including TGACG motif (involved in JA response), CGTCA motif (involved in MeJA response), ABRE motif (involved in ababolic acid stress), TCA element (involved in salicylic acid reactivity), TGACG motif (involved in JA response), and TCA motif (involved in salicylic acid reactivity), WUN motif (wound response element). These results indicate that the stress-related response elements of OsRRM1 gene are relatively complete, suggesting that members of the OsRRM1 gene family regulate stress to a certain extent. In order to further explore the expression changes of OsRRM1 gene in response to biological stress, qRT-PCR was performed on four OsRRM1 gene candidates through the analysis of GO and KEGG results and combined with the expression heat map to measure the transcription level of OsRRM1 gene. There were differences in the expression levels of four OsRRM1 genes under rice blast stress, all of which were up-regulated after treatment (Figure 9), indicating that OsRRM1 played a certain role in the development of rice blast, which also verified the results of S. Wang and X. Shi[67].
This study offers an initial comprehension of the RRM1 gene family in rice, elucidating the potential roles of these genes in rice resistance, and establishing a basis for future investigations into the functions of individual members within this gene family. Subsequent steps will involve cloning, analysis of expression patterns, and functional verification of relevant genes in order to deepen our understanding and explore the significant contribution of RRM1 genes to the growth and development of rice.

Author Contributions

Conceptualization, Xinlei Jiang, Shaochun Liu and Junying Huang; methodology, Shangwei Yu; software, Shangwei Yu; validation, Xinlei Jiang and Yuhan Huang; formal analysis, Xinlei Jiang; investigation, Junru Fu; resources, Haihui Fu and Dewei Ynag; data curation, Haihui Fu; writing—original draft preparation, Xinlei Jiang; writing—review and editing, Haihui Fu; visualization, Xinlei Jiang; supervision, Haihui Fu; project administration, Haihui Fu; funding acquisition, Haihui Fu. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Double Thousand Plan of Jiangxi Province to Haihui Fu, grant number jxsq2019101057.

Conflicts of Interest

The authors declare no conflict of interest. The funder of this paper is Professor Fu, who supervised all the experiments in the paper and played a key role in review and editing.

Appendix A

Figure A1. Phylogenetic tree of RRM1 gene families in Arabidopsis and rice.
Figure A1. Phylogenetic tree of RRM1 gene families in Arabidopsis and rice.
Preprints 83161 g0a1

References

  1. Latchman, D.S. Transcriptional Gene Regulation in Eukaryotes. In Els, 2011.
  2. Jeune, E.L.; Ladurner, A.G. Book Review. Protein Science 2004, 13, 1950–1952. [Google Scholar] [CrossRef]
  3. Jackson, D.A.; Pombo, A.; Iborra, F. The Balance Sheet for Transcription: An Analysis of Nuclear Rna Metabolism in Mammalian Cells. Faseb j 2000, 14, 242–254. [Google Scholar] [CrossRef] [PubMed]
  4. Lorković, Z.J.; Barta, A. Genome Analysis: Rna Recognition Motif (Rrm) and K Homology (Kh) Domain Rna-Binding Proteins from the Flowering Plant Arabidopsis Thaliana. Nucleic Acids Res 2002, 30, 623–635. [Google Scholar] [CrossRef] [PubMed]
  5. Burd, C.G.; Dreyfuss, G. Conserved Structures and Diversity of Functions of Rna-Binding Proteins. Science 1994, 265, 615–621. [Google Scholar] [CrossRef] [PubMed]
  6. Dreyfuss, G.; Swanson, M.S.; Piñol-Roma, S. Heterogeneous Nuclear Ribonucleoprotein Particles and the Pathway of Mrna Formation. Trends in Biochemical Sciences 1988, 13, 86–91. [Google Scholar] [CrossRef]
  7. Adam, S.A.; Nakagawa, T.; Swanson, M.S.; Woodruff, T.K.; Dreyfuss, G. Mrna Polyadenylate-Binding Protein: Gene Isolation and Sequencing and Identification of a Ribonucleoprotein Consensus Sequence. Mol Cell Biol 1986, 6, 2932–2943. [Google Scholar] [PubMed]
  8. Bandziulis, R.J.; Swanson, M.S.; Dreyfuss, G. Rna-Binding Proteins as Developmental Regulators. Genes Dev 1989, 3, 431–437. [Google Scholar] [CrossRef]
  9. Dreyfuss, G.; Kim, V.N.; Kataoka, N. Messenger-Rna-Binding Proteins and the Messages They Carry. Nat Rev Mol Cell Biol 2002, 3, 195–205. [Google Scholar] [CrossRef]
  10. Gomes, J.-E.; Encalada, S.E.; Swan, K.A.; Shelton, C.A.; Carter, J.C.; Bowerman, B. The Maternal Gene Spn-4 Encodes a Predicted Rrm Protein Required for Mitotic Spindle Orientation and Cell Fate Patterning in Early C. Elegans Embryos. Development 2021, 21, 4301–4314. [Google Scholar]
  11. Zhan, X.; Qian, B.; Cao, F.; Wu, W.; Yang, L.; Guan, Q.; Gu, X.; Wang, P.; Okusolubo, T.A.; Dunn, S.L.; Zhu, J.K.; Zhu, J. An Arabidopsis Pwi and Rrm Motif-Containing Protein Is Critical for Pre-Mrna Splicing and Aba Responses. Nat Commun 2015, 6, 8139. [Google Scholar] [CrossRef]
  12. Paukku, K.; Backlund, M.; De Boer, R.A.; Kalkkinen, N.; Kontula, K.K.; Lehtonen, J.Y. Regulation of At1r Expression through Hur by Insulin. Nucleic Acids Res 2012, 40, 5250–5261. [Google Scholar] [CrossRef] [PubMed]
  13. O’Bryan, M.K.; Clark, B.J.; McLaughlin, E.A.; D’Sylva, R.J.; O’Donnell, L.; Wilce, J.A.; Sutherland, J.; O’Connor, A.E.; Whittle, B.; Goodnow, C.C.; Ormandy, C.J.; Jamsai, D. Rbm5 Is a Male Germ Cell Splicing Factor and Is Required for Spermatid Differentiation and Male Fertility. PLoS Genet 2013, 9, e1003628. [Google Scholar] [CrossRef] [PubMed]
  14. Maris, C.; Dominguez, C.; Allain, F.H. The Rna Recognition Motif, a Plastic Rna-Binding Platform to Regulate Post-Transcriptional Gene Expression. Febs j 2005, 272, 2118–2131. [Google Scholar] [CrossRef] [PubMed]
  15. Nagai, K.; Oubridge, C.; Jessen, T.H.; Li, J.; Evans, P.R. Crystal Structure of the Rna-Binding Domain of the U1 Small Nuclear Ribonucleoprotein A. Nature 1990, 348, 515–520. [Google Scholar] [CrossRef]
  16. Cléry, A.; Blatter, M.; Allain, F.H. Rna Recognition Motifs: Boring? Not Quite. Curr Opin Struct Biol 2008, 18, 290–298. [Google Scholar] [CrossRef]
  17. Birney, E.; Kumar, S.; Krainer, A.R. Analysis of the Rna-Recognition Motif and Rs and Rgg Domains: Conservation in Metazoan Pre-Mrna Splicing Factors. Nucleic Acids Research 1993, 21, 5803–5816. [Google Scholar] [CrossRef]
  18. Query, C.C.; Bentley, R.C.; Keene, J.D. A Common Rna Recognition Motif Identified within a Defined U1 Rna Binding Domain of the 70k U1 Snrnp Protein. Cell 1989, 57, 89–101. [Google Scholar] [CrossRef]
  19. Chambers, J.C.; Kenan, D.; Martin, B.J.; Keene, J.D. Genomic Structure and Amino Acid Sequence Domains of the Human La Autoantigen. J Biol Chem 1988, 263, 18043–18051. [Google Scholar] [CrossRef]
  20. 20. Sachs, Davis and Kornberg. A Single Domain of Yeast Poly(a)-Binding Protein Is Necessary and Sufficient for Rna Binding and Cell Viability. Mol.cell.biol.
  21. Kielkopf, C.L.; Lücke, S.; Green, M.R. U2af Homology Motifs: Protein Recognition in the Rrm World. Genes Dev 2004, 18, 1513–1526. [Google Scholar] [CrossRef]
  22. Zhai, K.; Deng, Y.; Liang, D.; Tang, J.; Liu, J.; Yan, B.; Yin, X.; Lin, H.; Chen, F.; Yang, D. Rrm Transcription Factors Interact with Nlrs and Regulate Broad-Spectrum Blast Resistance in Rice. Mol Cell 2019. [CrossRef]
  23. Jeon, J.; Lee, G.W.; Kim, K.T.; Park, S.Y.; Kim, S.; Kwon, S.; Huh, A.; Chung, H.; Lee, D.Y.; Kim, C.Y.; Lee, Y.H. Transcriptome Profiling of the Rice Blast Fungus Magnaporthe Oryzae and Its Host Oryza Sativa During Infection. Mol Plant Microbe Interact 2020, 33, 141–144. [Google Scholar] [CrossRef] [PubMed]
  24. Manandhar, H.K.; Jørgensen, H.J.L.; Mathur, S.B.; Smedegaard-Petersen, V. Suppression of Rice Blast by Preinoculation with Avirulent Pyricularia Oryzae and the Nonrice Pathogen Bipolaris Sorokiniana. Phytopathology 1998, 7, 735–739. [Google Scholar] [CrossRef] [PubMed]
  25. Nasir, F.; Tian, L.; Chang, C.; Li, X.; Gao, Y.; Tran, L.P.; Tian, C. Current Understanding of Pattern-Triggered Immunity and Hormone-Mediated Defense in Rice (Oryza Sativa) in Response to Magnaporthe Oryzae Infection. Semin Cell Dev Biol 2018, 83, 95–105. [Google Scholar] [CrossRef] [PubMed]
  26. Moriyama, H.; Urayama, S.I.; Higashiura, T.; Le, T.M.; Komatsu, K. Chrysoviruses in Magnaporthe Oryzae. Viruses 2018, 10. [Google Scholar] [CrossRef] [PubMed]
  27. Lee, D.H.; Kim, D.S.; Hwang, B.K. The Pepper Rna-Binding Protein Carbp1 Functions in Hypersensitive Cell Death and Defense Signaling in the Cytoplasm. Plant J 2012, 72, 235–248. [Google Scholar] [CrossRef]
  28. Nina and F. J. C. O. i., P. Biology. Rna-Binding Proteins in Plants: The Tip of an Iceberg? 2002.
  29. Lorković, Z.J. Role of Plant Rna-Binding Proteins in Development, Stress Response and Genome Organization. 2009, 14, 229–236.
  30. Woloshen, V.; Huang, S.; Li, X. Review Article Rna-Binding Proteins in Plant Immunity. 2011.
  31. Zhai, K.; Deng, Y.; Liang, D.; Tang, J.; Liu, J.; Yan, B.; Yin, X.; Lin, H.; Chen, F.; Yang, D.; Xie, Z.; Liu, J.-Y.; Li, Q.; Zhang, L.; He, Z. Rrm Transcription Factors Interact with Nlrs and Regulate Broad-Spectrum Blast Resistance in Rice. Mol Cell 2019, 74, 996–1009. [Google Scholar] [CrossRef]
  32. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Xia, R. Tbtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Molecular Plant 2020, 13. [Google Scholar] [CrossRef]
  33. Hu, Y.; Zhu, N.; Wang, X.; Yi, Q.; Zhu, D.; Lai, Y.; Zhao, Y. Analysis of Rice Snf2 Family Proteins and Their Potential Roles in Epigenetic Regulation. Plant Physiol Biochem 2013, 70, 33–42. [Google Scholar] [CrossRef]
  34. Mimura, M.; Itoh, J. Genetic Interaction between Rice Plastochron Genes and the Gibberellin Pathway in Leaf Development. Rice (N Y) 2014, 7, 25. [Google Scholar] [CrossRef]
  35. Kawakatsu, T.; Itoh, J.-I.; Miyoshi, K.; Kurata, N.; Alvarez, N.; Veit, B.; Nagato, Y. Plastochron2 Regulates Leaf Initiation and Maturation in Rice. The Plant Cell 2006, 18, 612–625. [Google Scholar] [CrossRef]
  36. Xiong, G.S.; Hu, X.M.; Jiao, Y.Q.; Yu, Y.C.; Chu, C.C.; Li, J.Y.; Qian, Q.; Wang, Y.H. Leafy Head2, Which Encodes a Putative Rna-Binding Protein, Regulates Shoot Development of Rice. Cell Res 2006, 16, 267–276. [Google Scholar] [CrossRef] [PubMed]
  37. Lyu, J.; Wang, D.; Duan, P.; Liu, Y.; Huang, K.; Zeng, D.; Zhang, L.; Dong, G.; Li, Y.; Xu, R.; Zhang, B.; Huang, X.; Li, N.; Wang, Y.; Qian, Q.; Li, Y. . Control of Grain Size and Weight by the Gsk2-Large1/Oml4 Pathway in Rice. Plant Cell 2020, 32, 1905–1918. [Google Scholar] [CrossRef]
  38. Isshiki, M.; Matsuda, Y.; Takasaki, A.; Wong, H.L.; Satoh, H.; Shimamoto, K.J.P.B. Du3, a Mrna Cap-Binding Protein Gene, Regulates Amylose Content in Japonica Rice Seeds. Plant Biotechnology 2008. [CrossRef]
  39. Yano, M.; Okuno, K.; Satoh, H.; Omura, T. Chromosomal Location of Genes Conditioning Low Amylose Content of Endosperm Starches in Rice, Oryza Sativa L. Theor Appl Genet 1988, 76, 183–189. [Google Scholar] [CrossRef] [PubMed]
  40. Zhai, K.; Deng, Y.; Liang, D.; Tang, J.; Liu, J.; Yan, B.; Yin, X.; Lin, H.; Chen, F.; Yang, D.; Xie, Z.; Liu, J.Y.; Li, Q.; Zhang, L.; He, Z. Rrm Transcription Factors Interact with Nlrs and Regulate Broad-Spectrum Blast Resistance in Rice. Mol Cell 2019, 74, 996–1009. [Google Scholar] [CrossRef] [PubMed]
  41. Liu, T.; Zhang, X.; Zhang, H.; Cheng, Z.; Liu, J.; Zhou, C.; Luo, S.; Luo, W.; Li, S.; Xing, X.; Chang, Y.; Shi, C.; Ren, Y.; Zhu, S.; Lei, C.; Guo, X.; Wang, J.; Zhao, Z.; Wang, H.; Zhai, H.; Lin, Q.; Wan, J. Dwarf and High Tillering1 Represses Rice Tillering through Mediating the Splicing of D14 Pre-Mrna. Plant Cell 2022, 34, 3301–3318. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, X.; Lan, J.; Huang, Y.; Cao, P.; Zhou, C.; Ren, Y.; He, N.; Liu, S.; Tian, Y.; Nguyen, T.; Jiang, L.; Wan, J. Wsl5, a Pentatricopeptide Repeat Protein, Is Essential for Chloroplast Biogenesis in Rice under Cold Stress. J Exp Bot 2018, 69, 3949–3961. [Google Scholar] [CrossRef] [PubMed]
  43. Lu, Q.; Ding, S.; Reiland, S.; Rödiger, A.; Roschitzki, B.; Xue, P.; Gruissem, W.; Lu, C.; Baginsky, S. Identification and Characterization of Chloroplast Casein Kinase Ii from Oryza Sativa (Rice). J Exp Bot 2015, 66, 175–187. [Google Scholar] [CrossRef]
  44. Conservation and Divergence of Fca Function between Arabidopsis and Rice. Plant Molecular Biology 2005, 58, 823–838. [CrossRef]
  45. Chen, S.Y.; Wang, Z.Y.; Cai, X.L. Osrrm, a Spen-Like Rice Gene Expressed Specifically in the Endosperm. Cell Res 2007, 17, 713–721. [Google Scholar] [CrossRef]
  46. Chen, S.-Y.; Wang, Z.-Y.; Cai, X.-L. Osrrm, a Spen-Like Rice Gene Expressed Specifically in the Endosperm. Cell Res 2007, 17, 713–721. [Google Scholar] [CrossRef] [PubMed]
  47. Kwak, K.J.; Jung, H.J.; Lee, K.H.; Kim, Y.S.; Kim, W.Y.; Ahn, S.J.; Kang, H. The Minor Spliceosomal Protein U11/U12-31k Is an Rna Chaperone Crucial for U12 Intron Splicing and the Development of Dicot and Monocot Plants. PLoS One 2012, 7, e43707. [Google Scholar] [CrossRef] [PubMed]
  48. Cai, Y.; Vega-Sánchez, M.E.; Park, C.H.; Bellizzi, M.; Guo, Z.; Wang, G.L. Rbs1, an Rna Binding Protein, Interacts with Spin1 and Is Involved in Flowering Time Control in Rice. PLoS One 2014, 9, e87258. [Google Scholar] [CrossRef] [PubMed]
  49. Sharma, S.; Kaur, C.; Singla-Pareek, S.L.; Sopory, S.K. Ossro1a Interacts with Rna Binding Domain-Containing Protein (Osrbd1) and Functions in Abiotic Stress Tolerance in Yeast. Front Plant Sci 2016, 7, 62. [Google Scholar] [CrossRef] [PubMed]
  50. Zhao, T.; Ren, L.; Zhao, Y.; You, H.; Zhou, Y.; Tang, D.; Du, G.; Shen, Y.; Li, Y.; Cheng, Z. Reproductive Cells and Peripheral Parietal Cells Collaboratively Participate in Meiotic Fate Acquisition in Rice Anthers. Plant J 2021, 108, 661–671. [Google Scholar] [CrossRef] [PubMed]
  51. Miyazaki, S.; Sato, Y.; Asano, T.; Nagamura, Y.; Nonomura, K. Rice Mel2, the Rna Recognition Motif (Rrm) Protein, Binds in Vitro to Meiosis-Expressed Genes Containing U-Rich Rna Consensus Sequences in the 3’-Utr. Plant Mol Biol 2015, 89, 293–307. [Google Scholar] [CrossRef]
  52. Nonomura, K.; Eiguchi, M.; Nakano, M.; Takashima, K.; Komeda, N.; Fukuchi, S.; Miyazaki, S.; Miyao, A.; Hirochika, H.; Kurata, N. A Novel Rna-Recognition-Motif Protein Is Required for Premeiotic G1/S-Phase Transition in Rice (Oryza Sativa L.). PLoS Genet 2011, 7, e1001265. [Google Scholar] [CrossRef]
  53. Sahi, C.; Agarwal, M.; Singh, A.; Grover, A. Molecular Characterization of a Novel Isoform of Rice (Oryza Sativa L.) Glycine Rich-Rna Binding Protein and Evidence for Its Involvement in High Temperature Stress Response. Plant Science 2007, 173, 144–155. [Google Scholar] [CrossRef]
  54. Cléry, A.; Blatter, M.; Allain, F.H.T. Rna Recognition Motifs: Boring? Not Quite. Curr Opin Struct Biol 2008, 18, 290–298. [Google Scholar] [CrossRef]
  55. Lorković, Z.J.; Barta, A. Genome Analysis: Rna Recognition Motif (Rrm) and K Homology (Kh) Domain Rna-Binding Proteins from the Flowering Plant Arabidopsis Thaliana. Nucleic Acids Research 2002, 30, 623–635. [Google Scholar] [CrossRef]
  56. Shi, X.; Hanson, M.R.; Bentolila, S. Functional Diversity of Arabidopsis Organelle-Localized Rna-Recognition Motif-Containing Proteins. Wiley Interdiscip Rev Rna 2017, e1420. [Google Scholar] [CrossRef]
  57. Shi, X.; Hanson, M.R.; Bentolila, S. Functional Diversity of Arabidopsis Organelle-Localized Rna-Recognition Motif-Containing Proteins. Wiley Interdiscip Rev Rna 2017, 8. [Google Scholar] [CrossRef] [PubMed]
  58. Zhan, X.; Qian, B.; Cao, F.; Wu, W.; Yang, L.; Guan, Q.; Gu, X.; Wang, P.; Okusolubo, T.A.; Dunn, S.L.; Zhu, J.-K.; Zhu, J. An Arabidopsis Pwi and Rrm Motif-Containing Protein Is Critical for Pre-Mrna Splicing and Aba Responses. Nat Commun 2015, 6, 8139. [Google Scholar] [CrossRef] [PubMed]
  59. Kim, J.Y.; Park, S.J.; Jang, B.; Jung, C.H.; Ahn, S.-J.; Goh, C.H.; Cho, K.; Han, O.; Kang, H. Functional Characterization of a Glycine-Rich Rna-Binding Protein 2 in Arabidopsis Thaliana under Abiotic Stress Conditions. The Plant journal 2007, 3, 439–451. [Google Scholar] [CrossRef]
  60. Xu, T.; Lee, K.; Gu, L.; Kim, J.-I.; Kang, H. Functional Characterization of a Plastid-Specific Ribosomal Protein Psrp2 in Arabidopsis Thaliana under Abiotic Stress Conditions. Plant Physiology and Biochemistry 2013, 73, 405–411. [Google Scholar] [CrossRef] [PubMed]
  61. Cold Shock Domain Proteins and Glycine-Rich Rna-Binding Proteins from Arabidopsis Thaliana Can Promote the Cold Adaptation Process in Escherichia Coli. Nucleic Acids Research 2007.
  62. Wang, S.; Bai, G.; Wang, S.; Yang, L.; Yang, F.; Wang, Y.; Zhu, J.K.; Hua, J. Chloroplast Rna-Binding Protein Rbd1 Promotes Chilling Tolerance through 23s Rrna Processing in Arabidopsis. PLoS Genet 2016, 12, e1006027. [Google Scholar] [CrossRef]
  63. Shi, X.; Germain, A.; Hanson, M.R.; Bentolila, S. Rna Recognition Motif-Containing Protein Orrm4 Broadly Affects Mitochondrial Rna Editing and Impacts Plant Development and Flowering. Plant Physiol 2016, 170, 294–309. [Google Scholar] [CrossRef]
  64. Vermel, M.; Guermann, B.; Delage, L.; Grienenberger, J.M.; Maréchal-Drouard, L.; Gualberto, J.M. A Family of Rrm-Type Rna-Binding Proteins Specific to Plant Mitochondria. Proc Natl Acad Sci U S A 2002, 99, 5866–5871. [Google Scholar] [CrossRef]
  65. Kwak, K.J.; Kim, Y.O.; Kang, H. Characterization of Transgenic Arabidopsis Plants Overexpressing Gr-Rbp4 under High Salinity, Dehydration, or Cold Stress. J Exp Bot 2005, 56, 3007–3016. [Google Scholar] [CrossRef]
  66. Lorković, Z.J. Role of Plant Rna-Binding Proteins in Development, Stress Response and Genome Organization. Trends Plant Sci 2009, 14, 229–236. [Google Scholar] [CrossRef] [PubMed]
  67. Shuai, *!!! REPLACE !!!*; Wan, *!!! REPLACE !!!*; Shu, *!!! REPLACE !!!*; Wan, *!!! REPLACE !!!*; Leiyun, *!!! REPLACE !!!*; Yang, *!!! REPLACE !!!*; Fen, *!!! REPLACE !!!*; Genetics, Y.J.P. Shuai; Wan; Shu; Wan; Leiyun; Yang; Fen; Genetics, Y.J.P. Chloroplast Rna-Binding Protein Rbd1 Promotes Chilling Tolerance through 23s Rrna Processing in Arabidopsis. 2016.
Figure 1. The conserved domain of OsRRM1 gene family.
Figure 1. The conserved domain of OsRRM1 gene family.
Preprints 83161 g001
Figure 2. Chromosome mapping of OsRRM1 gene family.
Figure 2. Chromosome mapping of OsRRM1 gene family.
Preprints 83161 g002
Figure 3. Phylogenetic tree of OsRRM1 gene family.
Figure 3. Phylogenetic tree of OsRRM1 gene family.
Preprints 83161 g003
Figure 4. Motif analysis and prediction of OsRRM1 gene family(left) and Schematic diagram of gene structure of OsRRM1 gene family(right).
Figure 4. Motif analysis and prediction of OsRRM1 gene family(left) and Schematic diagram of gene structure of OsRRM1 gene family(right).
Preprints 83161 g004
Figure 5. The synteny analysis RRM1 gene family in Arabidopsis thaliana and rice.
Figure 5. The synteny analysis RRM1 gene family in Arabidopsis thaliana and rice.
Preprints 83161 g005
Figure 6. Geng function enrichment analysis. (A) Analysis of GO of OsRRM1 gene family; (B) KEGG annotation of OsRRM1 gene family.
Figure 6. Geng function enrichment analysis. (A) Analysis of GO of OsRRM1 gene family; (B) KEGG annotation of OsRRM1 gene family.
Preprints 83161 g006
Figure 7. Predictive cis-regulatory elements in the promoter of OsRRM1 gene family.
Figure 7. Predictive cis-regulatory elements in the promoter of OsRRM1 gene family.
Preprints 83161 g007
Figure 8. Expression heat map of OsRRM1 gene family treated with Magnaporthe oryzae.
Figure 8. Expression heat map of OsRRM1 gene family treated with Magnaporthe oryzae.
Preprints 83161 g008
Figure 9. Expression levels of OsRRM1 gene at different time periods under rice blast stress.
Figure 9. Expression levels of OsRRM1 gene at different time periods under rice blast stress.
Preprints 83161 g009
Table 1. Specific primers for OsRRM1 gene.
Table 1. Specific primers for OsRRM1 gene.
Gene F-primer R-primer
RRM1-15 GGATGTGACTGAAGCTCGGGTGATC GGATGTGACTGAAGCTCGGGTGATC
RRM1-61 GGAGGTCTTGGAAGCCAAGGTCATC CCATCCATGTCAGCGCCATCAAG
RRM1-76 CACTGAAGCAAAGGTGGTTTTTGAC GAGCTTTATCGACAGTGATCGCC
RRM1-207 CTTGGATGGAAAGGATCTCGATGG CATAGCCACCGCCTCCATAG
Actin CCAATCGTGAGAAGATGACCCA CCATCAGGAAGCTCGTAGCTCT
Table 2. Basic information of OsRRM1 gene identified in rice.
Table 2. Basic information of OsRRM1 gene identified in rice.
Gene RAP Number of Amino Acid Molecular Weight pI subcellular localization
RRM1-1 Os01g0101600 978 106323.33 9.56 nucleus
RRM1-2 Os01g0155600 324 36893.16 11.27 nucleus
RRM1-3 Os01g0209400 308 33656.38 8.94 nucleus
RRM1-4 Os01g0265800 490 49279.96 5.09 nucleus
RRM1-5 Os01g0316600 124 13965.3 9.91 chloroplast
RRM1-6 Os01g0367300 698 79763.67 10.57 nucleus
RRM1-7 Os01g0502800 53 5837.75 10.27 chloroplast
RRM1-8 Os01g0614500 447 44269.69 8.43 nucleus
RRM1-9 Os01g0619000 163 18016.54 5.76 extracellular space
RRM1-10[33] Os01g0636700 469 52108.23 8.63 nucleus
RRM1-11 Os01g0867800 439 49316.8 6.46 nucleus
RRM1-12 Os01g0876500 100 11385 7.72 chloroplast
RRM1-13 Os01g0876800 300 31951.79 8.91 extracellular space
RRM1-14[34,35,36] Os01g0907900 683 71779.19 6.37 nucleus
RRM1-15 Os01g0916600 150 15546.9 8.01 chloroplast thylakoid lumen
RRM1-16 Os01g0938200 460 48888.22 8.72 nucleus
RRM1-17 Os01g0945800 363 40073.63 6.61 nucleus
RRM1-18 Os01g0956600 608 68184.84 7.8 nucleus
RRM1-19 Os01g0958500 310 31802.78 8.34 nucleus
RRM1-20 Os01g0959000 432 48111.49 12.37 chloroplast thylakoid lumen
RRM1-21 Os01g0974701 116 12459.19 9.74 mitochondrion
RRM1-22 Os02g0122800 249 28953.55 10 nucleus
RRM1-23 Os02g0131700 448 49261.45 5.02 nucleus
RRM1-24 Os02g0167500 957 105767.07 7.88 extracellular space
RRM1-25 Os02g0179900 240 28105.95 8.85 nucleus
RRM1-26 Os02g0221500 397 40265.08 5.63 nucleus
RRM1-27 Os02g0244600 359 38737.53 5.62 nucleus
RRM1-28 Os02g0252100 265 30466.57 11.09 nucleus
RRM1-29 Os02g0319100 811 90295.23 6.27 nucleus
RRM1-30 Os02g0497700 480 50879.51 5.01 nucleus
RRM1-31[37] Os02g0517531 1001 110368.83 6.39 nucleus
RRM1-32 Os02g0536400 656 74812.42 9.43 nucleus
RRM1-33 Os02g0567900 259 28284.5 9.18 nucleus
RRM1-34 Os02g0602600 386 41584.82 7.67 nucleus
RRM1-35 Os02g0610400 467 51689.83 5.56 nucleus
RRM1-36 Os02g0610600 200 22797.31 11.33 nucleus
RRM1-37[38,39] Os02g0612300 243 28573.22 5.44 chloroplast
RRM1-38 Os02g0714000 287 30609.94 9.32 nucleus
RRM1-39 Os02g0719800 428 47331.12 5.57 nucleus
RRM1-40 Os02g0730800 399 43547.8 6.15 extracellular space
RRM1-41 Os02g0755400 176 18512.61 9.99 mitochondrion
RRM1-42 Os02g0757900 212 24083.82 5.07 nucleus
RRM1-43 Os02g0788300 295 32235.18 7.72 nucleus
RRM1-44 Os02g0788400 289 32009.09 8.66 nucleus
RRM1-45 Os02g0789400 185 21023.33 11.24 nucleus
RRM1-46 Os02g0815200 316 34612.01 5.17 chloroplast thylakoid lumen
RRM1-47 Os03g0123200 252 28108.69 7.64 nucleus
RRM1-48 Os03g0136800 296 32305.94 9.02 nucleus
RRM1-49 Os03g0174100 416 46056.33 5.35 nucleus
RRM1-50 Os03g0265600 125 13993.55 7.86 chloroplast
RRM1-51 Os03g0278300 238 24720.42 9.83 chloroplast
RRM1-52 Os03g0278500 647 72627.76 8.43 nucleus
RRM1-53 Os03g0278800 173 18433.86 9.3 chloroplast outer membrane
RRM1-54 Os03g0285900 330 37042.2 11 nucleus
RRM1-55 Os03g0286500 310 32704.09 9 extracellular space
RRM1-56 Os03g0298800 232 26100.86 9.44 chloroplast
RRM1-57 Os03g0326600 467 51073.78 9.06 nucleus
RRM1-58 Os03g0344100 264 29782.1 10.08 nucleus
RRM1-59 Os03g0363800 243 27781.69 10.83 nucleus
RRM1-60 Os03g0374575 217 25589.48 11.17 nucleus
RRM1-61 Os03g0376600 265 28556.57 4.5 chloroplast outer membrane
RRM1-62 Os03g0376900 464 49564.37 6.39 nucleus
RRM1-63 Os03g0388000 205 24739.51 10.27 nucleus
RRM1-64 Os03g0418800 523 56761.18 8.75 chloroplast
RRM1-65 Os03g0566500 429 46194.37 9.62 chloroplast
RRM1-66 Os03g0569900 402 43945.82 5.34 extracellular space
RRM1-67 Os03g0670700 196 20375.4 6.73 nucleus
RRM1-68 Os03g0681900 308 34036.6 9.05 nucleus
RRM1-69[40] Os03g0713600 284 30904.71 5.06 nucleus
RRM1-70 Os03g0748900 278 29986.94 9.23 nucleus
RRM1-71 Os03g0801800 959 105396.52 9.48 nucleus
RRM1-72 Os03g0809900 197 21969.34 5.2 nucleus
RRM1-73 Os03g0811700 130 14710.82 9.49 chloroplast
RRM1-74 Os03g0824300 523 58186.08 7.22 nucleus
RRM1-75 Os03g0826400 312 36258.57 9.25 nucleus
RRM1-76 Os03g0836200 205 21823.38 8.29 nucleus
RRM1-77 Os03g0854300 441 48288.94 10.11 nucleus
RRM1-78 Os04g0118900 245 28783.89 9.94 nucleus
RRM1-79 Os04g0306800 649 72026.14 9.09 nucleus
RRM1-80 Os04g0372800 486 51446 5.1 nucleus
RRM1-81 Os04g0394300 903 97243.83 8.7 nucleus
RRM1-82 Os04g0414300 137 15074.25 9.93 chloroplast
RRM1-83 Os04g0449900 387 41807.64 8.68 extracellular space
RRM1-84 Os04g0467300 484 51314.72 7.33 nucleus
RRM1-85 Os04g0496400 476 53576.63 4.69 nucleus
RRM1-86 Os04g0497600 435 48295.81 5.49 nucleus
RRM1-87 Os04g0504800 659 71231.24 8.95 extracellular space
RRM1-88 Os04g0510500 462 51785.72 5.01 nucleus
RRM1-89 Os04g0543200 774 86649.43 5.64 nucleus
RRM1-90 Os04g0591000 291 31672.86 6.05 mitochondrion
RRM1-91 Os04g0611500 536 60240.64 9.16 nucleus
RRM1-92 Os04g0620700 707 75253.44 4.85 nucleus
RRM1-93 Os04g0624800 376 40858.93 5.59 nucleus
RRM1-94 Os04g0625800 425 46195.8 5.99 extracellular space
RRM1-95[41] Os04g0636900 515 52204.84 5.79 nucleus
RRM1-96 Os04g0641400 144 16026.58 4.61 nucleus
RRM1-97 Os04g0682400 1008 110200.99 6.17 nucleus
RRM1-98[42] Os04g0684500 901 101135.53 6.65 chloroplast inner membrane
RRM1-99 Os05g0102800 955 104522 6.01 nucleus
RRM1-100 Os05g0105900 380 42434.11 12.18 nucleus
RRM1-101 Os05g0114500 290 32890.31 6.85 nucleus
RRM1-102 Os05g0120100 323 36222.41 10.83 nucleus
RRM1-103 Os05g0140500 204 22104.33 5.18 nucleus
RRM1-104 Os05g0154800 253 28203.66 9.2 cytoplasm
RRM1-105 Os05g0162600 338 39019.1 9.83 nucleus
RRM1-106 Os05g0223200 104 11486.44 8.03 nucleus
RRM1-107 Os05g0223300 102 11702.99 5.06 nucleus
RRM1-108 Os05g0303700 254 29800.11 8.77 nucleus
RRM1-109 Os05g0364600 319 36105.16 11.2 nucleus
RRM1-110 Os05g0373400 466 50213.29 8.1 nucleus
RRM1-111 Os05g0376000 209 23394.61 9.14 nucleus
RRM1-112 Os05g0437300 444 49754.23 6.41 nucleus
RRM1-113[40] Os06g0112400 261 27763.35 6.23 nucleus
RRM1-114 Os06g0127500 265 28209.55 7.14 nucleus
RRM1-115 Os06g0151200 300 32650.85 5 nucleus
RRM1-116 Os06g0170500 482 54009.89 8.12 nucleus
RRM1-117 Os06g0187900 185 21183.36 11.29 nucleus
RRM1-118 Os06g0219600 204 23178.94 5.19 nucleus
RRM1-119 Os06g0220600 343 36170.91 9.63 chloroplast outer membrane
RRM1-120 Os06g0248200 164 17952.57 5.98 nucleus
RRM1-121 Os06g0256200 294 31817.7 10.97 nucleus
RRM1-122 Os06g0566100 292 29810.49 9.33 nucleus
RRM1-123 Os06g0589700 399 43823.12 9.17 nucleus
RRM1-124 Os06g0622900 275 29594.2 8.39 nucleus
RRM1-125 Os06g0670400 469 53864.27 5.38 nucleus
RRM1-126 Os06g0670500 564 64975.32 5.63 nucleus
RRM1-127 Os06g0687500 219 23922.07 9.52 endomembrane system
RRM1-128 Os06g0698400 123 13222.7 5 nucleus
RRM1-129 Os06g0724600 164 18503.88 10.31 nucleus
RRM1-130 Os07g0102500 438 47703.93 9.53 nucleus
RRM1-131 Os07g0124600 377 41006.31 6.68 nucleus
RRM1-132 Os07g0158300 364 39084.91 4.61 mitochondrion
RRM1-133 Os07g0180800 411 46253.74 9.65 nucleus
RRM1-134 Os07g0237100 340 36144.67 10.27 chloroplast
RRM1-135 Os07g0281000 486 54334.99 6.72 nucleus
RRM1-136 Os07g0296200 394 43291.14 8.3 nucleus
RRM1-137 Os07g0516900 251 27613.79 6.3 extracellular space
RRM1-138 Os07g0549800 133 14421.25 9.41 chloroplast outer membrane
RRM1-139 Os07g0583500 474 54197.46 6.55 extracellular space
RRM1-140 Os07g0584500 472 50477.44 5.94 nucleus
RRM1-141 Os07g0602600 238 23564.23 8.54 mitochondrion
RRM1-142 Os07g0603100 569 62175.74 6.15 nucleus
RRM1-143 Os07g0615400 427 46723.56 7.19 nucleus
RRM1-144 Os07g0623300 275 32242.91 11.35 nucleus
RRM1-145[43] Os07g0631900 264 28099.31 4.75 chloroplast thylakoid lumen
RRM1-146 Os07g0633200 213 24820.57 10.68 nucleus
RRM1-147 Os07g0663300 427 46493.89 9.17 nucleus
RRM1-148 Os07g0673500 296 33141.48 10.64 nucleus
RRM1-149 Os08g0113200 838 95016.62 5.47 endomembrane system
RRM1-150 Os08g0116400 302 32739.26 6.4 nucleus
RRM1-151 Os08g0117100 319 35941.88 6.02 chloroplast outer membrane
RRM1-152 Os08g0139000 111 11938.8 9.55 chloroplast outer membrane
RRM1-153 Os08g0190200 442 47809.63 5.86 extracellular space
RRM1-154 Os08g0192900 572 60393.68 4.98 nucleus
RRM1-155 Os08g0314800 660 71558.46 7.55 nucleus
RRM1-156 Os08g0320100 350 36738.65 9.22 nucleus
RRM1-157 Os08g0385900 279 32947.48 11.88 nucleus
RRM1-158 Os08g0412200 214 25104.07 10.05 chloroplast
RRM1-159 Os08g0416400 503 54742.2 7.66 nucleus
RRM1-160 Os08g0427900 286 30491.17 11.05 nucleus
RRM1-161 Os08g0436000 461 49888.14 6.46 nucleus
RRM1-162 Os08g0483200 269 29132.14 9.39 mitochondrion
RRM1-163 Os08g0486200 289 33541.09 11.8 nucleus
RRM1-164 Os08g0490300 603 64733.85 6.09 nucleus
RRM1-165 Os08g0492100 362 38125.83 9.22 nucleus
RRM1-166 Os08g0504600 684 75299.38 6.19 nucleus
RRM1-167 Os08g0520300 447 48765.28 6.86 nucleus
RRM1-168 Os08g0547000 294 31708.05 7.08 nucleus
RRM1-169 Os08g0557100 194 21388.83 4.95 chloroplast
RRM1-170 Os08g0567200 235 26254.56 9.77 nucleus
RRM1-171 Os09g0115400 662 71630.27 6.45 mitochondrion
RRM1-172[44] Os09g0123200 738 79658.29 9.09 nucleus
RRM1-173 Os09g0279500 245 26681.14 8.53 chloroplast thylakoid lumen
RRM1-174[45] Os09g0298700 1005 110844.59 6.79 nucleus
RRM1-175 Os09g0299500 160 17315.17 5.76 extracellular space
RRM1-176 Os09g0314500 353 38868.39 5.96 nucleus
RRM1-177 Os09g0462700 441 46949.78 8.52 chloroplast
RRM1-178 Os09g0476100 604 64263.07 6.3 nucleus
RRM1-179 Os09g0491756 290 34087.52 8.92 nucleus
RRM1-180 Os09g0513700 375 43193.42 9.74 nucleus
RRM1-181[46] Os09g0516300 900 97198.57 6.85 nucleus
RRM1-182 Os09g0527100 149 16616.66 8.8 nucleus
RRM1-183 Os09g0527500 235 25960.25 8.81 nucleus
RRM1-184[47] Os09g0549500 276 29500.33 9.18 nucleus
RRM1-185 Os09g0565200 322 35425.05 4.41 mitochondrion
RRM1-186 Os10g0115600 463 55113.96 9.1 nucleus
RRM1-187 Os10g0151800 438 47821.62 4.98 nucleus
RRM1-188 Os10g0167500 374 40267.56 3.97 nucleus
RRM1-189 Os10g0321700 317 32244.11 4.59 chloroplast thylakoid lumen
RRM1-190 Os10g0439600 330 34829.59 4.96 nucleus
RRM1-191 Os10g0457000 355 38849.39 8.55 nucleus
RRM1-192 Os10g0470900 464 45620.47 6.24 nucleus
RRM1-193 Os10g0569200 719 83181.8 4.98 nucleus
RRM1-194 Os11g0100200 219 24033.05 9.87 nucleus
RRM1-195 Os11g0133600 298 32998.39 7.65 nucleus
RRM1-196 Os11g0139500 189 21471.25 4.13 extracellular space
RRM1-197 Os11g0176100 495 52955.01 6.43 extracellular space
RRM1-198[48] Os11g0250000 441 48446.94 5.68 nucleus
RRM1-199 Os11g0549537 242 26479.77 6.08 chloroplast
RRM1-200 Os11g0620100 441 47561.26 6.86 nucleus
RRM1-201 Os11g0636900 550 61141.76 7.78 nucleus
RRM1-202 Os11g0637700 467 49048.64 8.44 nucleus
RRM1-203 Os11g0704700 511 57960.23 10.14 chloroplast
RRM1-204[49] Os12g0100100 228 24809.9 9.87 nucleus
RRM1-205 Os12g0131000 300 33277.87 8.81 chloroplast
RRM1-206 Os12g0136200 502 55072.87 5.03 nucleus
RRM1-207 Os12g0502200 258 25044.52 4.74 mitochondrion
RRM1-208 Os12g0572400 263 30186.19 10.9 nucleus
RRM1-209[50,51,52] Os12g0572800 1160 127816.97 8.61 plasma membrane
RRM1-210 Os12g0577100 414 47380.57 9.1 nucleus
RRM1-211 Os12g0587100 947 106893.09 9.14 nucleus
RRM1-212[53] Os12g0632000 162 16083.1 6.31 nucleus
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated